Sample records for insensitive binding site

  1. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  2. Characterization and crystal structure of lysine insensitive Corynebacterium glutamicum dihydrodipicolinate synthase (cDHDPS) protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rice, E.A.; Bannon, G.A.; Glenn, K.C.

    2008-11-21

    The lysine insensitive Corynebacterium glutamicum dihydrodipicolinate synthase enzyme (cDHDPS) was recently successfully introduced into maize plants to enhance the level of lysine in the grain. To better understand lysine insensitivity of the cDHDPS, we expressed, purified, kinetically characterized the protein, and solved its X-ray crystal structure. The cDHDPS enzyme has a fold and overall structure that is highly similar to other DHDPS proteins. A noteworthy feature of the active site is the evidence that the catalytic lysine residue forms a Schiff base adduct with pyruvate. Analyses of the cDHDPS structure in the vicinity of the putative binding site for S-lysinemore » revealed that the allosteric binding site in the Escherichia coli DHDPS protein does not exist in cDHDPS due to three non-conservative amino acids substitutions, and this is likely why cDHDPS is not feedback inhibited by lysine.« less

  3. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  4. Identification of metal ion binding sites based on amino acid sequences

    PubMed Central

    Cao, Xiaoyong; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html. PMID:28854211

  5. Identification of metal ion binding sites based on amino acid sequences.

    PubMed

    Cao, Xiaoyong; Hu, Xiuzhen; Zhang, Xiaojin; Gao, Sujuan; Ding, Changjiang; Feng, Yonge; Bao, Weihua

    2017-01-01

    The identification of metal ion binding sites is important for protein function annotation and the design of new drug molecules. This study presents an effective method of analyzing and identifying the binding residues of metal ions based solely on sequence information. Ten metal ions were extracted from the BioLip database: Zn2+, Cu2+, Fe2+, Fe3+, Ca2+, Mg2+, Mn2+, Na+, K+ and Co2+. The analysis showed that Zn2+, Cu2+, Fe2+, Fe3+, and Co2+ were sensitive to the conservation of amino acids at binding sites, and promising results can be achieved using the Position Weight Scoring Matrix algorithm, with an accuracy of over 79.9% and a Matthews correlation coefficient of over 0.6. The binding sites of other metals can also be accurately identified using the Support Vector Machine algorithm with multifeature parameters as input. In addition, we found that Ca2+ was insensitive to hydrophobicity and hydrophilicity information and Mn2+ was insensitive to polarization charge information. An online server was constructed based on the framework of the proposed method and is freely available at http://60.31.198.140:8081/metal/HomePage/HomePage.html.

  6. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  7. pH-insensitive electrostatic interaction of carmoisine with two serum proteins: a possible caution on its uses in food and pharmaceutical industry.

    PubMed

    Datta, Shubhashis; Mahapatra, Niharendu; Halder, Mintu

    2013-07-05

    Here we have investigated the binding of carmoisine, a water-soluble azo food colorant, with serum proteins (HSA and BSA) by fluorescence and UV-VIS spectroscopy, circular dichroism and molecular docking studies. Results indicate that fluorescence quenching of protein has been due to site-specific binding of the dye with biomacromolecules. Site marker competitive binding and molecular docking explorations show that interaction occurs in the sub-domain ІІA of HSA and the sub-domains ІІA and ІB in the case of BSA. Conformational investigation indicates that dye binding modifies the secondary structure of proteins and this also alters the microenvironment of the tryptophan(s). The interaction is found to be pH-insensitive which can have relevance to the toxicological profiles of the dye, and ionic strength dependence of binding can be exploited in protein purification mediated by such food colorants. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  9. [125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

    PubMed Central

    Dumont, Yvan; Quirion, Rémi

    2000-01-01

    GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

  10. [Molecular organization of glutamate-sensitive chemoexcitatory membranes of nerve cells. Binding of L-[3H]glutamate to synaptic membranes of the rat cerebral cortex].

    PubMed

    Dambinova, S A; Gorodinskiĭ, A I

    1984-01-01

    The binding of L-[3H]glutamate to rat cerebral cortex synaptic membranes was investigated. Two types of binding sites, a Na+-independent (Kd = 140-160 nm; Bmax = 3.8-4.5 pmol-mg of protein) and a Na+-dependent (Kd = 2.0 microM; Bmax = 45-50 pmol/mg of protein) ones, were detected. The dependence of Na+-insensitive binding on time and temperature and membrane content in a sample was determined. Mono- and divalent cations (5-10 mM) potentiated specific binding by 2.1-3.3 times. The Na+-dependent binding is associated with active transport systems, while the Na+-independent one-with true receptor binding. The relationship between CNS glutamate receptors and Na+-independent binding sites is discussed.

  11. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

  12. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  13. Fungal toxins bind to the URF13 protein in maize mitochondria and Escherichia coli.

    PubMed Central

    Braun, C J; Siedow, J N; Levings, C S

    1990-01-01

    Expression of the maize mitochondrial T-urf13 gene results in a sensitivity to a family of fungal pathotoxins and to methomyl, a structurally unrelated systemic insecticide. Similar effects of pathotoxins and methomyl are observed when T-urf13 is cloned and expressed in Escherichia coli. An interaction between these compounds and the membrane-bound URF13 protein permeabilizes the inner mitochondrial and bacterial plasma membranes. To understand the toxin-URF13 effects, we have investigated whether toxin specifically binds to the URF13 protein. Our studies indicate that toxin binds to the URF13 protein in maize mitochondria and in E. coli expressing URF13. Binding analysis in E. coli reveals cooperative toxin binding. A low level of specific toxin binding is also demonstrated in cms-T and cms-T-restored mitochondria; however, binding does not appear to be cooperative in maize mitochondria. Competition and displacement studies in E. coli demonstrate that toxin binding is reversible and that the toxins and methomyl compete for the same, or for overlapping, binding sites. Two toxin-insensitive URF13 mutants display a diminished capability to bind toxin in E. coli, which identifies residues of URF13 important in toxin binding. A third toxin-insensitive URF13 mutant shows considerable toxin binding in E. coli, demonstrating that toxin binding can occur without causing membrane permeabilization. Our results indicate that toxin-mediated membrane permeabilization only occurs when toxin or methomyl is bound to URF13. PMID:2136632

  14. Regulation of Hippocampal Glutamate Receptors: Evidence for the Involvement of a Calcium-Activated Protease

    NASA Astrophysics Data System (ADS)

    Baudry, Michel; Lynch, Gary

    1980-04-01

    Specific [3H]glutamate binding to rat hippocampal membranes and the calcium-induced increase in this binding are markedly temperature-sensitive and are inhibited by alkylating or reducing agents as well as by various protease inhibitors. N-Ethylmaleimide, chloromethyl ketone derivatives of lysine and phenylalanine, and tosylarginine methyl ester decrease the maximum number of [3H]glutamate binding sites without changing their affinity for glutamate. Preincubation of the membranes with glutamate does not protect the glutamate ``receptors'' from the suppressive effects of these agents. The proteases trypsin and α -chymotrypsin increase the maximum number of [3H]glutamate binding sites. The effects of calcium on glutamate binding are different across brain regions. Cerebellar membranes are almost insensitive whereas hippocampal and striatal membranes exhibit a strong increase in the number of binding sites after exposure to even low concentrations of calcium. These results suggest that an endogenous membrane-associated thiol protease regulates the number of [3H]glutamate binding sites in hippocampal membranes and that this is the mechanism by which calcium stimulates glutamate binding. The possibility is discussed that the postulated mechanisms participate in synaptic physiology and in particular may be related to the long-term potentiation of transmission found in hippocampus under certain conditions.

  15. Cyanide-insensitive quinol oxidase (CIO) from Gluconobacter oxydans is a unique terminal oxidase subfamily of cytochrome bd.

    PubMed

    Miura, Hiroshi; Mogi, Tatsushi; Ano, Yoshitaka; Migita, Catharina T; Matsutani, Minenosuke; Yakushi, Toshiharu; Kita, Kiyoshi; Matsushita, Kazunobu

    2013-06-01

    Cyanide-insensitive terminal quinol oxidase (CIO) is a subfamily of cytochrome bd present in bacterial respiratory chain. We purified CIO from the Gluconobacter oxydans membranes and characterized its properties. The air-oxidized CIO showed some or weak peaks of reduced haemes b and of oxygenated and ferric haeme d, differing from cytochrome bd. CO- and NO-binding difference spectra suggested that haeme d serves as the ligand-binding site of CIO. Notably, the purified CIO showed an extraordinary high ubiquinol-1 oxidase activity with the pH optimum of pH 5-6. The apparent Vmax value of CIO was 17-fold higher than that of G. oxydans cytochrome bo3. In addition, compared with Escherichia coli cytochrome bd, the quinol oxidase activity of CIO was much more resistant to cyanide, but sensitive to azide. The Km value for O2 of CIO was 7- to 10-fold larger than that of G. oxydans cytochrome bo3 or E. coli cytochrome bd. Our results suggest that CIO has unique features attributable to the structure and properties of the O2-binding site, and thus forms a new sub-group distinct from cytochrome bd. Furthermore, CIO of acetic acid bacteria may play some specific role for rapid oxidation of substrates under acidic growth conditions.

  16. Predicting Ligand Binding Sites on Protein Surfaces by 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Jian, Jhih-Wei; Elumalai, Pavadai; Pitti, Thejkiran; Wu, Chih Yuan; Tsai, Keng-Chang; Chang, Jeng-Yih; Peng, Hung-Pin; Yang, An-Suei

    2016-01-01

    Predicting ligand binding sites (LBSs) on protein structures, which are obtained either from experimental or computational methods, is a useful first step in functional annotation or structure-based drug design for the protein structures. In this work, the structure-based machine learning algorithm ISMBLab-LIG was developed to predict LBSs on protein surfaces with input attributes derived from the three-dimensional probability density maps of interacting atoms, which were reconstructed on the query protein surfaces and were relatively insensitive to local conformational variations of the tentative ligand binding sites. The prediction accuracy of the ISMBLab-LIG predictors is comparable to that of the best LBS predictors benchmarked on several well-established testing datasets. More importantly, the ISMBLab-LIG algorithm has substantial tolerance to the prediction uncertainties of computationally derived protein structure models. As such, the method is particularly useful for predicting LBSs not only on experimental protein structures without known LBS templates in the database but also on computationally predicted model protein structures with structural uncertainties in the tentative ligand binding sites. PMID:27513851

  17. Gibberellin Receptor GID1: Gibberellin Recognition and Molecular Evolution

    NASA Astrophysics Data System (ADS)

    Kato, Hiroaki; Sato, Tomomi; Ueguchi-Tanaka, Miyako

    Gibberellins (GAs) are phytohormones essential for many developmental processes in plants. We analyzed the crystal structure of a nuclear GA receptor, GIBBERELLIN INSENSITIVE DWARF 1 (GID1) from Oryza sativa. As it was proposed from the sequence similarity, the overall structure of GID1 shows an α/β-hydrolase fold similar to that of the hormone-sensitive lipases (HSLs) except for an amino-terminal lid. The GA-binding site corresponds to the substrate-binding site of HSLs. Almost residues assigned for GA binding showed very little or no activity when they were replaced with Ala. The substitution of the residues corresponding to those of the lycophyte GID1s caused an increase in the binding affinity for GA34, a 2β-hydroxylated GA4. These findings indicate that GID1 originated from HSL and was tinkered to have the specificity for bioactive GAs in the course of plant evolution.

  18. Studies on the regulation of the human E1 subunit of the 2-oxoglutarate dehydrogenase complex, including the identification of a novel calcium-binding site.

    PubMed

    Armstrong, Craig T; Anderson, J L Ross; Denton, Richard M

    2014-04-15

    The regulation of the 2-oxoglutarate dehydrogenase complex is central to intramitochondrial energy metabolism. In the present study, the active full-length E1 subunit of the human complex has been expressed and shown to be regulated by Ca2+, adenine nucleotides and NADH, with NADH exerting a major influence on the K0.5 value for Ca2+. We investigated two potential Ca2+-binding sites on E1, which we term site 1 (D114ADLD) and site 2 (E139SDLD). Comparison of sequences from vertebrates with those from Ca2+-insensitive non-vertebrate complexes suggest that site 1 may be the more important. Consistent with this view, a mutated form of E1, D114A, shows a 6-fold decrease in sensitivity for Ca2+, whereas variant ∆site1 (in which the sequence of site 1 is replaced by A114AALA) exhibits an almost complete loss of Ca2+ activation. Variant ∆site2 (in which the sequence is replaced with A139SALA) shows no measurable change in Ca2+ sensitivity. We conclude that site 1, but not site 2, forms part of a regulatory Ca2+-binding site, which is distinct from other previously described Ca2+-binding sites.

  19. Selective labelling of diazepam-insensitive GABAA receptors in vivo using [3H]Ro 15-4513.

    PubMed

    Pym, Luanda J; Cook, Susan M; Rosahl, Thomas; McKernan, Ruth M; Atack, John R

    2005-11-01

    Classical benzodiazepines (BZs), such as diazepam, bind to GABAA receptors containing alpha1, alpha2, alpha3 or alpha5 subunits that are therefore described as diazepam-sensitive (DS) receptors. However, the corresponding binding site of GABAA receptors containing either an alpha4 or alpha6 subunit do not bind the classical BZs and are therefore diazepam-insensitive (DIS) receptors; a difference attributable to a single amino acid (histidine in alpha1, alpha2, alpha3 and alpha5 subunits and arginine in alpha4 and alpha6). Unlike classical BZs, the imidazobenzodiazepines Ro 15-4513 and bretazenil bind to both DS and DIS populations of GABAA receptors. In the present study, an in vivo assay was developed using lorazepam to fully occupy DS receptors such that [3H]Ro 15-4513 was then only able to bind to DIS receptors. When dosed i.v., [3H]Ro 15-4513 rapidly entered and was cleared from the brain, with approximately 70% of brain radioactivity being membrane-bound. Essentially all membrane binding to DS+DIS receptors could be displaced by unlabelled Ro 15-4513 or bretazenil, with respective ID50 values of 0.35 and 1.2 mg kg(-1). A dose of 30 mg kg(-1) lorazepam was used to block all DS receptors in a [3H]Ro 15-1788 in vivo binding assay. When predosed in a [3H]Ro 15-4513 binding assay, lorazepam blocked [3H]Ro 15-4513 binding to DS receptors, with the remaining binding to DIS receptors accounting for 5 and 23% of the total (DS plus DIS) receptors in the forebrain and cerebellum, respectively. The in vivo binding of [3H]Ro 15-4513 to DIS receptors in the presence of lorazepam was confirmed using alpha1H101R knock-in mice, in which alpha1-containing GABAA receptors are rendered diazepam insensitive by mutation of the histidine that confers diazepam sensitivity to arginine. In these mice, and in the presence of lorazepam, there was an increase of in vivo [3H]Ro 15-4513 binding in the forebrain and cerebellum from 4 and 15% to 36 and 59% of the total (i.e. DS plus DIS) [3H]Ro 15-4513 binding observed in the absence of lorazepam.

  20. Replacement of arginine 773 by cysteine or histidine in the human androgen receptor causes complete androgen insensitivity with different receptor phenotypes

    PubMed Central

    Prior, Lynn; Bordet, Sylvie; Trifiro, Mark A.; Mhatre, Anand; Kaufman, Morris; Pinsky, Leonard; Wrogeman, Klaus; Belsham, Denise D.; Pereira, Fred; Greenberg, Cheryl; Trapman, Jan; Brinkman, Albert O.; Chang, Chawnshang; Liao, Shutsung

    1992-01-01

    We have discovered two different point mutations in a single codon of the X-linked androgen-receptor (AR) gene in two pairs of unrelated families who have complete androgen insensitivity (resistance) associated with different AR phenotypes in their genital skin fibroblasts. One mutation is a C-to-T transition at a CpG sequence near the 5' terminus of exon 6; it changes the sense of codon 773 from arginine to cysteine, ablates specific androgen-binding activity at 37°C, and eliminates a unique KpnI site at the intron-exon boundary. The other mutation is a G-to-A transition that changes amino acid 773 to histidine and eliminates an SphI site. This mutant AR has a normal androgen-binding capacity at 37°C but has a reduced affinity for androgens and is thermolabile in their presence. Transient transfection of COS cells with cDNA expression vectors yielded little androgen-binding activity at 37°C from Arg773Cys and abundant activity with abnormal properties from Arg773His, thereby proving the pathogenicity of both sequence alterations. This conclusion coincides with the following facts about evolutionary preservation of the position homologous to Arg773 in the AR: it is occupied by Arg or lysine in the progesterone, glucocorticoid, and mineralocorticoid receptors, and it is within a 14-amino-acid region of their steroid-binding domains that share ∼85% amino acid identity. ImagesFigure 7Figure 2Figure 3Figure 5Figure 6Figure 8 PMID:1609793

  1. Determination of the affinity of drugs toward serum albumin by measurement of the quenching of the intrinsic tryptophan fluorescence of the protein.

    PubMed

    Epps, D E; Raub, T J; Caiolfa, V; Chiari, A; Zamai, M

    1999-01-01

    Binding of new chemical entities to serum proteins is an issue confronting pharmaceutical companies during development of potential therapeutic agents. Most drugs bind to the most abundant plasma protein, human serum albumin (HSA), at two major binding sites. Excepting fluorescence spectroscopy, existing methods for assaying drug binding to serum albumin are insensitive to higher-affinity compounds and can be labour-intensive, time-consuming, and usually require compound-specific assays. This led us to examine alternative ways to measure drug-albumin interaction. One method described here uses fluorescence quenching of the single tryptophan (Trp) residue in HSA excited at 295 nm to measure drug-binding affinity. Unfortunately, many compounds absorb, fluoresce, or both, in this UV wavelength region of the spectrum. Several types of binding phenomenon and spectral interference were identified by use of six structurally unrelated compounds and the equations necessary to make corrections mathematically were derived and applied to calculate binding constants accurately. The general cases were: direct quenching of Trp fluorescence by optically transparent ligands with low or high affinities; binding of optically transparent, non-fluorescent ligands to two specific sites where both sites or only one site result in Trp fluorescence quenching; and chromophores whose absorption either overlaps the Trp emission and quenches by energy transfer or absorbs light at the Trp fluorescence excitation wavelength producing absorptive screening as well as fluorescence quenching. Unless identification of the site specificity of drug binding to serum albumin is desired, quenching of the Trp fluorescence of albumin by titration with ligand is a rapid and facile method for determining the binding affinities of drugs for serum albumin.

  2. Structural basis for pH-insensitive inhibition of immunoglobulin G recycling by an anti-neonatal Fc receptor antibody

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kenniston, Jon A.; Taylor, Brandy M.; Conley, Gregory P.

    The neonatal Fc receptor FcRn plays a critical role in the trafficking of IgGs across tissue barriers and in retaining high circulating concentrations of both IgG and albumin. Although generally beneficial from an immunological perspective in maintaining IgG populations, FcRn can contribute to the pathogenesis of autoimmune disorders when an abnormal immune response targets normal biological components. We previously described a monoclonal antibody (DX-2507) that binds to FcRn with high affinity at both neutral and acidic pH, prevents the simultaneous binding of IgG, and reduces circulating IgG levels in preclinical animal models. Here, we report a 2.5 Å resolution X-raymore » crystal structure of an FcRn–DX-2507 Fab complex, revealing a nearly complete overlap of the IgG–Fc binding site in FcRn by complementarity-determining regions in DX-2507. This overlap explains how DX-2507 blocks IgG binding to FcRn and thereby shortens IgG half-life by preventing IgGs from recycling back into circulation. Moreover, the complex structure explains how the DX-2507 interaction is pH-insensitive unlike normal Fc interactions and how serum albumin levels are unaffected by DX-2507 binding. These structural studies could inform antibody-based therapeutic approaches for limiting the effects of IgG-mediated autoimmune disease.« less

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zukin, R.S.; Eghbali, M.; Olive, D.

    {kappa} opioid receptors ({kappa} receptors) have been characterized in homogenates of guinea pig and rat brain under in vitro binding conditions. {kappa} receptors were labeled by using the tritiated prototypic {kappa} opioid ethylketocyclazocine under conditions in which {mu} and {delta} opioid binding was suppressed. In the case of guinea pig brain membranes, a single population of high-affinity {kappa} opioid receptor sites was observed. In contrast, in the case of rat brain, two populations of {kappa} sites were observed. To test the hypothesis that the high- and low-affinity {kappa} sites represent two distinct {kappa} receptor subtypes, a series of opioids weremore » tested for their abilities to compete for binding to the two sites. U-69,593 and Cambridge 20 selectively displaced the high-affinity {kappa} site in both guinea pig and rat tissue, but were inactive at the rat-brain low-affinity site. Other {kappa} opioid drugs competed for binding to both sites, but with different rank orders of potency. Quantitative light microscopy in vitro autoradiography was used to visualize the neuroanatomical pattern of {kappa} receptors in rat and guinea pig brain. The distribution patterns of the two {kappa} receptor subtypes of rat brain were clearly different. Collectively, these data provide direct evidence for the presence of two {kappa} receptor subtypes; the U-69,593-sensitive, high-affinity {kappa}{sub 1} site predominates in guinea pig brain, and the U-69,593-insensitive, low-affinity {kappa}{sub 2} site predominates in rat brain.« less

  4. Structural Basis of Glyphosate Resistance Resulting from the Double Mutation Thr97 → Ile and Pro101 → Ser in 5-Enolpyruvylshikimate-3-phosphate Synthase from Escherichia coli*S⃞

    PubMed Central

    Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

    2009-01-01

    The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (Ki = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (Km = 0.1 mm). The crystal structure at 1.7-Å resolution revealed that the dual mutation causes a shift of residue Gly96 toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile97 points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr97 and Pro101 induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS. PMID:19211556

  5. Structural basis of glyphosate resistance resulting from the double mutation Thr97 -> Ile and Pro101 -> Ser in 5-enolpyruvylshikimate-3-phosphate synthase from Escherichia coli.

    PubMed

    Funke, Todd; Yang, Yan; Han, Huijong; Healy-Fried, Martha; Olesen, Sanne; Becker, Andreas; Schönbrunn, Ernst

    2009-04-10

    The shikimate pathway enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) is the target of the broad spectrum herbicide glyphosate. The genetic engineering of EPSPS led to the introduction of glyphosate-resistant crops worldwide. The genetically engineered corn lines NK603 and GA21 carry distinct EPSPS enzymes. CP4 EPSPS, expressed in NK603 corn and transgenic soybean, cotton, and canola, belongs to class II EPSPS, glyphosate-insensitive variants of this enzyme isolated from certain Gram-positive bacteria. GA21 corn, on the other hand, was created by point mutations of class I EPSPS, such as the enzymes from Zea mays or Escherichia coli, which are sensitive to low glyphosate concentrations. The structural basis of the glyphosate resistance resulting from these point mutations has remained obscure. We studied the kinetic and structural effects of the T97I/P101S double mutation, the molecular basis for GA21 corn, using EPSPS from E. coli. The T97I/P101S enzyme is essentially insensitive to glyphosate (K(i) = 2.4 mm) but maintains high affinity for the substrate phosphoenolpyruvate (PEP) (K(m) = 0.1 mm). The crystal structure at 1.7-A resolution revealed that the dual mutation causes a shift of residue Gly(96) toward the glyphosate binding site, impairing efficient binding of glyphosate, while the side chain of Ile(97) points away from the substrate binding site, facilitating PEP utilization. The single site T97I mutation renders the enzyme sensitive to glyphosate and causes a substantial decrease in the affinity for PEP. Thus, only the concomitant mutations of Thr(97) and Pro(101) induce the conformational changes necessary to produce catalytically efficient, glyphosate-resistant class I EPSPS.

  6. Cofilin is a pH sensor for actin free barbed end formation: role of phosphoinositide binding.

    PubMed

    Frantz, Christian; Barreiro, Gabriela; Dominguez, Laura; Chen, Xiaoming; Eddy, Robert; Condeelis, John; Kelly, Mark J S; Jacobson, Matthew P; Barber, Diane L

    2008-12-01

    Newly generated actin free barbed ends at the front of motile cells provide sites for actin filament assembly driving membrane protrusion. Growth factors induce a rapid biphasic increase in actin free barbed ends, and we found both phases absent in fibroblasts lacking H(+) efflux by the Na-H exchanger NHE1. The first phase is restored by expression of mutant cofilin-H133A but not unphosphorylated cofilin-S3A. Constant pH molecular dynamics simulations and nuclear magnetic resonance (NMR) reveal pH-sensitive structural changes in the cofilin C-terminal filamentous actin binding site dependent on His133. However, cofilin-H133A retains pH-sensitive changes in NMR spectra and severing activity in vitro, which suggests that it has a more complex behavior in cells. Cofilin activity is inhibited by phosphoinositide binding, and we found that phosphoinositide binding is pH-dependent for wild-type cofilin, with decreased binding at a higher pH. In contrast, phosphoinositide binding by cofilin-H133A is attenuated and pH insensitive. These data suggest a molecular mechanism whereby cofilin acts as a pH sensor to mediate a pH-dependent actin filament dynamics.

  7. A possible molecular mechanism of the action of digitalis: ouabain action on calcium binding to sites associated with a purified sodium-potassium-activated adenosine triphosphatase from kidney.

    PubMed

    Gervais, A; Lane, L K; Anner, B M; Lindenmayer, G E; Schwartz, A

    1977-01-01

    Calcium binding at 0 degrees C to a purified sheep kidney Na+,K+-ATPase was described by linear Scatchard plots. Binding at saturating free calcium was 65-80 nmol/mg of protein, or 30-40 mol of calcium/mol of enzyme. Aqueous emulsions of lipids extracted from Na+,K+-ATPase yielded dissociation constants and maximum calcium-binding values that were similar to those for native Na+,K+-ATPase. Phospholipase A treatment markedly reduced calcium binding. Pretreatment of native Na+,K+-ATPase with ouabain increased the dissociation constant for calcium binding from 131 +/- 7 to 192 +/- 7 muM without altering maximum calcium binding. Ouabain pretreatment did not affect calcium binding to extracted phospholipids, ouabain-insensitive ATPases, or heat denatured Na+,K+-ATPase, Na+ and K+ (5-20 mM) increased the dissociation constants for calcium, which suggests competition between the monovalent cations and calcium for the binding sites. At higher concentrations of monovalent cations, ouabain increased the apparent affinity of binding sites for calcium. Extrapolation to physiological cation concentrations revealed that the ouabain-induced increase in apparent affinity for calcium may be as much as 2- to 3-fold. These results suggest: (1) calcium binds to phospholipids associated with Na+,K+-ATPase; (2) ouabain interaction with Na+,K+-ATPase induces a perturbation that is transmitted to adjacent phospholipids, altering their affinity for calcium; and (3) at physiological concentrations of Na+ or K+, or both, ouabain interaction with Na+,K+-ATPase may lead to an increased pool of membrane-bound calcium.

  8. Different components of /sup 3/H-imipramine binding in rat brain membranes: relation to serotonin uptake sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gobbi, M.; Taddei, C.; Mennini, T.

    1988-01-01

    In the present paper, the authors confirm and extend previous studies showing heterogeneous /sup 3/H-imipramine (/sup 3/H-IMI) binding sites. Inhibition curves of various drugs (serotonin, imipramine, desmethyl-imipramine, d-fenfluramine, d-norfenfluramine and indalpine, a potent serotonin uptake inhibitor) obtained using 2 nM /sup 3/H-IMI and in presence of 120 mM NaCl, confirmed the presence of at least three /sup 3/H-IMI binding sites: two of these were serotonin-insensitive while the third one was selectively inhibited by serotonin and indalpine with nanomolar affinities. Moreover this last component was found to be selectively modulated by chronic imipramine treatment thus suggesting a close relation to serontoninmore » uptake mechanism. These data indicate that the use of a more selective inhibitors of the serotonin-sensitive component (like indalpine or serotonin itself) to define non specific /sup 3/H-IMI, may be of help in understanding its relation with serotonin uptake system. 22 references, 2 figures, 2 tables.« less

  9. Natural Variation in Monoterpene Synthesis in Kiwifruit: Transcriptional Regulation of Terpene Synthases by NAC and ETHYLENE-INSENSITIVE3-Like Transcription Factors1

    PubMed Central

    Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.

    2015-01-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633

  10. Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.

    PubMed

    Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G

    2015-04-01

    Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American Society of Plant Biologists. All Rights Reserved.

  11. Intrasteric control of AMPK via the gamma1 subunit AMP allosteric regulatory site.

    PubMed

    Adams, Julian; Chen, Zhi-Ping; Van Denderen, Bryce J W; Morton, Craig J; Parker, Michael W; Witters, Lee A; Stapleton, David; Kemp, Bruce E

    2004-01-01

    AMP-activated protein kinase (AMPK) is a alphabetagamma heterotrimer that is activated in response to both hormones and intracellular metabolic stress signals. AMPK is regulated by phosphorylation on the alpha subunit and by AMP allosteric control previously thought to be mediated by both alpha and gamma subunits. Here we present evidence that adjacent gamma subunit pairs of CBS repeat sequences (after Cystathionine Beta Synthase) form an AMP binding site related to, but distinct from the classical AMP binding site in phosphorylase, that can also bind ATP. The AMP binding site of the gamma(1) CBS1/CBS2 pair, modeled on the structures of the CBS sequences present in the inosine monophosphate dehydrogenase crystal structure, contains three arginine residues 70, 152, and 171 and His151. The yeast gamma homolog, snf4 contains a His151Gly substitution, and when this is introduced into gamma(1), AMP allosteric control is substantially lost and explains why the yeast snf1p/snf4p complex is insensitive to AMP. Arg70 in gamma(1) corresponds to the site of mutation in human gamma(2) and pig gamma(3) genes previously identified to cause an unusual cardiac phenotype and glycogen storage disease, respectively. Mutation of any of AMP binding site Arg residues to Gln substantially abolishes AMP allosteric control in expressed AMPK holoenzyme. The Arg/Gln mutations also suppress the previously described inhibitory properties of ATP and render the enzyme constitutively active. We propose that ATP acts as an intrasteric inhibitor by bridging the alpha and gamma subunits and that AMP functions to derepress AMPK activity.

  12. A substitutional mutation in the DNA binding domain of the androgen receptor causes complete androgen insensitivity syndrome.

    PubMed

    Komori, S; Sakata, K; Kasumi, H; Tsuji, Y; Hamada, K; Koyama, K

    1999-10-01

    DNA analysis of the androgen receptor gene in a patient with complete androgen insensitivity syndrome identified a substitutional mutation (tyrosine converted to cysteine at position 571) in the DNA binding domain. In vitro transfection experiments with the patients' androgen receptor gene, indicated normal expression of the androgen receptor in transfected COS-7 cells compared to the wild type gene. There was also no evidence of impaired thermal stability of the 5 alpha-dihydrotestosterone-androgen receptor complex. However, the capacity of the androgen receptor to activate target gene transcription was found to be completely disrupted in a luciferase assay. These results confirmed that only one substitutional mutation in the DNA binding domain was related to the pathogenesis of the complete androgen insensitivity syndrome.

  13. An L319F mutation in transmembrane region 3 (TM3) selectively reduces sensitivity to okaramine B of the Bombyx mori l-glutamate-gated chloride channel.

    PubMed

    Furutani, Shogo; Okuhara, Daiki; Hashimoto, Anju; Ihara, Makoto; Kai, Kenji; Hayashi, Hideo; Sattelle, David B; Matsuda, Kazuhiko

    2017-10-01

    Okaramines produced by Penicillium simplicissimum AK-40 activate l-glutamate-gated chloride channels (GluCls) and thus paralyze insects. However, the okaramine binding site on insect GluCls is poorly understood. Sequence alignment shows that the equivalent of residue Leucine319 of the okaramine B sensitive Bombyx mori (B. mori) GluCl is a phenylalanine in the okaramine B insensitive B. mori γ-aminobutyric acid-gated chloride channel of the same species. This residue is located in the third transmembrane (TM3) region, a location which in a nematode GluCl is close to the ivermectin binding site. The B. mori GluCl containing the L319F mutation retained its sensitivity to l-glutamate, but responses to ivermectin were reduced and those to okaramine B were completely blocked.

  14. Evidence of paired M2 muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potter, L.T.; Ballesteros, L.A.; Bichajian, L.H.

    Binding assays involving various antagonists, including N-(3H) methylscopolamine, (3H)quinuclidinyl benzilate, AFDX-116, pirenzepine, and propylbenzilylcholine mustard, disclosed only a single population of M2 muscarinic receptors in membranes from the rat brainstem (medulla, pons, and colliculi). However, competition curves between N-(3H)methylscopolamine and various agonists, including oxotremorine, cis-dioxolane, and acetylethylcholine mustard, showed approximately equal numbers of guanine nucleotide-sensitive high affinity (H) sites and guanine nucleotide-insensitive low affinity (L) sites. This 50% H phenomenon persisted in different buffers, at different temperatures, after the number of receptors was halved (and, thus, the remaining receptor to guanine nucleotide-binding protein ratio was doubled), after membrane solubilization withmore » digitonin, and when rabbit cardiac membranes were used instead of rat brainstem membranes. Preferential occupation of H sites with acetylethylcholine mustard, and of L sites with quinuclidinyl benzilate or either mustard, yielded residual free receptor populations showing predominantly L and H sites, respectively. Low concentrations of (3H)-oxotremorine-M labeled only H sites, and the Bmax for these sites was 49% of the Bmax found with (3H)quinuclidinyl benzilate plus guanine nucleotide. These and other results are most consistent with the idea that H and L receptor sites exist on separate but dimeric receptor molecules and with the hypothesis that only the H receptors cycle between high and low affinity, depending upon interactions between this receptor molecule and a guanine nucleotide-binding protein.« less

  15. 14-3-3 proteins mediate inhibitory effects of cAMP on salt-inducible kinases (SIKs).

    PubMed

    Sonntag, Tim; Vaughan, Joan M; Montminy, Marc

    2018-02-01

    The salt-inducible kinase (SIK) family regulates cellular gene expression via the phosphorylation of cAMP-regulated transcriptional coactivators (CRTCs) and class IIA histone deacetylases, which are sequestered in the cytoplasm by phosphorylation-dependent 14-3-3 interactions. SIK activity toward these substrates is inhibited by increases in cAMP signaling, although the underlying mechanism is unclear. Here, we show that the protein kinase A (PKA)-dependent phosphorylation of SIKs inhibits their catalytic activity by inducing 14-3-3 protein binding. SIK1 and SIK3 contain two functional PKA/14-3-3 sites, while SIK2 has four. In keeping with the dimeric nature of 14-3-3s, the presence of multiple binding sites within target proteins dramatically increases binding affinity. As a result, loss of a single 14-3-3-binding site in SIK1 and SIK3 abolished 14-3-3 association and rendered them insensitive to cAMP. In contrast, mutation of three sites in SIK2 was necessary to fully block cAMP regulation. Superimposed on the effects of PKA phosphorylation and 14-3-3 association, an evolutionary conserved domain in SIK1 and SIK2 (the so called RK-rich region; 595-624 in hSIK2) is also required for the inhibition of SIK2 activity. Collectively, these results point to a dual role for 14-3-3 proteins in repressing a family of Ser/Thr kinases as well as their substrates. © 2017 Federation of European Biochemical Societies.

  16. Dynamics of 1α,25-dihydroxyvitamin D3-dependent chromatin accessibility of early vitamin D receptor target genes.

    PubMed

    Seuter, Sabine; Pehkonen, Petri; Heikkinen, Sami; Carlberg, Carsten

    2013-12-01

    The signaling cascade of the transcription factor vitamin D receptor (VDR) is triggered by its specific ligand 1α,25-dihydroxyvitamin D3 (1α,25(OH)2D3). In this study we demonstrate that in THP-1 human monocytic leukemia cells 87.4% of the 1034 most prominent genome-wide VDR binding sites co-localize with loci of open chromatin. At 165 of them 1α,25(OH)2D3 strongly increases chromatin accessibility and has at further 217 sites weaker effects. Interestingly, VDR binding sites in 1α,25(OH)2D3-responsive chromatin regions are far more often composed of direct repeats with 3 intervening nucleotides (DR3s) than those in ligand insensitive regions. DR3-containing VDR sites are enriched in the neighborhood of genes that are involved in controling cellular growth, while non-DR3 VDR binding is often found close to genes related to immunity. At the example of six early VDR target genes we show that the slope of their 1α,25(OH)2D3-induced transcription correlates with the basal chromatin accessibility of their major VDR binding regions. However, the chromatin loci controlling these genes are indistinguishable in their VDR association kinetics. Taken together, ligand responsive chromatin loci represent dynamically regulated contact points of VDR with the genome, from where it controls early 1α,25(OH)2D3 target genes. © 2013.

  17. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  18. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  19. Rational design and validation of a vanilloid-sensitive TRPV2 ion channel.

    PubMed

    Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

    2016-06-28

    Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S-S498F-L505T-Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular "glue" that bridges the S4-S5 linker to the S1-S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor.

  20. Ubiquinol-binding site in the alternative oxidase: mutagenesis reveals features important for substrate binding and inhibition.

    PubMed

    Albury, Mary S; Elliott, Catherine; Moore, Anthony L

    2010-12-01

    The alternative oxidase (AOX) is a non-protonmotive ubiquinol oxidase that is found in all plants, some fungi, green algae, bacteria and pathogenic protozoa. The lack of AOX in the mammalian host renders this protein an important potential therapeutic target in the treatment of pathogenic protozoan infections. Bioinformatic searches revealed that, within a putative ubiquinol-binding crevice in AOX, Gln242, Asn247, Tyr253, Ser256, His261 and Arg262 were highly conserved. To confirm that these amino-acid residues are important for ubiquinol-binding and hence activity substitution mutations were generated and characterised. Assessment of AOX activity in isolated Schizosaccharomyces pombe mitochondria revealed that mutation of either Gln242, Ser256, His261 and Arg262 resulted in >90% inhibition of antimycin A-insensitive respiration suggesting that hydroxyl, guanidino, imidazole groups, polar and charged residues in addition to the size of the amino-acid chain are important for ubiquinone-binding. Substitution of Asn247 with glutamine or Tyr253 with phenylalanine had little effect upon the respiratory rate indicating that these residues are not critical for AOX activity. However replacement of Tyr253 by alanine resulted in a 72% loss of activity suggesting that the benzoquinone group and not hydroxyl group is important for quinol binding. These results provide important new insights into the ubiquinol-binding site of the alternative oxidase, the identity of which maybe important for future rational drug design. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Light-driven Na + pump from Gillisia limnaea: A high-affinity Na + binding site is formed transiently in the photocycle

    DOE PAGES

    Balashov, Sergei P.; Imasheva, Eleonora S.; Dioumaev, Andrei K.; ...

    2014-11-06

    A group of microbial retinal proteins most closely related to the proton pump xanthorhodopsin has a novel sequence motif and a novel function. Instead of, or in addition to, proton transport, they perform light-driven sodium ion transport, as reported for one representative of this group (KR2) from Krokinobacter. In this paper, we examine a similar protein, GLR from Gillisia limnaea, expressed in Escherichia coli, which shares some properties with KR2 but transports only Na +. The absorption spectrum of GLR is insensitive to Na + at concentrations of ≤3 M. However, very low concentrations of Na + cause profound differencesmore » in the decay and rise time of photocycle intermediates, consistent with a switch from a “Na +-independent” to a “Na +-dependent” photocycle (or photocycle branch) at ~60 μM Na +. The rates of photocycle steps in the latter, but not the former, are linearly dependent on Na + concentration. This suggests that a high-affinity Na + binding site is created transiently after photoexcitation, and entry of Na + from the bulk to this site redirects the course of events in the remainder of the cycle. A greater concentration of Na + is needed for switching the reaction path at lower pH. The data suggest therefore competition between H + and Na + to determine the two alternative pathways. The idea that a Na + binding site can be created at the Schiff base counterion is supported by the finding that upon perturbation of this region in the D251E mutant, Na + binds without photoexcitation. Furthermore, binding of Na+ to the mutant shifts the chromophore maximum to the red like that of H +, which occurs in the photocycle of the wild type.« less

  2. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression

    PubMed Central

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-01-01

    We explore a model for ‘quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10–11 bp insertions or deletions (INDELs) and sensitive to 5–6 bp INDELs. We test this prediction on 61 σ54-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat. PMID:26832446

  3. Using synthetic bacterial enhancers to reveal a looping-based mechanism for quenching-like repression.

    PubMed

    Brunwasser-Meirom, Michal; Pollak, Yaroslav; Goldberg, Sarah; Levy, Lior; Atar, Orna; Amit, Roee

    2016-02-02

    We explore a model for 'quenching-like' repression by studying synthetic bacterial enhancers, each characterized by a different binding site architecture. To do so, we take a three-pronged approach: first, we compute the probability that a protein-bound dsDNA molecule will loop. Second, we use hundreds of synthetic enhancers to test the model's predictions in bacteria. Finally, we verify the mechanism bioinformatically in native genomes. Here we show that excluded volume effects generated by DNA-bound proteins can generate substantial quenching. Moreover, the type and extent of the regulatory effect depend strongly on the relative arrangement of the binding sites. The implications of these results are that enhancers should be insensitive to 10-11 bp insertions or deletions (INDELs) and sensitive to 5-6 bp INDELs. We test this prediction on 61 σ(54)-regulated qrr genes from the Vibrio genus and confirm the tolerance of these enhancers' sequences to the DNA's helical repeat.

  4. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor- targeted therapeutics: advantages and limitations

    PubMed Central

    Williams, Dustin K.; Wang, Jingyi; Papke, Roger L.

    2011-01-01

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. PMID:21575610

  5. Positive allosteric modulators as an approach to nicotinic acetylcholine receptor-targeted therapeutics: advantages and limitations.

    PubMed

    Williams, Dustin K; Wang, Jingyi; Papke, Roger L

    2011-10-15

    Neuronal nicotinic acetylcholine receptors (nAChR), recognized targets for drug development in cognitive and neuro-degenerative disorders, are allosteric proteins with dynamic interconversions between multiple functional states. Activation of the nAChR ion channel is primarily controlled by the binding of ligands (agonists, partial agonists, competitive antagonists) at conventional agonist binding sites, but is also regulated in either negative or positive ways by the binding of ligands to other modulatory sites. In this review, we discuss models for the activation and desensitization of nAChR, and the discovery of multiple types of ligands that influence those processes in both heteromeric nAChR, such as the high-affinity nicotine receptors of the brain, and homomeric α7-type receptors. In recent years, α7 nAChRs have been identified as a potential target for therapeutic indications leading to the development of α7-selective agonists and partial agonists. However, unique properties of α7 nAChR, including low probability of channel opening and rapid desensitization, may limit the therapeutic usefulness of ligands binding exclusively to conventional agonist binding sites. New enthusiasm for the therapeutic targeting of α7 has come from the identification of α7-selective positive allosteric modulators (PAMs) that work effectively on the intrinsic factors that limit α7 ion channel activation. While these new drugs appear promising for therapeutic development, we also consider potential caveats and possible limitations for their use, including PAM-insensitive forms of desensitization and cytotoxicity issues. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. [125I]2-(2-chloro-4-iodo-phenylamino)-5-methyl-pyrroline (LNP 911), a high-affinity radioligand selective for I1 imidazoline receptors.

    PubMed

    Greney, Hugues; Urosevic, Dragan; Schann, Stephan; Dupuy, Laurence; Bruban, Véronique; Ehrhardt, Jean-Daniel; Bousquet, Pascal; Dontenwill, Monique

    2002-07-01

    The I1 subtype of imidazoline receptors (I1R) is a plasma membrane protein that is involved in diverse physiological functions. Available radioligands used so far to characterize the I(1)R were able to bind with similar affinities to alpha2-adrenergic receptors (alpha2-ARs) and to I1R. This feature was a major drawback for an adequate characterization of this receptor subtype. New imidazoline analogs were therefore synthesized and the present study describes one of these compounds, 2-(2-chloro-4-iodo-phenylamino)-5-methyl-pyrroline (LNP 911), which was of high affinity and selectivity for the I1R. LNP 911 was radioiodinated and its binding properties characterized in different membrane preparations. Saturation experiments with [125I]LNP 911 revealed a single high affinity binding site in PC-12 cell membranes (K(D) = 1.4 nM; B(max) = 398 fmol/mg protein) with low nonspecific binding. [125I]LNP 911 specific binding was inhibited by various imidazolines and analogs but was insensitive to guanosine-5'-O-(3-thio)triphosphate. The rank order of potency of some competing ligands [LNP 911, PIC, rilmenidine, 4-chloro-2-(imidazolin-2-ylamino)-isoindoline (BDF 6143), lofexidine, and clonidine] was consistent with the definition of [125I]LNP 911 binding sites as I1R. However, other high-affinity I1R ligands (moxonidine, efaroxan, and benazoline) exhibited low affinities for these binding sites in standard binding assays. In contrast, when [125I]LNP 911 was preincubated at 4 degrees C, competition curves of moxonidine became biphasic. In this case, moxonidine exhibited similar high affinities on [125I]LNP 911 binding sites as on I1R defined with [125I]PIC. Moxonidine proved also able to accelerate the dissociation of [125I]LNP 911 from its binding sites. These results suggest the existence of an allosteric modulation at the level of the I1R, which seems to be corroborated by the dose-dependent enhancement by LNP 911 of the agonist effects on the adenylate cyclase pathway associated to I1R. Because [125I]LNP 911 was unable to bind to the I2 binding site and alpha2AR, our data indicate that [125I]LNP 911 is the first highly selective radioiodinated probe for I1R with a nanomolar affinity. This new tool should facilitate the molecular characterization of the I1 imidazoline receptor.

  7. Electromagnetic field triggered drug and chemical delivery via liposomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liburdy, R.P.

    1993-03-02

    The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release the chemical agent from the liposomes at a temperature of between about +10 and 65 C.more » The invention further relates to the use of the liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.« less

  8. Electromagnetic field triggered drug and chemical delivery via liposomes

    DOEpatents

    Liburdy, R.P.

    1993-03-02

    The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release the chemical agent from the liposomes at a temperature of between about +10 and 65 C. The invention further relates to the use of the liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

  9. Electromagnetic field triggered drug and chemical delivery via liposomes

    DOEpatents

    Liburdy, Robert P.

    1993-01-01

    The present invention relates to a system and to a method of delivering a drug to a preselected target body site of a patient, comprising the steps of encapsulating the chemical agent within liposomes, essentially temperature insensitive, i.e. not having a specific predetermined phase transition temperature within the specific temperature range of drug administration; administering the liposomes to the target body site; and subjecting the target body site to nonionizing electromagnetic fields in an area of the preselected target body in order to release said chemical agent from the liposomes at a temperature of between about +10 and 65.degree. C. The invention further relates to the use of said liposomes to bind to the surface of or to enter target tissue or an organ in a living system, and, when subjected to a nonionizing field, to release a drug from the liposomes into the target site.

  10. Rational design and validation of a vanilloid-sensitive TRPV2 ion channel

    PubMed Central

    Yang, Fan; Vu, Simon; Yarov-Yarovoy, Vladimir; Zheng, Jie

    2016-01-01

    Vanilloids activation of TRPV1 represents an excellent model system of ligand-gated ion channels. Recent studies using cryo-electron microcopy (cryo-EM), computational analysis, and functional quantification revealed the location of capsaicin-binding site and critical residues mediating ligand-binding and channel activation. Based on these new findings, here we have successfully introduced high-affinity binding of capsaicin and resiniferatoxin to the vanilloid-insensitive TRPV2 channel, using a rationally designed minimal set of four point mutations (F467S–S498F–L505T–Q525E, termed TRPV2_Quad). We found that binding of resiniferatoxin activates TRPV2_Quad but the ligand-induced open state is relatively unstable, whereas binding of capsaicin to TRPV2_Quad antagonizes resiniferatoxin-induced activation likely through competition for the same binding sites. Using Rosetta-based molecular docking, we observed a common structural mechanism underlying vanilloids activation of TRPV1 and TRPV2_Quad, where the ligand serves as molecular “glue” that bridges the S4–S5 linker to the S1–S4 domain to open these channels. Our analysis revealed that capsaicin failed to activate TRPV2_Quad likely due to structural constraints preventing such bridge formation. These results not only validate our current working model for capsaicin activation of TRPV1 but also should help guide the design of drug candidate compounds for this important pain sensor. PMID:27298359

  11. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

    PubMed

    Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. © 2015 Dai et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

    PubMed Central

    Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.

    2015-01-01

    Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. PMID:25561495

  13. Stepwise evolution of resistance to toxic cardenolides via genetic substitutions in the Na+/K+ -ATPase of milkweed butterflies (lepidoptera: Danaini).

    PubMed

    Petschenka, Georg; Fandrich, Steffi; Sander, Nils; Wagschal, Vera; Boppré, Michael; Dobler, Susanne

    2013-09-01

    Despite the monarch butterfly (Danaus plexippus) being famous for its adaptations to the defensive traits of its milkweed host plants, little is known about the macroevolution of these traits. Unlike most other animal species, monarchs are largely insensitive to cardenolides, because their target site, the sodium pump (Na(+)/K(+) -ATPase), has evolved amino acid substitutions that reduce cardenolide binding (so-called target site insensitivity, TSI). Because many, but not all, species of milkweed butterflies (Danaini) are associated with cardenolide-containing host plants, we analyzed 16 species, representing all phylogenetic lineages of milkweed butterflies, for the occurrence of TSI by sequence analyses of the Na(+)/K(+) -ATPase gene and by enzymatic assays with extracted Na(+)/K(+) -ATPase. Here we report that sensitivity to cardenolides was reduced in a stepwise manner during the macroevolution of milkweed butterflies. Strikingly, not all Danaini typically consuming cardenolides showed TSI, but rather TSI was more strongly associated with sequestration of toxic cardenolides. Thus, the interplay between bottom-up selection by plant compounds and top-down selection by natural enemies can explain the evolutionary sequence of adaptations to these toxins. © 2013 The Author(s). Evolution © 2013 The Society for the Study of Evolution.

  14. Pyrearinus termitilluminans larval click beetle luciferase: active site properties, structure and function relationships and comparison with other beetle luciferases.

    PubMed

    Silva Neto, A J; Scorsato, V; Arnoldi, F G C; Viviani, V R

    2009-12-01

    Several beetle luciferases have been cloned and sequenced. However, most studies on structure and function relationships and bioanalytical applications were done with firefly luciferases, which are pH sensitive. Several years ago we cloned Pyrearinus termitilluminans larval click beetle luciferase, which displays the most blue-shifted bioluminescence among beetle luciferases and is pH insensitive. This enzyme was expressed in E. coli, purified, and its properties investigated. This luciferase shows slower luminescence kinetics, K(M) values comparable to other beetle luciferases and high catalytic constant. Fluorescence studies with 8-anilino-1-naphtalene-sulfonic acid (1,8-ANS) and modeling studies suggest that the luciferin binding site of this luciferase is very hydrophobic, supporting the solvent and orientation polarizability effects as determining mechanisms for bioluminescence colors. Although pH insensitive in the range between pH 6-8, at pH 10 this luciferase displays a remarkable red-shift and broadening of the bioluminescence spectrum. Modeling studies suggest that the residue C312 may play an important role in bioluminescence color modulation. Compared to other beetle luciferases, Pyrearinus termitilluminans luciferase also displays higher thermostability and sustained luminescence in a bacterial cell environment, which makes this luciferase particularly suitable for in vivo cell analysis and bioimaging.

  15. Reversal of Ion Charge Selectivity Renders the Pentameric Ligand-Gated Ion Channel GLIC Insensitive to Anesthetics

    PubMed Central

    Tillman, Tommy; Cheng, Mary H.; Chen, Qiang; Tang, Pei; Xu, Yan

    2014-01-01

    Pentameric ligand gated ion channels (pLGICs) are a family of structurally homologous cationic and anionic channels involved in neurotransmission. Cationic members of the pLGIC family are typically inhibited by general anesthetics, while anionic members are potentiated. GLIC is a prokaryotic cationic pLGIC and can be inhibited by clinical concentrations of general anesthetics. The introduction of three mutations, Y221A (Y–3′A), E222P (E–2′P) and N224R (N0′R), at the selectivity filter and one, A237T (A13′T), at the hydrophobic gate, converted GLIC to an anion channel. The mutated GLIC (GLIC4) became insensitive to the anesthetics propofol and etomidate as well as the channel blocker picrotoxin. Molecular dynamics (MD) simulations revealed changes in the structure and dynamics of GLIC4 in comparison to GLIC, particularly in the tilting angles of the pore-lining helix (TM2) that consequently resulted in different pore radius and hydration profiles. Propofol binding to an intra-subunit site of GLIC shifted the tilting angles of TM2 towards closure at the hydrophobic gate region, consistent with propofol inhibition of GLIC. In contrast, the pore of GLIC4 was much more resilient to perturbation from propofol binding. This study underscores the importance of pore dynamics and conformation to anesthetic effects on channel functions. PMID:22978431

  16. Cadmium is a potent inhibitor of PPM phosphatases and targets the M1 binding site

    PubMed Central

    Pan, Chang; Liu, Hong-Da; Gong, Zheng; Yu, Xiao; Hou, Xu-Ben; Xie, Di-Dong; Zhu, Xi-Bin; Li, Hao-Wen; Tang, Jun-Yi; Xu, Yun-Fei; Yu, Jia-Qi; Zhang, Lian-Ying; Fang, Hao; Xiao, Kun-Hong; Chen, Yu-Guo; Wang, Jiang-Yun; Pang, Qi; Chen, Wei; Sun, Jin-Peng

    2013-01-01

    The heavy metal cadmium is a non-degradable pollutant. By screening the effects of a panel of metal ions on the phosphatase activity, we unexpectedly identified cadmium as a potent inhibitor of PPM1A and PPM1G. In contrast, low micromolar concentrations of cadmium did not inhibit PP1 or tyrosine phosphatases. Kinetic studies revealed that cadmium inhibits PPM phosphatases through the M1 metal ion binding site. In particular, the negative charged D441 in PPM1G specific recognized cadmium. Our results suggest that cadmium is likely a potent inhibitor of most PPM family members except for PHLPPs. Furthermore, we demonstrated that cadmium inhibits PPM1A-regulated MAPK signaling and PPM1G-regulated AKT signaling potently in vivo. Cadmium reversed PPM1A-induced cell cycle arrest and cadmium insensitive PPM1A mutant rescued cadmium induced cell death. Taken together, these findings provide a better understanding of the effects of the toxicity of cadmium in the contexts of human physiology and pathology. PMID:23903585

  17. A double tyrosine motif in the cardiac sodium channel domain III-IV linker couples calcium-dependent calmodulin binding to inactivation gating.

    PubMed

    Sarhan, Maen F; Van Petegem, Filip; Ahern, Christopher A

    2009-11-27

    Voltage-gated sodium channels maintain the electrical cadence and stability of neurons and muscle cells by selectively controlling the transmembrane passage of their namesake ion. The degree to which these channels contribute to cellular excitability can be managed therapeutically or fine-tuned by endogenous ligands. Intracellular calcium, for instance, modulates sodium channel inactivation, the process by which sodium conductance is negatively regulated. We explored the molecular basis for this effect by investigating the interaction between the ubiquitous calcium binding protein calmodulin (CaM) and the putative sodium channel inactivation gate composed of the cytosolic linker between homologous channel domains III and IV (DIII-IV). Experiments using isothermal titration calorimetry show that CaM binds to a novel double tyrosine motif in the center of the DIII-IV linker in a calcium-dependent manner, N-terminal to a region previously reported to be a CaM binding site. An alanine scan of aromatic residues in recombinant DIII-DIV linker peptides shows that whereas multiple side chains contribute to CaM binding, two tyrosines (Tyr(1494) and Tyr(1495)) play a crucial role in binding the CaM C-lobe. The functional relevance of these observations was then ascertained through electrophysiological measurement of sodium channel inactivation gating in the presence and absence of calcium. Experiments on patch-clamped transfected tsA201 cells show that only the Y1494A mutation of the five sites tested renders sodium channel steady-state inactivation insensitive to cytosolic calcium. The results demonstrate that calcium-dependent calmodulin binding to the sodium channel inactivation gate double tyrosine motif is required for calcium regulation of the cardiac sodium channel.

  18. Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis

    PubMed Central

    Guo, Yongxia; Zheng, Zuyu; La Clair, James J.; Chory, Joanne; Noel, Joseph P.

    2013-01-01

    Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2–karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic–aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2–KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner. PMID:23613584

  19. Smoke-derived karrikin perception by the α/β-hydrolase KAI2 from Arabidopsis.

    PubMed

    Guo, Yongxia; Zheng, Zuyu; La Clair, James J; Chory, Joanne; Noel, Joseph P

    2013-05-14

    Genetic studies in Arabidopsis implicate an α/β-hydrolase, KARRIKIN-INSENSITIVE 2 (KAI2) as a receptor for karrikins, germination-promoting butenolide small molecules found in the smoke of burned plants. However, direct biochemical evidence for the interaction between KAI2 and karrikin and for the mechanism of downstream signaling by a KAI2-karrikin complex remain elusive. We report crystallographic analyses and ligand-binding experiments for KAI2 recognition of karrikins. The karrikin-1 (KAR1) ligand sits in the opening to the active site abutting a helical domain insert but distal from the canonical catalytic triad (Ser95-His246-Asp217) of α/β-hydrolases, consistent with the lack of detectable hydrolytic activity by purified KAI2. The closest approach of KAR1 to Ser95-His246-Asp217 is 3.8 Å from His246. Six aromatic side chains, including His246, encapsulate KAR1 through geometrically defined aromatic-aromatic interactions. KAR1 binding induces a conformational change in KAI2 at the active site entrance. A crevice of hydrophobic residues linking the polar edge of KAR1 and the helical domain insert suggests that KAI2-KAR1 creates a contiguous interface for binding signaling partners in a ligand-dependent manner.

  20. Regulation of nrf operon expression in pathogenic enteric bacteria: sequence divergence reveals new regulatory complexity

    PubMed Central

    Godfrey, Rita E.; Lee, David J.; Busby, Stephen J. W.

    2017-01-01

    Summary The Escherichia coli K‐12 nrf operon encodes a periplasmic nitrite reductase, the expression of which is driven from a single promoter, pnrf. Expression from pnrf is activated by the FNR transcription factor in response to anaerobiosis and further increased in response to nitrite by the response regulator proteins, NarL and NarP. FNR‐dependent transcription is suppressed by the binding of two nucleoid associated proteins, IHF and Fis. As Fis levels increase in cells grown in rich medium, the positioning of its binding site, overlapping the promoter −10 element, ensures that pnrf is sharply repressed. Here, we investigate the expression of the nrf operon promoter from various pathogenic enteric bacteria. We show that pnrf from enterohaemorrhagic E. coli is more active than its K‐12 counterpart, exhibits substantial FNR‐independent activity and is insensitive to nutrient quality, due to an improved −10 element. We also demonstrate that the Salmonella enterica serovar Typhimurium core promoter is more active than previously thought, due to differences around the transcription start site, and that its expression is repressed by downstream sequences. We identify the CsrA RNA binding protein as being responsible for this, and show that CsrA differentially regulates the E. coli K‐12 and Salmonella nrf operons. PMID:28211111

  1. Empirically Optimized Flow Cytometric Immunoassay Validates Ambient Analyte Theory

    PubMed Central

    Parpia, Zaheer A.; Kelso, David M.

    2010-01-01

    Ekins’ ambient analyte theory predicts, counter intuitively, that an immunoassay’s limit of detection can be improved by reducing the amount of capture antibody. In addition, it also anticipates that results should be insensitive to the volume of sample as well as the amount of capture antibody added. The objective of this study is to empirically validate all of the performance characteristics predicted by Ekins’ theory. Flow cytometric analysis was used to detect binding between a fluorescent ligand and capture microparticles since it can directly measure fractional occupancy, the primary response variable in ambient analyte theory. After experimentally determining ambient analyte conditions, comparisons were carried out between ambient and non-ambient assays in terms of their signal strengths, limits of detection, and their sensitivity to variations in reaction volume and number of particles. The critical number of binding sites required for an assay to be in the ambient analyte region was estimated to be 0.1VKd. As predicted, such assays exhibited superior signal/noise levels and limits of detection; and were not affected by variations in sample volume and number of binding sites. When the signal detected measures fractional occupancy, ambient analyte theory is an excellent guide to developing assays with superior performance characteristics. PMID:20152793

  2. Optical Control of Dopamine Receptors Using a Photoswitchable Tethered Inverse Agonist.

    PubMed

    Donthamsetti, Prashant C; Winter, Nils; Schönberger, Matthias; Levitz, Joshua; Stanley, Cherise; Javitch, Jonathan A; Isacoff, Ehud Y; Trauner, Dirk

    2017-12-27

    Family A G protein-coupled receptors (GPCRs) control diverse biological processes and are of great clinical relevance. Their archetype rhodopsin becomes naturally light sensitive by binding covalently to the photoswitchable tethered ligand (PTL) retinal. Other GPCRs, however, neither bind covalently to ligands nor are light sensitive. We sought to impart the logic of rhodopsin to light-insensitive Family A GPCRs in order to enable their remote control in a receptor-specific, cell-type-specific, and spatiotemporally precise manner. Dopamine receptors (DARs) are of particular interest for their roles in motor coordination, appetitive, and aversive behavior, as well as neuropsychiatric disorders such as Parkinson's disease, schizophrenia, mood disorders, and addiction. Using an azobenzene derivative of the well-known DAR ligand 2-(N-phenethyl-N-propyl)amino-5-hydroxytetralin (PPHT), we were able to rapidly, reversibly, and selectively block dopamine D1 and D2 receptors (D1R and D2R) when the PTL was conjugated to an engineered cysteine near the dopamine binding site. Depending on the site of tethering, the ligand behaved as either a photoswitchable tethered neutral antagonist or inverse agonist. Our results indicate that DARs can be chemically engineered for selective remote control by light and provide a template for precision control of Family A GPCRs.

  3. Combined computational and biochemical study reveals the importance of electrostatic interactions between the "pH sensor" and the cation binding site of the sodium/proton antiporter NhaA of Escherichia coli.

    PubMed

    Olkhova, Elena; Kozachkov, Lena; Padan, Etana; Michel, Hartmut

    2009-08-15

    Sodium proton antiporters are essential enzymes that catalyze the exchange of sodium ions for protons across biological membranes. The crystal structure of NhaA has provided a basis to explore the mechanism of ion exchange and its unique regulation by pH. Here, the mechanism of the pH activation of the antiporter is investigated through functional and computational studies of several variants with mutations in the ion-binding site (D163, D164). The most significant difference found computationally between the wild type antiporter and the active site variants, D163E and D164N, are low pK(a) values of Glu78 making them insensitive to pH. Although in the variant D163N the pK(a) of Glu78 is comparable to the physiological one, this variant cannot demonstrate the long-range electrostatic effect of Glu78 on the pH-dependent structural reorganization of trans-membrane helix X and, hence, is proposed to be inactive. In marked contrast, variant D164E remains sensitive to pH and can be activated by alkaline pH shift. Remarkably, as expected computationally and discovered here biochemically, D164E is viable and active in Na(+)/H(+) exchange albeit with increased apparent K(M). Our results unravel the unique electrostatic network of NhaA that connect the coupled clusters of the "pH sensor" with the binding site, which is crucial for pH activation of NhaA. 2009 Wiley-Liss, Inc.

  4. Endothelin induces two types of contractions of rat uterus: phasic contractions by way of voltage-dependent calcium channels and developing contractions through a second type of calcium channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kozuka, M.; Ito, T.; Hirose, S.

    1989-02-28

    Effects of endothelin on nonvascular smooth muscle have been examined using rat uterine horns and two modes of endothelin action have been revealed. Endothelin (0.3 nM) caused rhythmic contractions of isolated uterus in the presence of extracellular calcium. The rhythmic contractions were completely inhibited by calcium channel antagonists. These characteristics of endothelin-induced contractions were very similar to those induced by oxytocin. Binding assays using /sup 125/I-endothelin showed that endothelin and the calcium channel blockers did not compete for the binding sites. However, endothelin was unique in that it caused, in addition to rhythmic contractions, a slowly developing monophasic contraction thatmore » was insensitive to calcium channel blockers. This developing contraction became dominant at higher concentrations of endothelin and was also calcium dependent.« less

  5. Eudicot plant-specific sphingolipids determine host selectivity of microbial NLP cytolysins.

    PubMed

    Lenarčič, Tea; Albert, Isabell; Böhm, Hannah; Hodnik, Vesna; Pirc, Katja; Zavec, Apolonija B; Podobnik, Marjetka; Pahovnik, David; Žagar, Ema; Pruitt, Rory; Greimel, Peter; Yamaji-Hasegawa, Akiko; Kobayashi, Toshihide; Zienkiewicz, Agnieszka; Gömann, Jasmin; Mortimer, Jenny C; Fang, Lin; Mamode-Cassim, Adiilah; Deleu, Magali; Lins, Laurence; Oecking, Claudia; Feussner, Ivo; Mongrand, Sébastien; Anderluh, Gregor; Nürnberger, Thorsten

    2017-12-15

    Necrosis and ethylene-inducing peptide 1-like (NLP) proteins constitute a superfamily of proteins produced by plant pathogenic bacteria, fungi, and oomycetes. Many NLPs are cytotoxins that facilitate microbial infection of eudicot, but not of monocot plants. Here, we report glycosylinositol phosphorylceramide (GIPC) sphingolipids as NLP toxin receptors. Plant mutants with altered GIPC composition were more resistant to NLP toxins. Binding studies and x-ray crystallography showed that NLPs form complexes with terminal monomeric hexose moieties of GIPCs that result in conformational changes within the toxin. Insensitivity to NLP cytolysins of monocot plants may be explained by the length of the GIPC head group and the architecture of the NLP sugar-binding site. We unveil early steps in NLP cytolysin action that determine plant clade-specific toxin selectivity. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  6. The binding of [3H]-propylbenzilylcholine mustard by longitudinal muscle strips from guinea-pig small intestine

    PubMed Central

    Burgen, A.S.V.; Hiley, C.R.; Young, J.M.

    1974-01-01

    1 The synthesis of tritium labelled propylbenzilylcholine mustard ([3H]-PrBCM; N-2′-chloroethyl-N-[2″, 3″-3H2] propyl-2-aminoethyl benzilate) is described. 2 The uptake by muscle strips was measured and shown to be considerably increased by previous immersion of the muscle in distilled water. 3 A considerable part of the uptake is inhibited selectively by atropine, but not by nicotinic antagonists. A number of muscarinic agonists also inhibit uptake and their apparent affinity constants have been determined. 4 The uptake by atropine-sensitive sites is temperature-insensitive, whereas the other sites are temperature-sensitive. Recovery is highly temperature-sensitive and there is good agreement between recovery of sensitivity to agonists and loss of radioactivity from the muscle. PMID:4150888

  7. Novel mutations of the SRD5A2 and AR genes in Thai patients with 46, XY disorders of sex development.

    PubMed

    Ittiwut, Chupong; Pratuangdejkul, Jaturong; Supornsilchai, Vichit; Muensri, Sasipa; Hiranras, Yodporn; Sahakitrungruang, Taninee; Watcharasindhu, Suttipong; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

    2017-01-01

    Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.

  8. Ph-Dependent Inhibition of Voltage-Gated H+ Currents in Rat Alveolar Epithelial Cells by Zn2+ and Other Divalent Cations

    PubMed Central

    Cherny, Vladimir V.; DeCoursey, Thomas E.

    1999-01-01

    Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017

  9. Impaired helix 12 dynamics due to proline 892 substitutions in the androgen receptor are associated with complete androgen insensitivity.

    PubMed

    Elhaji, Youssef A; Stoica, Ileana; Dennis, Sheldon; Purisima, Enrico O; Lumbroso, Rose; Beitel, Lenore K; Trifiro, Mark A

    2006-03-15

    Structural studies of the ligand-binding domain (LBD) of several steroid receptors have revealed that the dynamic properties of the C-terminal helix 12 (H12) are the major determinant of the activation mode of these receptors. H12 exhibits high mobility and different conformations in the absence of ligand. Upon ligand binding, H12 is stabilized in a precise position to seal the ligand-binding pocket and finalize the assembly of the activation function (AF-2) domain. In this study, we investigated the role of the conserved proline 892 of the androgen receptor (AR) in directing the dynamic location and orientation of the AR-H12. We used a combined approach including kinetic and biochemical assays with molecular dynamic simulations to analyze two substitutions (P892A and P892L) identified in individuals with complete androgen insensitivity syndrome. Our analyses revealed distinct mechanisms by which these substitutions impair H12 function resulting in severely defective receptors. The AR-P892A receptor exhibited reduced ligand binding and transactivational potential because of an increased flexibility in H12. The AR-P892L substitution renders the receptor inactive due to a distorted, unstructured and misplaced H12. To confirm the mutants' inability to stabilize H12 in an active position, we have developed a novel in vivo assay to evaluate the accessibility of the H12-docking site on the AR-LBD surface. An extrinsic AR-H12 peptide was able to interact with wild-type and mutant LBDs in the absence of ligand. Ligand-induced proper positioning of the intrinsic H12 of wild-type AR prevented these interactions, whereas the misplacement of the mutants' H12 did not. Proline at this position may be critical for H12 dynamics not only in the AR, but also in other nuclear receptors where this proline is conserved.

  10. Inter-residue coupling contributes to high-affinity subtype-selective binding of α-bungarotoxin to nicotinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sine, Steven M.; Huang, Sun; Li, Shu-Xing

    2013-09-01

    The crystal structure of a pentameric α7 ligand-binding domain chimaera with bound α-btx (α-bungarotoxin) showed that of the five conserved aromatic residues in α7, only Tyr 184 in loop C of the ligand-binding site was required for high-affinity binding. To determine whether the contribution of Tyr 184 depends on local residues, we generated mutations in an α7/5HT 3A (5-hydroxytryptamine type 3A) receptor chimaera, individually and in pairs, and measured 125I-labelled α-btx binding. The results show that mutations of individual residues near Tyr 184 do not affect α-btx affinity, but pairwise mutations decrease affinity in an energetically coupled manner. Kinetic measurementsmore » show that the affinity decreases arise through increases in the α-btx dissociation rate with little change in the association rate. Replacing loop C in α7 with loop C from the α-btx-insensitive α2 or α3 subunits abolishes high-affinity α-btx binding, but preserves acetylcholine-elicited single channel currents. However, in both the α2 and α3 construct, mutating either residue that flanks Tyr 184 to its α7 counterpart restores high-affinity α-btx binding. Analogously, in α7, mutating both residues that flank Tyr 184 to the α2 or α3 counterparts abolishes high-affinity α-btx binding. Thus interaction between Tyr 184 and local residues contributes to high-affinity subtype-selective α-btx binding.« less

  11. Ginseng gintonin activates the human cardiac delayed rectifier K+ channel: involvement of Ca2+/calmodulin binding sites.

    PubMed

    Choi, Sun-Hye; Lee, Byung-Hwan; Kim, Hyeon-Joong; Jung, Seok-Won; Kim, Hyun-Sook; Shin, Ho-Chul; Lee, Jun-Hee; Kim, Hyoung-Chun; Rhim, Hyewhon; Hwang, Sung-Hee; Ha, Tal Soo; Kim, Hyun-Ji; Cho, Hana; Nah, Seung-Yeol

    2014-09-01

    Gintonin, a novel, ginseng-derived G protein-coupled lysophosphatidic acid (LPA) receptor ligand, elicits [Ca(2+)]i transients in neuronal and non-neuronal cells via pertussis toxin-sensitive and pertussis toxin-insensitive G proteins. The slowly activating delayed rectifier K(+) (I(Ks)) channel is a cardiac K(+) channel composed of KCNQ1 and KCNE1 subunits. The C terminus of the KCNQ1 channel protein has two calmodulin-binding sites that are involved in regulating I(Ks) channels. In this study, we investigated the molecular mechanisms of gintonin-mediated activation of human I(Ks) channel activity by expressing human I(Ks) channels in Xenopus oocytes. We found that gintonin enhances IKs channel currents in concentration- and voltage-dependent manners. The EC50 for the I(Ks) channel was 0.05 ± 0.01 μg/ml. Gintonin-mediated activation of the I(Ks) channels was blocked by an LPA1/3 receptor antagonist, an active phospholipase C inhibitor, an IP3 receptor antagonist, and the calcium chelator BAPTA. Gintonin-mediated activation of both the I(Ks) channel was also blocked by the calmodulin (CaM) blocker calmidazolium. Mutations in the KCNQ1 [Ca(2+)]i/CaM-binding IQ motif sites (S373P, W392R, or R539W)blocked the action of gintonin on I(Ks) channel. However, gintonin had no effect on hERG K(+) channel activity. These results show that gintonin-mediated enhancement of I(Ks) channel currents is achieved through binding of the [Ca(2+)]i/CaM complex to the C terminus of KCNQ1 subunit.

  12. Molecular analysis of UAS(E), a cis element containing stress response elements responsible for ethanol induction of the KlADH4 gene of Kluyveromyces lactis.

    PubMed

    Mazzoni, C; Santori, F; Saliola, M; Falcone, C

    2000-01-01

    KlADH4 is a gene of Kluyveromyces lactis encoding a mitochondrial alcohol dehydrogenase activity, which is specifically induced by ethanol and insensitive to glucose repression. In this work, we report the molecular analysis of UAS(E), an element of the KlADH4 promoter which is essential for the induction of KlADH4 in the presence of ethanol. UAS(E) contains five stress response elements (STREs), which have been found in many genes of Saccharomyces cerevisiae involved in the response of cells to conditions of stress. Whereas KlADH4 is not responsive to stress conditions, the STREs present in UAS(E) seem to play a key role in the induction of the gene by ethanol, a situation that has not been observed in the related yeast S. cerevisiae. Gel retardation experiments showed that STREs in the KlADH4 promoter can bind factor(s) under non-inducing conditions. Moreover, we observed that the RAP1 binding site present in UAS(E) binds KlRap1p.

  13. Up-regulation of angiotensin II receptors by in vitro differentiation of murine N1E-115 neuroblastoma cells.

    PubMed

    Reagan, L P; Ye, X H; Mir, R; DePalo, L R; Fluharty, S J

    1990-12-01

    In vitro differentiation of murine neuroblastoma N1E-115 cells induced by low serum (0.5%) and dimethyl sulfoxide (1.5%) increased the uptake of 45Ca2+ as well as basal and forskolin-stimulated adenylate cyclase activity. Associated with these biochemical indices of differentiation was an increase in the density of binding sites for the angiotensin II (Ang II) receptor agonist 125I-[Sar1]-Ang II and the antagonist 125I-[Sar1,Ile8]-Ang II (125I-SARILE). This up-regulation was apparent within 24 hr and was maximal at 72 hr. Other manipulations that independently increased intracellular cAMP or Ca2+ levels produced a qualitatively similar up-regulation of Ang II receptors. In vitro differentiation did not diminish the specificity of these receptors for Ang-II related peptides. Sarcosine-substituted Ang II receptor antagonists such as [Sar1,Gly8]-Ang II, [Sar1,Thr8]-Ang II, or SARILE itself competed for 125I-SARILE in a monophasic fashion, whereas the competition displayed by the agonists Ang II, angiotensin III, and Crinia-Ang II for 125I-SARILE-labeled sites was biphasic, consisting of distinct high and low affinity components. Moreover, in vitro differentiation predominantly increased the density of high affinity sites for angiotensin III and Crinia-Ang II, but the lower affinity site for Ang II, and in all three cases the majority of this increased binding was insensitive to guanine nucleotides. Collectively, these results demonstrate that the expression of Ang II receptors on neuron-like cells is regulated by the biochemical events accompanying differentiation and suggest that the biphasic nature of the binding of some angiotensin agonists may be indicative of multiple receptor subtypes.

  14. Glutamate 90 at the Luminal Ion Gate of Sarcoplasmic Reticulum Ca2+-ATPase Is Critical for Ca2+ Binding on Both Sides of the Membrane*

    PubMed Central

    Clausen, Johannes D.; Andersen, Jens Peter

    2010-01-01

    The roles of Ser72, Glu90, and Lys297 at the luminal ends of transmembrane helices M1, M2, and M4 of sarcoplasmic reticulum Ca2+-ATPase were examined by transient and steady-state kinetic analysis of mutants. The dependence on the luminal Ca2+ concentration of phosphorylation by Pi (“Ca2+ gradient-dependent E2P formation”) showed a reduction of the apparent affinity for luminal Ca2+ in mutants with alanine or leucine replacement of Glu90, whereas arginine replacement of Glu90 or Ser72 allowed E2P formation from Pi even at luminal Ca2+ concentrations much too small to support phosphorylation in wild type. The latter mutants further displayed a blocked dephosphorylation of E2P and an increased rate of conversion of the ADP-sensitive E1P phosphoenzyme intermediate to ADP-insensitive E2P as well as insensitivity of the E2·BeF3− complex to luminal Ca2+. Altogether, these findings, supported by structural modeling, indicate that the E2P intermediate is stabilized in the mutants with arginine replacement of Glu90 or Ser72, because the positive charge of the arginine side chain mimics Ca2+ occupying a luminally exposed low affinity Ca2+ site of E2P, thus identifying an essential locus (a “leaving site”) on the luminal Ca2+ exit pathway. Mutants with alanine or leucine replacement of Glu90 further displayed a marked slowing of the Ca2+ binding transition as well as slowing of the dissociation of Ca2+ from Ca2E1 back toward the cytoplasm, thus demonstrating that Glu90 is also critical for the function of the cytoplasmically exposed Ca2+ sites on the opposite side of the membrane relative to where Glu90 is located. PMID:20421308

  15. Structure of the MazF-mt9 toxin, a tRNA-specific endonuclease from Mycobacterium tuberculosis.

    PubMed

    Chen, Ran; Tu, Jie; Liu, Zhihui; Meng, Fanrong; Ma, Pinyun; Ding, Zhishan; Yang, Chengwen; Chen, Lei; Deng, Xiangyu; Xie, Wei

    2017-05-06

    Tuberculosis (TB) is a severe disease caused by Mycobacterium tuberculosis (M. tb) and the well-characterized M. tb MazE/F proteins play important roles in stress adaptation. Recently, the MazF-mt9 toxin has been found to display endonuclease activities towards tRNAs but the mechanism is unknown. We hereby present the crystal structure of apo-MazF-mt9. The enzyme recognizes tRNA Lys with a central UUU motif within the anticodon loop, but is insensitive to the sequence context outside of the loop. Based on our crystallographic and biochemical studies, we identified key residues for catalysis and proposed the potential tRNA-binding site. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Luteinizing hormone-releasing hormone inactivation by purified pituitary plasma membranes: effects of receptor-binding studies.

    PubMed

    Clayton, R N; Shakespear, R A; Duncan, J A; Marshall, J C

    1979-05-01

    Inactivation of LHRH by purified bovine pituitary plasma membranes was studied in vitro. After incubation of [125I]iodo-LHRH with plasma membranes, the amount of tracer bound to the pellet was measured, and the integrity of the unbound tracer in the supernatant was assessed. Reduction in ability to bind to anti-LHRH serum and to rebind to plasma membranes together with altered electrophoretic mobility on polyacrylamide gels showed that the unbound [125I]iodo-LHRH was inactivated. LHRH inactivation occurred rapidly and was dependent upon membrane concentration and incubation temperature. These results indicate that hormone inactivation must be taken into account in the interpretation of LHRH-receptor interactions. During 37 C incubations, the apparent absence of specific LHRH binding can be explained by inactivation of tracer hormone. Significant LHRH inactivation also occurred at 0 C, which in part explains the insensitivity of LHRH receptor assays. Assessment of LHRH inactivation by different particulate subcellular fractions of pituitary tissue showed that the inactivating enzyme was associated with the plasma membranes; other organelles did not alter LHRH. The enzyme appeared to be an integral part of the plasma membrane structure, since enzymic activity could not be removed by washing without reducing specific LHRH binding. Additionally, reduction of LHRH inactivation by the inhibitors Bacitracin and Trasylol and by magnesium was also accompanied by reduced LHRH binding. Previous studies have shown that the majority of LHRH binding to pituitary plasma membranes is to the low affinity site (approximately 10(-6) M), but the significance of this binding has been uncertain. Our findings indicate that low affinity binding probably represents binding of LHRH to the inactivating enzyme. The LHRH analog, D-Ser6(TBu), des Gly10, ethylamide, has greater biological activity than LHRH and is not inactivated to a significant extent by pituitary plasma membranes. The enhanced biological activity of the analog, therefore, may be due to its resistance to inactivation by enzymes on the pituitary cell surface. The membrane-associated inactivating enzyme could play an important role in vivo in determining the concentration of intact LHRH available at the receptor site which initiates gonadotropin release.

  17. Mechanism underlying selective regulation of G protein-gated inwardly rectifying potassium channels by the psychostimulant-sensitive sorting nexin 27

    PubMed Central

    Balana, Bartosz; Maslennikov, Innokentiy; Kwiatkowski, Witek; Stern, Kalyn M.; Bahima, Laia; Choe, Senyon; Slesinger, Paul A.

    2011-01-01

    G protein-gated inwardly rectifying potassium (GIRK) channels are important gatekeepers of neuronal excitability. The surface expression of neuronal GIRK channels is regulated by the psychostimulant-sensitive sorting nexin 27 (SNX27) protein through a class I (-X-Ser/Thr-X-Φ, where X is any residue and Φ is a hydrophobic amino acid) PDZ-binding interaction. The G protein-insensitive inward rectifier channel (IRK1) contains the same class I PDZ-binding motif but associates with a different synaptic PDZ protein, postsynaptic density protein 95 (PSD95). The mechanism by which SNX27 and PSD95 discriminate these channels was previously unclear. Using high-resolution structures coupled with biochemical and functional analyses, we identified key amino acids upstream of the channel's canonical PDZ-binding motif that associate electrostatically with a unique structural pocket in the SNX27-PDZ domain. Changing specific charged residues in the channel's carboxyl terminus or in the PDZ domain converts the selective association and functional regulation by SNX27. Elucidation of this unique interaction site between ion channels and PDZ-containing proteins could provide a therapeutic target for treating brain diseases. PMID:21422294

  18. Impact of ursodeoxycholic acid on a CCK1R cholesterol-binding site may contribute to its positive effects in digestive function

    PubMed Central

    Desai, Aditya J.; Dong, Maoqing; Harikumar, Kaleeckal G.

    2015-01-01

    Dysfunction of the type 1 cholecystokinin (CCK) receptor (CCK1R) as a result of increased gallbladder muscularis membrane cholesterol has been implicated in the pathogenesis of cholesterol gallstones. Administration of ursodeoxycholic acid, which is structurally related to cholesterol, has been shown to have beneficial effects on gallstone formation. Our aims were to explore the possible direct effects and mechanism of action of bile acids on CCK receptor function. We studied the effects of structurally related hydrophobic chenodeoxycholic acid and hydrophilic ursodeoxycholic acid in vitro on CCK receptor function in the setting of normal and elevated membrane cholesterol. We also examined their effects on a cholesterol-insensitive CCK1R mutant (Y140A) disrupting a key site of cholesterol action. The results show that, similar to the impact of cholesterol on CCK receptors, bile acid effects were limited to CCK1R, with no effects on CCK2R. Chenodeoxycholic acid had a negative impact on CCK1R function, while ursodeoxycholic acid had no effect on CCK1R function in normal membranes but was protective against the negative impact of elevated cholesterol on this receptor. The cholesterol-insensitive CCK1R mutant Y140A was resistant to effects of both bile acids. These data suggest that bile acids compete with the action of cholesterol on CCK1R, probably by interacting at the same site, although the conformational impact of each bile acid appears to be different, with ursodeoxycholic acid capable of correcting the abnormal conformation of CCK1R in a high-cholesterol environment. This mechanism may contribute to the beneficial effect of ursodeoxycholic acid in reducing cholesterol gallstone formation. PMID:26138469

  19. Impact of ursodeoxycholic acid on a CCK1R cholesterol-binding site may contribute to its positive effects in digestive function.

    PubMed

    Desai, Aditya J; Dong, Maoqing; Harikumar, Kaleeckal G; Miller, Laurence J

    2015-09-01

    Dysfunction of the type 1 cholecystokinin (CCK) receptor (CCK1R) as a result of increased gallbladder muscularis membrane cholesterol has been implicated in the pathogenesis of cholesterol gallstones. Administration of ursodeoxycholic acid, which is structurally related to cholesterol, has been shown to have beneficial effects on gallstone formation. Our aims were to explore the possible direct effects and mechanism of action of bile acids on CCK receptor function. We studied the effects of structurally related hydrophobic chenodeoxycholic acid and hydrophilic ursodeoxycholic acid in vitro on CCK receptor function in the setting of normal and elevated membrane cholesterol. We also examined their effects on a cholesterol-insensitive CCK1R mutant (Y140A) disrupting a key site of cholesterol action. The results show that, similar to the impact of cholesterol on CCK receptors, bile acid effects were limited to CCK1R, with no effects on CCK2R. Chenodeoxycholic acid had a negative impact on CCK1R function, while ursodeoxycholic acid had no effect on CCK1R function in normal membranes but was protective against the negative impact of elevated cholesterol on this receptor. The cholesterol-insensitive CCK1R mutant Y140A was resistant to effects of both bile acids. These data suggest that bile acids compete with the action of cholesterol on CCK1R, probably by interacting at the same site, although the conformational impact of each bile acid appears to be different, with ursodeoxycholic acid capable of correcting the abnormal conformation of CCK1R in a high-cholesterol environment. This mechanism may contribute to the beneficial effect of ursodeoxycholic acid in reducing cholesterol gallstone formation. Copyright © 2015 the American Physiological Society.

  20. Heterodimerization with the β1 subunit directs the α2 subunit of nitric oxide-sensitive guanylyl cyclase to calcium-insensitive cell-cell contacts in HEK293 cells: Interaction with Lin7a.

    PubMed

    Hochheiser, Julia; Haase, Tobias; Busker, Mareike; Sömmer, Anne; Kreienkamp, Hans-Jürgen; Behrends, Sönke

    2016-12-15

    Nitric oxide-sensitive guanylyl cyclase is a heterodimeric enzyme consisting of an α and a β subunit. Two different α subunits (α 1 and α 2 ) give rise to two heterodimeric enzymes α 1 /β 1 and α 2 /β 1 . Both coexist in a wide range of tissues including blood vessels and the lung, but expression of the α 2 /β 1 form is generally much lower and approaches levels similar to the α 1 /β 1 form in the brain only. In the present paper, we show that the α 2 /β 1 form interacts with Lin7a in mouse brain synaptosomes based on co-precipitation analysis. In HEK293 cells, we found that the overexpressed α 2 /β 1 form, but not the α 1 /β 1 form is directed to calcium-insensitive cell-cell contacts. The isolated PDZ binding motif of an amino-terminally truncated α 2 subunit was sufficient for cell-cell contact localization. For the full length α 2 subunit with the PDZ binding motif this was only the case in the heterodimer configuration with the β 1 subunit, but not as isolated α 2 subunit. We conclude that the PDZ binding motif of the α 2 subunit is only accessible in the heterodimer conformation of the mature nitric oxide-sensitive enzyme. Interaction with Lin7a, a small scaffold protein important for synaptic function and cell polarity, can direct this complex to nectin based cell-cell contacts via MPP3 in HEK293 cells. We conclude that heterodimerization is a prerequisite for further protein-protein interactions that direct the α 2 /β 1 form to strategic sites of the cell membrane with adjacent neighbouring cells. Drugs increasing the nitric oxide-sensitivity of this specific form may be particularly effective. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. X-Ray Crystal Structure of the Ancestral 3-Ketosteroid Receptor-Progesterone-Mifepristone Complex Shows Mifepristone Bound at the Coactivator Binding Interface

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Colucci, Jennifer K.; Ortlund, Eric A.

    2013-12-12

    Steroid receptors are a subfamily of nuclear receptors found throughout all metazoans. They are highly important in the regulation of development, inflammation, and reproduction and their misregulation has been implicated in hormone insensitivity syndromes and cancer. Steroid binding to SRs drives a conformational change in the ligand binding domain that promotes nuclear localization and subsequent interaction with coregulator proteins to affect gene regulation. SRs are important pharmaceutical targets, yet most SR-targeting drugs have off-target pharmacology leading to unwanted side effects. A better understanding of the structural mechanisms dictating ligand specificity and the evolution of the forces that created the SR-hormonemore » pairs will enable the design of better pharmaceutical ligands. In order to investigate this relationship, we attempted to crystallize the ancestral 3-ketosteroid receptor (ancSR2) with mifepristone, a SR antagonist. Here, we present the x-ray crystal structure of the ancestral 3-keto steroid receptor (ancSR2)-progesterone complex at a resolution of 2.05 Å. This improves upon our previously reported structure of the ancSR2-progesterone complex, permitting unambiguous assignment of the ligand conformation within the binding pocket. Surprisingly, we find mifepristone, fortuitously docked at the protein surface, poised to interfere with coregulator binding. Recent attention has been given to generating pharmaceuticals that block the coregulator binding site in order to obstruct coregulator binding and achieve tissue-specific SR regulation independent of hormone binding. Mifepristone’s interaction with the coactivator cleft of this SR suggests that it may be a useful molecular scaffold for further coactivator binding inhibitor development.« less

  2. Spectroscopic Characterization of a Green Copper Site in a Single-Domain Cupredoxin

    PubMed Central

    Roger, Magali; Biaso, Frédéric; Castelle, Cindy J.; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

    2014-01-01

    Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought. PMID:24932914

  3. Spectroscopic characterization of a green copper site in a single-domain cupredoxin.

    PubMed

    Roger, Magali; Biaso, Frédéric; Castelle, Cindy J; Bauzan, Marielle; Chaspoul, Florence; Lojou, Elisabeth; Sciara, Giuliano; Caffarri, Stefano; Giudici-Orticoni, Marie-Thérèse; Ilbert, Marianne

    2014-01-01

    Cupredoxins are widespread copper-binding proteins, mainly involved in electron transfer pathways. They display a typical rigid greek key motif consisting of an eight stranded β-sandwich. A fascinating feature of cupredoxins is the natural diversity of their copper center geometry. These geometry variations give rise to drastic changes in their color, such as blue, green, red or purple. Based on several spectroscopic and structural analyses, a connection between the geometry of their copper-binding site and their color has been proposed. However, little is known about the relationship between such diversity of copper center geometry in cupredoxins and possible implications for function. This has been difficult to assess, as only a few naturally occurring green and red copper sites have been described so far. We report herein the spectrocopic characterization of a novel kind of single domain cupredoxin of green color, involved in a respiratory pathway of the acidophilic organism Acidithiobacillus ferrooxidans. Biochemical and spectroscopic characterization coupled to bioinformatics analysis reveal the existence of some unusual features for this novel member of the green cupredoxin sub-family. This protein has the highest redox potential reported to date for a green-type cupredoxin. It has a constrained green copper site insensitive to pH or temperature variations. It is a green-type cupredoxin found for the first time in a respiratory pathway. These unique properties might be explained by a region of unknown function never found in other cupredoxins, and by an unusual length of the loop between the second and the fourth copper ligands. These discoveries will impact our knowledge on non-engineered green copper sites, whose involvement in respiratory chains seems more widespread than initially thought.

  4. CARDIAC SULFONYLUREA RECEPTOR SHORT FORM-BASED CHANNELS CONFER A GLIBENCLAMIDE-INSENSITIVE KATP ACTIVITY

    PubMed Central

    Pu, Jie-Lin,; Ye, Bin; Kroboth, Stacie L.; McNally, Elizabeth M.; Makielski, Jonathan C.; Shi, Nian-Qing

    2008-01-01

    The cardiac sarcolemmal ATP-sensitive potassium channel (KATP) consists of a Kir6.2 pore and a SUR2 regulatory subunit, which is an ATP-binding cassette (ABC) transporter. KATP channels have been proposed to play protective roles during ischemic preconditioning. A SUR2 mutant mouse was previously generated by disrupting the first nucleotide-binding domain (NBD1), where a glibenclamide action site was located. In the mutant ventricular myocytes, a non-conventional glibenclamide-insensitive (10 μM), ATP-sensitive current (IKATPn) was detected in 33% of single-channel recordings with an average amplitude of 12.3±5.4 pA per patch, an IC50 to ATP inhibition at 10 μM, and a mean burst duration at 20.6±1.8 ms. Newly designed SUR2-isoform or variant-specific antibodies identified novel SUR2 short forms in the sizes of 28 and 68 kDa in addition to a 150-kDa long form in the sarcolemmal membrane of wild-type (WT) heart. We hypothesized that channels constituted by these short forms that lack NBD1, confer IKATPn. The absence of the long form in the mutant corresponded to loss of the conventional glibenclamide-sensitive KATP currents (IKATP) in isolated cardiomyocytes and vascular smooth muscle cells but the SUR2 short forms remained intact. Nested exonic RT-PCR in the mutant indicated that the short forms lacked NBD1 but contained NBD2. The SUR2 short forms co-immunoprecipitated with Kir6.1 or Kir6.2 suggesting that the short forms may function as hemi-transporters reported in other eukaryotic ABC transporter subgroups. Our results indicate that different KATP compositions may co-exist in cardiac sarcolemmal membrane. PMID:18001767

  5. Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

    PubMed Central

    Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

    1991-01-01

    Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

  6. Identification of a magnesium-dependent NAD(P)(H)-binding domain in the nicotinoprotein methanol dehydrogenase from Bacillus methanolicus.

    PubMed

    Hektor, Harm J; Kloosterman, Harm; Dijkhuizen, Lubbert

    2002-12-06

    The Bacillus methanolicus methanol dehydrogenase (MDH) is a decameric nicotinoprotein alcohol dehydrogenase (family III) with one Zn(2+) ion, one or two Mg(2+) ions, and a tightly bound cofactor NAD(H) per subunit. The Mg(2+) ions are essential for binding of cofactor NAD(H) in MDH. A B. methanolicus activator protein strongly stimulates the relatively low coenzyme NAD(+)-dependent MDH activity, involving hydrolytic removal of the NMN(H) moiety of cofactor NAD(H) (Kloosterman, H., Vrijbloed, J. W., and Dijkhuizen, L. (2002) J. Biol. Chem. 277, 34785-34792). Members of family III of NAD(P)-dependent alcohol dehydrogenases contain three unique, conserved sequence motifs (domains A, B, and C). Domain C is thought to be involved in metal binding, whereas the functions of domains A and B are still unknown. This paper provides evidence that domain A constitutes (part of) a new magnesium-dependent NAD(P)(H)-binding domain. Site-directed mutants D100N and K103R lacked (most of the) bound cofactor NAD(H) and had lost all coenzyme NAD(+)-dependent MDH activity. Also mutants G95A and S97G were both impaired in cofactor NAD(H) binding but retained coenzyme NAD(+)-dependent MDH activity. Mutant G95A displayed a rather low MDH activity, whereas mutant S97G was insensitive to activator protein but displayed "fully activated" MDH reaction rates. The various roles of these amino acid residues in coenzyme and/or cofactor NAD(H) binding in MDH are discussed.

  7. Characterization of the voltage-gated sodium channel of the Asian citrus psyllid, Diaphorina citri.

    PubMed

    Liu, Bin; Coy, Monique R; Wang, Jin-Jun; Stelinski, Lukasz L

    2017-02-01

    The Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important insect pest of citrus. It is the vector of 'Candidatus' Liberibacter asiaticus, a phloem-limited bacterium that infects citrus, resulting in the disease Huanglongbing (HLB). Disease management relies heavily on suppression of D. citri populations with insecticides, including pyrethroids. In recent annual surveys to monitor insecticide resistance, reduced susceptibility to fenpropathrin was identified in several field populations of D. citri. The primary target of pyrethroids is the voltage-gated sodium channel (VGSC). The VGSC is prone to target-site insensitivity because of mutations that either reduce pyrethroid binding and/or alter gating kinetics. These mutations, known as knockdown resistance or kdr, have been reported in a wide diversity of arthropod species. Alternative splicing, in combination with kdr mutations, has been also associated with reduced pyrethroid efficacy. Here we report the molecular characterization of the VGSC in D. citri along with a survey of alternative splicing across developmental stages of this species. Previous studies demonstrated that D. citri has an exquisite enzymatic arsenal to detoxify insecticides resulting in reduced efficacy. The results from the current investigation demonstrate that target-site insensitivity is also a potential basis for insecticide resistance to pyrethroids in D. citri. The VGSC sequence and its molecular characterization should facilitate early elucidation of the underlying cause of an established case of resistance to pyrethroids. This is the first characterization of a VGSC from a hemipteran to this level of detail, with the majority of the previous studies on dipterans and lepidopterans. © 2015 Institute of Zoology, Chinese Academy of Sciences.

  8. Impact of linker and conjugation chemistry on antigen binding, Fc receptor binding and thermal stability of model antibody-drug conjugates

    PubMed Central

    Acchione, Mauro; Kwon, Hyewon; Jochheim, Claudia M.; Atkins, William M.

    2012-01-01

    Antibody-drug conjugates (ADCs) with biotin as a model cargo tethered to IgG1 mAbs via different linkers and conjugation methods were prepared and tested for thermostability and ability to bind target antigen and Fc receptor. Most conjugates demonstrated decreased thermostability relative to unconjugated antibody, based on DSC, with carbohydrate and amine coupled ADCs showing the least effect compared with thiol coupled conjugates. A strong correlation between biotin-load and loss of stability is observed with thiol conjugation to one IgG scaffold, but the stability of a second IgG scaffold is relatively insensitive to biotin load. The same correlation for amine coupling was less significant. Binding of antibody to antigen and Fc receptor was investigated using surface plasmon resonance. None of the conjugates exhibited altered antigen affinity. Fc receptor FcγIIb (CD32b) interactions were investigated using captured antibody conjugate. Protein G and Protein A, known inhibitors of Fc receptor (FcR) binding to IgG, were also used to extend the analysis of the impact of conjugation on Fc receptor binding. H10NPEG4 was the only conjugate to show significant negative impact to FcR binding, which is likely due to higher biotin-load compared with the other ADCs. The ADC aHISNLC and aHISTPEG8 demonstrated some loss in affinity for FcR, but to much lower extent. The general insensitivity of target binding and effector function of the IgG1 platform to conjugation highlight their utility. The observed changes in thermostability require consideration for the choice of conjugation chemistry, depending on the system being pursued and particular application of the conjugate. PMID:22531451

  9. Characterization of detergent-solubilized sarcoplasmic reticulum Ca2+-ATPase by high-performance liquid chromatography.

    PubMed

    Andersen, J P; Vilsen, B; Nielsen, H; Møller, J V

    1986-10-21

    Sarcoplasmic reticulum Ca2+-ATPase solubilized by the nonionic detergent octaethylene glycol monododecyl ether was studied by molecular sieve high-performance liquid chromatography (HPLC) and analytical ultracentrifugation. Significant irreversible aggregation of soluble Ca2+-ATPase occurred within a few hours in the presence of less than or equal to 50 microM Ca2+. The aggregates were inactive and were primarily held together by hydrophobic forces. In the absence of reducing agent, secondary formation of disulfide bonds occurred. The stability of the inactive dimer upon dilution permitted unambiguous assignment of its elution position and sedimentation coefficient. At high Ca2+ concentration (500 microM), monomeric Ca2+-ATPase was stable for several hours. Reversible self-association induced by variation in protein, detergent, and lipid concentrations was studied by large-zone HPLC. The association constant for dimerization of active Ca2+-ATPase was found to be 10(5)-10(6) M-1 depending on the detergent concentration. More detergent was bound to monomeric than to dimeric Ca2+-ATPase, even above the critical micellar concentration of the detergent. Binding of Ca2+ and vanadate as well as ATP-dependent phosphorylation was studied in monomeric and in reversibly associated dimeric preparations. In both forms, two high-affinity Ca2+ binding sites per phosphorylation site existed. The delipidated monomer purified by HPLC was able to form ADP-insensitive phosphoenzyme and to bind ATP and vanadate simultaneously. These results suggest that formation of Ca2+-ATPase oligomers in the membrane is governed by nonspecific forces (low affinity) and that each polypeptide chain constitutes a functional unit.

  10. GENOTOXIC ACTIVITY OF 1-CHLOROMETHYLPYRENE IN STOMACH EPITHELIUM IN VIVO: INSENSITIVITY OF THE SCINTILLATION UDS ASSAY

    EPA Science Inventory

    An acknowledged weakness of current testing programs for genotoxic hazard has been the potential insensitivity of the established mouse bone ma,-row micronucleus test and rat liver UDS assays to direct-acting or short lived mutagens which may be consumed at the site of initial co...

  11. Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

    1988-05-01

    Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

  12. Evaluation of [11C]metergoline as a PET radiotracer for 5HTR in nonhuman primates

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hooker, J.M.; Hooker, J.M.; Kim, S.W.

    2010-04-20

    Metergoline, a serotonin receptor antagonist, was labeled with carbon-11 in order to evaluate its pharmacokinetics and distribution in non-human primates using positron emission tomography. [{sup 11}C]Metergoline had moderate brain uptake and exhibited heterogeneous specific binding, which was blocked by pretreatment with metergoline and altanserin throughout the cortex. Non-specific binding and insensitivity to changes in synaptic serotonin limit its potential as a PET radiotracer. However, the characterization of [{sup 11}C]metergoline pharmacokinetics and binding in the brain and peripheral organs using PET improves our understanding of metergoline drug pharmacology.

  13. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  14. Analysis by mutagenesis of the ATP binding site of the gamma subunit of skeletal muscle phosphorylase kinase expressed using a baculovirus system.

    PubMed

    Lee, J H; Maeda, S; Angelos, K L; Kamita, S G; Ramachandran, C; Walsh, D A

    1992-11-03

    Active gamma subunit of skeletal muscle phosphorylase kinase has been obtained by expression of the rat soleus cDNA in a baculovirus system. The protein exhibited the expected pH 6.8/8.2 activity ratio of 0.6, and its activity was insensitive to Ca2+ addition, indicating that it was free gamma subunit and not a gamma subunit-calmodulin complex. It was stimulated approximately 2-fold by Ca(2+)-calmodulin addition, demonstrating that it had retained high-affinity calmodulin binding. By site-directed mutagenesis, we have examined the role of six of the amino acids that constitute the consensus ATP binding site of the protein kinase, which in the gamma subunit is represented by the sequence 26Gly.Arg.Gly.Val.Ser.Ser.Val.Val33. Changes were evaluated by the kinetic determination of the dissociation constants of gamma-ATP, gamma-ADP, gamma-AMP.PCP, and gamma-phosphorylase and the maximum catalytic activity. The mutants Ser26-gamma, Ser29-gamma, Phe30-gamma, and Gly31-gamma each exhibited an essentially identical dissociation constant for gamma subunit phosphorylase, indicating that these mutations had not caused a global alteration in the protein structure but were limited to changes in the nucleotide binding site domain. Substitution of either Val33 (by Gly) or Gly28 (by Ser), two of the most conserved residues in all protein kinases, resulted in enzyme with marginally detectable activity. In noted contrast, the Ser26 mutant, which substituted the first glycine of the consensus glycine trio motif, and which is also very highly conserved, retained at least 25% of the enzymatic activity. The Gly31 substitution, which restored a glycine to a position characteristic for most protein kinases, had little overall effect upon the maximum rate of catalysis. Restoration of Ser30 to the more typical phenylalanine, which is present in most protein kinases, had minimal effect on catalysis. These data provide the first direct evaluation of the roles that different residues play within this consensus glycine trio/valine motif of the protein kinases, which up to now have only been surmised to be of importance because of their conservation. Two unexpected findings are that for one residue that is very conserved (Gly26) there is some flexibility of substitution not apparent from the evolutionary conservation and that a second quite conserved residue in protein kinases (equivalent to Gly at position 31) does not produce a protein optimized for nucleotide binding.

  15. Functional importance of EAK1 tyrosine phosphorylation in vivo

    USDA-ARS?s Scientific Manuscript database

    The plant receptor kinase BRASSINOSTEROID ASSOCIATED KINASE 1 (BAK1) is known as a partner of several ligand-binding leucine-rich repeat receptor kinases, including BRASSINOSTEROID INSENSITIVE 1 (BRI1) and the flagellin receptor FLS2. Autophosphorylation of receptor kinases is recognized to be an i...

  16. Binding and release of brain calcium by low-level electromagnetic fields: A review

    NASA Astrophysics Data System (ADS)

    Adey, W. R.; Bawin, S. M.

    Evidence has accumulated that sensitivity of brain tissue to specific weak oscillating electromagnetic fields occurs in the absence of significant tissue heating (less than 0.1°C). This review focuses on the ‘windowed’ character of sensitivities of calcium binding and electrical activity in brain tissue to low-frequency modulation and intensity characteristics of impressed RF fields. ELF fields decrease calcium efflux from isolated chick and cat cerebral tissue by about 15% only in narrow amplitude and frequency ‘windows,’ between 6 and 20 Hz and between 10 and 100 V/m (approximate tissue gradient, 10-7 V/cm). VHF (147 MHz) and UHF (450 MHz) fields increase calcium efflux from isolated chick brain by about 15% when amplitude modulated between 6 and 20 Hz, but only for incident fields in the vicinity of 1.0 mW/cm2. We have now shown that this increased efflux in response to 16-Hz amplitude-modulated 450-MHz, 0.75-mW/cm2 field exposure is insensitive to variations in calcium concentration from 0 to 4.16 mM in the testing solution but is enhanced by addition of hydrogen ions (0.108 mM 0.1 N HCl) and inhibited in the absence of normal bicarbonate ion levels (2.4 mM). In the presence of lanthanum ions (2.0 mM), which block transmembrane movement of calcium, exposure to these EM fields decreases the 45Ca2 + efflux. Low-frequency gradients may be transduced in a specific class of extracellular binding sites, normally occupied by calcium ions and susceptible to competitive hydrogen ion binding. Transductive coupling may involve coherent charge states between anionic sites on membrane surface glycoproteins, with longrange cooperative interactions triggered by weak extracellular electric fields. Proton ‘tunneling’ may occur at boundaries between coherent and noncoherent charge zones.

  17. Use of Chimeras, Point Mutants, and Molecular Modeling to Map the Antagonist-binding Site of 4,4′,4″,4‴-(Carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic Acid (NF449) at P2X1 Receptors for ATP*

    PubMed Central

    Farmer, Louise K.; Schmid, Ralf; Evans, Richard J.

    2015-01-01

    P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. PMID:25425641

  18. Use of chimeras, point mutants, and molecular modeling to map the antagonist-binding site of 4,4',4″,4‴-(carbonylbis-(imino-5,1,3-benzenetriylbis(carbonylimino)))tetrakisbenzene-1,3-disulfonic acid (NF449) at P2X1 receptors for ATP.

    PubMed

    Farmer, Louise K; Schmid, Ralf; Evans, Richard J

    2015-01-16

    P2X receptor subtype-selective antagonists are promising candidates for treatment of a range of pathophysiological conditions. However, in contrast to high resolution structural understanding of agonist action in the receptors, comparatively little is known about the molecular basis of antagonist binding. We have generated chimeras and point mutations in the extracellular ligand-binding loop of the human P2X1 receptor, which is inhibited by NF449, suramin, and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate, with residues from the rat P2X4 receptor, which is insensitive to these antagonists. There was little or no effect on sensitivity to suramin and pyridoxal-phosphate-6-azophenyl-2,4-disulfonate in chimeric P2X1/4 receptors, indicating that a significant number of residues required for binding of these antagonists are present in the P2X4 receptor. Sensitivity to the P2X1 receptor-selective antagonist NF449 was reduced by ∼60- and ∼135-fold in chimeras replacing the cysteine-rich head, and the dorsal fin region below it in the adjacent subunit, respectively. Point mutants identified the importance of four positively charged residues at the base of the cysteine-rich head and two variant residues in the dorsal fin for high affinity NF449 binding. These six residues were used as the starting area for molecular docking. The four best potential NF449-binding poses were then discriminated by correspondence with the mutagenesis data and an additional mutant to validate the binding of one lobe of NF449 within the core conserved ATP-binding pocket and the other lobes coordinated by positive charge on the cysteine-rich head region and residues in the adjacent dorsal fin. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. The helical structure of DNA facilitates binding

    NASA Astrophysics Data System (ADS)

    Berg, Otto G.; Mahmutovic, Anel; Marklund, Emil; Elf, Johan

    2016-09-01

    The helical structure of DNA imposes constraints on the rate of diffusion-limited protein binding. Here we solve the reaction-diffusion equations for DNA-like geometries and extend with simulations when necessary. We find that the helical structure can make binding to the DNA more than twice as fast compared to a case where DNA would be reactive only along one side. We also find that this rate advantage remains when the contributions from steric constraints and rotational diffusion of the DNA-binding protein are included. Furthermore, we find that the association rate is insensitive to changes in the steric constraints on the DNA in the helix geometry, while it is much more dependent on the steric constraints on the DNA-binding protein. We conclude that the helical structure of DNA facilitates the nonspecific binding of transcription factors and structural DNA-binding proteins in general.

  20. Structural impact of complete CpG methylation within target DNA on specific complex formation of the inducible transcription factor Egr-1.

    PubMed

    Zandarashvili, Levani; White, Mark A; Esadze, Alexandre; Iwahara, Junji

    2015-07-08

    The inducible transcription factor Egr-1 binds specifically to 9-bp target sequences containing two CpG sites that can potentially be methylated at four cytosine bases. Although it appears that complete CpG methylation would make an unfavorable steric clash in the previous crystal structures of the complexes with unmethylated or partially methylated DNA, our affinity data suggest that DNA recognition by Egr-1 is insensitive to CpG methylation. We have determined, at a 1.4-Å resolution, the crystal structure of the Egr-1 zinc-finger complex with completely methylated target DNA. Structural comparison of the three different methylation states reveals why Egr-1 can recognize the target sequences regardless of CpG methylation. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  1. Mechanism of action of the hypnotic zolpidem in vivo

    PubMed Central

    Crestani, Florence; Martin, James R; Möhler, Hanns; Rudolph, Uwe

    2000-01-01

    Zolpidem is a widely used hypnotic agent acting at the GABAA receptor benzodiazepine site. On recombinant receptors, zolpidem displays a high affinity to α1-GABAA receptors, an intermediate affinity to α2- and α3-GABAA receptors and fails to bind to α5-GABAA receptors. However, it is not known which receptor subtype is essential for mediating the sedative-hypnotic action in vivo. Studying α1(H101R) mice, which possess zolpidem-insensitive α1-GABAA receptors, we show that the sedative action of zolpidem is exclusively mediated by α1-GABAA receptors. Similarly, the activity of zolpidem against pentylenetetrazole-induced tonic convulsions is also completely mediated by α1-GABAA receptors. These results establish that the sedative-hypnotic and anticonvulsant activities of zolpidem are due to its action on α1-GABAA receptors and not on α2- or α3-GABAA receptors. PMID:11090095

  2. Lifting DELLA repression of Arabidopsis seed germination by nonproteolytic gibberellin signaling

    USDA-ARS?s Scientific Manuscript database

    DELLA repression of Arabidopsis seed germination can be lifted through the ubiquitin-proteasome pathway and proteolysis-independent GA signaling. GA-binding to the GID1 (GIBBERELLIN-INSENSITIVE DWARF1) GA receptors stimulates GID1-GA-DELLA complex formation which in turn triggers DELLA protein ubiq...

  3. SAPWOOD WATER CONTENT IS INSENSITIVE TO CHANGES IN SOIL MOISTURE

    EPA Science Inventory

    Changes in sapwood water content of large Douglas fir (Pseudotsuga menziesii) trees were measured throughout the year at two sites: a low elevation (600-m) site where precipitation occurs primarily as rain, and a high elevation (1200-m) site that receives significant snowfall. B...

  4. Reconstitution of the Hepatic Asialoglycoprotein Receptor with Phospholipid Vesicles

    NASA Astrophysics Data System (ADS)

    Klausner, Richard D.; Bridges, Kenneth; Tsunoo, Hajime; Blumenthal, Robert; Weinstein, John N.; Ashwell, Gilbert

    1980-09-01

    A solubilized detergent-free preparation of the hepatic binding protein specific for asialoglycoproteins associates spontaneously with small unilamellar lipid vesicles. This process is independent of the phase transition of the lipid and effectively restores the specific binding activity of the receptor protein. The insensitivity of the resulting lipid-protein complex to ionic strength provides evidence for a hydrophobic interaction. There is a perturbation of the lipid phase transition concomitant with addition of the protein. Circular dichroism studies indicate that the protein undergoes a conformational change on association with lipid. Binding of specific ligand produces further physical changes in the receptor as indicated by alterations in the tryptophan fluorescence quenching pattern.

  5. Motor-substrate interactions in mycoplasma motility explains non-Arrhenius temperature dependence.

    PubMed

    Chen, Jing; Neu, John; Miyata, Makoto; Oster, George

    2009-12-02

    Mycoplasmas exhibit a novel, substrate-dependent gliding motility that is driven by approximately 400 "leg" proteins. The legs interact with the substrate and transmit the forces generated by an assembly of ATPase motors. The velocity of the cell increases linearly by nearly 10-fold over a narrow temperature range of 10-40 degrees C. This corresponds to an Arrhenius factor that decreases from approximately 45 k(B)T at 10 degrees C to approximately 10 k(B)T at 40 degrees C. On the other hand, load-velocity curves at different temperatures extrapolate to nearly the same stall force, suggesting a temperature-insensitive force-generation mechanism near stall. In this article, we propose a leg-substrate interaction mechanism that explains the intriguing temperature sensitivity of this motility. The large Arrhenius factor at low temperature comes about from the addition of many smaller energy barriers arising from many substrate-binding sites at the distal end of the leg protein. The Arrhenius dependence attenuates at high temperature due to two factors: 1), the reduced effective multiplicity of energy barriers intrinsic to the multiple-site binding mechanism; and 2), the temperature-sensitive weakly facilitated leg release that curtails the power stroke. The model suggests an explanation for the similar steep, sub-Arrhenius temperature-velocity curves observed in many molecular motors, such as kinesin and myosin, wherein the temperature behavior is dominated not by the catalytic biochemistry, but by the motor-substrate interaction.

  6. Motor-Substrate Interactions in Mycoplasma Motility Explains Non-Arrhenius Temperature Dependence

    PubMed Central

    Chen, Jing; Neu, John; Miyata, Makoto; Oster, George

    2009-01-01

    Abstract Mycoplasmas exhibit a novel, substrate-dependent gliding motility that is driven by ∼400 “leg” proteins. The legs interact with the substrate and transmit the forces generated by an assembly of ATPase motors. The velocity of the cell increases linearly by nearly 10-fold over a narrow temperature range of 10–40°C. This corresponds to an Arrhenius factor that decreases from ∼45 kBT at 10°C to ∼10 kBT at 40°C. On the other hand, load-velocity curves at different temperatures extrapolate to nearly the same stall force, suggesting a temperature-insensitive force-generation mechanism near stall. In this article, we propose a leg-substrate interaction mechanism that explains the intriguing temperature sensitivity of this motility. The large Arrhenius factor at low temperature comes about from the addition of many smaller energy barriers arising from many substrate-binding sites at the distal end of the leg protein. The Arrhenius dependence attenuates at high temperature due to two factors: 1), the reduced effective multiplicity of energy barriers intrinsic to the multiple-site binding mechanism; and 2), the temperature-sensitive weakly facilitated leg release that curtails the power stroke. The model suggests an explanation for the similar steep, sub-Arrhenius temperature-velocity curves observed in many molecular motors, such as kinesin and myosin, wherein the temperature behavior is dominated not by the catalytic biochemistry, but by the motor-substrate interaction. PMID:19948122

  7. Participation of mitochondrial diazepam binding inhibitor receptors in the anticonflict, antineophobic and anticonvulsant action of 2-aryl-3-indoleacetamide and imidazopyridine derivatives.

    PubMed

    Auta, J; Romeo, E; Kozikowski, A; Ma, D; Costa, E; Guidotti, A

    1993-05-01

    The 2-hexyl-indoleacetamide derivative, FGIN-1-27 [N,N-di-n-hexyl-2- (4-fluorophenyl)indole-3-acetamide], and the imidazopyridine derivative, alpidem, both bind with high affinity to glial mitochondrial diazepam binding inhibitor receptors (MDR) and increase mitochondrial steroidogenesis. Although FGIN-1-27 is selective for the MDR, alpidem also binds to the allosteric modulatory site of the gamma-aminobutyric acidA receptor where the benzodiazepines bind. FGIN-1-27 and alpidem, like the neurosteroid 3 alpha,21-dehydroxy-5 alpha-pregnane-20-one (THDOC), clonazepam and zolpidem (the direct allosteric modulators of gamma-aminobutyric acidA receptors) delay the onset of isoniazid and metrazol-induced convulsions. The anti-isoniazid convulsant action of FGIN-1-27 and alpidem, but not that of THDOC, is blocked by PK 11195. In contrast, flumazenil blocked completely the anticonvulsant action of clonazepam and zolpidem and partially blocked that of alpidem, but it did not affect the anticonvulsant action of THDOC and FGIN-1-27. Alpidem, like clonazepam, zolpidem and diazepam, but not THDOC or FGIN-1-27, delay the onset of bicuculline-induced convulsions. In two animal models of anxiety, the neophobic behavior in the elevated plus maze test and the conflict-punishment behavior in the Vogel conflict test, THDOC and FGIN-1-27 elicited anxiolytic-like effects in a manner that is flumazenil insensitive, whereas alpidem elicited a similar anxiolytic effect, but is partially blocked by flumazenil. Whereas PK 11195 blocked the effect of FGIN-1-27 and partially blocked alpidem, it did not affect THDOC in both animal models of anxiety.(ABSTRACT TRUNCATED AT 250 WORDS)

  8. Mechanism and molecular basis for the sodium channel subtype specificity of µ-conopeptide CnIIIC

    PubMed Central

    Markgraf, René; Leipold, Enrico; Schirmeyer, Jana; Paolini-Bertrand, Marianne; Hartley, Oliver; Heinemann, Stefan H

    2012-01-01

    BACKGROUND AND PURPOSE Voltage-gated sodium channels (NaV channels) are key players in the generation and propagation of action potentials, and selective blockade of these channels is a promising strategy for clinically useful suppression of electrical activity. The conotoxin µ-CnIIIC from the cone snail Conus consors exhibits myorelaxing activity in rodents through specific blockade of skeletal muscle (NaV1.4) NaV channels. EXPERIMENTAL APPROACH We investigated the activity of µ-CnIIIC on human NaV channels and characterized its inhibitory mechanism, as well as the molecular basis, for its channel specificity. KEY RESULTS Similar to rat paralogs, human NaV1.4 and NaV1.2 were potently blocked by µ-CnIIIC, the sensitivity of NaV1.7 was intermediate, and NaV1.5 and NaV1.8 were insensitive. Half-channel chimeras revealed that determinants for the insensitivity of NaV1.8 must reside in both the first and second halves of the channel, while those for NaV1.5 are restricted to domains I and II. Furthermore, domain I pore loop affected the total block and therefore harbours the major determinants for the subtype specificity. Domain II pore loop only affected the kinetics of toxin binding and dissociation. Blockade by µ-CnIIIC of NaV1.4 was virtually irreversible but left a residual current of about 5%, reflecting a ‘leaky’ block; therefore, Na+ ions still passed through µ-CnIIIC-occupied NaV1.4 to some extent. TTX was excluded from this binding site but was trapped inside the pore by µ-CnIIIC. CONCLUSION AND IMPLICATIONS Of clinical significance, µ-CnIIIC is a potent and persistent blocker of human skeletal muscle NaV1.4 that does not affect activity of cardiac NaV1.5. PMID:22537004

  9. The influence of the loop between residues 223-235 in beetle luciferase bioluminescence spectra: a solvent gate for the active site of pH-sensitive luciferases.

    PubMed

    Viviani, Vadim R; Silva Neto, Antonio J; Arnoldi, Frederico G C; Barbosa, João A R G; Ohmiya, Yoshihiro

    2008-01-01

    Beetle luciferases emit a wide range of bioluminescence colors, ranging from green to red. Firefly luciferases can shift the spectrum to red in response to pH and temperature changes, whereas click beetle and railroadworm luciferases do not. Despite many studies on firefly luciferases, the origin of pH-sensitivity is far from being understood. Through comparative site-directed mutagenesis and modeling studies, using the pH-sensitive luciferases (Macrolampis and Cratomorphus distinctus fireflies) and the pH-insensitive luciferases (Pyrearinus termitilluminans, Phrixotrix viviani and Phrixotrix hirtus) cloned by our group, here we show that substitutions dramatically affecting bioluminescence colors in both groups of luciferases are clustered in the loop between residues 223-235 (Photinus pyralis sequence). The substitutions at positions 227, 228 and 229 (P. pyralis sequence) cause dramatic redshift and temporal shift in both groups of luciferases, indicating their involvement in labile interactions. Modeling studies showed that the residues Y227 and N229 are buried in the protein core, fixing the loop to other structural elements participating at the bottom of the luciferin binding site. Changes in pH and temperature (in firefly luciferases), as well as point mutations in this loop, may disrupt the interactions of these structural elements exposing the active site and modulating bioluminescence colors.

  10. Interaction of a dinoflagellate neurotoxin with voltage-activated ion channels in a marine diatom.

    PubMed

    Kitchen, Sheila A; Bourdelais, Andrea J; Taylor, Alison R

    2018-01-01

    The potent neurotoxins produced by the harmful algal bloom species Karenia brevis are activators of sodium voltage-gated channels (VGC) in animals, resulting in altered channel kinetics and membrane hyperexcitability. Recent biophysical and genomic evidence supports widespread presence of homologous sodium (Na + ) and calcium (Ca 2+ ) permeable VGCs in unicellular algae, including marine phytoplankton. We therefore hypothesized that VGCs of these phytoplankton may be an allelopathic target for waterborne neurotoxins produced by K. brevis blooms that could lead to ion channel dysfunction and disruption of signaling in a similar manner to animal Na + VGCs. We examined the interaction of brevetoxin-3 (PbTx-3), a K. brevis neurotoxin, with the Na + /Ca 2+ VGC of the non-toxic diatom Odontella sinensi s using electrophysiology. Single electrode current- and voltage- clamp recordings from O. sinensis in the presence of PbTx-3 were used to examine the toxin's effect on voltage gated Na + /Ca 2+ currents. In silico analysis was used to identify the putative PbTx binding site in the diatoms. We identified Na + /Ca 2+ VCG homologs from the transcriptomes and genomes of 12 diatoms, including three transcripts from O. sinensis and aligned them with site-5 of Na + VGCs, previously identified as the PbTx binding site in animals. Up to 1 µM PbTx had no effect on diatom resting membrane potential or membrane excitability. The kinetics of fast inward Na + /Ca 2+ currents that underlie diatom action potentials were also unaffected. However, the peak inward current was inhibited by 33%, delayed outward current was inhibited by 25%, and reversal potential of the currents shifted positive, indicating a change in permeability of the underlying channels. Sequence analysis showed a lack of conservation of the PbTx binding site in diatom VGC homologs, many of which share molecular features more similar to single-domain bacterial Na + /Ca 2+ VGCs than the 4-domain eukaryote channels. Although membrane excitability and the kinetics of action potential currents were unaffected, the permeation of the channels underlying the diatom action potential was significantly altered in the presence of PbTx-3. However, at environmentally relevant concentrations the effects of PbTx- on diatom voltage activated currents and interference of cell signaling through this pathway may be limited. The relative insensitivity of phytoplankton VGCs may be due to divergence of site-5 (the putative PbTx binding site), and in some cases, such as O. sinensis , resistance to toxin effects may be because of evolutionary loss of the 4-domain eukaryote channel, while retaining a single domain bacterial-like VGC that can substitute in the generation of fast action potentials.

  11. The Kinetics of Ouabain Inhibition and the Partition of Rubidium Influx in Human Red Blood Cells

    PubMed Central

    Beauge, L. A.; Adragna, Norma

    1971-01-01

    In the development of ouabain inhibition of rubidium influx in human red blood cells a time lag can be detected which is a function of at least three variables: the concentrations of external sodium, rubidium, and ouabain. The inhibition is antagonized by rubidium and favored by sodium. Similar considerations could be applied to the binding of ouabain to membrane sites. The total influx of rubidium as a function of external rubidium concentration can be separated into two components: (a) a linear uptake not affected by external sodium or ouabain and not requiring an energy supply, and (b) a saturable component. The latter component, on the basis of the different effects of the aforementioned factors, can be divided into three fractions. The first is ouabain-sensitive, inhibited by external sodium at low rubidium, and requires an energy supply; this represents about 70–80% of the total uptake and is related to the active sodium extrusion mechanism. The second is ouabain-insensitive, activated by external sodium over the entire range of rubidium concentrations studied, and dependent on internal ATP; this represents about 15% of the total influx; it could be coupled to an active sodium extrusion or belong to a rubidium-potassium exchange. The third, which can be called residual influx, is ouabain-insensitive, unaffected by external sodium, and independent of internal ATP; this represents about 10–20% of the total influx. PMID:5553102

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allen, I.S.; Gaa, S.T.; Rogers, T.B.

    The muscarinic cholinergic agonist, carbachol, and pertussis toxin were used to examine the functional status of the guanine nucleotide-binding protein that inhibits adenylate cyclase (G{sub i}) in cultured neonatal rat heart myocytes. The isoproterenol stimulation of adenylate cyclase activity in myocyte membranes and adenosine 3{prime},5{prime}-cyclic monophosphate (cAMP) accumulation in intact cells (4 days in culture) were insensitive to carbachol. However, in cells cultured for 11 days, carbachol inhibited isoproterenol-stimulated cAMP accumulation by 30%. Angiotensin II (ANG II) was also found to inhibit isoproterenol-stimulated cAMP accumulation in day 11 cells in a dose-dependent manner. Pertussis toxin treatment reversed the inhibitory effectsmore » of both ANG II and carbachol, suggesting a role for G{sub i} in the process. Carbachol binding to membranes from day 4 cells was relatively insensitive to guanine nucleotides when compared with binding to membranes from day 11 or adult cells. Furthermore, pertussis toxin-mediated {sup 32}P incorporation into a 39- to 41-kDa substrate in day 11 membranes was increased 3.2-fold over that measured in day 4 membranes. These findings support the view that, although G{sub i} is expressed, it is nonfunctional in 4-day-old cultured neonatal rat heart myocytes and acquisition of functional G{sub i} is dependent on culture conditions. Furthermore, the ANG II receptor can couple to G{sub i} in heart.« less

  13. Integration of G protein α (Gα) signaling by the regulator of G protein signaling 14 (RGS14).

    PubMed

    Brown, Nicole E; Goswami, Devrishi; Branch, Mary Rose; Ramineni, Suneela; Ortlund, Eric A; Griffin, Patrick R; Hepler, John R

    2015-04-03

    RGS14 contains distinct binding sites for both active (GTP-bound) and inactive (GDP-bound) forms of Gα subunits. The N-terminal regulator of G protein signaling (RGS) domain binds active Gαi/o-GTP, whereas the C-terminal G protein regulatory (GPR) motif binds inactive Gαi1/3-GDP. The molecular basis for how RGS14 binds different activation states of Gα proteins to integrate G protein signaling is unknown. Here we explored the intramolecular communication between the GPR motif and the RGS domain upon G protein binding and examined whether RGS14 can functionally interact with two distinct forms of Gα subunits simultaneously. Using complementary cellular and biochemical approaches, we demonstrate that RGS14 forms a stable complex with inactive Gαi1-GDP at the plasma membrane and that free cytosolic RGS14 is recruited to the plasma membrane by activated Gαo-AlF4(-). Bioluminescence resonance energy transfer studies showed that RGS14 adopts different conformations in live cells when bound to Gα in different activation states. Hydrogen/deuterium exchange mass spectrometry revealed that RGS14 is a very dynamic protein that undergoes allosteric conformational changes when inactive Gαi1-GDP binds the GPR motif. Pure RGS14 forms a ternary complex with Gαo-AlF4(-) and an AlF4(-)-insensitive mutant (G42R) of Gαi1-GDP, as observed by size exclusion chromatography and differential hydrogen/deuterium exchange. Finally, a preformed RGS14·Gαi1-GDP complex exhibits full capacity to stimulate the GTPase activity of Gαo-GTP, demonstrating that RGS14 can functionally engage two distinct forms of Gα subunits simultaneously. Based on these findings, we propose a working model for how RGS14 integrates multiple G protein signals in host CA2 hippocampal neurons to modulate synaptic plasticity. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Sulfonylureas suppress the stimulatory action of Mg-nucleotides on Kir6.2/SUR1 but not Kir6.2/SUR2A KATP channels: a mechanistic study.

    PubMed

    Proks, Peter; de Wet, Heidi; Ashcroft, Frances M

    2014-11-01

    Sulfonylureas, which stimulate insulin secretion from pancreatic β-cells, are widely used to treat both type 2 diabetes and neonatal diabetes. These drugs mediate their effects by binding to the sulfonylurea receptor subunit (SUR) of the ATP-sensitive K(+) (KATP) channel and inducing channel closure. The mechanism of channel inhibition is unusually complex. First, sulfonylureas act as partial antagonists of channel activity, and second, their effect is modulated by MgADP. We analyzed the molecular basis of the interactions between the sulfonylurea gliclazide and Mg-nucleotides on β-cell and cardiac types of KATP channel (Kir6.2/SUR1 and Kir6.2/SUR2A, respectively) heterologously expressed in Xenopus laevis oocytes. The SUR2A-Y1206S mutation was used to confer gliclazide sensitivity on SUR2A. We found that both MgATP and MgADP increased gliclazide inhibition of Kir6.2/SUR1 channels and reduced inhibition of Kir6.2/SUR2A-Y1206S. The latter effect can be attributed to stabilization of the cardiac channel open state by Mg-nucleotides. Using a Kir6.2 mutation that renders the KATP channel insensitive to nucleotide inhibition (Kir6.2-G334D), we showed that gliclazide abolishes the stimulatory effects of MgADP and MgATP on β-cell KATP channels. Detailed analysis suggests that the drug both reduces nucleotide binding to SUR1 and impairs the efficacy with which nucleotide binding is translated into pore opening. Mutation of one (or both) of the Walker A lysines in the catalytic site of the nucleotide-binding domains of SUR1 may have a similar effect to gliclazide on MgADP binding and transduction, but it does not appear to impair MgATP binding. Our results have implications for the therapeutic use of sulfonylureas. © 2014 Proks et al.

  15. Glycine aggravates ischemia reperfusion-induced acute kidney injury through N-Methyl-D-Aspartate receptor activation in rats.

    PubMed

    Arora, Shiyana; Kaur, Tajpreet; Kaur, Anudeep; Singh, Amrit Pal

    2014-08-01

    The present study was designed to investigate the role of glycine in ischemia reperfusion-induced acute kidney injury (AKI) in rats. The AKI was induced in rats by occluding renal pedicles for 40 min followed by reperfusion for 24 h. The AKI was assessed by measuring creatinine clearance, blood urea nitrogen, plasma uric acid, potassium, fractional excretion of sodium, and microproteinuria. The oxidative stress in renal tissues was assessed by quantification of myeloperoxidase activity, thiobarbituric acid-reactive substances, superoxide anion generation, and reduced glutathione level. Glycine (100, 200, and 400 mg/kg, i.p.) was administered to rats 30 min before subjecting to AKI. The glycinergic receptor blocker, strychnine (0.75 mg/kg i.p.), and glycine-binding site blocker at N-methyl-D-aspartate (NMDA) receptor, kynurenic acid (300 and 600 mg/kg i.p.), were used in the present study. The ischemia reperfusion induced AKI as witnessed by significant change in plasma, urinary, and tissue parameters employed in the present study. Glycine treatment increased ischemia reperfusion-induced AKI. The treatment with strychnine did not show any protection, whereas kynurenic acid ameliorated renal ischemia reperfusion-induced AKI. The results obtained in present study suggest that glycine increases ischemia reperfusion-induced renal damage through NMDA receptor agonism rather than strychnine-sensitive glycinergic receptors. Hence, it is concluded that glycine aggravates ischemia reperfusion-induced AKI. In addition, the activation of strychnine-insensitive glycine-binding site of NMDA receptors is responsible for its renal-damaging effect rather than strychnine-sensitive glycinergic receptors.

  16. Central Ghrelin Resistance Permits the Overconsolidation of Fear Memory.

    PubMed

    Harmatz, Elia S; Stone, Lauren; Lim, Seh Hong; Lee, Graham; McGrath, Anna; Gisabella, Barbara; Peng, Xiaoyu; Kosoy, Eliza; Yao, Junmei; Liu, Elizabeth; Machado, Nuno J; Weiner, Veronica S; Slocum, Warren; Cunha, Rodrigo A; Goosens, Ki A

    2017-06-15

    There are many contradictory findings about the role of the hormone ghrelin in aversive processing, with studies suggesting that ghrelin signaling can both inhibit and enhance aversion. Here, we characterize and reconcile the paradoxical role of ghrelin in the acquisition of fearful memories. We used enzyme-linked immunosorbent assay to measure endogenous acyl-ghrelin and corticosterone at time points surrounding auditory fear learning. We used pharmacological (systemic and intra-amygdala) manipulations of ghrelin signaling and examined several aversive and appetitive behaviors. We also used biotin-labeled ghrelin to visualize ghrelin binding sites in coronal brain sections of amygdala. All work was performed in rats. In unstressed rodents, endogenous peripheral acyl-ghrelin robustly inhibits fear memory consolidation through actions in the amygdala and accounts for virtually all interindividual variability in long-term fear memory strength. Higher levels of endogenous ghrelin after fear learning were associated with weaker long-term fear memories, and pharmacological agonism of the ghrelin receptor during the memory consolidation period reduced fear memory strength. These fear-inhibitory effects cannot be explained by changes in appetitive behavior. In contrast, we show that chronic stress, which increases both circulating endogenous acyl-ghrelin and fear memory formation, promotes profound loss of ghrelin binding sites in the amygdala and behavioral insensitivity to ghrelin receptor agonism. These studies provide a new link between stress, a novel type of metabolic resistance, and vulnerability to excessive fear memory formation and reveal that ghrelin can regulate negative emotionality in unstressed animals without altering appetite. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  17. Probing the Arabidopsis Flagellin Receptor: FLS2-FLS2 Association and the Contributions of Specific Domains to Signaling Function[W][OA

    PubMed Central

    Sun, Wenxian; Cao, Yangrong; Jansen Labby, Kristin; Bittel, Pascal; Boller, Thomas; Bent, Andrew F.

    2012-01-01

    FLAGELLIN SENSING2 (FLS2) is a transmembrane receptor kinase that activates antimicrobial defense responses upon binding of bacterial flagellin or the flagellin-derived peptide flg22. We find that some Arabidopsis thaliana FLS2 is present in FLS2-FLS2 complexes before and after plant exposure to flg22. flg22 binding capability is not required for FLS2-FLS2 association. Cys pairs flank the extracellular leucine rich repeat (LRR) domain in FLS2 and many other LRR receptors, and we find that the Cys pair N-terminal to the FLS2 LRR is required for normal processing, stability, and function, possibly due to undescribed endoplasmic reticulum quality control mechanisms. By contrast, disruption of the membrane-proximal Cys pair does not block FLS2 function, instead increasing responsiveness to flg22, as indicated by a stronger oxidative burst. There was no evidence for intermolecular FLS2-FLS2 disulfide bridges. Truncated FLS2 containing only the intracellular domain associates with full-length FLS2 and exerts a dominant-negative effect on wild-type FLS2 function that is dependent on expression level but independent of the protein kinase capacity of the truncated protein. FLS2 is insensitive to disruption of multiple N-glycosylation sites, in contrast with the related receptor EF-Tu RECEPTOR that can be rendered nonfunctional by disruption of single glycosylation sites. These and additional findings more precisely define the molecular mechanisms of FLS2 receptor function. PMID:22388452

  18. GZ-793A, a lobelane analog, interacts with the vesicular monoamine transporter-2 to inhibit the effect of methamphetamine

    PubMed Central

    Horton, David B.; Nickell, Justin R.; Zheng, Guangrong; Crooks, Peter A.; Dwoskin, Linda P.

    2013-01-01

    GZ-793A inhibits methamphetamine-evoked dopamine release from striatal slices and methamphetamine self-administration in rats. GZ-793A potently and selectively inhibits dopamine uptake at the vesicular monoamine transporter-2 (VMAT2). The present study determined GZ-793A’s ability to evoke [3H]dopamine release and inhibit methamphetamine-evoked [3H]dopamine release from isolated striatal synaptic vesicles. Results show GZ-793A concentration-dependent [3H]dopamine release; nonlinear regression revealed a two-site model of interaction with VMAT2 (High- and Low-EC50 = 15.5 nM and 29.3 µM, respectively). Tetrabenazine and reserpine completely inhibited the GZ-793A-evoked [3H]dopamine release, however, only at the High-affinity site. Low concentrations of GZ-793A that interact with the extravesicular dopamine uptake site and the High-affinity intravesicular DA release site also inhibited methamphetamine-evoked [3H]dopamine release from synaptic vesicles. A rightward shift in the methamphetamine concentration-response was evident with increasing concentrations of GZ-793A, and the Schild regression slope was 0.49±0.08, consistent with surmountable allosteric inhibition. These results support a hypothetical model of GZ-793A interaction at more than one site on VMAT2 protein, which explains its potent inhibition of dopamine uptake, dopamine release via a High-affinity tetrabenazine- and reserpine-sensitive site, dopamine release via a Low-affinity tetrabenazine- and reserpine-insensitive site, and low-affinity interaction with the dihydrotetrabenazine binding site on VMAT2. GZ-793A-inhibition of the effects of methamphetamine supports its potential as a therapeutic agent for the treatment of methamphetamine abuse. PMID:23875622

  19. Pharmacokinetics and pharmacodynamics of the proton pump inhibitors.

    PubMed

    Shin, Jai Moo; Kim, Nayoung

    2013-01-01

    Proton pump inhibitor (PPI) is a prodrug which is activated by acid. Activated PPI binds covalently to the gastric H(+), K(+)-ATPase via disulfide bond. Cys813 is the primary site responsible for the inhibition of acid pump enzyme, where PPIs bind. Omeprazole was the first PPI introduced in market, followed by pantoprazole, lansoprazole and rabeprazole. Though these PPIs share the core structures benzimidazole and pyridine, their pharmacokinetics and pharmacodynamics are a little different. Several factors must be considered in understanding the pharmacodynamics of PPIs, including: accumulation of PPI in the parietal cell, the proportion of the pump enzyme located at the canaliculus, de novo synthesis of new pump enzyme, metabolism of PPI, amounts of covalent binding of PPI in the parietal cell, and the stability of PPI binding. PPIs have about 1hour of elimination half-life. Area under the plasmic concentration curve and the intragastric pH profile are very good indicators for evaluating PPI efficacy. Though CYP2C19 and CYP3A4 polymorphism are major components of PPI metabolism, the pharmacokinetics and pharmacodynamics of racemic mixture of PPIs depend on the CYP2C19 genotype status. S-omeprazole is relatively insensitive to CYP2C19, so better control of the intragastric pH is achieved. Similarly, R-lansoprazole was developed in order to increase the drug activity. Delayed-release formulation resulted in a longer duration of effective concentration of R-lansoprazole in blood, in addition to metabolic advantage. Thus, dexlansoprazole showed best control of the intragastric pH among the present PPIs. Overall, PPIs made significant progress in the management of acid-related diseases and improved health-related quality of life.

  20. ProTx-II, a selective inhibitor of NaV1.7 sodium channels, blocks action potential propagation in nociceptors.

    PubMed

    Schmalhofer, William A; Calhoun, Jeffrey; Burrows, Rachel; Bailey, Timothy; Kohler, Martin G; Weinglass, Adam B; Kaczorowski, Gregory J; Garcia, Maria L; Koltzenburg, Martin; Priest, Birgit T

    2008-11-01

    Voltage-gated sodium (Na(V)1) channels play a critical role in modulating the excitability of sensory neurons, and human genetic evidence points to Na(V)1.7 as an essential contributor to pain signaling. Human loss-of-function mutations in SCN9A, the gene encoding Na(V)1.7, cause channelopathy-associated indifference to pain (CIP), whereas gain-of-function mutations are associated with two inherited painful neuropathies. Although the human genetic data make Na(V)1.7 an attractive target for the development of analgesics, pharmacological proof-of-concept in experimental pain models requires Na(V)1.7-selective channel blockers. Here, we show that the tarantula venom peptide ProTx-II selectively interacts with Na(V)1.7 channels, inhibiting Na(V)1.7 with an IC(50) value of 0.3 nM, compared with IC(50) values of 30 to 150 nM for other heterologously expressed Na(V)1 subtypes. This subtype selectivity was abolished by a point mutation in DIIS3. It is interesting that application of ProTx-II to desheathed cutaneous nerves completely blocked the C-fiber compound action potential at concentrations that had little effect on Abeta-fiber conduction. ProTx-II application had little effect on action potential propagation of the intact nerve, which may explain why ProTx-II was not efficacious in rodent models of acute and inflammatory pain. Mono-iodo-ProTx-II ((125)I-ProTx-II) binds with high affinity (K(d) = 0.3 nM) to recombinant hNa(V)1.7 channels. Binding of (125)I-ProTx-II is insensitive to the presence of other well characterized Na(V)1 channel modulators, suggesting that ProTx-II binds to a novel site, which may be more conducive to conferring subtype selectivity than the site occupied by traditional local anesthetics and anticonvulsants. Thus, the (125)I-ProTx-II binding assay, described here, offers a new tool in the search for novel Na(V)1.7-selective blockers.

  1. Single Residue Mutation in Active Site of Serine Acetyltransferase Isoform 3 from Entamoeba histolytica Assists in Partial Regaining of Feedback Inhibition by Cysteine

    PubMed Central

    Kumar, Sudhir; Mazumder, Mohit; Dharavath, Sudhaker; Gourinath, S.

    2013-01-01

    The cysteine biosynthetic pathway is essential for survival of the protist pathogen Entamoeba histolytica, and functions by producing cysteine for countering oxidative attack during infection in human hosts. Serine acetyltransferase (SAT) and O-acetylserine sulfhydrylase (OASS) are involved in cysteine biosynthesis and are present in three isoforms each. While EhSAT1 and EhSAT2 are feedback inhibited by end product cysteine, EhSAT3 is nearly insensitive to such inhibition. The active site residues of EhSAT1 and of EhSAT3 are identical except for position 208, which is a histidine residue in EhSAT1 and a serine residue in EhSAT3. A combination of comparative modeling, multiple molecular dynamics simulations and free energy calculation studies showed a difference in binding energies of native EhSAT3 and of a S208H-EhSAT3 mutant for cysteine. Mutants have also been generated in vitro, replacing serine with histidine at position 208 in EhSAT3 and replacing histidine 208 with serine in EhSAT1. These mutants showed decreased affinity for substrate serine, as indicated by Km, compared to the native enzymes. Inhibition kinetics in the presence of physiological concentrations of serine show that IC50 of EhSAT1 increases by about 18 folds from 9.59 µM for native to 169.88 µM for H208S-EhSAT1 mutant. Similar measurements with EhSAT3 confirm it to be insensitive to cysteine inhibition while its mutant (S208H-EhSAT3) shows a gain of cysteine inhibition by 36% and the IC50 of 3.5 mM. Histidine 208 appears to be one of the important residues that distinguish the serine substrate from the cysteine inhibitor. PMID:23437075

  2. Crystal structures and mutagenesis of PPP-family ser/thr protein phosphatases elucidate the selectivity of cantharidin and novel norcantharidin-based inhibitors of PP5C.

    PubMed

    Chattopadhyay, Debasish; Swingle, Mark R; Salter, Edward A; Wood, Eric; D'Arcy, Brandon; Zivanov, Catherine; Abney, Kevin; Musiyenko, Alla; Rusin, Scott F; Kettenbach, Arminja; Yet, Larry; Schroeder, Chad E; Golden, Jennifer E; Dunham, Wade H; Gingras, Anne-Claude; Banerjee, Surajit; Forbes, David; Wierzbicki, Andrzej; Honkanen, Richard E

    2016-06-01

    Cantharidin is a natural toxin and an active constituent in a traditional Chinese medicine used to treat tumors. Cantharidin acts as a semi-selective inhibitor of PPP-family ser/thr protein phosphatases. Despite sharing a common catalytic mechanism and marked structural similarity with PP1C, PP2AC and PP5C, human PP4C was found to be insensitive to the inhibitory activity of cantharidin. To explore the molecular basis for this selectivity, we synthesized and tested novel C5/C6-derivatives designed from quantum-based modeling of the interactions revealed in the co-crystal structures of PP5C in complex with cantharidin. Structure-activity relationship studies and analysis of high-resolution (1.25Å) PP5C-inhibitor co-crystal structures reveal close contacts between the inhibitor bridgehead oxygen and both a catalytic metal ion and a non-catalytic phenylalanine residue, the latter of which is substituted by tryptophan in PP4C. Quantum chemistry calculations predicted that steric clashes with the bulkier tryptophan side chain in PP4C would force all cantharidin-based inhibitors into an unfavorable binding mode, disrupting the strong coordination of active site metal ions observed in the PP5C co-crystal structures, thereby rendering PP4C insensitive to the inhibitors. This prediction was confirmed by inhibition studies employing native human PP4C. Mutation of PP5C (F446W) and PP1C (F257W), to mimic the PP4C active site, resulted in markedly suppressed sensitivity to cantharidin. These observations provide insight into the structural basis for the natural selectivity of cantharidin and provide an avenue for PP4C deselection. The novel crystal structures also provide insight into interactions that provide increased selectivity of the C5/C6 modifications for PP5C versus other PPP-family phosphatases. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Fluorescence spectroscopy studies of HEK293 cells expressing DOR-Gi1α fusion protein; the effect of cholesterol depletion.

    PubMed

    Brejchová, Jana; Sýkora, Jan; Dlouhá, Kateřina; Roubalová, Lenka; Ostašov, Pavel; Vošahlíková, Miroslava; Hof, Martin; Svoboda, Petr

    2011-12-01

    Biophysical studies of fluorescence anisotropy of DPH and Laurdan generalized polarization were performed in plasma membranes (PM) isolated from control and cholesterol-depleted HEK293 cells stably expressing pertussis toxin (PTX)-insensitive DOR-Gi1α (Cys351-Ile351) fusion protein. PM isolated from control, PTX-untreated, cells were compared with PM isolated from PTX-treated cells. Results from both types of PM indicated that i) hydrophobic membrane interior was made more accessible to water molecules and more chaotically organized in cholesterol-depleted samples, ii) cholesterol depletion resulted in an overall increase in surface area of membrane, membrane fluidity, and mobility of its constituents. Analysis of DOR-Gi1α coupling in PTX-treated and PTX-untreated cells indicated that cholesterol depletion did not alter the agonist binding site of DOR (Bmax and Kd) but the ability of DOR agonist DADLE to activate G proteins was markedly impaired. In PTX-untreated membranes, EC50 for DADLE-stimulated [35S]GTPγS binding was shifted by one order of magnitude to the right: from 4.3±1.2×10(-9) M to 2.2±1.3×10(-8) M in control and cholesterol-depleted membrane samples, respectively. In PTX-treated membranes, EC50 was shifted from 4.5±1.1×10(-9) M to 2.8±1.4×10(-8) M. In summary, the perturbation of optimum PM organization by cholesterol depletion deteriorates functional coupling of DOR to covalently bound Gi1α as well as endogenously expressed PTX-sensitive G proteins of Gi/Go family while receptor ligand binding site is unchanged. The biophysical state of hydrophobic plasma (cell) membrane interior should be regarded as regulatory factor of DOR-signaling cascade. Copyright © 2011 Elsevier B.V. All rights reserved.

  4. ETHYLENE INSENSITIVE3 and ETHYLENE INSENSITIVE3-LIKE1 repress SALICYLIC ACID INDUCTION DEFICIENT2 expression to negatively regulate plant innate immunity in Arabidopsis.

    PubMed

    Chen, Huamin; Xue, Li; Chintamanani, Satya; Germain, Hugo; Lin, Huiqiong; Cui, Haitao; Cai, Run; Zuo, Jianru; Tang, Xiaoyan; Li, Xin; Guo, Hongwei; Zhou, Jian-Min

    2009-08-01

    Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) trigger plant immunity that forms the first line inducible defenses in plants. The regulatory mechanism of MAMP-triggered immunity, however, is poorly understood. Here, we show that Arabidopsis thaliana transcription factors ETHYLENE INSENSITIVE3 (EIN3) and ETHYLENE INSENSITIVE3-LIKE1 (EIL1), previously known to mediate ethylene signaling, also negatively regulate PAMP-triggered immunity. Plants lacking EIN3 and EIL1 display enhanced PAMP defenses and heightened resistance to Pseudomonas syringae bacteria. Conversely, plants overaccumulating EIN3 are compromised in PAMP defenses and exhibit enhanced disease susceptibility to Pseudomonas syringae. Microarray analysis revealed that EIN3 and EIL1 negatively control PAMP response genes. Further analyses indicated that SALICYLIC ACID INDUCTION DEFICIENT2 (SID2), which encodes isochorismate synthase required for pathogen-induced biosynthesis of salicylic acid (SA), is a key target of EIN3 and EIL1. Consistent with this, the ein3-1 eil1-1 double mutant constitutively accumulates SA in the absence of pathogen attack, and a mutation in SID2 restores normal susceptibility in the ein3 eil1 double mutant. EIN3 can specifically bind SID2 promoter sequence in vitro and in vivo. Taken together, our data provide evidence that EIN3/EIL1 directly target SID2 to downregulate PAMP defenses.

  5. Photopigment quenching is Ca2+ dependent and controls response duration in salamander L-cone photoreceptors

    PubMed Central

    2010-01-01

    The time scale of the photoresponse in photoreceptor cells is set by the slowest of the steps that quench the light-induced activity of the phototransduction cascade. In vertebrate photoreceptor cells, this rate-limiting reaction is thought to be either shutoff of catalytic activity in the photopigment or shutoff of the pigment's effector, the transducin-GTP–phosphodiesterase complex. In suction pipette recordings from isolated salamander L-cones, we found that preventing changes in internal [Ca2+] delayed the recovery of the light response and prolonged the dominant time constant for recovery. Evidence that the Ca2+-sensitive step involved the pigment itself was provided by the observation that removal of Cl− from the pigment's anion-binding site accelerated the dominant time constant for response recovery. Collectively, these observations indicate that in L-cones, unlike amphibian rods where the dominant time constant is insensitive to [Ca2+], pigment quenching rate limits recovery and provides an additional mechanism for modulating the cone response during light adaptation. PMID:20231373

  6. Polyamine/salt-assembled microspheres coated with hyaluronic acid for targeting and pH sensing.

    PubMed

    Zhang, Pan; Yang, Hui; Wang, Guojun; Tong, Weijun; Gao, Changyou

    2016-06-01

    The poly(allylamine hydrochloride)/trisodium citrate aggregates were fabricated and further covalently crosslinked via the coupling reaction of carboxylic sites on trisodium citrate with the amine groups on polyamine, onto which poly-L-lysine and hyaluronic acid were sequentially assembled, forming stable microspheres. The pH sensitive dye and pH insensitive dye were further labeled to enable the microspheres with pH sensing property. Moreover, these microspheres could be specifically targeted to HeLa tumor cells, since hyaluronic acid can specifically recognize and bind to CD44, a receptor overexpressed on many tumor cells. Quantitative pH measurement by confocal laser scanning microscopy demonstrated that the microspheres were internalized into HeLa cells, and accumulated in acidic compartments. By contrast, only a few microspheres were adhered on the NIH 3T3 cells surface. The microspheres with combined pH sensing property and targeting ability can enhance the insight understanding of the targeted drug vehicles trafficking after cellular internalization. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Nuclear Physics Around the Unitarity Limit.

    PubMed

    König, Sebastian; Grießhammer, Harald W; Hammer, H-W; van Kolck, U

    2017-05-19

    We argue that many features of the structure of nuclei emerge from a strictly perturbative expansion around the unitarity limit, where the two-nucleon S waves have bound states at zero energy. In this limit, the gross features of states in the nuclear chart are correlated to only one dimensionful parameter, which is related to the breaking of scale invariance to a discrete scaling symmetry and set by the triton binding energy. Observables are moved to their physical values by small perturbative corrections, much like in descriptions of the fine structure of atomic spectra. We provide evidence in favor of the conjecture that light, and possibly heavier, nuclei are bound weakly enough to be insensitive to the details of the interactions but strongly enough to be insensitive to the exact size of the two-nucleon system.

  8. A missense allele of KARRIKIN-INSENSITIVE2 impairs ligand-binding and downstream signaling in Arabidopsis thaliana.

    PubMed

    Lee, Inhye; Kim, Kuglae; Lee, Sumin; Lee, Seungjun; Hwang, Eunjin; Shin, Kihye; Kim, Dayoung; Choi, Jungki; Choi, Hyunmo; Cha, Jeong Seok; Kim, Hoyoung; Lee, Rin-A; Jeong, Suyeong; Kim, Jeongsik; Kim, Yumi; Nam, Hong Gil; Park, Soon-Ki; Cho, Hyun-Soo; Soh, Moon-Soo

    2018-06-27

    A smoke-derived compound, karrikin (KAR), and an endogenous but as yet unidentified KARRIKIN INSENSITIVE2 (KAI2) ligand (KL) have been identified as chemical cues in higher plants that impact on multiple aspects of growth and development. Genetic screening of light-signaling mutants in Arabidopsis thaliana has identified a mutant designated as ply2 (pleiotropic long hypocotyl2) that has pleiotropic light-response defects. In this study, we used positional cloning to identify the molecular lesion of ply2 as a missense mutation of KAI2/HYPOSENSITIVE TO LIGHT, which causes a single amino acid substitution, Ala219Val. Physiological analysis and genetic epistasis analysis with the KL-signaling components MORE AXILLARY GROWTH2 (MAX2) and SUPPRESSOR OF MAX2 1 suggested that the pleiotropic phenotypes of the ply2 mutant can be ascribed to a defect in KL-signaling. Molecular and biochemical analyses revealed that the mutant KAI2ply2 protein is impaired in its ligand-binding activity. In support of this conclusion, X-ray crystallography studies suggested that the KAI2ply2 mutation not only results in a narrowed entrance gate for the ligand but also alters the structural flexibility of the helical lid domains. We discuss the structural implications of the Ala219 residue with regard to ligand-specific binding and signaling of KAI2, together with potential functions of KL-signaling in the context of the light-regulatory network in Arabidopsis thaliana.

  9. ETHYLENE RESPONSE FACTOR 96 positively regulates Arabidopsis resistance to necrotrophic pathogens by direct binding to GCC elements of jasmonate - and ethylene-responsive defence genes.

    PubMed

    Catinot, Jérémy; Huang, Jing-Bo; Huang, Pin-Yao; Tseng, Min-Yuan; Chen, Ying-Lan; Gu, Shin-Yuan; Lo, Wan-Sheng; Wang, Long-Chi; Chen, Yet-Ran; Zimmerli, Laurent

    2015-12-01

    The ERF (ethylene responsive factor) family is composed of transcription factors (TFs) that are critical for appropriate Arabidopsis thaliana responses to biotic and abiotic stresses. Here we identified and characterized a member of the ERF TF group IX, namely ERF96, that when overexpressed enhances Arabidopsis resistance to necrotrophic pathogens such as the fungus Botrytis cinerea and the bacterium Pectobacterium carotovorum. ERF96 is jasmonate (JA) and ethylene (ET) responsive and ERF96 transcripts accumulation was abolished in JA-insensitive coi1-16 and in ET-insensitive ein2-1 mutants. Protoplast transactivation and electrophoresis mobility shift analyses revealed that ERF96 is an activator of transcription that binds to GCC elements. In addition, ERF96 mainly localized to the nucleus. Microarray analysis coupled to chromatin immunoprecipitation-PCR of Arabidopsis overexpressing ERF96 revealed that ERF96 enhances the expression of the JA/ET defence genes PDF1.2a, PR-3 and PR-4 as well as the TF ORA59 by direct binding to GCC elements present in their promoters. While ERF96-RNAi plants demonstrated wild-type resistance to necrotrophic pathogens, basal PDF1.2 expression levels were reduced in ERF96-silenced plants. This work revealed ERF96 as a key player of the ERF network that positively regulates the Arabidopsis resistance response to necrotrophic pathogens. © 2015 John Wiley & Sons Ltd.

  10. Deletion of the steroid-binding domain of the human androgen receptor gene in one family with complete androgen insensitivity syndrome: Evidence for further genetic heterogeneity in this syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brown, T.R.; Lubahn, D.B.; Wilson, E.M.

    1988-11-01

    The cloning of a cDNA for the human androgen receptor gene has resulted in the availability for cDNA probes that span various parts of the gene, including the entire steroid-binding domain and part of the DNA-binding domain, as well as part of the 5' region of the gene. The radiolabeled probes were used to screen for androgen receptor mutations on Southern blots prepared by restriction endonuclease digestion of genomic DNA from human subjects with complete androgen insensitivity syndrome (AIS). In this investigation, the authors considered only patients presenting complete AIS and with the androgen receptor (-) form as the mostmore » probably subjects to show a gene deletion. One subject from each of six unrelated families with the receptor (-) form of complete AIS and 10 normal subjects were studied. In the 10 normal subjects and in 5 of the 6 patients, identical DNA restriction fragment patterns were observed with EcoRI and BamHI. Analysis of other members of this family confirmed the apparent gene deletion. The data provide direct proof that complete AIS in some families can result from a deletion of the androgen receptor structural gene. However, other families do not demonstrate such a deletion, suggesting that point mutations may also result in the receptor (-) form of complete AIS, adding further to the genetic heterogeneity of this syndrome.« less

  11. A half-century of studies of growth hormone insensitivity/Laron syndrome: A historical perspective.

    PubMed

    Rosenbloom, Arlan L

    2016-06-01

    A growth hormone (GH) dependent substance responsible for sulfate uptake by costal cartilage of hypophysectomized rats, labeled sulfation factor, was reported in 1957. In 1962 the radioimmunoassay for GH was described. The clinical picture of severe GH deficiency but with high serum concentrations of GH was reported in 3 siblings in 1966 and followed by a 1968 report of 22 patients belonging to 14 consanguineous oriental Jewish families in Israel. Defective sulfation factor generation was demonstrated in 15 of these individuals and in a 1971 report; FFA response to IV GH and growth response to GH injections suggested competitive saturation of peripheral tissue receptors by an abnormal GH. However, studies published in 1973 demonstrated normal fractionation of their circulating GH, and normal binding of GH from 22 patients to various antisera used for radioimmunoassay. In 1976, the Israeli investigators reported that circulating GH from 7 patients reacted normally in the recently developed radioreceptor assay for GH. In 1984, using hepatic microsome pellets, they demonstrated that the defect was a failure of GH binding to receptors. Characterization of the human GH receptor (GHR) gene, reported in 1989, included the initial description of a genetic defect of the GHR in 2 of 9 Israeli patients. At about the same time began the identification in Ecuador of what was to become the largest population of GH insensitivity in the world, ~100 individuals, and the only substantial population with a common mutation of the GH receptor. Treatment studies with recombinant IGF-I began in 1990. Growth response was modest compared to that of GH treated GH deficient subjects. The spectrum of GH insensitivity has expanded beyond GH receptor deficiency to include postreceptor abnormalities: IGF-I gene mutation (1996); IGF-I receptor mutation (2003); signal transducer and activator of transcription 5b mutation (2003); and mutation of the GH-dependent acid labile subunit (2004). Rare conditions of GH insensitivity caused by GH receptor and postreceptor abnormalities have provided insights into the processes of growth, body composition, and metabolism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Mitogen-activated protein kinase kinase 1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors sensitize reduced glucocorticoid response mediated by TNF{alpha} in human epidermal keratinocytes (HaCaT)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Onda, Kenji; Nagashima, Masahiro; Kawakubo, Yo

    2006-12-08

    Glucocorticoids (GCs) are essential drugs administered topically or systematically for the treatment of autoimmune skin diseases such as pemphigus. However, a certain proportion of patients does not respond well to GCs. Although studies on the relationship between cytokines and GC insensitivity in local tissues have attracted attention recently, little is known about the underlying mechanism(s) for GC insensitivity in epidermal keratinocytes. Here, we report that tumor necrosis factor (TNF) {alpha} reduces GC-induced transactivation of endogenous genes as well as a reporter plasmid which contains GC responsive element (GRE) in human epidermal keratinocyte cells (HaCaT). The GC insensitivity by TNF{alpha} wasmore » not accompanied by changes in mRNA expressions of GR isoforms ({alpha} or {beta}). However, we observed that mitogen-activated protein kinase kinase-1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors (PD98059 and U0126) significantly sensitized the GC-induced transactivation of anti-inflammatory genes (glucocorticoid-induced leucine zipper (GILZ) and mitogen-activated protein kinase phosphatase (MKP)-1) and FK506 binding protein (FKBP) 51 gene in the presence of TNF{alpha}. Additionally, we observed that TNF{alpha} reduced prednisolone (PSL)-dependent nuclear translocation of GR, which was restored by pre-treatment of MEK-1 inhibitors. This is the first study demonstrating a role of the MEK-1/ERK cascade in TNF{alpha}-mediated GC insensitivity. Our data suggest that overexpression of TNF{alpha} leads to topical GC insensitivity by reducing GR nuclear translocation in keratinocytes, and our findings also suggest that inhibiting the MEK-1/ERK cascade may offer a therapeutic potential for increasing GC efficacy in epidermis where sufficient inflammatory suppression is required.« less

  13. Mitogen-activated protein kinase kinase 1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors sensitize reduced glucocorticoid response mediated by TNFalpha in human epidermal keratinocytes (HaCaT).

    PubMed

    Onda, Kenji; Nagashima, Masahiro; Kawakubo, Yo; Inoue, Shota; Hirano, Toshihiko; Oka, Kitaro

    2006-12-08

    Glucocorticoids (GCs) are essential drugs administered topically or systematically for the treatment of autoimmune skin diseases such as pemphigus. However, a certain proportion of patients does not respond well to GCs. Although studies on the relationship between cytokines and GC insensitivity in local tissues have attracted attention recently, little is known about the underlying mechanism(s) for GC insensitivity in epidermal keratinocytes. Here, we report that tumor necrosis factor (TNF) alpha reduces GC-induced transactivation of endogenous genes as well as a reporter plasmid which contains GC responsive element (GRE) in human epidermal keratinocyte cells (HaCaT). The GC insensitivity by TNFalpha was not accompanied by changes in mRNA expressions of GR isoforms (alpha or beta). However, we observed that mitogen-activated protein kinase kinase-1/extracellular signal-regulated kinase (MEK-1/ERK) inhibitors (PD98059 and U0126) significantly sensitized the GC-induced transactivation of anti-inflammatory genes (glucocorticoid-induced leucine zipper (GILZ) and mitogen-activated protein kinase phosphatase (MKP)-1) and FK506 binding protein (FKBP) 51 gene in the presence of TNFalpha. Additionally, we observed that TNFalpha reduced prednisolone (PSL)-dependent nuclear translocation of GR, which was restored by pre-treatment of MEK-1 inhibitors. This is the first study demonstrating a role of the MEK-1/ERK cascade in TNFalpha-mediated GC insensitivity. Our data suggest that overexpression of TNFalpha leads to topical GC insensitivity by reducing GR nuclear translocation in keratinocytes, and our findings also suggest that inhibiting the MEK-1/ERK cascade may offer a therapeutic potential for increasing GC efficacy in epidermis where sufficient inflammatory suppression is required.

  14. Isolation, Characterization and Lipid-Binding Properties of the Recalcitrant FtsA Division Protein from Escherichia coli

    PubMed Central

    Zorrilla, Silvia; Reija, Belén; Alfonso, Carlos; Mingorance, Jesús; Rivas, Germán; Jiménez, Mercedes

    2012-01-01

    We have obtained milligram amounts of highly pure Escherichia coli division protein FtsA from inclusion bodies with an optimized purification method that, by overcoming the reluctance of FtsA to be purified, surmounts a bottleneck for the analysis of the molecular basis of FtsA function. Purified FtsA is folded, mostly monomeric and interacts with lipids. The apparent affinity of FtsA binding to the inner membrane is ten-fold higher than to phospholipids, suggesting that inner membrane proteins could modulate FtsA-membrane interactions. Binding of FtsA to lipids and membranes is insensitive to ionic strength, indicating that a net contribution of hydrophobic interactions is involved in the association of FtsA to lipid/membrane structures. PMID:22761913

  15. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  16. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  17. Decreased Sensitivity to Changes in the Concentration of Metal Ions as the Basis for the Hyperactivity of DtxR(E175K)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D’Aquino, J. Alejandro; Denninger, Andrew R.; Moulin, Aaron G.

    2010-01-12

    The metal-ion-activated diphtheria toxin repressor (DtxR) is responsible for the regulation of virulence and other genes in Corynebacterium diphtheriae. A single point mutation in DtxR, DtxR(E175K), causes this mutant repressor to have a hyperactive phenotype. Mice infected with Mycobacterium tuberculosis transformed with plasmids carrying this mutant gene show reduced signs of the tuberculosis infection. Corynebacterial DtxR is able to complement mycobacterial IdeR and vice versa. To date, an explanation for the hyperactivity of DtxR(E175K) has remained elusive. In an attempt to address this issue, we have solved the first crystal structure of DtxR(E175K) and characterized this mutant using circular dichroism,more » isothermal titration calorimetry, and other biochemical techniques. The results show that although DtxR(E175K) and the wild type have similar secondary structures, DtxR(E175K) gains additional thermostability upon activation with metal ions, which may lead to this mutant requiring a lower concentration of metal ions to reach the same levels of thermostability as the wild-type protein. The E175K mutation causes binding site 1 to retain metal ion bound at all times, which can only be removed by incubation with an ion chelator. The crystal structure of DtxR(E175K) shows an empty binding site 2 without evidence of oxidation of Cys102. The association constant for this low-affinity binding site of DtxR(E175K) obtained from calorimetric titration with Ni(II) is K{sub a} = 7.6 {+-} 0.5 x 10{sup 4}, which is very similar to the reported value for the wild-type repressor, K{sub a} = 6.3 x 10{sup 4}. Both the wild type and DtxR(E175K) require the same amount of metal ion to produce a shift in the electrophoretic mobility shift assay, but unlike the wild type, DtxR(E175K) binding to its cognate DNA [tox promoter-operator (toxPO)] does not require metal-ion supplementation in the running buffer. In the timescale of these experiments, the Mn(II)-DtxR(E175K)-toxPO complex is insensitive to changes in the environmental cation concentrations. In addition to Mn(II), Ni(II), Co(II), Cd(II), and Zn(II) are able to sustain the hyperactive phenotype. These results demonstrate a prominent role of binding site 1 in the activation of DtxR and support the hypothesis that DtxR(E175K) attenuates the expression of virulence due to the decreased ability of the Me(II)-DtxR(E175K)-toxPO complex to dissociate at low concentrations of metal ions.« less

  18. A Quantitative Raman Spectroscopic Signal for Metal–Phosphodiester Interactions in Solution†

    PubMed Central

    Christian, Eric L.; Anderson, Vernon E.; Carey, Paul R.; Harris, Michael E.

    2011-01-01

    Accurate identification and quantification of metal ion–phosphodiester interactions are essential for understanding the role of metal ions as determinants of three-dimensional folding of large RNAs and as cofactors in the active sites of both RNA and protein phosphodiesterases. Accomplishing this goal is difficult due to the dynamic and complex mixture of direct and indirect interactions formed with nucleic acids and other phosphodiesters in solution. To address this issue, Raman spectroscopy has been used to measure changes in bond vibrational energies due to metal interactions. However, the contributions of inner-sphere, H-bonding, and electrostatic interactions to the Raman spectrum of phosphoryl oxygens have not been analyzed quantitatively. Here, we report that all three forms of metal ion interaction result in attenuation of the Raman signal for the symmetric vibration of the nonbridging phosphate oxygens (νsPO2−), while only inner-sphere coordination gives rise to an apparent shift of νsPO2− to higher wavenumbers (νsPO2−M) in solution. Formation of νsPO2−M is shown to be both dependent on metal ion identity and an accurate measure of site-specific metal ion binding. In addition, the spectroscopic parameter reflecting the energetic difference between νsPO2− and νsPO2−M (ΔνM) is largely insensitive to changes in phosphodiester structure but strongly dependent on the absolute electronegativity and hardness of the interacting metal ion. Together, these studies provide strong experimental support for the use of νsPO2−M and ΔνM as general spectroscopic features for the quantitative analysis of metal binding affinity and the identification of metal ions associated with phosphodiesters in solution. PMID:20180599

  19. An interaction map of small-molecule kinase inhibitors with anaplastic lymphoma kinase (ALK) mutants in ALK-positive non-small cell lung cancer.

    PubMed

    Ai, Xinghao; Shen, Shengping; Shen, Lan; Lu, Shun

    2015-05-01

    Human anaplastic lymphoma kinase (ALK) has become a well-established target for the treatment of ALK-positive non-small cell lung cancer (NSCLC). Here, we have profiled seven small-molecule inhibitors, including 2 that are approved drugs, against a panel of clinically relevant mutations in ALK tyrosine kinase (TK) domain, aiming at a comprehensive understanding of molecular mechanism and biological implication underlying inhibitor response to ALK TK mutation. We find that (i) the gatekeeper mutation L1196M causes crizotinib resistance by simultaneously increasing and decreasing the binding affinities of, respectively, ATP and inhibitor to ALK, whereas the secondary mutation C1156Y, which is located far away from the ATP-binding site of ALK TK domain, causes the resistance by inducing marked allosteric effect on the site, (ii) the 2nd and 3rd generation kinase inhibitors exhibit relatively high sensitivity towards ALK mutants as compared to 1st generation inhibitors, (iii) the pan-kinase inhibitor staurosporine is insensitive for most mutations due to its high structural compatibility, and (iv) ATP affinity to ALK is generally reduced upon most clinically relevant mutations. Furthermore, we also identify six novel mutation-inhibitor pairs that are potentially associated with drug resistance. In addition, the G1202R and C1156Y mutations are expected to generally cause resistance for many existing inhibitors, since they can address significant effect on the geometric shape and physicochemical property of ALK active pocket. Copyright © 2015 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  20. Nuclear Physics Around the Unitarity Limit

    DOE PAGES

    König, Sebastian; Grießhammer, Harald W.; Hammer, H. -W.; ...

    2017-05-15

    We argue that many features of the structure of nuclei emerge from a strictly perturbative expansion around the unitarity limit, where the two-nucleon S waves have bound states at zero energy. In this limit, the gross features of states in the nuclear chart are correlated to only one dimensionful parameter, which is related to the breaking of scale invariance to a discrete scaling symmetry and set by the triton binding energy. Observables are moved to their physical values by small perturbative corrections, much like in descriptions of the fine structure of atomic spectra. We provide evidence in favor of themore » conjecture that light, and possibly heavier, nuclei are bound weakly enough to be insensitive to the details of the interactions but strongly enough to be insensitive to the exact size of the two-nucleon system.« less

  1. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  2. Physiological epidermal growth factor concentrations activate high affinity receptors to elicit calcium oscillations.

    PubMed

    Marquèze-Pouey, Béatrice; Mailfert, Sébastien; Rouger, Vincent; Goaillard, Jean-Marc; Marguet, Didier

    2014-01-01

    Signaling mediated by the epidermal growth factor (EGF) is crucial in tissue development, homeostasis and tumorigenesis. EGF is mitogenic at picomolar concentrations and is known to bind its receptor on high affinity binding sites depending of the oligomerization state of the receptor (monomer or dimer). In spite of these observations, the cellular response induced by EGF has been mainly characterized for nanomolar concentrations of the growth factor, and a clear definition of the cellular response to circulating (picomolar) concentrations is still lacking. We investigated Ca2+ signaling, an early event in EGF responses, in response to picomolar doses in COS-7 cells where the monomer/dimer equilibrium is unaltered by the synthesis of exogenous EGFR. Using the fluo5F Ca2+ indicator, we found that picomolar concentrations of EGF induced in 50% of the cells a robust oscillatory Ca2+ signal quantitatively similar to the Ca2+ signal induced by nanomolar concentrations. However, responses to nanomolar and picomolar concentrations differed in their underlying mechanisms as the picomolar EGF response involved essentially plasma membrane Ca2+ channels that are not activated by internal Ca2+ store depletion, while the nanomolar EGF response involved internal Ca2+ release. Moreover, while the picomolar EGF response was modulated by charybdotoxin-sensitive K+ channels, the nanomolar response was insensitive to the blockade of these ion channels.

  3. Modulation of ionotropic glutamate receptor function by vertebrate galectins.

    PubMed

    Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

    2014-05-15

    AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. © 2014 The Authors. The Journal of Physiology © 2014 The Physiological Society.

  4. Modulation of ionotropic glutamate receptor function by vertebrate galectins

    PubMed Central

    Copits, Bryan A; Vernon, Claire G; Sakai, Ryuichi; Swanson, Geoffrey T

    2014-01-01

    AMPA and kainate receptors are glutamate-gated ion channels whose function is known to be altered by a variety of plant oligosaccharide-binding proteins, or lectins, but the physiological relevance of this activity has been uncertain because no lectins with analogous allosteric modulatory effects have been identified in animals. We report here that members of the prototype galectin family, which are β-galactoside-binding lectins, exhibit subunit-specific allosteric modulation of desensitization of recombinant homomeric and heteromeric AMPA and kainate receptors. Galectin modulation of GluK2 kainate receptors was dependent upon complex oligosaccharide processing of N-glycosylation sites in the amino-terminal domain and downstream linker region. The sensitivity of GluA4 AMPA receptors to human galectin-1 could be enhanced by supplementation of culture media with uridine and N-acetylglucosamine (GlcNAc), precursors for the hexosamine pathway that supplies UDP-GlcNAc for synthesis of complex oligosaccharides. Neuronal kainate receptors in dorsal root ganglia were sensitive to galectin modulation, whereas AMPA receptors in cultured hippocampal neurons were insensitive, which could be a reflection of differential N-glycan processing or receptor subunit selectivity. Because glycan content of integral proteins can be modified dynamically, we postulate that physiological or pathological conditions in the CNS could arise in which galectins alter excitatory neurotransmission or neuronal excitability through their actions on AMPA or kainate receptors. PMID:24614744

  5. Stimuli of Sensory-Motor Nerves Terminate Arterial Contractile Effects of Endothelin-1 by CGRP and Dissociation of ET-1/ETA-Receptor Complexes

    PubMed Central

    Meens, Merlijn J. P. M. T.; Compeer, Matthijs G.; Hackeng, Tilman M.; van Zandvoort, Marc A.; Janssen, Ben J. A.; De Mey, Jo G. R.

    2010-01-01

    Background Endothelin-1 (ET-1), a long-acting paracrine mediator, is implicated in cardiovascular diseases but clinical trials with ET-receptor antagonists were not successful in some areas. We tested whether the quasi-irreversible receptor-binding of ET-1 (i) limits reversing effects of the antagonists and (ii) can be selectively dissociated by an endogenous counterbalancing mechanism. Methodology/Principal findings In isolated rat mesenteric resistance arteries, ETA-antagonists, endothelium-derived relaxing factors and synthetic vasodilators transiently reduced contractile effects of ET-1 but did not prevent persistent effects of the peptide. Stimuli of peri-vascular vasodilator sensory-motor nerves such as capsaicin not only reduced but also terminated long-lasting effects of ET-1. This was prevented by CGRP-receptor antagonists and was mimicked by exogenous calcitonin gene-related peptide (CGRP). Using 2-photon laser scanning microscopy in vital intact arteries, capsaicin and CGRP, but not ETA-antagonism, were observed to promote dissociation of pre-existing ET-1/ETA-receptor complexes. Conclusions Irreversible binding and activation of ETA-receptors by ET-1 (i) occur at an antagonist-insensitive site of the receptor and (ii) are selectively terminated by endogenously released CGRP. Hence, natural stimuli of sensory-motor nerves that stimulate release of endogenous CGRP can be considered for therapy of diseases involving ET-1. PMID:20532232

  6. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  7. Partial androgen insensitivity syndrome caused by a deep intronic mutation creating an alternative splice acceptor site of the AR gene.

    PubMed

    Ono, Hiroyuki; Saitsu, Hirotomo; Horikawa, Reiko; Nakashima, Shinichi; Ohkubo, Yumiko; Yanagi, Kumiko; Nakabayashi, Kazuhiko; Fukami, Maki; Fujisawa, Yasuko; Ogata, Tsutomu

    2018-02-02

    Although partial androgen insensitivity syndrome (PAIS) is caused by attenuated responsiveness to androgens, androgen receptor gene (AR) mutations on the coding regions and their splice sites have been identified only in <25% of patients with a diagnosis of PAIS. We performed extensive molecular studies including whole exome sequencing in a Japanese family with PAIS, identifying a deep intronic variant beyond the branch site at intron 6 of AR (NM_000044.4:c.2450-42 G > A). This variant created the splice acceptor motif that was accompanied by pyrimidine-rich sequence and two candidate branch sites. Consistent with this, reverse transcriptase (RT)-PCR experiments for cycloheximide-treated lymphoblastoid cell lines revealed a relatively large amount of aberrant mRNA produced by the newly created splice acceptor site and a relatively small amount of wildtype mRNA produced by the normal splice acceptor site. Furthermore, most of the aberrant mRNA was shown to undergo nonsense mediated decay (NMD) and, if a small amount of aberrant mRNA may have escaped NMD, such mRNA was predicted to generate a truncated AR protein missing some functional domains. These findings imply that the deep intronic mutation creating an alternative splice acceptor site resulted in the production of a relatively small amount of wildtype AR mRNA, leading to PAIS.

  8. Investigational agents for the treatment of growth hormone-insensitivity syndrome.

    PubMed

    Kemp, Stephen F; Thrailkill, Kathryn M

    2006-04-01

    Growth hormone-insensitivity syndrome (GHIS) is usually caused by mutations in the growth hormone receptor. Recombinant IGF-I has been used to treat GHIS either alone (mecasermin) or in combination with IGF-binding protein (IGFBP)-3 (mecasermin rinfabate). IGF-I increases the growth velocity of children with IGF deficiency, which is either as a result of GHIS or an IGF-I gene deletion. Hypoglycaemia has been reported with administration of unbound IGF-I and, in addition, the serum half-life of unbound IGF-I is shorter when administered to patients with GHIS (who have low serum concentrations of its binding protein IGFBP-3) than when administered to normal volunteers or to patients with an IGF-I gene deletion (but normal IGFBP-3 levels). The IGF-I-IGFBP-3 combination was developed to prolong the half-life and counteract the acute adverse events (particularly hypoglycaemia) that are associated with administration of IGF-I. It seems that the IGF-I-IGFBP-3 combination has a longer half-life in patients with GHIS than unbound IGF-I, with fewer reports of adverse events (including hypoglycaemia) when administered to patients with diabetes. There are no studies comparing the efficacy of mecasermin with mecasermin rinfabate; both drugs have been shown to be effective but cannot be differentiated in terms of efficacy.

  9. Redundant and distinct functions of the ABA response loci ABA-INSENSITIVE(ABI)5 and ABRE-BINDING FACTOR (ABF)3.

    PubMed

    Finkelstein, Ruth; Gampala, Srinivas S L; Lynch, Tim J; Thomas, Terry L; Rock, Christopher D

    2005-09-01

    Abscisic acid-responsive gene expression is regulated by numerous transcription factors, including a subgroup of basic leucine zipper factors that bind to the conserved cis-acting sequences known as ABA-responsive elements. Although one of these factors, ABA-insensitive 5 (ABI5), was identified genetically, the paucity of genetic data for the other family members has left it unclear whether they perform unique functions or act redundantly to ABI5 or each other. To test for potential redundancy with ABI5, we identified the family members with most similar effects and interactions in transient expression systems (ABF3 and ABF1), then characterized loss-of-function lines for those loci. The abf1 and abf3 monogenic mutant lines had at most minimal effects on germination or seed-specific gene expression, but the enhanced ABA- and stress-resistance of abf3 abi5 double mutants revealed redundant action of these genes in multiple stress responses of seeds and seedlings. Although ABI5, ABF3, and ABF1 have some overlapping effects, they appear to antagonistically regulate each other's expression at specific stages. Consequently, loss of any one factor may be partially compensated by increased expression of other family members.

  10. Bioluminescence of beetle luciferases with 6'-amino-D-luciferin analogues reveals excited keto-oxyluciferin as the emitter and phenolate/luciferin binding site interactions modulate bioluminescence colors.

    PubMed

    Viviani, Vadim R; Neves, Deimison Rodrigues; Amaral, Danilo Trabuco; Prado, Rogilene A; Matsuhashi, Takuto; Hirano, Takashi

    2014-08-19

    Beetle luciferases produce different bioluminescence colors from green to red using the same d-luciferin substrate. Despite many studies of the mechanisms and structural determinants of bioluminescence colors with firefly luciferases, the identity of the emitters and the specific active site interactions responsible for bioluminescence color modulation remain elusive. To address these questions, we analyzed the bioluminescence spectra with 6'-amino-D-luciferin (aminoluciferin) and its 5,5-dimethyl analogue using a set of recombinant beetle luciferases that naturally elicit different colors and different pH sensitivities (pH-sensitive, Amydetes vivianii λmax=538 nm, Macrolampis sp2 λmax=564 nm; pH-insensitive, Phrixotrix hirtus λmax=623 nm, Phrixotrix vivianii λmax=546 nm, and Pyrearinus termitilluminans λmax=534 nm), a luciferase-like enzyme (Tenebrionidae, Zophobas morio λmax=613 nm), and mutants of C311 (S314). The green-yellow-emitting luciferases display red-shifted bioluminescence spectra with aminoluciferin in relation to those with D-luciferin, whereas the red-emitting luciferases displayed blue-shifted spectra. Bioluminescence spectra with 5,5-dimethylaminoluciferin, in which enolization is blocked, were almost identical to those of aminoluciferin. Fluorescence probing using 2-(4-toluidino)naphthalene-6-sulfonate and inference with aminoluciferin confirm that the luciferin binding site of the red-shifted luciferases is more polar than in the case of the green-yellow-emitting luciferases. Altogether, the results show that the keto form of excited oxyluciferin is the emitter in beetle bioluminescence and that bioluminescence colors are essentially modulated by interactions of the 6'-hydroxy group of oxyluciferin and basic moieties under the influence of the microenvironment polarity of the active site: a strong interaction between a base moiety and oxyluciferin phenol in a hydrophobic microenvironment promotes green-yellow emission, whereas a more polar environment weakens such interaction promoting red shifts. In pH-sensitive luciferases, a pH-mediated switch from a closed hydrophobic conformation to a more open polar conformation promotes the typical red shift.

  11. Mechanisms that limit the light stimulus frequency following through the APB sensitive and insensitive rod Off-pathways

    PubMed Central

    Bai, Xia; Zhu, Junling; Yang, Jinnan; Savoie, Brian T.; Wang, Guo-Yong

    2009-01-01

    In the retina, rod signal pathways process scotopic visual information. Light decrements are mediated by two distinct groups of rod pathways in the dark adapted retina that can be differentiated on the basis of their sensitivity to the glutamate agonist DL-2-amino-4-phosphonobutyric acid (APB). We have found that the APB sensitive and insensitive rod Off-pathways signal different light decrement information: the APB sensitive rod Off-pathway conveys slow and low frequency light signals, whereas the APB insensitive rod Off-pathways mediate fast and high frequency light signals (Wang, 2006). However, the mechanisms which limit the frequency following through the APB sensitive and insensitive rod Off-pathways remain unknown. In the current study, whole-cell patch-clamp recordings were made from ganglion cells in dark and light adapted mouse retina to identify the mechanisms that limit the frequency following through the APB sensitive and insensitive rod Off-pathways. The results showed that the sites from AII amacrine cells to Off cone bipolar cells are the major mechanisms that limit the frequency following through the APB sensitive rod Off-pathway. In the APB insensitive rod Off-pathways, rods themselves limited the frequency following through these pathways. Moreover, ganglion cells were able to follow higher frequencies under photopic conditions than under scotopic conditions. The Off responses followed lower frequencies than On responses under photopic conditions. This finding was observed in cells that yielded On or Off responses only as well as in On-Off cells. PMID:19406212

  12. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  13. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces.

    PubMed

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-09-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design.

  14. Resolution of the diadenosine 5',5"'-P1,P4-tetraphosphate binding subunit from a multiprotein form of HeLa cell DNA polymerase alpha.

    PubMed Central

    Baril, E; Bonin, P; Burstein, D; Mara, K; Zamecnik, P

    1983-01-01

    A diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) binding subunit has been resolved from a high molecular weight (640,000) multiprotein form of DNA polymerase alpha [deoxynucleoside triphosphate:DNA nucleotidyltransferase (DNA-directed), EC 2.7.7.7] from HeLa cells [DNA polymerase alpha 2 of Lamothe, P., Baril, B., Chi, A., Lee, L. & Baril, E. (1981) Proc. Natl. Acad. Sci. USA 78, 4723-4727]. The Ap4A binding activity copurifies with the DNA polymerizing activity during the course of purification. Hydrophobic chromatography on butylagarose resolves the Ap4A binding activity from the DNA polymerase. The Ap4A binding activity is protein in nature since the binding of Ap4A is abolished by treatment of the isolated binding activity with proteinase K but is insensitive to treatment with DNase or RNase. The molecular weight of the Ap4A binding protein, as determined by polyacrylamide gel electrophoresis under nondenaturing conditions or by NaDodSO4/polyacrylamide gel electrophoresis after photoaffinity labeling of the protein with [32P]Ap4A is 92,000 or 47,000. The binding activity of this protein is highly specific for Ap4A. Images PMID:6576366

  15. Structural determinants for antagonist pharmacology that distinguish the rho1 GABAC receptor from GABAA receptors.

    PubMed

    Zhang, Jianliang; Xue, Fenqin; Chang, Yongchang

    2008-10-01

    GABA receptor (GABAR) types C (GABACR) and A (GABAAR) are both GABA-gated chloride channels that are distinguished by their distinct competitive antagonist properties. The structural mechanism underlying these distinct properties is not well understood. In this study, using previously identified binding residues as a guide, we made individual or combined mutations of nine binding residues in the rho1 GABACR subunit to their counterparts in the alpha1beta2gamma2 GABAAR or reverse mutations in alpha1 or beta2 subunits. The mutants were expressed in Xenopus laevis oocytes and tested for sensitivities of GABA-induced currents to the GABAA and GABAC receptor antagonists. The results revealed that bicuculline insensitivity of the rho1 GABACR was mainly determined by Tyr106, Phe138 and Phe240 residues. Gabazine insensitivity of the rho1 GABACR was highly dependent on Tyr102, Tyr106, and Phe138. The sensitivity of the rho1 GABACR to 3-aminopropyl-phosphonic acid and its analog 3-aminopropyl-(methyl)phosphinic acid mainly depended on residues Tyr102, Val140, FYS240-242, and Phe138. Thus, the residues Tyr102, Tyr106, Phe138, and Phe240 in the rho1 GABACR are major determinants for its antagonist properties distinct from those in the GABAAR. In addition, Val140 in the GABACR contributes to 3-APA binding. In conclusion, we have identified the key structural elements underlying distinct antagonist properties for the GABACR. The mechanistic insights were further extended and discussed in the context of antagonists docking to the homology models of GABAA or GABAC receptors.

  16. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  17. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  18. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  19. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  20. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  1. Negative gating modulation by (R)-N-(benzimidazol-2-yl)-1,2,3,4-tetrahydro-1-naphthylamine (NS8593) depends on residues in the inner pore vestibule: pharmacological evidence of deep-pore gating of K(Ca)2 channels.

    PubMed

    Jenkins, David Paul; Strøbæk, Dorte; Hougaard, Charlotte; Jensen, Marianne L; Hummel, Rene; Sørensen, Ulrik S; Christophersen, Palle; Wulff, Heike

    2011-06-01

    Acting as a negative gating modulator, (R)-N-(benzimidazol-2-yl)-1,2,3,4-tetrahydro-1-naphthylamine (NS8593) shifts the apparent Ca(2+)-dependence of the small-conductance Ca(2+)-activated K(+) channels K(Ca)2.1-2.3 to higher Ca(2+) concentrations. Similar to the positive K(Ca) channel-gating modulators 1-ethyl-2-benzimidazolinone (1-EBIO) and cyclohexyl-[2-(3,5-dimethyl-pyrazol-1-yl)-6-methylpyrimidin-4-yl]-amine (CyPPA), the binding site for NS8593 has been assumed to be located in the C-terminal region, in which these channels interact with their Ca(2+) sensor calmodulin. However, by using a progressive chimeric approach, we were able to localize the site-of-action of NS8593 to the K(Ca)2 pore. For example, when we transferred the C terminus from the NS8593-insensitive intermediate-conductance K(Ca)3.1 channel to K(Ca)2.3, the chimeric channel remained as sensitive to NS8593 as wild-type K(Ca)2.3. In contrast, when we transferred the K(Ca)2.3 pore to K(Ca)3.1, the channel became sensitive to NS8593. Using site-directed mutagenesis, we subsequently identified two specific residues in the inner vestibule of K(Ca)2.3 (Ser507 and Ala532) that determined the effect of NS8593. Mutation of these residues to the corresponding residues in K(Ca)3.1 (Thr250 and Val275) made K(Ca)2.3 insensitive to NS8593, whereas introduction of serine and alanine into K(Ca)3.1 was sufficient to render this channel highly sensitive to NS8593. It is noteworthy that the same two residue positions have been found previously to mediate sensitivity of K(Ca)3.1 to clotrimazole and 1-[(2-chlorophenyl)diphenylmethyl]-1H-pyrazole (TRAM-34). The location of Ser507 in the pore-loop near the selectivity filter and Ala532 in an adjacent position in S6 are within the region predicted to contain the K(Ca)2 channel gate. Hence, we propose that NS8593-mediated gating modulation occurs via interaction with gating structures at a position deep within the inner pore vestibule.

  2. Lack of complex I activity in human cells carrying a mutation in MtDNA-encoded ND4 subunit is corrected by the Saccharomyces cerevisiae NADH-quinone oxidoreductase (NDI1) gene.

    PubMed

    Bai, Y; Hájek, P; Chomyn, A; Chan, E; Seo, B B; Matsuno-Yagi, A; Yagi, T; Attardi, G

    2001-10-19

    The gene for the single subunit, rotenone-insensitive, and flavone-sensitive internal NADH-quinone oxidoreductase of Saccharomyces cerevisiae (NDI1) can completely restore the NADH dehydrogenase activity in mutant human cells that lack the essential mitochondrial DNA (mtDNA)-encoded subunit ND4. In particular, the NDI1 gene was introduced into the nuclear genome of the human 143B.TK(-) cell line derivative C4T, which carries a homoplasmic frameshift mutation in the ND4 gene. Two transformants with a low or high level of expression of the exogenous gene were chosen for a detailed analysis. In these cells the corresponding protein is localized in mitochondria, its NADH-binding site faces the matrix compartment as in yeast mitochondria, and in perfect correlation with its abundance restores partially or fully NADH-dependent respiration that is rotenone-insensitive, flavone-sensitive, and antimycin A-sensitive. Thus the yeast enzyme has become coupled to the downstream portion of the human respiratory chain. Furthermore, the P:O ratio with malate/glutamate-dependent respiration in the transformants is approximately two-thirds of that of the wild-type 143B.TK(-) cells, as expected from the lack of proton pumping activity in the yeast enzyme. Finally, whereas the original mutant cell line C4T fails to grow in medium containing galactose instead of glucose, the high NDI1-expressing transformant has a fully restored capacity to grow in galactose medium. The present observations substantially expand the potential of the yeast NDI1 gene for the therapy of mitochondrial diseases involving complex I deficiency.

  3. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  4. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  5. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  7. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  8. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  9. Voltage- and ATP-dependent structural rearrangements of the P2X2 receptor associated with the gating of the pore

    PubMed Central

    Keceli, Batu; Kubo, Yoshihiro

    2014-01-01

    P2X2 is an extracellular ATP-gated cation channel which has a voltage-dependent gating property even though it lacks a canonical voltage sensor. It is a trimer in which each subunit has two transmembrane helices and a large extracellular domain. The three inter-subunit ATP binding sites are linked to the pore forming transmembrane (TM) domains by β-strands. We analysed structural rearrangements of the linker strands between the ATP binding site and TM domains upon ligand binding and voltage change, electrophysiologically in Xenopus oocytes, using mutants carrying engineered thiol-modifiable cysteine residues. (1) We demonstrated that the double mutant D315C&I67C (at β-14 and β-1, respectively) shows a 2- to 4-fold increase in current amplitude after treatment with a reducing reagent, dithiothreitol (DTT). Application of the thiol-reactive metal Cd2+ induced current decline due to bond formation between D315C and I67C. This effect was not observed in wild type (WT) or in single point mutants. (2) Cd2+-induced current decline was analysed in hyperpolarized and depolarized conditions with different pulse protocols, and also in the presence and absence of ATP. (3) Current decline induced by Cd2+ could be clearly observed in the presence of ATP, but was not clear in the absence of ATP, showing a state-dependent modification. (4) In the presence of ATP, Cd2+ modification was significantly faster in hyperpolarized than in depolarized conditions, showing voltage-dependent structural rearrangements of the linker strands. (5) Experiments using tandem trimeric constructs (TTCs) with controlled number and position of mutations in the trimer showed that the bridging by Cd2+ between 315 and 67 was not intra- but inter-subunit. (6) Finally, we performed similar analyses of a pore mutant T339S, which makes the channel activation voltage insensitive. Cd2+ modification rates of T339S were similar in hyperpolarized and depolarized conditions. Taking these results together, we demonstrated that structural rearrangements of the linker region of the P2X2 receptor channel are induced not only by ligand binding but also by membrane potential change. PMID:25172943

  10. A robust methodology to subclassify pseudokinases based on their nucleotide-binding properties

    PubMed Central

    Murphy, James M.; Zhang, Qingwei; Young, Samuel N.; Reese, Michael L.; Bailey, Fiona P.; Eyers, Patrick A.; Ungureanu, Daniela; Hammaren, Henrik; Silvennoinen, Olli; Varghese, Leila N.; Chen, Kelan; Tripaydonis, Anne; Jura, Natalia; Fukuda, Koichi; Qin, Jun; Nimchuk, Zachary; Mudgett, Mary Beth; Elowe, Sabine; Gee, Christine L.; Liu, Ling; Daly, Roger J.; Manning, Gerard; Babon, Jeffrey J.; Lucet, Isabelle S.

    2017-01-01

    Protein kinase-like domains that lack conserved residues known to catalyse phosphoryl transfer, termed pseudokinases, have emerged as important signalling domains across all kingdoms of life. Although predicted to function principally as catalysis-independent protein-interaction modules, several pseudokinase domains have been attributed unexpected catalytic functions, often amid controversy. We established a thermal-shift assay as a benchmark technique to define the nucleotide-binding properties of kinase-like domains. Unlike in vitro kinase assays, this assay is insensitive to the presence of minor quantities of contaminating kinases that may otherwise lead to incorrect attribution of catalytic functions to pseudokinases. We demonstrated the utility of this method by classifying 31 diverse pseudokinase domains into four groups: devoid of detectable nucleotide or cation binding; cation-independent nucleotide binding; cation binding; and nucleotide binding enhanced by cations. Whereas nine pseudokinases bound ATP in a divalent cation-dependent manner, over half of those examined did not detectably bind nucleotides, illustrating that pseudokinase domains predominantly function as non-catalytic protein-interaction modules within signalling networks and that only a small subset is potentially catalytically active. We propose that henceforth the thermal-shift assay be adopted as the standard technique for establishing the nucleotide-binding and catalytic potential of kinase-like domains. PMID:24107129

  11. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  12. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  13. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  14. Partial reconstitution of photoreceptor cGMP phosphodiesterase characteristics in cGMP phosphodiesterase-5.

    PubMed

    Granovsky, A E; Artemyev, N O

    2001-06-15

    Photoreceptor cGMP phosphodiesterases (PDE6) are uniquely qualified to serve as effector enzymes in the vertebrate visual transduction cascade. In the dark-adapted photoreceptors, the activity of PDE6 is blocked via tight association with the inhibitory gamma-subunits (Pgamma). The Pgamma block is removed in the light-activated PDE6 by the visual G protein, transducin. Transducin-activated PDE6 exhibits an exceptionally high catalytic rate of cGMP hydrolysis ensuring high signal amplification. To identify the structural determinants for the inhibitory interaction with Pgamma and the remarkable cGMP hydrolytic ability, we sought to reproduce the PDE6 characteristics by mutagenesis of PDE5, a related cyclic GMP-specific, cGMP-binding PDE. PDE5 is insensitive to Pgamma and has a more than 100-fold lower k(cat) for cGMP hydrolysis. Our mutational analysis of chimeric PDE5/PDE6alpha' enzymes revealed that the inhibitory interaction of cone PDE6 catalytic subunits (PDE6alpha') with Pgamma is mediated primarily by three hydrophobic residues at the entry to the catalytic pocket, Met(758), Phe(777), and Phe(781). The maximal catalytic rate of PDE5 was enhanced by at least 10-fold with substitutions of PDE6alpha'-specific glycine residues for the corresponding PDE5 alanine residues, Ala(608) and Ala(612). The Gly residues are adjacent to the highly conserved metal binding motif His-Asn-X-X-His, which is essential for cGMP hydrolysis. Our results suggest that the unique Gly residues allow the PDE6 metal binding site to adopt a more favorable conformation for cGMP hydrolysis.

  15. Reconstruction of diaminopimelic acid biosynthesis allows characterisation of Mycobacterium tuberculosis N-succinyl-L,L-diaminopimelic acid desuccinylase

    PubMed Central

    Usha, Veeraraghavan; Lloyd, Adrian J.; Roper, David I.; Dowson, Christopher G.; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T.; Blindauer, Claudia A.; Besra, Gurdyal S.

    2016-01-01

    With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug. PMID:26976706

  16. Reconstruction of diaminopimelic acid biosynthesis allows characterisation of Mycobacterium tuberculosis N-succinyl-L,L-diaminopimelic acid desuccinylase.

    PubMed

    Usha, Veeraraghavan; Lloyd, Adrian J; Roper, David I; Dowson, Christopher G; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T; Blindauer, Claudia A; Besra, Gurdyal S

    2016-03-15

    With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug.

  17. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  18. NAIM and site-specific functional group modification analysis of RNase P RNA: magnesium dependent structure within the conserved P1-P4 multihelix junction contributes to catalysis.

    PubMed

    Kaye, Nicholas M; Christian, Eric L; Harris, Michael E

    2002-04-09

    The tRNA processing endonuclease ribonuclease P contains an essential and highly conserved RNA molecule (RNase P RNA) that is the catalytic subunit of the enzyme. To identify and characterize functional groups involved in RNase P RNA catalysis, we applied self-cleaving ribozyme-substrate conjugates, on the basis of the RNase P RNA from Escherichia coli, in nucleotide analogue interference mapping (NAIM) and site-specific modification experiments. At high monovalent ion concentrations (3 M) that facilitate protein-independent substrate binding, we find that the ribozyme is largely insensitive to analogue substitution and that concentrations of Mg2+ (1.25 mM) well below that necessary for optimal catalytic rate (>100 mM) are required to produce interference effects because of modification of nucleotide bases. An examination of the pH dependence of the reaction rate at 1.25 mM Mg2+ indicates that the increased sensitivity to analogue interference is not due to a change in the rate-limiting step. The nucleotide positions detected by NAIM under these conditions are located exclusively in the catalytic domain, consistent with the proposed global structure of the ribozyme, and predominantly occur within the highly conserved P1-P4 multihelix junction. Several sensitive positions in J3/4 and J2/4 are proximal to a previously identified site of divalent metal ion binding in the P1-P4 element. Kinetic analysis of ribozymes with site-specific N7-deazaadenosine and deazaguanosine modifications in J3/4 was, in general, consistent with the interference results and also permitted the analysis of sites not accessible by NAIM. These results show that, in this region only, modification of the N7 positions of A62, A65, and A66 resulted in measurable effects on reaction rate and modification at each position displayed distinct sensitivities to Mg2+ concentration. These results reveal a restricted subset of individual functional groups within the catalytic domain that are particularly important for substrate cleavage and demonstrate a close association between catalytic function and metal ion-dependent structure in the highly conserved P1-P4 multihelix junction.

  19. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  20. An ABRE promoter sequence is involved in osmotic stress-responsive expression of the DREB2A gene, which encodes a transcription factor regulating drought-inducible genes in Arabidopsis.

    PubMed

    Kim, June-Sik; Mizoi, Junya; Yoshida, Takuya; Fujita, Yasunari; Nakajima, Jun; Ohori, Teppei; Todaka, Daisuke; Nakashima, Kazuo; Hirayama, Takashi; Shinozaki, Kazuo; Yamaguchi-Shinozaki, Kazuko

    2011-12-01

    In plants, osmotic stress-responsive transcriptional regulation depends mainly on two major classes of cis-acting elements found in the promoter regions of stress-inducible genes: ABA-responsive elements (ABREs) and dehydration-responsive elements (DREs). ABRE has been shown to perceive ABA-mediated osmotic stress signals, whereas DRE is known to be involved in an ABA-independent pathway. Previously, we reported that the transcription factor DRE-BINDING PROTEIN 2A (DREB2A) regulates DRE-mediated transcription of target genes under osmotic stress conditions in Arabidopsis (Arabidopsis thaliana). However, the transcriptional regulation of DREB2A itself remains largely uncharacterized. To elucidate the transcriptional mechanism associated with the DREB2A gene under osmotic stress conditions, we generated a series of truncated and base-substituted variants of the DREB2A promoter and evaluated their transcriptional activities individually. We found that both ABRE and coupling element 3 (CE3)-like sequences located approximately -100 bp from the transcriptional initiation site are necessary for the dehydration-responsive expression of DREB2A. Coupling our transient expression analyses with yeast one-hybrid and chromatin immunoprecipitation (ChIP) assays indicated that the ABRE-BINDING PROTEIN 1 (AREB1), AREB2 and ABRE-BINDING FACTOR 3 (ABF3) bZIP transcription factors can bind to and activate the DREB2A promoter in an ABRE-dependent manner. Exogenous ABA application induced only a modest accumulation of the DREB2A transcript when compared with the osmotic stress treatment. However, the osmotic stress-induced DREB2A expression was found to be markedly impaired in several ABA-deficient and ABA-insensitive mutants. These results suggest that in addition to an ABA-independent pathway, the ABA-dependent pathway plays a positive role in the osmotic stress-responsive expression of DREB2A.

  1. Transscleral diffusion of ethacrynic acid and sodium fluorescein

    PubMed Central

    Lin, Cheng-Wen; Wang, Yong; Challa, Pratap; Epstein, David L.

    2007-01-01

    Purpose One of the current limitations in developing novel glaucoma drugs that target the trabecular meshwork (TM) is the induced corneal toxicity from eyedrop formulations. To avoid the corneal toxicity, an alternative approach would be to deliver TM drugs through the sclera. To this end, we quantified ex vivo diffusion coefficient of a potential TM drug, ethacrynic acid (ECA), and investigated mechanisms of ECA transport in the sclera. Methods An Ussing-type diffusion apparatus was built to measure the apparent diffusion coefficient of ECA in fresh porcine sclera at 4 °C. To understand mechanisms of ECA transport, we quantified the transscleral transport of a fluorescent tracer, sodium fluorescein (NaF), that has a similar molecular weight but is more hydrophilic compared to ECA. Furthermore, we developed a mathematical model to simulate the transport processes and used it to analyze the experimental data. The model was also used to investigate the dependence of diffusion coefficients on volume fraction of viable cells and the binding of NaF and ECA to scleral tissues. Results The diffusion coefficients of ECA and NaF in the sclera were 48.5±15.1x10-7 cm2/s (n=9) and 5.23±1.93x10-7 cm2/s (n=8), respectively. Both diffusion coefficients were insensitive to cell shrinkage caused by ECA during the diffusion experiments and cell damage caused by the storage of tissues ex vivo before the experiments. Binding of ECA to scleral tissues could not be detected. The apparent maximum binding capacity and the apparent equilibrium dissociation constant for NaF were 80±5 mM and 2.5±0.5 mM (n=3), respectively. Conclusions These data demonstrated that ECA diffusion was minimally hindered by structures in the sclera, presumably due to the lack of cells and binding sites for ECA in the sclera. PMID:17356511

  2. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  3. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Cloning and characterization of a novel Gladiolus hybridus AFP family gene (GhAFP-like) related to corm dormancy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Jian; Seng, Shanshan; Carianopol, Carina

    Abscisic acid (ABA) is an important phytohormone controlling seed dormancy. AFPs (ABA INSENSITIVE FIVE BINDING PROTEINS) are reported to be negative regulators of the ABA signaling pathway. The involvement of AFPs in dormant vegetative organs remains poorly understood. Here, we isolated and characterized a novel AFP family member from Gladiolus dormant cormels, GhAFP-like, containing three conserved domains of the AFP family. Quantitative PCR analysis revealed that GhAFP-like was expressed in dormant organs and its expression was down-regulated along with corm storage. GhAFP-like was verified to be a nuclear-localized protein. Overexpressing GhAFP-like in Arabidopsis thaliana not only showed weaker seed dormancymore » with insensitivity to ABA, but also changed the expression of some ABA related genes. In addition, a primary root elongation assay showed GhAFP-like may involve in auxin signaling response. The results in this study indicate that GhAFP-like acts as a negative regulator in ABA signaling and is related to dormancy. - Highlights: • GhAFP-like is expessed in dormant corm. • Overexpressing GhAFP-like showed early germination and insensitivity to ABA. • Overexpressing GhAFP-like changed ABI5 downstream genes expression.« less

  5. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  6. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  7. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  8. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  9. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  10. Selective down-regulation of [(125)I]Y0-alpha-conotoxin MII binding in rat mesostriatal dopamine pathway following continuous infusion of nicotine.

    PubMed

    Mugnaini, M; Garzotti, M; Sartori, I; Pilla, M; Repeto, P; Heidbreder, C A; Tessari, M

    2006-01-01

    Prolonged exposure to nicotine, as occurs in smokers, results in up-regulation of all the neuronal nicotinic acetylcholine receptor subtypes studied so far, the only differences residing in the extent and time course of the up-regulation. alpha6beta2*-Nicotinic acetylcholine receptors are selectively enriched in the mesostriatal dopaminergic system and may play a crucial role in nicotine dependence. Here we show that chronic nicotine treatment (3mg/kg/day for two weeks, via s.c. osmotic minipumps) caused a significant decrease (36% on average) in the binding of [(125)I]Y(0)-alpha-conotoxin MII (a selective ligand for alpha6beta2*-nicotinic acetylcholine receptors in this system) to all the five regions of the rat dopaminergic pathway analyzed in this study. After one week of withdrawal, binding was still lower than control in striatal terminal regions (namely the caudate putamen and the accumbens shell and core). In somatodendritic regions (the ventral tegmental area and the substantia nigra) the decrease was significant at the end of the treatment and recovered within one day of withdrawal. This effect was not due to displacement of [(125)I]Y(0)-alpha-conotoxin MII binding by residual nicotine. In fact the binding was not changed by 565 ng/g nicotine (obtained with a single injection of nicotine), a concentration much higher than that found in the brain of rats chronically treated with nicotine (240 ng/g). In addition, consistent with previous studies reporting an up-regulation of other subtypes of nicotinic acetylcholine receptors, we found that nicotine exposure significantly increased (40% on average) the binding of [(125)I]epibatidine (a non-selective agonist at most neuronal heteromeric nicotinic acetylcholine receptors) in three up to five regions containing only alpha-conotoxin MII-insensitive [(125)I]epibatidine binding sites, namely the primary motor, somatosensory and auditory cortices. In conclusion, this work is the first to demonstrate that alpha6beta2*-nicotinic acetylcholine receptors, unique within the nicotinic acetylcholine receptor family, are down-regulated following chronic nicotine treatment in rat dopaminergic mesostriatal pathway, a finding that may shed new light in the complex mechanisms of nicotine dependence.

  11. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  12. The evolution of milk casein genes from tooth genes before the origin of mammals.

    PubMed

    Kawasaki, Kazuhiko; Lafont, Anne-Gaelle; Sire, Jean-Yves

    2011-07-01

    Caseins are among cardinal proteins that evolved in the lineage leading to mammals. In milk, caseins and calcium phosphate (CaP) form a huge complex called casein micelle. By forming the micelle, milk maintains high CaP concentrations, which help altricial mammalian neonates to grow bone and teeth. Two types of caseins are known. Ca-sensitive caseins (α(s)- and β-caseins) bind Ca but precipitate at high Ca concentrations, whereas Ca-insensitive casein (κ-casein) does not usually interact with Ca but instead stabilizes the micelle. Thus, it is thought that these two types of caseins are both necessary for stable micelle formation. Both types of caseins show high substitution rates, which make it difficult to elucidate the evolution of caseins. Yet, recent studies have revealed that all casein genes belong to the secretory calcium-binding phosphoprotein (SCPP) gene family that arose by gene duplication. In the present study, we investigated exon-intron structures and phylogenetic distributions of casein and other SCPP genes, particularly the odontogenic ameloblast-associated (ODAM) gene, the SCPP-Pro-Gln-rich 1 (SCPPPQ1) gene, and the follicular dendritic cell secreted peptide (FDCSP) gene. The results suggest that contemporary Ca-sensitive casein genes arose from a putative common ancestor, which we refer to as CSN1/2. The six putative exons comprising CSN1/2 are all found in SCPPPQ1, although ODAM also shares four of these exons. By contrast, the five exons of the Ca-insensitive casein gene are all reminiscent of FDCSP. The phylogenetic distribution of these genes suggests that both SCPPPQ1 and FDCSP arose from ODAM. We thus argue that all casein genes evolved from ODAM via two different pathways; Ca-sensitive casein genes likely originated directly from SCPPPQ1, whereas the Ca-insensitive casein genes directly differentiated from FDCSP. Further, expression of ODAM, SCPPPQ1, and FDCSP was detected in dental tissues, supporting the idea that both types of caseins evolved as Ca-binding proteins. Based on these findings, we propose two alternative hypotheses for micelle formation in primitive milk. The conserved biochemical characteristics in caseins and their immediate ancestors also suggest that many slight genetic modifications have created modern caseins, proteins vital to the sustained success of mammals.

  13. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  14. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  15. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  16. From face to interface recognition: a differential geometric approach to distinguish DNA from RNA binding surfaces

    PubMed Central

    Shazman, Shula; Elber, Gershon; Mandel-Gutfreund, Yael

    2011-01-01

    Protein nucleic acid interactions play a critical role in all steps of the gene expression pathway. Nucleic acid (NA) binding proteins interact with their partners, DNA or RNA, via distinct regions on their surface that are characterized by an ensemble of chemical, physical and geometrical properties. In this study, we introduce a novel methodology based on differential geometry, commonly used in face recognition, to characterize and predict NA binding surfaces on proteins. Applying the method on experimentally solved three-dimensional structures of proteins we successfully classify double-stranded DNA (dsDNA) from single-stranded RNA (ssRNA) binding proteins, with 83% accuracy. We show that the method is insensitive to conformational changes that occur upon binding and can be applicable for de novo protein-function prediction. Remarkably, when concentrating on the zinc finger motif, we distinguish successfully between RNA and DNA binding interfaces possessing the same binding motif even within the same protein, as demonstrated for the RNA polymerase transcription-factor, TFIIIA. In conclusion, we present a novel methodology to characterize protein surfaces, which can accurately tell apart dsDNA from an ssRNA binding interfaces. The strength of our method in recognizing fine-tuned differences on NA binding interfaces make it applicable for many other molecular recognition problems, with potential implications for drug design. PMID:21693557

  17. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  18. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  19. Linear and circular dichroism characterization of thionine binding mode with DNA polynucleotides

    NASA Astrophysics Data System (ADS)

    Tuite, Eimer Mary; Nordén, Bengt

    2018-01-01

    The binding mode of thionine (3,7-diamino-5-phenothiazinium) with alternating and non-alternating DNA polynucleotides at low binding ratios was conclusively determined using linear and circular dichroism spectroscopies. The binding to [poly(dG-dC)]2 and poly(dG)·poly(dC) was purely intercalative and was insensitive to ionic strength. Intercalative binding to [poly(dA-dT)]2 is observed at low ionic strength, but a shift of some dye to an non-intercalative mode is observed as the background salt concentration increases. With poly(dA)·poly(dT), intercalative binding is unfavourable, although some dye molecules may intercalate at low ionic strength, and groove binding is strongly promoted with increasing concentration of background salt. However, stacking with bases is observed with single-stranded poly(dA) and with triplex poly(dT)*poly(dA)·poly(dT) which suggests that the unusual structure of poly(dA)·poly(dT) precludes intercalation. Thionine behaves similarly to the related dye methylene blue, and small differences may be attributed either to the ability of thionine to form H-bonds that stabilize intercalation or to its improved stacking interactions in the basepair pocket on steric grounds.

  20. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  1. Nerve Growth Factor Effects on the Immune System

    DTIC Science & Technology

    1989-12-19

    neuroblastoma cell iine SY5Y was also used in this study of NGF and NGFR. NGF treatment of SY5Y induces differentiation events that are similar to the effect of...Regino Perez-Polo. Nerve growth factor induced neurite outgrowth in clone derived from NGF insensitive -7- human neuroblastoma cell line . Int. J. Devl...as outlined, were to characterize NGF binding in different rodent and human lymphoid tissues and to screen possible NGFR bearing cell lines

  2. Steroid hormones are novel nucleoside transport inhibitors by competition with nucleosides for their transporters.

    PubMed

    Kaneko, Masahiro; Hakuno, Fumihiko; Kamei, Hiroyasu; Yamanaka, Daisuke; Chida, Kazuhiro; Minami, Shiro; Coe, Imogen R; Takahashi, Shin-Ichiro

    2014-01-10

    Nucleoside transport is important for nucleic acid synthesis in cells that cannot synthesize nucleosides de novo, and for entry of many cytotoxic nucleoside analog drugs used in chemotherapy. This study demonstrates that various steroid hormones induce inhibition of nucleoside transport in mammalian cells. We analyzed the inhibitory effects of estradiol (E2) on nucleoside transport using SH-SY5Y human neuroblastoma cells. We observed inhibitory effects after acute treatment with E2, which lasted in the presence of E2. However, when E2 was removed, the effect immediately disappeared, suggesting that E2 effects are not mediated through the canonical regulatory pathway of steroid hormones, such as transcriptional regulation. We also discovered that E2 could competitively inhibit thymidine uptake and binding of the labeled nucleoside transporter inhibitor, S-[4-nitrobenzyl]-6-thioinosine (NBTI), indicating that E2 binds to endogenous nucleoside transporters, leading to inhibition of nucleoside transport. We then tested the effects of various steroids on nucleoside uptake in NBTI-sensitive cells, SH-SY5Y and NBTI-insensitive cells H9c2 rat cardiomyoblasts. We found E2 and progesterone clearly inhibited both NBTI-sensitive and insensitive uptake at micromolar concentrations. Taken together, we concluded that steroid hormones function as novel nucleoside transport inhibitors by competition with nucleosides for their transporters. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

  4. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  5. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  6. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  7. Molecular basis of a novel adaptation to hypoxic-hypercapnia in a strictly fossorial mole.

    PubMed

    Campbell, Kevin L; Storz, Jay F; Signore, Anthony V; Moriyama, Hideaki; Catania, Kenneth C; Payson, Alexander P; Bonaventura, Joseph; Stetefeld, Jörg; Weber, Roy E

    2010-07-16

    Elevated blood O(2) affinity enhances survival at low O(2) pressures, and is perhaps the best known and most broadly accepted evolutionary adjustment of terrestrial vertebrates to environmental hypoxia. This phenotype arises by increasing the intrinsic O(2) affinity of the hemoglobin (Hb) molecule, by decreasing the intracellular concentration of allosteric effectors (e.g., 2,3-diphosphoglycerate; DPG), or by suppressing the sensitivity of Hb to these physiological cofactors. Here we report that strictly fossorial eastern moles (Scalopus aquaticus) have evolved a low O(2) affinity, DPG-insensitive Hb - contrary to expectations for a mammalian species that is adapted to the chronic hypoxia and hypercapnia of subterranean burrow systems. Molecular modelling indicates that this functional shift is principally attributable to a single charge altering amino acid substitution in the beta-type delta-globin chain (delta136Gly-->Glu) of this species that perturbs electrostatic interactions between the dimer subunits via formation of an intra-chain salt-bridge with delta82Lys. However, this replacement also abolishes key binding sites for the red blood cell effectors Cl-, lactate and DPG (the latter of which is virtually absent from the red cells of this species) at delta82Lys, thereby markedly reducing competition for carbamate formation (CO(2) binding) at the delta-chain N-termini. We propose this Hb phenotype illustrates a novel mechanism for adaptively elevating the CO(2) carrying capacity of eastern mole blood during burst tunnelling activities associated with subterranean habitation.

  8. Molecular basis of a novel adaptation to hypoxic-hypercapnia in a strictly fossorial mole

    PubMed Central

    2010-01-01

    Background Elevated blood O2 affinity enhances survival at low O2 pressures, and is perhaps the best known and most broadly accepted evolutionary adjustment of terrestrial vertebrates to environmental hypoxia. This phenotype arises by increasing the intrinsic O2 affinity of the hemoglobin (Hb) molecule, by decreasing the intracellular concentration of allosteric effectors (e.g., 2,3-diphosphoglycerate; DPG), or by suppressing the sensitivity of Hb to these physiological cofactors. Results Here we report that strictly fossorial eastern moles (Scalopus aquaticus) have evolved a low O2 affinity, DPG-insensitive Hb - contrary to expectations for a mammalian species that is adapted to the chronic hypoxia and hypercapnia of subterranean burrow systems. Molecular modelling indicates that this functional shift is principally attributable to a single charge altering amino acid substitution in the β-type δ-globin chain (δ136Gly→Glu) of this species that perturbs electrostatic interactions between the dimer subunits via formation of an intra-chain salt-bridge with δ82Lys. However, this replacement also abolishes key binding sites for the red blood cell effectors Cl-, lactate and DPG (the latter of which is virtually absent from the red cells of this species) at δ82Lys, thereby markedly reducing competition for carbamate formation (CO2 binding) at the δ-chain N-termini. Conclusions We propose this Hb phenotype illustrates a novel mechanism for adaptively elevating the CO2 carrying capacity of eastern mole blood during burst tunnelling activities associated with subterranean habitation. PMID:20637064

  9. Gal4-VP16 directs ATP-independent chromatin reorganization in a yeast chromatin assembly system.

    PubMed

    Robinson, Karen M; Schultz, Michael C

    2005-03-22

    Major insights into the regulation of chromatin organization have stemmed from biochemical studies using Gal4-VP16, a chimeric transcriptional activator in which the DNA binding domain of Gal4p is fused to the activation domain of viral protein VP16. Unexpectedly, given previous intensive efforts to understand how Gal4-VP16 functions in the context of chromatin, we have uncovered a new mode of chromatin reorganization that is dependent on Gal4-VP16. This reorganization is performed by an activity in a crude DEAE (CD) fraction from budding yeast which also supports ATP-dependent assembly of physiologically spaced nucleosome arrays. Biochemical analysis reveals that the activity tightly associates with chromatin and reorganizes nucleosome arrays by a mechanism which is insensitive to ATP depletion after nucleosome assembly. It generates a chromatin organization in which a nucleosome is stably positioned immediately adjacent to Gal4p binding sites in the template DNA. Individual deletion of genes previously implicated in chromatin assembly and remodeling, namely, the histone chaperones NAP1, ASF1, and CAC1 and the SNF2-like DEAD/H ATPases SNF2, ISW1, ISW2, CHD1, SWR1, YFR038w, and SPT20, does not significantly perturb reorganization. Therefore, Gal4-VP16-directed chromatin reorganization in yeast can occur by an ATP-independent mechanism that does not require SAGA, SWI/SNF, Isw1, or Isw2 chromatin remodeling complexes.

  10. HnRNP C, YB-1 and hnRNP L coordinately enhance skipping of human MUSK exon 10 to generate a Wnt-insensitive MuSK isoform

    PubMed Central

    Nasrin, Farhana; Rahman, Mohammad Alinoor; Masuda, Akio; Ohe, Kenji; Takeda, Jun-ichi; Ohno, Kinji

    2014-01-01

    Muscle specific receptor tyrosine kinase (MuSK) is an essential postsynaptic transmembrane molecule that mediates clustering of acetylcholine receptors (AChR). MUSK exon 10 is alternatively skipped in human, but not in mouse. Skipping of this exon disrupts a cysteine-rich region (Fz-CRD), which is essential for Wnt-mediated AChR clustering. To investigate the underlying mechanisms of alternative splicing, we exploited block-scanning mutagenesis with human minigene and identified a 20-nucleotide block that contained exonic splicing silencers. Using RNA-affinity purification, mass spectrometry, and Western blotting, we identified that hnRNP C, YB-1 and hnRNP L are bound to MUSK exon 10. siRNA-mediated knockdown and cDNA overexpression confirmed the additive, as well as the independent, splicing suppressing effects of hnRNP C, YB-1 and hnRNP L. Antibody-mediated in vitro protein depletion and scanning mutagenesis additionally revealed that binding of hnRNP C to RNA subsequently promotes binding of YB-1 and hnRNP L to the immediate downstream sites and enhances exon skipping. Simultaneous tethering of two splicing trans-factors to the target confirmed the cooperative effect of YB-1 and hnRNP L on hnRNP C-mediated exon skipping. Search for a similar motif in the human genome revealed nine alternative exons that were individually or coordinately regulated by hnRNP C and YB-1. PMID:25354590

  11. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  12. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  13. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  14. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  15. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  16. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  17. The relative contribution of target-site mutations in complex acaricide resistant phenotypes as assessed by marker assisted backcrossing in Tetranychus urticae.

    PubMed

    Riga, Maria; Bajda, Sabina; Themistokleous, Christos; Papadaki, Stavrini; Palzewicz, Maria; Dermauw, Wannes; Vontas, John; Leeuwen, Thomas Van

    2017-08-23

    The mechanisms underlying insecticide and acaricide resistance in insects and mites are often complex, including additive effects of target-site insensitivity, increased metabolism and transport. The extent to which target-site resistance mutations contribute to the resistance phenotype is, however, not well studied. Here, we used marker-assisted backcrossing to create 30 congenic lines carrying nine mutations (alone, or in combination in a few cases) associated with resistance to avermectins, pyrethroids, mite growth inhibitors and mitochondrial complex III inhibitors (QoI) in a polyphagous arthropod pest, the spider mite Tetranychus urticae. Toxicity tests revealed that mutations in the voltage-gated sodium channel, chitin synthase 1 and cytochrome b confer high levels of resistance and, when fixed in a population, these mutations alone can result in field failure of acaricide treatment. In contrast, although we confirmed the implication of mutations in glutamate-gated chloride channels in abamectin and milbemectin insensitivity, these mutations do not lead to the high resistance levels that are often reported in abamectin resistant strains of T. urticae. Overall, this study functionally validates reported target-site resistance mutations in T. urticae, by uncoupling them from additional mechanisms, allowing to finally investigate the strength of the conferred phenotype in vivo.

  18. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  19. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  20. Environment-insensitive and gate-controllable photocurrent enabled by bandgap engineering of MoS2 junctions.

    PubMed

    Shih, Fu-Yu; Wu, Yueh-Chun; Shih, Yi-Siang; Shih, Ming-Chiuan; Wu, Tsuei-Shin; Ho, Po-Hsun; Chen, Chun-Wei; Chen, Yang-Fang; Chiu, Ya-Ping; Wang, Wei-Hua

    2017-03-21

    Two-dimensional (2D) materials are composed of atomically thin crystals with an enormous surface-to-volume ratio, and their physical properties can be easily subjected to the change of the chemical environment. Encapsulation with other layered materials, such as hexagonal boron nitride, is a common practice; however, this approach often requires inextricable fabrication processes. Alternatively, it is intriguing to explore methods to control transport properties in the circumstance of no encapsulated layer. This is very challenging because of the ubiquitous presence of adsorbents, which can lead to charged-impurity scattering sites, charge traps, and recombination centers. Here, we show that the short-circuit photocurrent originated from the built-in electric field at the MoS 2 junction is surprisingly insensitive to the gaseous environment over the range from a vacuum of 1 × 10 -6   Torr to ambient condition. The environmental insensitivity of the short-circuit photocurrent is attributed to the characteristic of the diffusion current that is associated with the gradient of carrier density. Conversely, the photocurrent with bias exhibits typical persistent photoconductivity and greatly depends on the gaseous environment. The observation of environment-insensitive short-circuit photocurrent demonstrates an alternative method to design device structure for 2D-material-based optoelectronic applications.

  1. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  2. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  3. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  4. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  5. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  6. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  8. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  9. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  10. SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type Protein Kinase, Is Important for Abscisic Acid Responses in Arabidopsis through Phosphorylation of ABSCISIC ACID-INSENSITIVE51[OPEN

    PubMed Central

    Zhou, Xiaona; Hao, Hongmei; Zhang, Yuguo; Bai, Yili; Zhu, Wenbo; Qin, Yunxia; Yuan, Feifei; Zhao, Feiyi; Wang, Mengyao; Hu, Jingjiang; Xu, Hong; Guo, Aiguang; Zhao, Huixian; Zhao, Yang; Cao, Cuiling; Yang, Yongqing; Schumaker, Karen S.; Guo, Yan; Xie, Chang Gen

    2015-01-01

    Abscisic acid (ABA) plays an essential role in seed germination. In this study, we demonstrate that one SNF1-RELATED PROTEIN KINASE3-type protein kinase, SOS2-LIKE PROTEIN KINASE5 (PKS5), is involved in ABA signal transduction via the phosphorylation of an interacting protein, ABSCISIC ACID-INSENSITIVE5 (ABI5). We found that pks5-3 and pks5-4, two previously identified PKS5 superactive kinase mutants with point mutations in the PKS5 FISL/NAF (a conserved peptide that is necessary for interaction with SOS3 or SOS3-LIKE CALCIUM BINDING PROTEINs) motif and the kinase domain, respectively, are hypersensitive to ABA during seed germination. PKS5 was found to interact with ABI5 in yeast (Saccharomyces cerevisiae), and this interaction was further confirmed in planta using bimolecular fluorescence complementation. Genetic studies revealed that ABI5 is epistatic to PKS5. PKS5 phosphorylates a serine (Ser) residue at position 42 in ABI5 and regulates ABA-responsive gene expression. This phosphorylation was induced by ABA in vivo and transactivated ABI5. Expression of ABI5, in which Ser-42 was mutated to alanine, could not fully rescue the ABA-insensitive phenotypes of the abi5-8 and pks5-4abi5-8 mutants. In contrast, mutating Ser-42 to aspartate rescued the ABA insensitivity of these mutants. These data demonstrate that PKS5-mediated phosphorylation of ABI5 at Ser-42 is critical for the ABA regulation of seed germination and gene expression in Arabidopsis (Arabidopsis thaliana). PMID:25858916

  11. Different response of human glioma tumor-initiating cells to epidermal growth factor receptor kinase inhibitors.

    PubMed

    Griffero, Fabrizio; Daga, Antonio; Marubbi, Daniela; Capra, Maria Cristina; Melotti, Alice; Pattarozzi, Alessandra; Gatti, Monica; Bajetto, Adriana; Porcile, Carola; Barbieri, Federica; Favoni, Roberto E; Lo Casto, Michele; Zona, Gianluigi; Spaziante, Renato; Florio, Tullio; Corte, Giorgio

    2009-03-13

    Because a subpopulation of cancer stem cells (tumor-initiating cells, TICs) is believed to be responsible for the development, progression, and recurrence of many tumors, we evaluated the in vitro sensitivity of human glioma TICs to epidermal growth factor receptor (EGFR) kinase inhibitors (erlotinib and gefitinib) and possible molecular determinants for their effects. Cells isolated from seven glioblastomas (GBM 1-7) and grown using neural stem cell permissive conditions were characterized for in vivo tumorigenicity, expression of tumor stem cell markers (CD133, nestin), and multilineage differentiation properties, confirming that these cultures are enriched in TICs. TIC cultures were challenged with increasing concentrations of erlotinib and gefitinib, and their survival was evaluated after 1-4 days. In most cases, a time- and concentration-dependent cell death was observed, although GBM 2 was completely insensitive to both drugs, and GBM 7 was responsive only to the highest concentrations tested. Using a radioligand binding assay, we show that all GBM TICs express EGFR. Erlotinib and gefitinib inhibited EGFR and ERK1/2 phosphorylation/activation in all GBMs, irrespective of the antiproliferative response observed. However, under basal conditions GBM 2 showed a high Akt phosphorylation that was completely insensitive to both drugs, whereas GBM 7 was completely insensitive to gefitinib, and Akt inactivation occurred only for the highest erlotinib concentration tested, showing a precise relationship with the antiproliferative effects of the drug. Interestingly, in GBM 2, phosphatase and tensin homolog expression was significantly down-regulated, possibly accounting for the insensitivity to the drugs. In conclusion, glioma TICs are responsive to anti-EGFR drugs, but phosphatase and tensin homolog expression and Akt inhibition seem to be necessary for such effect.

  12. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    PubMed Central

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  13. Neuromodulation by Mg2+ and polyamines of excitatory amino acid currents in rodent neurones in culture.

    PubMed

    Kumamoto, E

    1996-12-01

    Excitatory amino-acid currents in rodent central neurones are mediated by the activation of glutamate receptors. Ionotropic types of the receptors are divided into alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate (AMPA), kainate and N-methyl-D-aspartate (NMDA) receptors, and the former two are collectively called non-NMDA receptors. The NMDA receptor is modulated by a number of endogenous neuromodulators including Mg2+, polyamines, glycine and protons in extracellular solutions. Although it has been generally thought that each of the neuromodulators acts on a distinct site in the NMDA receptor, recent studies have revealed that these actions may be not necessarily independent of each other. The NMDA receptor response is not only inhibited but also potentiated by Mg2+, and the latter action is due to an interaction of a Mg2+ site with either glycine- or proton-binding site. In the presence of polyamines, a tonic inhibition by protons of the NMDA receptor response is relieved, resulting in a potentiation of the response. Alternatively, it has been recently revealed that there are some subtypes of non-NMDA receptors which are negatively modulated by polyamines in either extra- or intra cellular solutions. The difference in polyamine sensitivity among non-NMDA receptors is attributed to a distinction in their constituted subunits. The inhibition of non-NMDA receptor by intracellular polyamines results in inward rectification of the current-voltage relation which is not seen for polyamine-insensitive ones. This polyamine action is not mimicked by intracellular Mg2+.

  14. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  15. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  17. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  19. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  20. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  1. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  2. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  3. Improved sensitivity in patients with peripheral neuropathy: effects of monochromatic infrared photo energy.

    PubMed

    DeLellis, Salvatore L; Carnegie, Dale H; Burke, Thomas J

    2005-01-01

    The medical records of 1,047 patients (mean age, 73 years) with established peripheral neuropathy were examined to determine whether treatment with monochromatic infrared photo energy was associated with increased foot sensitivity to the 5.07 Semmes-Weinstein monofilament. The peripheral neuropathy in 790 of these patients (75%) was due to diabetes mellitus. Before treatment with monochromatic infrared photo energy, of the ten tested sites (five on each foot), a mean +/- SD of 7.9 +/- 2.4 sites were insensitive to the 5.07 Semmes-Weinstein monofilament, and 1,033 patients exhibited loss of protective sensation. After treatment, the mean +/- SD number of insensate sites on both feet was 2.3 +/- 2.4, an improvement of 71%. Only 453 of 1,033 patients (43.9%) continued to have loss of protective sensation after treatment. Therefore, monochromatic infrared photo energy treatment seems to be associated with significant clinical improvement in foot sensation in patients, primarily Medicare aged, with peripheral neuropathy. Because insensitivity to the 5.07 Semmes-Weinstein monofilament has been reported to be a major risk factor for diabetic foot wounds, the use of monochromatic infrared photo energy may be associated with a reduced incidence of diabetic foot wounds and amputations.

  4. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  5. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  6. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  7. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  8. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  9. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  10. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  11. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  12. Interaction of Clostridium perfringens delta toxin with erythrocyte and liposome membranes and relation with the specific binding to the ganglioside GM2.

    PubMed

    Jolivet-Reynaud, C; Hauttecoeur, B; Alouf, J E

    1989-01-01

    The specific interaction of the cytolytic Clostridium perfringens delta toxin with membrane GM2 was indicated by: (i) characterization of this glycolipid in the membrane of sheep and goat erythrocytes, which are lysed by the toxin, whereas GM2 was undetectable in insensitive rabbit erythrocytes, (ii) demonstration of 125I-toxin binding to GM2, by autoradiography, following incubation with thin-layer chromatograms containing separated neuroblastoma gangliosides, and (iii) toxin fixation by phospholipid-cholesterol unilamellar vesicles containing either sheep gangliosides or GM2. In order to investigate the intramembrane events leading to membrane disruption following toxin binding, the photoreactive probe 12(4-azido-2-nitrophenoxy)stearoyl 1-14C glucosamine, which inserts into the outer layer and labels integral membrane proteins, was used to establish whether delta toxin penetrates into target cell membrane. No toxin labeling was found, suggesting that toxin action takes place at the membrane surface. This contention is supported by the observation that despite toxin binding, GM2 liposomes did not release entrapped 14C-glucose. Treatment of toxin with carboxypeptidases, but not aminopeptidases, abolished both toxin binding capacity onto erythrocytes and its combination with antitoxin neutralizing antibodies, suggesting that the carboxy terminal end of the toxin is critical for binding to cell membrane.

  13. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  14. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  15. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  16. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  17. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  18. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  19. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  20. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  1. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  2. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  3. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  4. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  5. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  6. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  7. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  8. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  9. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  10. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  11. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  12. Size-dependent impact of CNTs on dynamic properties of calmodulin

    NASA Astrophysics Data System (ADS)

    Gao, Jian; Wang, Liming; Kang, Seung-Gu; Zhao, Lina; Ji, Mingjuan; Chen, Chunying; Zhao, Yuliang; Zhou, Ruhong; Li, Jingyuan

    2014-10-01

    There are growing concerns about the biosafety of nanomaterials such as carbon nanotubes (CNTs) as their applications become more widespread. We report here a theoretical and experimental study of the binding of various sizes of CNTs [CNT (4,4), (5,5), (6,6) and (7,7)] to calmodulin (CaM) protein and, in particular, their impact on the Ca2+-dependent dynamic properties of CaM. Our simulations show that all the CNTs can plug into the hydrophobic binding pocket of Ca2+-bound CaM with binding affinities comparable with the native substrate M13 peptide. Even though CNT (4,4) shows a similar behavior to the M13 peptide in its dissociation from Ca2+-free CaM, wider CNTs still bind firmly to CaM, indicating a potential failure of Ca2+ regulation. Such a size-dependent impact of CNTs on the dynamic properties of CaM is a result of the excessively strong hydrophobic interactions between the wider CNTs and CaM. These simulation results were confirmed by circular dichroism spectroscopy, which showed that the secondary structures of CaM become insensitive to Ca2+ concentrations after the addition of CNTs. Our findings indicate that the cytotoxicity of nanoparticles to proteins arises not only from the inhibition of static protein structures (binding pockets), but also from impacts on their dynamic properties.There are growing concerns about the biosafety of nanomaterials such as carbon nanotubes (CNTs) as their applications become more widespread. We report here a theoretical and experimental study of the binding of various sizes of CNTs [CNT (4,4), (5,5), (6,6) and (7,7)] to calmodulin (CaM) protein and, in particular, their impact on the Ca2+-dependent dynamic properties of CaM. Our simulations show that all the CNTs can plug into the hydrophobic binding pocket of Ca2+-bound CaM with binding affinities comparable with the native substrate M13 peptide. Even though CNT (4,4) shows a similar behavior to the M13 peptide in its dissociation from Ca2+-free CaM, wider CNTs still bind firmly to CaM, indicating a potential failure of Ca2+ regulation. Such a size-dependent impact of CNTs on the dynamic properties of CaM is a result of the excessively strong hydrophobic interactions between the wider CNTs and CaM. These simulation results were confirmed by circular dichroism spectroscopy, which showed that the secondary structures of CaM become insensitive to Ca2+ concentrations after the addition of CNTs. Our findings indicate that the cytotoxicity of nanoparticles to proteins arises not only from the inhibition of static protein structures (binding pockets), but also from impacts on their dynamic properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr01623h

  13. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  14. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  15. The ABA receptors -- we report you decide.

    PubMed

    McCourt, Peter; Creelman, Robert

    2008-10-01

    The plant hormone abscisic acid (ABA) has been implicated in a variety of physiological responses ranging from seed dormancy to stomatal conductance. Recently, three groups have reported the molecular identification of three disparate ABA receptors. Unlike the identification of other hormone receptors, in these three cases high affinity binding to ABA rather than the isolation of ABA insensitive mutants led to these receptor genes. Interestingly, two of the receptors encode genes involved in floral timing and chlorophyll biosynthesis, which are not considered traditional ABA responses. And the third receptor has been clouded in issues of its molecular identity. To clearly determine the roles of these genes in ABA perception it will require placing of these ABA-binding proteins into the rich ABA physiological context that has built up over the years.

  16. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  17. Bioaccumulation kinetics of the conventional energetics TNT and RDX relative to insensitive munitions constituents DNAN and NTO in Rana pipiens tadpoles.

    PubMed

    Lotufo, Guilherme R; Biedenbach, James M; Sims, Jerre G; Chappell, Pornsawan; Stanley, Jacob K; Gust, Kurt A

    2015-04-01

    The manufacturing of explosives and their loading, assembling, and packing into munitions for use in testing on training sites or battlefields has resulted in contamination of terrestrial and aquatic sites that may pose risk to populations of sensitive species. The bioaccumulative potential of the conventional explosives 2,4,6-trinitrotoluene (TNT) and hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and of the insensitive munitions (i.e., less shock sensitive) compound 2,4-dinitroanisole (DNAN) were assessed using the Northern leopard frog, Rana pipiens. Trinitrotoluene entering the organism was readily biotransformed to aminodinitrotoluenes, whereas no transformation products were measured for RDX or DNAN. Uptake clearance rates were relatively slow and similar among compounds (1.32-2.19 L kg(-1) h(-1) ). Upon transfer to uncontaminated water, elimination rate was very fast, resulting in the prediction of fast time to approach steady state (5 h or less) and short elimination half-lives (1.2 h or less). A preliminary bioconcentration factor of 0.25 L kg(-1) was determined for the insensitive munitions compound 3-nitro-1,2,4-trizole-5-one (NTO) indicating negligible bioaccumulative potential. Because of the rapid elimination rate for explosives, tadpoles inhabiting contaminated areas are expected to experience harmful effects only if under constant exposure conditions given that body burdens can rapidly depurate preventing tissue concentrations from persisting at levels that may cause detrimental biological effects. © 2014 SETAC.

  18. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  19. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  20. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  1. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  2. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  3. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  4. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  5. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  6. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  7. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  8. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  9. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  10. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  11. Truncated transcripts of nicotinic acetylcholine subunit gene bdalpha6 are associated with spinosad resistance in Bactrocera dorsalis

    USDA-ARS?s Scientific Manuscript database

    We investigated spinosad resistance mechanisms of a Bactocera dorsalis strain from Taiwan. Resistance levels were 901-fold, and there was no cross resistance against imidacloprid or fipronil Combined biochemical and synergistic data indicated that target site insensitivity is the major resistance co...

  12. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  14. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  15. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  16. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  17. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  18. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  19. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  20. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  1. Yeast Ran-Binding Protein 1 (Yrb1) Shuttles between the Nucleus and Cytoplasm and Is Exported from the Nucleus via a CRM1 (XPO1)-Dependent Pathway

    PubMed Central

    Künzler, Markus; Gerstberger, Thomas; Stutz, Françoise; Bischoff, F. Ralf; Hurt, Ed

    2000-01-01

    The RanGTP-binding protein RanBP1, which is located in the cytoplasm, has been implicated in release of nuclear export complexes from the cytoplasmic side of the nuclear pore complex. Here we show that Yrb1 (the yeast homolog of RanBP1) shuttles between the nucleus and the cytoplasm. Nuclear import of Yrb1 is a facilitated process that requires a short basic sequence within the Ran-binding domain (RBD). By contrast, nuclear export of Yrb1 requires an intact RBD, which forms a ternary complex with the Xpo1 (Crm1) NES receptor in the presence of RanGTP. Nuclear export of Yrb1, however, is insensitive towards leptomycin B, suggesting a novel type of substrate recognition between Yrb1 and Xpo1. Taken together, these data suggest that ongoing nuclear import and export is an important feature of Yrb1 function in vivo. PMID:10825193

  2. Regulation of Steroid Hormone Receptor Function By the 52-kDa FK506-Binding Protein (FKBP52)

    PubMed Central

    Sivils, Jeffrey C.; Storer, Cheryl L.; Galigniana, Mario D.; Cox, Marc B.

    2011-01-01

    The large FK506-binding protein FKBP52 has been characterized as an important positive regulator of androgen, glucocorticoid and progesterone receptor signaling pathways. FKBP52 associates with receptor-Hsp90 complexes and is proposed to have roles in both receptor hormone binding and receptor subcellular localization. Data from biochemical and cellular studies has been corroborated in whole animal models as fkbp52-deficient male and female mice display characteristics of androgen, glucocorticoid and/or progesterone insensitivity. FKBP52 receptor specificity and the specific phenotypes displayed by the fkbp52-deficient mice have firmly established FKBP52 as a promising target for the treatment of a variety of hormone-dependent diseases. Recent studies demonstrated that the FKBP52 FK1 domain and the proline-rich loop within this domain are functionally important for FKBP52 regulation of receptor function. Based on these data, efforts are currently underway to target the FKBP52 FK1 domain and the proline-rich loop with small molecule inhibitors. PMID:21511531

  3. Gibberellin Perception by the Gibberellin Receptor and its Effector Recognition

    NASA Astrophysics Data System (ADS)

    Hakoshima, Toshio; Murase, Kohji; Hirano, Yoshinori; Sun, Tai-Ping

    Gibberellins control a diverse range of growth and developmental processes in higher plants and have been widely utilized in the agricultural industry. By binding to a nuclear receptor GIBBERELLIN INSENSITIVE DWARF1 (GID1), gibberellins regulate gene expression by promoting degradation of the transcriptional regulator DELLA proteins. The precise manner in which GID1 discriminates and becomes activated by bioactive gibberellins for specific binding to DELLA proteins remains unclear. We present the crystal structure of a ternary complex of Arabidopsis thaliana GID1A, a bioactive gibberellin and the N-terminal DELLA domain of GAI. In this complex, GID1a occludes gibberellin in a deep binding pocket covered by its N-terminal helical switch region, which in turn interacts with the DELLA domain containing DELLA, VHYNP and LExLE motifs. Our results establish a structural model of a plant hormone receptor which is distinct from the hormone-perception mechanism and effector recognition of the known auxin receptors.

  4. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  5. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  6. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  7. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  8. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  9. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  10. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  11. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  12. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  13. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  14. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  15. First molecular genotyping of insensitive acetylcholinesterase associated with malathion resistance in Culex quinquefasciatus Say populations in Malaysia.

    PubMed

    Low, Van Lun; Chen, Chee Dhang; Lim, Phaik Eem; Lee, Han Lim; Lim, Yvonne Ai Lian; Tan, Tiong Kai; Sofian-Azirun, Mohd

    2013-12-01

    Given that there is limited available information on the insensitive acetylcholinesterase in insect species in Malaysia, the present study aims to detect the presence of G119S mutation in the acetylcholinesterase gene of Culex quinquefasciatus from 14 residential areas across 13 states and a federal territory in Malaysia. The ace-1 sequence and PCR-RFLP test revealed the presence of glycine-serine ace-1 mutation in the wild populations of Cx. quinquefasciatus. Both direct sequencing and PCR-RFLP methods demonstrated similar results and revealed the presence of a heterozygous genotype at a very low frequency (18 out of 140 individuals), while a homozygous resistant genotype was not detected across any study site in Malaysia. In addition, statistical analysis also revealed that malathion resistance is associated with the frequency of ace-1(R) in Cx. quinquefasciatus populations. This study has demonstrated the first field-evolved instance of G119S mutation in Malaysian populations. Molecular identification of insensitive acetylcholinesterase provides significant insights into the evolution and adaptation of the Malaysian Cx. quinquefasciatus populations. © 2013 Society of Chemical Industry.

  16. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  17. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  18. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  19. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  20. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  1. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  2. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  3. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  4. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  7. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  8. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  9. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  11. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  12. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  13. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  14. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  15. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  16. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  17. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  18. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  19. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  20. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  1. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  2. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  3. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  4. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  5. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  6. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  7. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  8. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  9. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  11. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  12. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  13. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  14. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  15. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  16. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  17. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  18. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  19. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  20. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  1. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  2. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  3. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  4. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  5. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  6. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  7. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  8. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  9. Negative cross-resistance between dihydropyrazole insecticides and pyrethroids in houseflies, Musca domestica.

    PubMed

    Khambay, B P; Denholm, I; Carlson, G R; Jacobson, R M; Dhadialla, T S

    2001-09-01

    A series of insecticidal dihydropyrazoles and related compounds have been shown to exhibit negative cross-resistance to a resistant (super-kdr) strain of houseflies with site-insensitivity to pyrethroids. The level of cross-resistance is similar to that observed previously for a range of N-alkylamides against the same strain.

  10. Identification and functional analysis of tomato BRI1 and BAK1 receptor kinase phosphorylation sites

    USDA-ARS?s Scientific Manuscript database

    Brassinosteroids (BRs) are essential plant hormones that are perceived at the cell surface by a membrane bound receptor kinase, BRASSINOSTEROID INSENSITIVE 1 (BRI1). BRI1 interacts with BRI1-ASSOCIATED RECEPTOR KINASE 1 (BAK1) to initiate a signal transduction pathway in which autophosphorylation an...

  11. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  12. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  13. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  14. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  15. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  16. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  17. Voltage-Independent Inhibition of the Tetrodotoxin-Sensitive Sodium Currents by Oxotremorine and Angiotensin II in Rat Sympathetic Neurons.

    PubMed

    Puente, Erika I; De la Cruz, Lizbeth; Arenas, Isabel; Elias-Viñas, David; Garcia, David E

    2016-04-01

    Tetrodotoxin-sensitive Na(+) currents have been extensively studied because they play a major role in neuronal firing and bursting. In this study, we showed that voltage-dependent Na(+) currents are regulated in a slow manner by oxotremorine (oxo-M) and angiotensin II in rat sympathetic neurons. We found that these currents can be readily inhibited through a signaling pathway mediated by G proteins and phospholipase C (PLC) β1. This inhibition is slowly established, pertussis toxin-insensitive, partially reversed within tens of seconds after oxo-M washout, and not relieved by a strong depolarization, suggesting a voltage-insensitive mechanism of inhibition. Specificity of the M1 receptor was tested by the MT-7 toxin. Activation and inactivation curves showed no shift in the voltage dependency under the inhibition by oxo-M. This inhibition is blocked by a PLC inhibitor (U73122, 1-(6-{[(17β)-3-Methoxyestra-1,3,5(10)-trien-17-yl]amino}hexyl)-1H-pyrrole-2,5-dione), and recovery from inhibition is prevented by wortmannin, a PI3/4 kinase inhibitor. Hence, the pathway involves Gq/11 and is mediated by a diffusible second messenger. Oxo-M inhibition is occluded by screening phosphatidylinositol 4,5-bisphosphate (PIP2)-negative charges with poly-l-lysine and prevented by intracellular dialysis with a PIP2 analog. In addition, bisindolylmaleimide I, a specific ATP-competitive protein kinase C (PKC) inhibitor, rules out that this inhibition may be mediated by this protein kinase. Furthermore, oxo-M-induced suppression of Na(+) currents remains unchanged when neurons are treated with calphostin C, a PKC inhibitor that targets the diacylglycerol-binding site of the kinase. These results support a general mechanism of Na(+) current inhibition that is widely present in excitable cells through modulation of ion channels by specific G protein-coupled receptors. Copyright © 2016 by The American Society for Pharmacology and Experimental Therapeutics.

  18. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  19. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  20. Coordination of hepatocyte nuclear factor 4 and seven-up controls insect counter-defense cathepsin B expression.

    PubMed

    Ahn, Ji-Eun; Guarino, Linda A; Zhu-Salzman, Keyan

    2010-02-26

    CmCatB, a cathepsin B-type cysteine protease, is insensitive to inhibition by the soybean cysteine protease inhibitor (scN). Cowpea bruchids dramatically induce CmCatB expression when major digestive proteases are inactivated by dietary scN, which is presumably an adaptive strategy that insects use to minimize effects of nutrient deficiency. In this study, we cloned the cowpea bruchid hepatocyte nuclear factor 4 (CmHNF-4) and demonstrated its involvement in transcriptional activation of CmCatB in the digestive tract of scN-adapted bruchids. Electrophoretic mobility shift assays demonstrated that CmHNF-4 binds to a CmCatB promoter region containing two tandem chicken ovalbumin upstream promoter (COUP) sites, which is also the cis-element for Seven-up (CmSvp), a previously identified transcriptional repressor of CmCatB. Although CmSvp is predominantly expressed in unadapted insect midgut, CmHNF-4 is more abundant in adapted bruchids. When transiently expressed in Drosophila S2 cells, CmHNF-4 substantially increased CmCatB expression through COUP binding. CmSvp inhibited CmHNF-4-mediated transcriptional activation even in the absence of its DNA-binding domain. Thus antagonism resulted, at least in part, from protein-protein interactions between CmSvp and CmHNF-4. Association of the two transcription factors was subsequently confirmed by glutathione S-transferase pulldown assays. Interestingly, anti-CmHNF-4 serum caused a supershift not only with nuclear extracts of scN-adapted insect midgut but with that of unadapted control insects as well. The presence of CmHNF-4 in unadapted insects further supported the idea that interplay between CmSvp and CmHNF-4 controls CmCatB transcription activation. Together, these results suggest that coordination between CmHNF-4 and CmSvp is important in counter-defense gene regulation in insects.

  1. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  2. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  3. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  4. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  5. Nonparallel changes of growth hormone (GH) and insulin-like growth factor-I, insulin-like growth factor binding protein-3, and GH-binding protein, after craniospinal irradiation and chemotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nivot, S.; Adan, L.; Souberbielle, J.

    1994-03-01

    The authors studied the GH-insulin-like growth factor-I (IGF-I) axis serially over 24-36 months in six patients with medulloblastoma who underwent surgical removal of the tumor followed by craniospinal irradiation therapy for 6 weeks and then chemotherapy for 42 weeks. Eighteen and 24 months after beginning irradiation there was a decline in the peak GH secretory response to acute stimulation with arginine/insulin hypoglycemia. Six months after irradiation and during chemotherapy there was a transient decline in IGF-I, IGF binding protein-3 (IGFBP-3), and GH-BP values (respective mean values of 56.1 {+-} 9.0 ng/mL, 1.1 {+-} 0.2 {mu}g/mL, and 7.6 {+-} 3.3% ofmore » radioactivity as compared to time 0 values: 139 {+-} 15 ng/mL, 2.2 {+-} 0.2 {mu}g/mL, and 20.0 {+-} 4.0%, P < 0.001), although provoked GH secretion was normal at this time. The IGF-I, IGFBP-3, and GH-BP returned to pretreatment ranges by 12-36 months after initiation of the study. There was also a decline in body mass index and serum protein values at 6 months after irradiation in ligand and immunoblot analysis there was a decline in IGFBP-3 and an abnormal electrophoretic mobility of IGFBP-2 that were both normalized at 36 months. In one patient they observed a high level of IGFBP-3 proteolysis at this time. This study demonstrates that before the decrease of GH secretion in patients receiving cranial irradiation there is a transient phase of GH insensitivity that may be characteristic of the acute therapeutic phase including the chemotherapy. This partial insensitivity may explain the early growth retardation observed in these patients. 28 refs., 4 figs., 1 tab.« less

  6. Male patients with partial androgen insensitivity syndrome: a longitudinal follow-up of growth, reproductive hormones and the development of gynaecomastia.

    PubMed

    Hellmann, Philip; Christiansen, Peter; Johannsen, Trine Holm; Main, Katharina M; Duno, Morten; Juul, Anders

    2012-05-01

    To describe the natural history of phenotype, growth and gonadal function in patients with partial androgen insensitivity syndrome. Tertiary paediatric endocrine centre. Retrospective evaluation of 14 male patients with partial androgen insensitivity syndrome (PAIS) with verified androgen receptor (AR) mutations. The authors recorded phenotypic characteristics at birth and external masculinisation score (EMS), registered longitudinal growth, circulating levels of testosterone, estradiol, luteinising hormone (LH), follicle-stimulating hormone (FSH), inhibin-B and sex hormone binding globulin (SHBG), in addition to phenotype at postpubertal follow up. The EMS ranged from 5 to 12 in PAIS at birth. Six patients were born with hypospadias and all patients developed gynaecomastia in puberty. Eight of the patients received testosterone treatment. At follow-up penile size was impaired irrespective of EMS at birth, but responded to pubertal androgen therapy in some of the patients. Serum levels of testosterone, estradiol, SHBG and LH, but not FSH and inhibin B, were markedly elevated in puberty. Final height was 181.3 cm (165.7-190.5 cm) corresponding to an SD score of 0.7 (-2.1 to +2.1 SD, n=10). Gynaecomastia and impaired phallic growth are frequently observed in adults with PAIS, but may be ameliorated by androgen therapy. The authors suggest that male patients presenting with gynaecomastia in puberty, and elevated circulating levels of testosterone, estradiol and LH in puberty, but normal FSH, should be suspected of having PAIS and undergo genetic testing for AR mutations.

  7. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  8. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse)

    PubMed Central

    Zhou, Yihua; Xu, Bixiong C.; Maheshwari, Hiralal G.; He, Li; Reed, Michael; Lozykowski, Maria; Okada, Shigeru; Cataldo, Lori; Coschigamo, Karen; Wagner, Thomas E.; Baumann, Gerhard; Kopchick, John J.

    1997-01-01

    Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans. PMID:9371826

  9. A mammalian model for Laron syndrome produced by targeted disruption of the mouse growth hormone receptor/binding protein gene (the Laron mouse).

    PubMed

    Zhou, Y; Xu, B C; Maheshwari, H G; He, L; Reed, M; Lozykowski, M; Okada, S; Cataldo, L; Coschigamo, K; Wagner, T E; Baumann, G; Kopchick, J J

    1997-11-25

    Laron syndrome [growth hormone (GH) insensitivity syndrome] is a hereditary dwarfism resulting from defects in the GH receptor (GHR) gene. GHR deficiency has not been reported in mammals other than humans. Many aspects of GHR dysfunction remain unknown because of ethical and practical limitations in studying humans. To create a mammalian model for this disease, we generated mice bearing a disrupted GHR/binding protein (GHR/BP) gene through a homologous gene targeting approach. Homozygous GHR/BP knockout mice showed severe postnatal growth retardation, proportionate dwarfism, absence of the GHR and GH binding protein, greatly decreased serum insulin-like growth factor I and elevated serum GH concentrations. These characteristics represent the phenotype typical of individuals with Laron syndrome. Animals heterozygous for the GHR/BP defect show only minimal growth impairment but have an intermediate biochemical phenotype, with decreased GHR and GH binding protein expression and slightly diminished insulin-like growth factor I levels. These findings indicate that the GHR/BP-deficient mouse (Laron mouse) is a suitable model for human Laron syndrome that will prove useful for the elucidation of many aspects of GHR/BP function that cannot be obtained in humans.

  10. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  11. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  12. Role of a Transcriptional Regulator in Programmed Cell Death and Plant Development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Julie M. Stone

    2008-09-13

    The long-term goal of this research is to understand the role(s) and molecular mechanisms of programmed cell death (PCD) in the controlling plant growth, development and responses to biotic and abiotic stress. We developed a genetic selection scheme to identify A. thaliana FB1-resistant (fbr) mutants as a way to find genes involved in PCD (Stone et al., 2000; Stone et al., 2005; Khan and Stone, 2008). The disrupted gene in fbr6 (AtSPL14) responsible for the FB1-insensitivity and plant architecture phenotypes encodes a plant-specific SBP DNA-binding domain transcriptional regulator (Stone et al., 2005; Liang et al., 2008). This research plan ismore » designed to fill gaps in the knowledge about the role of SPL14 in plant growth and development. The work is being guided by three objectives aimed at determining the pathways in which SPL14 functions to modulate PCD and/or plant development: (1) determine how SPL14 functions in plant development, (2) identify target genes that are directly regulated by SPL14, and (3) identify SPL14 modifications and interacting proteins. We made significant progress during the funding period. Briefly, some major accomplishments are highlighted below: (1) To identify potential AtSPL14 target genes, we identified a consensus DNA binding site for the AtSPL14 SBP DNA-binding domain using systematic evolution of ligands by exponential selection (SELEX) and site-directed mutagenesis (Liang et al., 2008). This consensus binding site was used to analyze Affymetrix microarray gene expression data obtained from wild-type and fbr6 mutant plants to find possible AtSPL14-regulated genes. These candidate AtSPL14-regulated genes are providing new information on the molecular mechanisms linking plant PCD and plant development through modulation of the 26S proteasome. (2) Transgenic plants expressing epitope-tagged versions of AtSPL14 are being used to confirm the AtSPL14 targets (by ChIP-PCR) and further dissect the molecular interactions (Nazarenus, Liang and Stone, in preparation) (3) Double mutants generated between fbr6 and various accelerated cell death (acd) mutants indicate that sphingolipid metabolism is influenced by AtSPL14 and sphingolipidomics profiling supports this conclusion (Lin, Markham and Stone, in preparation). (4) A new set of phenotypes have been uncovered in the original fbr6-1 mutant, including a short-root phenotype related to auxin signaling and altered photosynthetic parameters related to stomatal density and conductance (Lin and Stone, in preparation; Lin, Madhavan and Stone, in preparation). Additional AtSPL14-related mutants and transgenic plants have been generated to effectively dissect the functions of AtSPL14, including a dominant negative fbr6-2 allele and transgenic plants overexpressing FBR6/AtSPL14 that display an accelerated cell death (acd) phenotype.« less

  13. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  14. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  16. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  17. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  18. An Aryl Hydrocarbon Receptor from the Salamander Ambystoma mexicanum Exhibits Low Sensitivity to 2,3,7,8-Tetrachlorodibenzo-p-dioxin.

    PubMed

    Shoots, Jenny; Fraccalvieri, Domenico; Franks, Diana G; Denison, Michael S; Hahn, Mark E; Bonati, Laura; Powell, Wade H

    2015-06-02

    Structural features of the aryl hydrocarbon receptor (AHR) can underlie species- and population-specific differences in its affinity for 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). These differences often explain variations in TCDD toxicity. Frogs are relatively insensitive to dioxin, and Xenopus AHRs bind TCDD with low affinity. Weak TCDD binding results from the combination of three residues in the ligand-binding domain: A354 and A370, and N325. Here we sought to determine whether this mechanism of weak TCDD binding is shared by other amphibian AHRs. We isolated an AHR cDNA from the Mexican axolotl (Ambystoma mexicanum). The encoded polypeptide contains identical residues at positions that confer low TCDD affinity to X. laevis AHRs (A364, A380, and N335), and homology modeling predicts they protrude into the binding cavity. Axolotl AHR bound one-tenth the TCDD of mouse AHR in velocity sedimentation analysis, and in transactivation assays, the EC50 for TCDD was 23 nM, similar to X. laevis AHR1β (27 nM) and greater than AHR containing the mouse ligand-binding domain (0.08 nM). Sequence, modeled structure, and function indicate that axolotl AHR binds TCDD weakly, predicting that A. mexicanum lacks sensitivity toTCDD toxicity. We hypothesize that this characteristic of axolotl and Xenopus AHRs arose in a common ancestor of the Caudata and Anura.

  19. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  20. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  1. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  2. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  3. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  4. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  5. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  6. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  7. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  8. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  9. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  10. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  11. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  12. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  13. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  14. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  15. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  16. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  17. Dual DNA binding property of ABA insensitive 3 like factors targeted to promoters responsive to ABA and auxin.

    PubMed

    Nag, Ronita; Maity, Manas Kanti; Dasgupta, Maitrayee

    2005-11-01

    The ABA responsive ABI3 and the auxin responsive ARF family of transcription factors bind the CATGCATG (Sph) and TGTCTC core motifs in ABA and auxin response elements (ABRE and AuxRE), respectively. Several evidences indicate ABI3s to act downstream to auxin too. Because DNA binding domain of ABI3s shows significant overlap with ARFs we enquired whether auxin responsiveness through ABI3s could be mediated by their binding to canonical AuxREs. Investigations were undertaken through in vitro gel mobility shift assays (GMSA) using the DNA binding domain B3 of PvAlf (Phaseolus vulgaris ABI3 like factor) and upstream regions of auxin responsive gene GH3 (-267 to -141) and ABA responsive gene Em (-316 to -146) harboring AuxRE and ABRE, respectively. We demonstrate that B3 domain of PvAlf could bind AuxRE only when B3 was associated with its flanking domain B2 (B2B3). Such strict requirement of B2 domain was not observed with ABRE, where B3 could bind with or without being associated with B2. This dual specificity in DNA binding of ABI3s was also demonstrated with nuclear extracts of cultured cells of Arachis hypogea. Supershift analysis of ABRE and AuxRE bound nuclear proteins with antibodies raised against B2B3 domains of PvAlf revealed that ABI3 associated complexes were detectable in association with both cis elements. Competition GMSA confirmed the same complexes to bind ABRE and AuxRE. This dual specificity of ABI3 like factors in DNA binding targeted to natural promoters responsive to ABA and auxin suggests them to have a potential role in conferring crosstalk between these two phytohormones.

  18. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  19. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  20. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  1. Non-local electron transport through normal and topological ladder-like atomic systems

    NASA Astrophysics Data System (ADS)

    Kurzyna, Marcin; Kwapiński, Tomasz

    2018-05-01

    We propose a locally protected ladder-like atomic system (nanoconductor) on a substrate that is insensitive to external perturbations. The system corresponds to coupled atomic chains fabricated on different surfaces. Electron transport properties of such conductors are studied theoretically using the model tight-binding Su-Schriffer-Hegger (SSH) Hamiltonian and Green's function formalism. We have found that the conductance of the system is almost insensitive to single adatoms and oscillates as a function of the side chain length with very large periods. Non-local character of the electron transport was observed also for topological SSH chains where nontrivial end states survive in the presence of disturbances as well as for different substrates. We have found that the careful inspection of the density of states or charge waves can provide the information about the atom energy levels and hopping amplitudes. Moreover, the ladder-like geometry allows one to distinguish between normal and topological zero-energy states. It is important that topological chains do not reveal Friedel oscillations which are observed in non-topological chains.

  2. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  3. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  4. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  5. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  6. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  7. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  8. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  9. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  10. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  11. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  12. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  13. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  14. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  15. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  16. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  17. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  18. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  19. AR mutations in 28 patients with androgen insensitivity syndrome (Prader grade 0-3).

    PubMed

    Wang, Yi; Gong, Chunxiu; Wang, Xiou; Qin, Miao

    2017-07-01

    We investigated the androgen receptor (AR) gene mutation profiles of Chinese patients exhibiting severe androgen insensitivity syndrome (AIS) phenotypes. The present study enrolled 28 patients with genetically diagnosed AIS, who presented with severe phenotypes (Prader grade 0-3). Patients and some family members were screened via amplification and sequencing of their AR exons 1-8, including the corresponding intronic flanking regions. Luteinizing (LH), follicle-stimulating (FSH), and testosterone (T) hormone levels were found to be slightly, but not significantly, higher in patients with complete androgen insensitivity syndrome (CAIS) than in patients with partial androgen insensitivity syndrome (PAIS) (P>0.05). We identified 24 different AR mutations, including 12 that were novel. Ten patients (cases 2, 3, 10, 28, 11, 12, 19, 20, 24, and 25) were found to carry five recurrent mutations (p.Y572S, p.P914S, p.S176R, p.Y782N, and p.R841H); of these, p.Y572S, p.S176R, and p.Y782N were novel. Among the mutations identified in patients with CAIS, six (66.7%) were characterized as single-nucleotide missense mutations, and six (66.7%) were found to be located in the AR ligand-binding domain (LBD). Among the mutations identified in patients with PAIS, 15 (93.8%) were found to be missense, and 11 (68.8%) were found to be located in the LBD. Patients 10 and 28 were determined to harbor the same missense mutation (p.P914S), but were diagnosed with CAIS and PAIS, respectively. Sex hormone levels were slightly, but not significantly, elevated in patients with CAIS compared to those with PAIS. Missense mutations spanning AR exons 1-8 were the predominant form of identified mutations, and these were mostly located in the AR LBD. Approximately 50% of the identified mutations were novel, and have enriched the AR gene-mutation database. Patients harboring identical mutations were in some instances found to exhibit divergent phenotypes.

  20. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  1. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  2. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  3. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  4. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  6. The rice YABBY4 gene regulates plant growth and development through modulating the gibberellin pathway.

    PubMed

    Yang, Chao; Ma, Yamei; Li, Jianxiong

    2016-10-01

    YABBY genes encode seed plant-specific transcription factors that play pivotal roles in diverse aspects of leaf, shoot, and flower development. Members of the YABBY gene family are primarily expressed in lateral organs in a polar manner and function to specify abaxial cell fate in dicotyledons, but this polar expression is not conserved in monocotyledons. The function of YABBY genes is therefore not well understood in monocotyledons. Here we show that overexpression of the rice (Oryza sativa L.) YABBY4 gene (OsYABBY4) leads to a semi-dwarf phenotype, abnormal development in the uppermost internode, an increased number of floral organs, and insensitivity to gibberellin (GA) treatment. We report on an important role for OsYABBY4 in negative control of the expression of a GA biosynthetic gene by binding to the promoter region of the gibberellin 20-oxidase 2 gene (GA20ox2), which is a direct target of SLR1 (the sole DELLA protein negatively controlling GA responses in rice). OsYABBY4 also suppresses the expression level of SLR1 and interacts with SLR1 protein. The interaction inhibits GA-dependent degradation of SLR1 and therefore leads to GA insensitivity. These data together suggest that OsYABBY4 serves as a DNA-binding intermediate protein for SLR1 and is associated with the GA signaling pathway regulating gene expression during plant growth and development. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  7. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  8. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  10. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  11. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  12. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  13. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  14. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  15. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  16. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  17. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  18. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  19. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  20. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  1. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  2. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  3. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  5. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  6. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  7. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  8. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  10. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  11. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  12. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  13. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  14. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  15. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  16. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  17. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  18. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  19. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  20. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  1. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  2. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  3. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  5. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  6. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  7. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  8. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  9. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  10. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  11. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  12. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  13. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  14. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  15. The C8-binding protein of human erythrocytes: interaction with the components of the complement-attack phase.

    PubMed Central

    Schönermark, S; Filsinger, S; Berger, B; Hänsch, G M

    1988-01-01

    C8-binding protein is an intrinsic membrane protein of the human erythrocyte. It inhibits the complement (C5b-9)-mediated lysis in a species-restricting manner. In the present study we incorporated C8bp, isolated from human erythrocytes, into sheep erythrocytes (SRBC). SRBC, normally sensitive to lysis by human C5b-9, became insensitive to lysis. Furthermore, we found that C8bp is incorporated into the membrane-attack complex C5b-9, most probably by interacting with C8, since C8bp has an affinity for C8, particularly for the C8 alpha-gamma-subunit. Antibodies to C8bp react with the C8 alpha-subunits and with C9, pointing to the possibility of a partial homology between these proteins. Images Figure 4 Figure 6 Figure 7 PMID:3366469

  16. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  17. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  18. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  19. Two classes of binding sites for [3H]substance P in rat cerebral cortex.

    PubMed

    Geraghty, D P; Burcher, E

    1993-01-22

    The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

Top