The Impact of Preoperative α-Adrenergic Antagonists on Ureteral Access Sheath Insertion Force and the Upper Limit of Force Required to Avoid Ureteral Mucosal Injury: A Randomized Controlled Study.

PubMed

Koo, Kyo Chul; Yoon, Jun-Ho; Park, No-Cheol; Lee, Hye Sun; Ahn, Hyun Kyu; Lee, Kwang Suk; Kim, Do Kyung; Cho, Kang Su; Chung, Byung Ha; Hong, Chang Hee

2018-06-01

Excessive bulking force during primary access of the ureteral access sheath may induce ureteral injury. We investigated the efficacy of preoperative α-blockade to reduce ureteral access sheath insertion force and determine the upper limit required to avoid ureteral injury. In this randomized controlled trial 135 patients from a single institution who had ureteropelvic junction or renal pelvis stones and were scheduled to undergo retrograde intrarenal surgery were prospectively enrolled from December 2015 to January 2017. Of the patients 41 and 42 were randomly assigned to the control and experimental groups, respectively. The experimental group received α-blockade preoperatively. The 21 patients who were pre-stented were assessed separately. We developed a homemade device to measure maximal ureteral access sheath insertion force. Our ureteral access sheath insertion force measurement device showed excellent reproducibility. Higher insertion velocity resulted in greater maximal sheath insertion force. Maximal insertion force in the α-blockade group was significantly lower than in the control group at the ureterovesical junction (p = 0.008) and the proximal ureter (p = 0.036). Maximal insertion force in the α-blockade group was comparable to that in pre-stented patients. Female patients and patients 70 years old or older showed a lower maximal ureteral access sheath insertion force than their counterparts. The rate of grade 2 or greater ureteral injury was lower in the α-blockade group than in controls (p = 0.038). No injury occurred in any case in which ureteral access sheath insertion force did not exceed 600 G. Preoperative α-blockade and slow sheath placement may reduce maximal ureteral access sheath insertion force. If the force exceeds 600 G, a smaller diameter sheath may be an alternative. Alternatively the procedure can be terminated and followed later by pre-stented retrograde intrarenal surgery. Copyright © 2018 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

PubMed

Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

2014-04-09

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

PubMed Central

Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

2014-01-01

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

Full-length and defective enterovirus G genomes with distinct torovirus protease insertions are highly prevalent on a Chinese pig farm.

PubMed

Wang, Yan; Zhang, Wen; Liu, Zhijian; Fu, Xingli; Yuan, Jiaqi; Zhao, Jieji; Lin, Yuan; Shen, Quan; Wang, Xiaochun; Deng, Xutao; Delwart, Eric; Shan, Tongling; Yang, Shixing

2018-05-21

Recombination occurs frequently between enteroviruses (EVs) which are classified within the same species of the Picornaviridae family. Here, using viral metagenomics, the genomes of two recombinant EV-Gs (strains EVG 01/NC_CHI/2014 and EVG 02/NC_CHI/2014) found in the feces of pigs from a swine farm in China are described. The two strains are characterized by distinct insertion of a papain-like protease gene from toroviruses classified within the Coronaviridae family. According to recent reports the site of the torovirus protease insertion was located at the 2C/3A junction region in EVG 02/NC_CHI/2014. For the other variant EVG 01/NC_CHI/2014, the inserted protease sequence replaced the entire viral capsid protein region up to the VP1/2A junction. These two EV-G strains were highly prevalent in the same pig farm with all animals shedding the full-length genome (EVG 02/NC_CHI/2014) while 65% also shed the capsid deletion mutant (EVG 01/NC_CHI/2014). A helper-defective virus relationship between the two co-circulating EV-G recombinants is hypothesized.

Endoscopic Removal of a Nitinol Mesh Stent from the Ureteropelvic Junction after 15 Years

PubMed Central

Smrkolj, Tomaž; Šalinović, Domagoj

2015-01-01

We report a rare case of a patient with a large stone encrusted on a nitinol mesh stent in the ureteropelvic junction. The stent was inserted in the year 2000 after failure of two pyeloplasty procedures performed due to symptomatic ureteropelvic junction stenosis. By combining minimally invasive urinary stone therapies—extracorporeal shock wave lithotripsy, semirigid ureterorenoscopy with laser lithotripsy, and percutaneous nephrolithotomy—it was possible to completely remove the encrusted stone and nitinol mesh stent that was implanted for 15 years, rendering the patient symptom and obstruction free. PMID:26697258

Rapid synthesis of acetylcholine receptors at neuromuscular junctions.

PubMed

Ramsay, D A; Drachman, D B; Pestronk, A

1988-10-11

The rate of acetylcholine receptor (AChR) degradation in mature, innervated mammalian neuromuscular junctions has recently been shown to be biphasic; up to 20% are rapidly turned over (RTOs; half life less than 1 day) whereas the remainder are lost more slowly ('stable' AChRs; half life 10-12 days). In order to maintain normal junctional receptor density, synthesis and insertion of AChRs should presumably be sufficiently rapid to replace both the RTOs and the stable receptors. We have tested this prediction by blocking pre-existing AChRs in the mouse sternomastoid muscle with alpha-bungarotoxin (alpha-BuTx), and monitoring the subsequent appearance of 'new' junctional AChRs at intervals of 3 h to 20 days by labeling them with 125I-alpha-BuTx. The results show that new receptors were initially inserted rapidly (16% at 24 h and 28% at 48 h). The rate of increase of 'new' 125I-alpha-BuTx binding sites gradually slowed down during the remainder of the time period studied. Control observations excluded possible artifacts of the experimental procedure including incomplete blockade of AChRs, dissociation of toxin-receptor complexes, or experimentally induced alteration of receptor synthesis. The present demonstration of rapid synthesis and incorporation of AChRs at innervated neuromuscular junctions provides support for the concept of a subpopulation of rapidly turned over AChRs. The RTOs may serve as precursors for the larger population of stable receptors and have an important role in the metabolism of the neuromuscular synapse.

Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy.

PubMed

Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.

Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

PubMed Central

Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020

Design and Photovoltaic Properties of Graphene/Silicon Solar Cell

NASA Astrophysics Data System (ADS)

Xu, Dikai; Yu, Xuegong; Yang, Lifei; Yang, Deren

2018-04-01

Graphene/silicon (Gr/Si) Schottky junction solar cells have attracted widespread attention for the fabrication of high-efficiency and low-cost solar cells. However, their performance is still limited by the working principles of Schottky junctions. Modulating the working mechanism of the solar cells into a quasi p-n junction has advantages, including higher open-circuit voltage (V OC) and less carrier recombination. In this study, Gr/Si quasi p-n junction solar cells were formed by inserting a tunneling Al2O3 interlayer in-between graphene and silicon, which led to obtain the PCE up to 8.48% without antireflection or chemical doping techniques. Our findings could pave a new way for the development of Gr/Si solar cells.

Role of interface layers on Tunneling Magnetoresistance

NASA Astrophysics Data System (ADS)

Yang, See-Hun; Samant, Mahesh; Parkin, Stuart S. P.

2002-03-01

Thin non-magnetic metallic layers inserted at the interface between tunneling barriers and the ferromagnetic electrodes in magnetic tunnel junctions quenches the magnetoresistance (TMR) exhibited by some structures[1]. Studies have been carried out on exchange biased magnetic tunnel junction structures in which one of the ferromagnetic electrodes is pinned by coupling to IrMn or PtMn antiferromagnetic layers. For metallic aluminum interface layers thicknesses of just a few angstrom completely suppress the TMR although this characteristic thickness depends on the roughness of the tunneling barrier. A variety of structures will be discussed in which a number of interface layers have been introduced. In particular results for insertion of Cu, Ru and Cr layers on either side of the tunnel barrier will be presented. A number of techniques including XANES, XMCD and high resolution cross-section transmission electron microscopy have been used to study the structure and morphology of the interface layers and to correlate the structure of these layers with the magneto-transport properties of the tunneling junctions. [1] S.S.P. Parkin, US patent 5,764,567 issued by the United States Patent and Trademark Office, June 9, 1998.

Enhanced Data Authentication System v. 2.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, Maikael A.; Tolsch, Brandon Jeffrey; Schwartz, Steven Robert

EDAS is a system, comprised on hardware and software, that plugs in to an existing data stream, and branches all data for transmission to a secondary observer computer. The EDAS Junction box, which inserts into the data stream, has Java software that forms these data into packets, digitally signs, encrypts, and sends these packets to a safeguards inspector computer. Further, there is a second Java program running on the secondary observer computer that receives data from the EDAS Junction Box to decrypt, authenticate, and store incoming packets. Also, there is a stand-alone Java program that is used to configure themore » EDAS Junction Box.« less

ER-plasma membrane junctions: Why and how do we study them?

PubMed

Chang, Chi-Lun; Chen, Yu-Ju; Liou, Jen

2017-09-01

Endoplasmic reticulum (ER)-plasma membrane (PM) junctions are membrane microdomains important for communication between the ER and the PM. ER-PM junctions were first reported in muscle cells in 1957, but mostly ignored in non-excitable cells due to their scarcity and lack of functional significance. In 2005, the discovery of stromal interaction molecule 1 (STIM1) mediating a universal Ca 2+ feedback mechanism at ER-PM junctions in mammalian cells led to a resurgence of research interests toward ER-PM junctions. In the past decade, several major advancements have been made in this emerging topic in cell biology, including the generation of tools for labeling ER-PM junctions and the unraveling of mechanisms underlying regulation and functions of ER-PM junctions. This review summarizes early studies, recently developed tools, and current advances in the characterization and understanding of ER-PM junctions. This article is part of a Special Issue entitled: Membrane Contact Sites edited by Christian Ungermann and Benoit Kornmann. Copyright © 2017 Elsevier B.V. All rights reserved.

Effects of Spaceflight on the Attachment of Muscle to the Tibia, Fibula and Calcaneus

NASA Technical Reports Server (NTRS)

Johnson, R. B.; Tsao, A. K.; St.John, K. R.; Betcher, R. A.; Tucci, M. A.; Parsell, D. E.; Dai, X.; Zardiackas, L. D.; Benghuzzi, H. A.

1999-01-01

Microgravity significantly reduces transmission of ground-reaction forces to bones, promoting atrophy. There is little information available concerning the effects of microgravity on bones at sites where anti-gravity muscles are attached (tendon-bone junctions). This study evaluates the effects of microgravity on the origin and insertion sites of anti-gravity muscles on the rat tibia, fibula and calcaneus. Changes in the strength of those tendon-bone junctions could predispose the animal to injury following spaceflight.

Traumatic Tear of the Latissimus Dorsi Myotendinous Junction

PubMed Central

Friedman, Michael V.; Stensby, J. Derek; Hillen, Travis J.; Demertzis, Jennifer L.; Keener, Jay D.

2015-01-01

A case of a latissimus dorsi myotendinous junction strain in an avid CrossFit athlete is presented. The patient developed acute onset right axillary burning and swelling and subsequent palpable pop with weakness while performing a “muscle up.” Magnetic resonance imaging examination demonstrated a high-grade tear of the right latissimus dorsi myotendinous junction approximately 9 cm proximal to its intact humeral insertion. There were no other injuries to the adjacent shoulder girdle structures. Isolated strain of the latissimus dorsi myotendinous junction is a very rare injury with a scarcity of information available regarding its imaging appearance and preferred treatment. This patient was treated conservatively and was able to resume active CrossFit training within 3 months. At 6 months postinjury, he had only a mild residual functional deficit compared with his preinjury level. PMID:26502450

SETA Support for the DARPA Microelectronics Technology Insertion Program of the Microelectronics Technology Office

DTIC Science & Technology

1992-08-17

Conclusions. Key personnel planned and administered the 193-nm lithography SBIR workshop on May 7, 1992 as well as planned the GaAs Insertion...converters can use Josephson junctions (JJ) to improve performance. Superconductive quantum interference devices (SQUIDs), such as JJs, are used to form...forward control of a lithography stepper. Mark Conner at Booz-Allen has copies of the charts. You should take a few minutes to review them. I asked Costos

CSReport: A New Computational Tool Designed for Automatic Analysis of Class Switch Recombination Junctions Sequenced by High-Throughput Sequencing.

PubMed

Boyer, François; Boutouil, Hend; Dalloul, Iman; Dalloul, Zeinab; Cook-Moreau, Jeanne; Aldigier, Jean-Claude; Carrion, Claire; Herve, Bastien; Scaon, Erwan; Cogné, Michel; Péron, Sophie

2017-05-15

B cells ensure humoral immune responses due to the production of Ag-specific memory B cells and Ab-secreting plasma cells. In secondary lymphoid organs, Ag-driven B cell activation induces terminal maturation and Ig isotype class switch (class switch recombination [CSR]). CSR creates a virtually unique IgH locus in every B cell clone by intrachromosomal recombination between two switch (S) regions upstream of each C region gene. Amount and structural features of CSR junctions reveal valuable information about the CSR mechanism, and analysis of CSR junctions is useful in basic and clinical research studies of B cell functions. To provide an automated tool able to analyze large data sets of CSR junction sequences produced by high-throughput sequencing (HTS), we designed CSReport, a software program dedicated to support analysis of CSR recombination junctions sequenced with a HTS-based protocol (Ion Torrent technology). CSReport was assessed using simulated data sets of CSR junctions and then used for analysis of Sμ-Sα and Sμ-Sγ1 junctions from CH12F3 cells and primary murine B cells, respectively. CSReport identifies junction segment breakpoints on reference sequences and junction structure (blunt-ended junctions or junctions with insertions or microhomology). Besides the ability to analyze unprecedentedly large libraries of junction sequences, CSReport will provide a unified framework for CSR junction studies. Our results show that CSReport is an accurate tool for analysis of sequences from our HTS-based protocol for CSR junctions, thereby facilitating and accelerating their study. Copyright © 2017 by The American Association of Immunologists, Inc.

Effectiveness of the levonorgestrel-releasing intrauterine system in the treatment of adenomyosis diagnosed and monitored by magnetic resonance imaging.

PubMed

Bragheto, Aristides M; Caserta, Nelson; Bahamondes, Luis; Petta, Carlos A

2007-09-01

This study was conducted to evaluate the effect of the levonorgestrel-releasing intrauterine system (LNG-IUS) on adenomyotic lesions diagnosed and monitored by magnetic resonance imaging (MRI). LNG-IUS was inserted during menstrual bleeding in 29 women, 24 to 46 years of age, with MRI-diagnosed adenomyosis associated with menorrhagia and dysmenorrhea. Clinical evaluations were carried out at baseline and at 3 and 6 months postinsertion. MRI was performed at baseline and at 6 months postinsertion and was used to calculate junctional zone thickness (in mm), to define the junctional zone borders, to identify the presence of high-signal foci on T(2)-weighted images and to calculate uterine volume (in mL). A significant reduction of 24.2% in junctional zone thickness was observed (p<.0001); however, no significant decrease in uterine volume was observed (142.6 mL vs. 136.4 mL; p=.2077) between baseline and the 6-month evaluation. A significant decrease in pain score was observed at 3 and 6 months after insertion (p<.0001); however, six women continued to report pain scores >3 at 6 months of observation. At 3 months of use, the most common bleeding pattern was spotting, and at 6 months of observation, oligomenorrhea was the most common pattern observed, although spotting was present in one third of the women. The insertion of an LNG-IUS led to a reduction in pain and abnormal bleeding associated with adenomyosis. MRI was useful for monitoring response of adenomyotic lesions to the LNG-IUS.

Controlled carrier screening in p-n NiO/GaN piezoelectric generators by an Al2O3 insertion layer

NASA Astrophysics Data System (ADS)

Johar, Muhammad Ali; Jeong, Dae Kyung; Afifi Hassan, Mostafa; Kang, Jin-Ho; Ha, Jun-Seok; Key Lee, June; Ryu, Sang-Wan

2017-12-01

The performance of a piezoelectric generator (PG) depends significantly on the internal screening process inside the device. As piezoelectric charges appear on both ends of the piezoelectric crystal, internal screening starts to decrease the piezoelectric bias. Therefore, the piezoelectric energy generated by external stress is not fully utilized by external circuit, which is the most challenging aspect of high-efficiency PGs. In this work, the internal screening effect of a NiO/GaN p-n PG was analyzed and controlled with an Al2O3 insertion layer. Internal screening in the p-n diode PG was categorized into free-carrier screening in neutral regions and junction screening due to charge drift across the junction. It was observed that junction screening could be significantly suppressed by inserting an Al2O3 layer and that effect was dominant in a leaky diode PG. With this implementation, the piezoelectric bias of the NiO/GaN PG was improved by a factor of ~100 for high-leakage diodes and a factor of ~1.6 for low-leakage diodes. Consequently, NiO/Al2O3/GaN PGs under a stress of 5 MPa provided a piezoelectric bias of 12.1 V and a current density of 2.25 µA cm-2. The incorporation of a highly resistive Al2O3 layer between p-NiO and n-GaN layers in NiO/GaN heterojunctions provides an efficient means of improving the piezoelectric performance by controlling the internal screening of the piezoelectric field.

Transoesophageal echocardiographic evaluation of central venous catheter positioning using Peres' formula or a radiological landmark-based approach: a prospective randomized single-centre study.

PubMed

Ahn, J H; Kim, I S; Yang, J H; Lee, I G; Seo, D H; Kim, S P

2017-02-01

The lower superior vena cava (SVC), near its junction with the right atrium (RA), is considered the ideal location for the central venous catheter tip to ensure proper function and prevent injuries. We determined catheter insertion depth with a new formula using the sternoclavicular joint and the carina as radiological landmarks, with a 1.5 cm safety margin. The accuracy of tip positioning with the radiological landmark-based technique (R) and Peres' formula (P) was compared using transoesophageal echocardiography. Real-time ultrasound-guided central venous catheter insertion was done through the right internal jugular or subclavian vein. Patients were randomly assigned to either the P group (n=93) or the R group (n=95). Optimal catheter tip position was considered to be within 2 cm above and 1 cm below the RA-SVC junction. Catheter tip position, abutment, angle to the vascular wall, and flow stream were evaluated on a bicaval view. The distance from the skin insertion point to the RA-SVC junction and determined depth of catheter insertion were more strongly correlated in the R group [17.4 (1.2) and 16.7 (1.5) cm; r=0.821, P<0.001] than in the P group [17.3 (1.2) and 16.4 (1.1) cm; r=0.517, P<0.001], with z=3.96 (P<0.001). More tips were correctly positioned in the R group than in the P group (74 vs 93%, P=0.001). Abutment, tip angle to the lateral wall >40°, and disrupted flow stream were comparable. Catheter tip position was more accurate with a radiological landmark-based technique than with Peres' formula. Clinical Trial Registry of Korea: https://cris.nih.go.kr/cris/index.jsp KCT0001937. © The Author 2017. Published by Oxford University Press on behalf of the British Journal of Anaesthesia. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Net Fluorescein Flux Across Corneal Endothelium Strongly Suggests Fluid Transport is due to Electro-osmosis.

PubMed

Sanchez, J M; Cacace, V; Kusnier, C F; Nelson, R; Rubashkin, A A; Iserovich, P; Fischbarg, J

2016-08-01

We have presented prior evidence suggesting that fluid transport results from electro-osmosis at the intercellular junctions of the corneal endothelium. Such phenomenon ought to drag other extracellular solutes. We have investigated this using fluorescein-Na2 as an extracellular marker. We measured unidirectional fluxes across layers of cultured human corneal endothelial (HCE) cells. SV-40-transformed HCE layers were grown to confluence on permeable membrane inserts. The medium was DMEM with high glucose and no phenol red. Fluorescein-labeled medium was placed either on the basolateral or the apical side of the inserts; the other side carried unlabeled medium. The inserts were held in a CO2 incubator for 1 h (at 37 °C), after which the entire volume of the unlabeled side was collected. After that, label was placed on the opposite side, and the corresponding paired sample was collected after another hour. Fluorescein counts were determined with a (Photon Technology) DeltaScan fluorometer (excitation 380 nm; emission 550 nm; 2 nm bwth). Samples were read for 60 s. The cells utilized are known to transport fluid from the basolateral to the apical side, just as they do in vivo in several species. We used 4 inserts for influx and efflux (total: 20 1-h periods). We found a net flux of fluorescein from the basolateral to the apical side. The flux ratio was 1.104 ± 0.056. That difference was statistically significant (p = 0.00006, t test, paired samples). The endothelium has a definite restriction at the junctions. Hence, an asymmetry in unidirectional fluxes cannot arise from osmosis, and can only point instead to paracellular solvent drag. We suggest, once more, that such drag is due to electro-osmotic coupling at the paracellular junctions.

Electron optics with ballistic graphene junctions

NASA Astrophysics Data System (ADS)

Chen, Shaowen

Electrons transmitted across a ballistic semiconductor junction undergo refraction, analogous to light rays across an optical boundary. A pn junction theoretically provides the equivalent of a negative index medium, enabling novel electron optics such as negative refraction and perfect (Veselago) lensing. In graphene, the linear dispersion and zero-gap bandstructure admit highly transparent pn junctions by simple electrostatic gating, which cannot be achieved in conventional semiconductors. Robust demonstration of these effects, however, has not been forthcoming. Here we employ transverse magnetic focusing to probe propagation across an electrostatically defined graphene junction. We find perfect agreement with the predicted Snell's law for electrons, including observation of both positive and negative refraction. Resonant transmission across the pn junction provides a direct measurement of the angle dependent transmission coefficient, and we demonstrate good agreement with theory. Comparing experimental data with simulation reveals the crucial role played by the effective junction width, providing guidance for future device design. Efforts toward sharper pn junction and possibility of zero field Veselago lensing will also be discussed. This work is supported by the Semiconductor Research Corporations NRI Center for Institute for Nanoelectronics Discovery and Exploration (INDEX).

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Linear response formulism of a carbon nano-onion stringed to gold electrodes

NASA Astrophysics Data System (ADS)

Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick

2017-04-01

Density functional theory is used to investigate the electronic state of a carbon nano-onion conglobated by endohedral-ing the highly curved C20 fullerene within its parent fullerene C60. The Non-Equilibrium Green's Function is later employed to examine the quantum transport when the carbon nano-onion, C20@C60 is stringed to the pair of gold electrodes of (001) plane. The computed results are evaluated and compared with C20 and C60 junctions. The calculated electronic parameters of these molecular junctions are utilized to extrapolate their two electrical parameters: current and conductance. The carbon nano-onion junction assembled from the C20 and C60 molecules displays the combined effect of their molecular junctions when organized separately. Also, the insertion of C20 molecule in the hollow cavity of C60 fullerene leads to the enhancement of its current and conductance in carbon nano-onion junction formed, when compared to the one constructed otherwise.

Spin-transfer torque in spin filter tunnel junctions

NASA Astrophysics Data System (ADS)

Ortiz Pauyac, Christian; Kalitsov, Alan; Manchon, Aurelien; Chshiev, Mairbek

2014-12-01

Spin-transfer torque in a class of magnetic tunnel junctions with noncollinear magnetizations, referred to as spin filter tunnel junctions, is studied within the tight-binding model using the nonequilibrium Green's function technique within Keldysh formalism. These junctions consist of one ferromagnet (FM) adjacent to a magnetic insulator (MI) or two FM separated by a MI. We find that the presence of the magnetic insulator dramatically enhances the magnitude of the spin-torque components compared to conventional magnetic tunnel junctions. The fieldlike torque is driven by the spin-dependent reflection at the MI/FM interface, which results in a small reduction of its amplitude when an insulating spacer (S) is inserted to decouple MI and FM layers. Meanwhile, the dampinglike torque is dominated by the tunneling electrons that experience the lowest barrier height. We propose a device of the form FM/(S)/MI/(S)/FM that takes advantage of these characteristics and allows for tuning the spin-torque magnitudes over a wide range just by rotation of the magnetization of the insulating layer.

Spin transport and spin accumulation signals in Si studied in tunnel junctions with a Fe/Mg ferromagnetic multilayer and an amorphous SiOxNy tunnel barrier

NASA Astrophysics Data System (ADS)

Nakane, Ryosho; Hada, Takato; Sato, Shoichi; Tanaka, Masaaki

2018-04-01

We studied the spin accumulation signals in phosphorus-doped n+-Si (8 × 1019 cm-3) by measuring the spin transport in three-terminal vertical devices with Fe(3 nm)/Mg(0 and 1 nm)/SiOxNy(1 nm)/n+-Si(001) tunnel junctions, where the amorphous SiOxNy layer was formed by oxnitridation of the Si substrate with radio frequency plasma. Obvious spin accumulation signals were observed at 4-300 K in the spin extraction geometry when the thickness of the Mg insertion layer was 1 nm. We found that by inserting a thin (1 nm) Mg layer, intermixing of Fe and SiOxNy is suppressed, leading to the appearance of the spin accumulation signals, and this result is consistent with the dead layer model recently proposed by our group [S. Sato et al., Appl. Phys. Lett. 107, 032407 (2015)]. We obtained relatively high spin polarization (PS) of electrons tunneling through the junction and long spin lifetime (τS): PS = 16% and τS = 5.6 ns at 4 K and PS = 7.5% and τS = 2.7 ns at 300 K. Tunnel junctions with an amorphous SiOxNy tunnel barrier are very promising for Si-based spintronic devices, since they can be formed by the method compatible with the silicon complementary metal-oxide-semiconductor technology.

Traumatic Tear of the Latissimus Dorsi Myotendinous Junction: Case Report of a CrossFit-Related Injury.

PubMed

Friedman, Michael V; Stensby, J Derek; Hillen, Travis J; Demertzis, Jennifer L; Keener, Jay D

2015-01-01

A case of a latissimus dorsi myotendinous junction strain in an avid CrossFit athlete is presented. The patient developed acute onset right axillary burning and swelling and subsequent palpable pop with weakness while performing a "muscle up." Magnetic resonance imaging examination demonstrated a high-grade tear of the right latissimus dorsi myotendinous junction approximately 9 cm proximal to its intact humeral insertion. There were no other injuries to the adjacent shoulder girdle structures. Isolated strain of the latissimus dorsi myotendinous junction is a very rare injury with a scarcity of information available regarding its imaging appearance and preferred treatment. This patient was treated conservatively and was able to resume active CrossFit training within 3 months. At 6 months postinjury, he had only a mild residual functional deficit compared with his preinjury level. © 2015 The Author(s).

Wire Crimp Connectors Verification using Ultrasonic Inspection

NASA Technical Reports Server (NTRS)

Cramer, K. Elliott; Perey, Daniel F.; Yost, William T.

2007-01-01

The development of a new ultrasonic measurement technique to quantitatively assess wire crimp connections is discussed. The amplitude change of a compressional ultrasonic wave propagating through the junction of a crimp connector and wire is shown to correlate with the results of a destructive pull test, which previously has been used to assess crimp wire junction quality. Various crimp junction pathologies (missing wire strands, incorrect wire gauge, incomplete wire insertion in connector) are ultrasonically tested, and their results are correlated with pull tests. Results show that the ultrasonic measurement technique consistently (as evidenced with pull-testing data) predicts good crimps when ultrasonic transmission is above a certain threshold amplitude level. A physics-based model, solved by finite element analysis, describes the compressional ultrasonic wave propagation through the junction during the crimping process. This model is in agreement within 6% of the ultrasonic measurements. A prototype instrument for applying the technique while wire crimps are installed is also presented.

Polarization-induced Zener tunnel diodes in GaN/InGaN/GaN heterojunctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Xiaodong; Li, Wenjun; Islam, S. M.

By the insertion of thin In{sub x}Ga{sub 1−x}N layers into Nitrogen-polar GaN p-n junctions, polarization-induced Zener tunnel junctions are studied. The reverse-bias interband Zener tunneling current is found to be weakly temperature dependent, as opposed to the strongly temperature-dependent forward bias current. This indicates tunneling as the primary reverse-bias current transport mechanism. The Indium composition in the InGaN layer is systematically varied to demonstrate the increase in the interband tunneling current. Comparing the experimentally measured tunneling currents to a model helps identify the specific challenges in potentially taking such junctions towards nitride-based polarization-induced tunneling field-effect transistors.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene

PubMed Central

Yoshida, Asuka; Samal, Siba K.

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3′-to-5′ attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV. PMID:28473820

Avian Paramyxovirus Type-3 as a Vaccine Vector: Identification of a Genome Location for High Level Expression of a Foreign Gene.

PubMed

Yoshida, Asuka; Samal, Siba K

2017-01-01

Avian paramyxovirus serotype 3 (APMV-3) causes infection in a wide variety of avian species, but it does not cause apparent diseases in chickens. On the contrary, APMV-1, also known as Newcastle disease virus (NDV), can cause severe disease in chickens. Currently, natural low virulence strains of NDV are used as live-attenuated vaccines throughout the world. NDV is also being evaluated as a vaccine vector against poultry pathogens. However, due to routine vaccination programs, chickens often possess pre-existing antibodies against NDV, which may cause the chickens to be less sensitive to recombinant NDV vaccines expressing antigens of other avian pathogens. Therefore, it may be possible for an APMV-3 vector vaccine to circumvent this issue. In this study, we determined the optimal insertion site in the genome of APMV-3 for high level expression of a foreign gene. We generated recombinant APMV-3 viruses expressing the green fluorescent protein (GFP) by inserting the GFP gene at five different intergenic regions in the genome. The levels of GFP transcription and translation were evaluated. Interestingly, the levels of GFP transcription and translation did not follow the 3'-to-5' attenuation mechanism of non-segmented, negative-sense RNA viruses. The insertion of GFP gene into the P-M gene junction resulted in higher level of expression of GFP than when the gene was inserted into the upstream N-P gene junction. Unlike NDV, insertion of GFP did not attenuate the growth efficiency of AMPV-3. Thus, APMV-3 could be a more useful vaccine vector for avian pathogens than NDV.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

KENNEDY SPACE CENTER, FLA. - Workers in the Orbiter Processing Facility insert the liquid oxygen feedline for the 17-inch disconnect in the orbiter Discovery. The 17-inch liquid oxygen and liquid hydrogen disconnects provide the propellant feed interface from the external tank to the orbiter main propulsion system and the three Shuttle main engines.

NASA Image and Video Library

2003-11-11

KENNEDY SPACE CENTER, FLA. - Workers in the Orbiter Processing Facility insert the liquid oxygen feedline for the 17-inch disconnect in the orbiter Discovery. The 17-inch liquid oxygen and liquid hydrogen disconnects provide the propellant feed interface from the external tank to the orbiter main propulsion system and the three Shuttle main engines.

Towards molecular electronics with large-area molecular junctions.

PubMed

Akkerman, Hylke B; Blom, Paul W M; de Leeuw, Dago M; de Boer, Bert

2006-05-04

Electronic transport through single molecules has been studied extensively by academic and industrial research groups. Discrete tunnel junctions, or molecular diodes, have been reported using scanning probes, break junctions, metallic crossbars and nanopores. For technological applications, molecular tunnel junctions must be reliable, stable and reproducible. The conductance per molecule, however, typically varies by many orders of magnitude. Self-assembled monolayers (SAMs) may offer a promising route to the fabrication of reliable devices, and charge transport through SAMs of alkanethiols within nanopores is well understood, with non-resonant tunnelling dominating the transport mechanism. Unfortunately, electrical shorts in SAMs are often formed upon vapour deposition of the top electrode, which limits the diameter of the nanopore diodes to about 45 nm. Here we demonstrate a method to manufacture molecular junctions with diameters up to 100 microm with high yields (> 95 per cent). The junctions show excellent stability and reproducibility, and the conductance per unit area is similar to that obtained for benchmark nanopore diodes. Our technique involves processing the molecular junctions in the holes of a lithographically patterned photoresist, and then inserting a conducting polymer interlayer between the SAM and the metal top electrode. This simple approach is potentially low-cost and could pave the way for practical molecular electronics.

Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

NASA Astrophysics Data System (ADS)

Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

1990-09-01

Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

Intercellular junctions between palisade nerve endings and outer root sheath cells of rat vellus hairs.

PubMed

Kaidoh, T; Inoué, T

2000-05-15

Hair follicles have a longitudinal set of sensory nerve endings called palisade nerve endings (PN). We examined the junctional structures between the PN and outer root sheath (ORS) cells of hair follicles in the rat external ear. Transmission electron microscopy of serial thin sections showed that the processes of the ORS cells penetrated the basal lamina of the hair follicle, forming intercellular junctions with the PN (PN-ORS junctions). Two types of junctions were found: junctions between nerve endings and ORS cells (N-ORS junctions) and those between Schwann cell processes and ORS cells (S-ORS junctions). The N-ORS junctions had two subtypes: 1) a short process or small eminence of the ORS cell was attached to the nerve ending (type I); or 2) a process of the ORS cell was invaginated into the nerve ending (type II). The S-ORS junctions also had two subtypes: 1) a short process or small eminence of the ORS cell was abutted on the Schwann cell process (type I); or 2) a process of the ORS cell was invaginated into the Schwann cell process (type II). Vesicles, coated pits, coated vesicles, and endosomes were sometimes seen in nerve endings, Schwann cells, and ORS cells near the junctions. Computer-aided reconstruction of the serial thin sections displayed the three-dimensional structure of these junctions. These results suggested that the PN-ORS junctions provided direct relationships between the PN and ORS in at least four different patterns. The discovery of these junctions shows the PN-ORS relationship to be closer than previously realized. We speculate that these junctions may have roles in attachment of the PN to the ORS, contributing to increases in the sensitivity of the PN, and in chemical signaling between the PN and ORS.

Rectifying and photovoltaic properties of the heterojunction composed of CaMnO3 and Nb-doped SrTiO3

NASA Astrophysics Data System (ADS)

Sun, J. R.; Zhang, S. Y.; Shen, B. G.; Wong, H. K.

2005-01-01

A heterojunction composed of CaMnO3 (CMO) and Nb-doped SrTiO3 (STON) was fabricated and its properties were studied and compared with La0.67Ca0.33MnO3/STON and LaMnO3+δ/STON p-n, junctions. This CMO/STON junction exhibits an asymmetric current-voltage relation similar to a p-n junction. The most remarkable discovery is that the magnetic state of the manganites has a strong impact on the rectifying behaviors. The diffusion voltage, which is the critical voltage for the current rush, shows a tendency to decrease/increase with the establishment of the antiferromagnetic/ferromagnetic order in the manganites of the junction. Similar to other manganite p-n junctions, CMO/STON also exhibits a significant photovoltaic effect, and the maximum photovoltage is ˜2.2mV under the illumination of ˜7mW light (λ=460nm). A qualitative explanation is given based on an analysis on the band diagram of the junctions.

Strong Fermi-Level Pinning at Metal/n-Si(001) Interface Ensured by Forming an Intact Schottky Contact with a Graphene Insertion Layer.

PubMed

Yoon, Hoon Hahn; Jung, Sungchul; Choi, Gahyun; Kim, Junhyung; Jeon, Youngeun; Kim, Yong Soo; Jeong, Hu Young; Kim, Kwanpyo; Kwon, Soon-Yong; Park, Kibog

2017-01-11

We report the systematic experimental studies demonstrating that a graphene layer inserted at metal/n-Si(001) interface is efficient to explore interface Fermi-level pinning effect. It is confirmed that an inserted graphene layer prevents atomic interdiffusion to form an atomically abrupt Schottky contact. The Schottky barriers of metal/graphene/n-Si(001) junctions show a very weak dependence on metal work-function, implying that the metal Fermi-level is almost completely pinned at charge neutrality level close to the valence band edge of Si. The atomically impermeable and electronically transparent properties of graphene can be used generally to form an intact Schottky contact for all semiconductors.

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes

PubMed Central

Gallus, Susanne; Janke, Axel

2017-01-01

Abstract Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. PMID:28985298

Cancer gene discovery: exploiting insertional mutagenesis

PubMed Central

Ranzani, Marco; Annunziato, Stefano; Adams, David J.; Montini, Eugenio

2013-01-01

Insertional mutagenesis has been utilized as a functional forward genetics screen for the identification of novel genes involved in the pathogenesis of human cancers. Different insertional mutagens have been successfully used to reveal new cancer genes. For example, retroviruses (RVs) are integrating viruses with the capacity to induce the deregulation of genes in the neighborhood of the insertion site. RVs have been employed for more than 30 years to identify cancer genes in the hematopoietic system and mammary gland. Similarly, another tool that has revolutionized cancer gene discovery is the cut-and-paste transposons. These DNA elements have been engineered to contain strong promoters and stop cassettes that may function to perturb gene expression upon integration proximal to genes. In addition, complex mouse models characterized by tissue-restricted activity of transposons have been developed to identify oncogenes and tumor suppressor genes that control the development of a wide range of solid tumor types, extending beyond those tissues accessible using RV-based approaches. Most recently, lentiviral vectors (LVs) have appeared on the scene for use in cancer gene screens. LVs are replication defective integrating vectors that have the advantage of being able to infect non-dividing cells, in a wide range of cell types and tissues. In this review, we describe the various insertional mutagens focusing on their advantages/limitations and we discuss the new and promising tools that will improve the insertional mutagenesis screens of the future. PMID:23928056

Big, Deep, and Smart Data in Scanning Probe Microscopy

DOE PAGES

Kalinin, Sergei V.; Strelcov, Evgheni; Belianinov, Alex; ...

2016-09-27

Scanning probe microscopy techniques open the door to nanoscience and nanotechnology by enabling imaging and manipulation of structure and functionality of matter on nanometer and atomic scales. We analyze the discovery process by SPM in terms of information flow from tip-surface junction to the knowledge adoption by scientific community. Furthermore, we discuss the challenges and opportunities offered by merging of SPM and advanced data mining, visual analytics, and knowledge discovery technologies.

Robustness effect of gap junctions between Golgi cells on cerebellar cortex oscillations

PubMed Central

2011-01-01

Background Previous one-dimensional network modeling of the cerebellar granular layer has been successfully linked with a range of cerebellar cortex oscillations observed in vivo. However, the recent discovery of gap junctions between Golgi cells (GoCs), which may cause oscillations by themselves, has raised the question of how gap-junction coupling affects GoC and granular-layer oscillations. To investigate this question, we developed a novel two-dimensional computational model of the GoC-granule cell (GC) circuit with and without gap junctions between GoCs. Results Isolated GoCs coupled by gap junctions had a strong tendency to generate spontaneous oscillations without affecting their mean firing frequencies in response to distributed mossy fiber input. Conversely, when GoCs were synaptically connected in the granular layer, gap junctions increased the power of the oscillations, but the oscillations were primarily driven by the synaptic feedback loop between GoCs and GCs, and the gap junctions did not change oscillation frequency or the mean firing rate of either GoCs or GCs. Conclusion Our modeling results suggest that gap junctions between GoCs increase the robustness of cerebellar cortex oscillations that are primarily driven by the feedback loop between GoCs and GCs. The robustness effect of gap junctions on synaptically driven oscillations observed in our model may be a general mechanism, also present in other regions of the brain. PMID:22330240

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

Conformational trapping of mismatch recognition complex MSH2/MSH3 on repair-resistant DNA loops.

PubMed

Lang, Walter H; Coats, Julie E; Majka, Jerzy; Hura, Greg L; Lin, Yuyen; Rasnik, Ivan; McMurray, Cynthia T

2011-10-18

Insertion and deletion of small heteroduplex loops are common mutations in DNA, but why some loops are prone to mutation and others are efficiently repaired is unknown. Here we report that the mismatch recognition complex, MSH2/MSH3, discriminates between a repair-competent and a repair-resistant loop by sensing the conformational dynamics of their junctions. MSH2/MSH3 binds, bends, and dissociates from repair-competent loops to signal downstream repair. Repair-resistant Cytosine-Adenine-Guanine (CAG) loops adopt a unique DNA junction that traps nucleotide-bound MSH2/MSH3, and inhibits its dissociation from the DNA. We envision that junction dynamics is an active participant and a conformational regulator of repair signaling, and governs whether a loop is removed by MSH2/MSH3 or escapes to become a precursor for mutation.

MYONEURAL JUNCTIONS OF TWO ULTRASTRUCTURALLY DISTINCT TYPES IN EARTHWORM BODY WALL MUSCLE

PubMed Central

Rosenbluth, Jack

1972-01-01

The longitudinal muscle of the earthworm body wall is innervated by nerve bundles containing axons of two types which form two corresponding types of myoneural junction with the muscle fibers Type I junctions resemble cholinergic neuromuscular junctions of vertebrate skeletal muscle and are characterized by three features: (a) The nerve terminals contain large numbers of spherical, clear, ∼500 A vesicles plus a small number of larger dense-cored vesicles (b) The junctional gap is relatively wide (∼900 A), and it contains a basement membrane-like material, (c) The postjunctional membrane, although not folded, displays prominent specializations on both its external and internal surfaces The cytoplasmic surface is covered by a dense matrix ∼200 A thick which appears to be the site of insertion of fine obliquely oriented cytoplasmic filaments The external surface exhibits rows of projections ∼200 A long whose bases consist of hexagonally arrayed granules seated in the outer dense layer of the plasma membrane The concentration of these hexagonally disposed elements corresponds to the estimated concentration of both receptor sites and acetylcholinesterase sites at cholinergic junctions elsewhere. Type II junctions resemble the adrenergic junctions in vertebrate smooth muscle and exhibit the following structural characteristics: (a) The nerve fibers contain predominantly dense-cored vesicles ∼1000 A in diameter (b) The junctional gap is relatively narrow (∼150 A) and contains no basement membrane-like material, (c) Postjunctional membrane specialization is minimal. It is proposed that the structural differences between the two types of myoneural junction reflect differences in the respective transmitters and corresponding differences in the mechanisms of transmitter action and/or inactivation. PMID:5044759

Posterior medial meniscus root ligament lesions: MRI classification and associated findings.

PubMed

Choi, Ja-Young; Chang, Eric Y; Cunha, Guilherme M; Tafur, Monica; Statum, Sheronda; Chung, Christine B

2014-12-01

The purposes of this study were to determine the prevalence of altered MRI appearances of "posterior medial meniscus root ligament (PMMRL)" lesions, introduce a classification of lesion types, and report associated findings. We retrospectively reviewed 419 knee MRI studies to identify the presence of PMMRL lesions. Classification was established on the basis of lesions encountered. The medial compartment was assessed for medial meniscal tears in the meniscus proper, medial meniscal extrusion, insertional PMMRL osseous changes, regional synovitis, osteoarthritis, insufficiency fracture, and cruciate ligament abnormality. PMMRL abnormalities occurred in 28.6% (120/419) of the studies: degeneration, 14.3% (60/419) and tear, 14.3% (60/419). Our classification system included degeneration and tearing. Tearing was categorized as partial or complete with delineation of the point of failure as entheseal, midsubstance, or junction to meniscus. Of all tears, 93.3% (56/60) occurred at the meniscal junction. Univariate analysis revealed significant differences between the knees with and without PMMRL lesions in age, medial meniscal tear, medial meniscal extrusion, insertional PMMRL osseous change, regional synovitis, osteoarthritis, insufficiency fracture (p=0.017), and cruciate ligament degeneration (p<0.001). PMMRL lesions are commonly detected in symptomatic patients. We have introduced an MRI classification system. PMMRL lesions are significantly associated with age, medial meniscal tears, medial meniscal extrusion, insertional PMMRL osseous change, regional synovitis, osteoarthritis, insufficiency fracture, and cruciate ligament degeneration.

Endoplasmic reticulum-plasma membrane junctions: structure, function and dynamics.

PubMed

Okeke, Emmanuel; Dingsdale, Hayley; Parker, Tony; Voronina, Svetlana; Tepikin, Alexei V

2016-06-01

Endoplasmic reticulum (ER)-plasma membrane (PM) junctions are contact sites between the ER and the PM; the distance between the two organelles in the junctions is below 40 nm and the membranes are connected by protein tethers. A number of molecular tools and technical approaches have been recently developed to visualise, modify and characterise properties of ER-PM junctions. The junctions serve as the platforms for lipid exchange between the organelles and for cell signalling, notably Ca(2+) and cAMP signalling. Vice versa, signalling events regulate the development and properties of the junctions. Two Ca(2+) -dependent mechanisms of de novo formation of ER-PM junctions have been recently described and characterised. The junction-forming proteins and lipids are currently the focus of vigorous investigation. Junctions can be relatively short-lived and simple structures, forming and dissolving on the time scale of a few minutes. However, complex, sophisticated and multifunctional ER-PM junctions, capable of attracting numerous protein residents and other cellular organelles, have been described in some cell types. The road from simplicity to complexity, i.e. the transformation from simple 'nascent' ER-PM junctions to advanced stable multiorganellar complexes, is likely to become an attractive research avenue for current and future junctologists. Another area of considerable research interest is the downstream cellular processes that can be activated by specific local signalling events in the ER-PM junctions. Studies of the cell physiology and indeed pathophysiology of ER-PM junctions have already produced some surprising discoveries, likely to expand with advances in our understanding of these remarkable organellar contact sites. © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

Gene and enhancer trap tagging of vascular-expressed genes in poplar trees

Treesearch

Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan

2004-01-01

We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...

Phylogenetic Conflict in Bears Identified by Automated Discovery of Transposable Element Insertions in Low-Coverage Genomes.

PubMed

Lammers, Fritjof; Gallus, Susanne; Janke, Axel; Nilsson, Maria A

2017-10-01

Phylogenetic reconstruction from transposable elements (TEs) offers an additional perspective to study evolutionary processes. However, detecting phylogenetically informative TE insertions requires tedious experimental work, limiting the power of phylogenetic inference. Here, we analyzed the genomes of seven bear species using high-throughput sequencing data to detect thousands of TE insertions. The newly developed pipeline for TE detection called TeddyPi (TE detection and discovery for Phylogenetic Inference) identified 150,513 high-quality TE insertions in the genomes of ursine and tremarctine bears. By integrating different TE insertion callers and using a stringent filtering approach, the TeddyPi pipeline produced highly reliable TE insertion calls, which were confirmed by extensive in vitro validation experiments. Analysis of single nucleotide substitutions in the flanking regions of the TEs shows that these substitutions correlate with the phylogenetic signal from the TE insertions. Our phylogenomic analyses show that TEs are a major driver of genomic variation in bears and enabled phylogenetic reconstruction of a well-resolved species tree, despite strong signals for incomplete lineage sorting and introgression. The analyses show that the Asiatic black, sun, and sloth bear form a monophyletic clade, in which phylogenetic incongruence originates from incomplete lineage sorting. TeddyPi is open source and can be adapted to various TE and structural variation callers. The pipeline makes it possible to confidently extract thousands of TE insertions even from low-coverage genomes (∼10×) of nonmodel organisms. This opens new possibilities for biologists to study phylogenies and evolutionary processes as well as rates and patterns of (retro-)transposition and structural variation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Dependency of tunneling magneto-resistance on Fe insertion-layer thickness in Co{sub 2}Fe{sub 6}B{sub 2}/MgO-based magnetic tunneling junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chae, Kyo-Suk; Samsung Electronics Co., Ltd., San #16 Banwol-dong, Hwasung-City, Gyeonggi-Do 445-701; Park, Jea-Gun, E-mail: parkjgL@hanyang.ac.kr

For Co{sub 2}Fe{sub 6}B{sub 2}/MgO-based perpendicular magnetic tunneling junctions spin valves with [Co/Pd]{sub n}-synthetic-antiferromagnetic (SyAF) layers, the tunneling-magneto-resistance (TMR) ratio strongly depends on the nanoscale Fe insertion-layer thickness (t{sub Fe}) between the Co{sub 2}Fe{sub 6}B{sub 2} pinned layer and MgO tunneling barrier. The TMR ratio rapidly increased as t{sub Fe} increased up to 0.4 nm by improving the crystalline linearity of a MgO tunneling barrier and by suppressing the diffusion of Pd atoms from a [Co/Pd]{sub n}-SyAF. However, it abruptly decreased by further increasing t{sub Fe} in transferring interfacial-perpendicular magnetic anisotropy into the IMA characteristic of the Co{sub 2}Fe{sub 6}B{sub 2}more » pinned layer. Thus, the TMR ratio peaked at t{sub Fe} = 0.4 nm: i.e., 120% at 29 Ωμm{sup 2}.« less

Intein-modified enzymes, their production and industrial applications

DOEpatents

Apgar, James; Lessard, Philip; Raab, Michael R.; Shen, Binzhang; Lazar, Gabor; de la Vega, Humberto

2016-10-11

A method of predicting an intein insertion site in a protein that will lead to a switching phenotype is provided. The method includes identifying a plurality of C/T/S sites within the protein; selecting from the plurality of C/T/S/ sites those that are ranked 0.75 or higher by a support vector machine, within ten angstroms of the active site of the protein, and at or near a loop-.beta.-sheet junction or a loop-.alpha.-helix junction. A method of controlling protein activity and hosts including proteins with controlled activity are also provided. Also, intein modified proteins and plants containing intein modified proteins are provided.

Big, Deep, and Smart Data in Scanning Probe Microscopy.

PubMed

Kalinin, Sergei V; Strelcov, Evgheni; Belianinov, Alex; Somnath, Suhas; Vasudevan, Rama K; Lingerfelt, Eric J; Archibald, Richard K; Chen, Chaomei; Proksch, Roger; Laanait, Nouamane; Jesse, Stephen

2016-09-27

Scanning probe microscopy (SPM) techniques have opened the door to nanoscience and nanotechnology by enabling imaging and manipulation of the structure and functionality of matter at nanometer and atomic scales. Here, we analyze the scientific discovery process in SPM by following the information flow from the tip-surface junction, to knowledge adoption by the wider scientific community. We further discuss the challenges and opportunities offered by merging SPM with advanced data mining, visual analytics, and knowledge discovery technologies.

Analysis of Full-Test tools and their limitations as applied to terminal junction blocks

NASA Technical Reports Server (NTRS)

Smith, J. L.

1983-01-01

Discovery of unlocked contacts in Deutsch Block terminal junctions in Solid Rocket Booster flight hardware prompted an investigation into pull test techniques to help insure against possible failures. Internal frictional forces between socket and pin and between wire and grommet were examined. Pull test force must be greater than internal friction yet less than the crimp strength of the pin or socket. For this reason, a 100 percent accurate test is impossible. Test tools were evaluated. Available tools are adequate for pull testing.

First principles calculation for Gilbert damping constants in ferromagnetic/non-magnetic junctions

NASA Astrophysics Data System (ADS)

Hiramatsu, R.; Miura, D.; Sakuma, A.

2018-05-01

We evaluated an intrinsic α in ferromagnetic (FM)/non-magnetic (NM) junctions from first principles (FM = Co, Fe, and Ni and NM = Cu, Pd, and Pt) to investigate the effects of the inserted NM layer. α is calculated by liner muffin-tin orbital methods based on the torque-correlation model. We confirmed that Gilbert damping is enhanced and saturated as NM thickness increases, and that the enhancement is greater in NM materials having a stronger spin-orbital interaction. By contrast, the calculated FM thickness dependences of α show that Gilbert damping tends to decrease and be saturated as the FM thickness increases. Under the torque-correlation model, the dependences of α on FM and NM thickness can be explained by considering the electronic structure of the total system, including junction interfaces, which exhibit similar behaviors derived by spin pumping theory.

Myofibroblasts Electrotonically Coupled to Cardiomyocytes Alter Conduction: Insights at the Cellular Level from a Detailed In silico Tissue Structure Model

PubMed Central

Jousset, Florian; Maguy, Ange; Rohr, Stephan; Kucera, Jan P.

2016-01-01

Fibrotic myocardial remodeling is typically accompanied by the appearance of myofibroblasts (MFBs). In vitro, MFBs were shown to slow conduction and precipitate ectopic activity following gap junctional coupling to cardiomyocytes (CMCs). To gain further mechanistic insights into this arrhythmogenic MFB-CMC crosstalk, we performed numerical simulations in cell-based high-resolution two-dimensional tissue models that replicated experimental conditions. Cell dimensions were determined using confocal microscopy of single and co-cultured neonatal rat ventricular CMCs and MFBs. Conduction was investigated as a function of MFB density in three distinct cellular tissue architectures: CMC strands with endogenous MFBs, CMC strands with coating MFBs of two different sizes, and CMC strands with MFB inserts. Simulations were performed to identify individual contributions of heterocellular gap junctional coupling and of the specific electrical phenotype of MFBs. With increasing MFB density, both endogenous and coating MFBs slowed conduction. At MFB densities of 5–30%, conduction slowing was most pronounced in strands with endogenous MFBs due to the MFB-dependent increase in axial resistance. At MFB densities >40%, very slow conduction and spontaneous activity was primarily due to MFB-induced CMC depolarization. Coating MFBs caused non-uniformities of resting membrane potential, which were more prominent with large than with small MFBs. In simulations of MFB inserts connecting two CMC strands, conduction delays increased with increasing insert lengths and block appeared for inserts >1.2 mm. Thus, electrophysiological properties of engineered CMC-MFB co-cultures depend on MFB density, MFB size and their specific positioning in respect to CMCs. These factors may influence conduction characteristics in the heterocellular myocardium. PMID:27833567

K-Band Latching Switches

NASA Technical Reports Server (NTRS)

Piotrowski, W. S.; Raue, J. E.

1984-01-01

Design, development, and tests are described for two single-pole-double-throw latching waveguide ferrite switches: a K-band switch in WR-42 waveguide and a Ka-band switch in WR-28 waveguide. Both switches have structurally simple junctions, mechanically interlocked without the use of bonding materials; they are impervious to the effects of thermal, shock, and vibration stresses. Ferrite material for the Ka-band switch with a proper combination of magnetic and dielectric properties was available and resulted in excellent low loss, wideband performance. The high power handling requirement of the K-band switch limited the choice of ferrite to nickel-zinc compositions with adequate magnetic properties, but with too low relative dielectric constant. The relative dielectric constant determines the junction dimensions for given frequency responses. In this case the too low value unavoidably leads to a larger than optimum junction volume, increasing the insertion loss and restricting the operating bandwidth. Efforts to overcome the materials-related difficulties through the design of a composite junction with increased effective dielectric properties efforts to modify the relative dielectric constant of nickel-zinc ferrite are examined.

Wire Crimp Termination Verification Using Ultrasonic Inspection

NASA Technical Reports Server (NTRS)

Perey, Daniel F.; Cramer, K. Elliott; Yost, William T.

2007-01-01

The development of a new ultrasonic measurement technique to quantitatively assess wire crimp terminations is discussed. The amplitude change of a compressional ultrasonic wave propagating through the junction of a crimp termination and wire is shown to correlate with the results of a destructive pull test, which is a standard for assessing crimp wire junction quality. Various crimp junction pathologies such as undercrimping, missing wire strands, incomplete wire insertion, partial insulation removal, and incorrect wire gauge are ultrasonically tested, and their results are correlated with pull tests. Results show that the nondestructive ultrasonic measurement technique consistently (as evidenced with destructive testing) predicts good crimps when ultrasonic transmission is above a certain threshold amplitude level. A physics-based model, solved by finite element analysis, describes the compressional ultrasonic wave propagation through the junction during the crimping process. This model is in agreement within 6% of the ultrasonic measurements. A prototype instrument for applying this technique while wire crimps are installed is also presented. The instrument is based on a two-jaw type crimp tool suitable for butt-splice type connections. Finally, an approach for application to multipin indenter type crimps will be discussed.

SV40 host-substituted variants: a new look at the monkey DNA inserts and recombinant junctions.

PubMed

Singer, Maxine; Winocour, Ernest

2011-04-10

The available monkey genomic data banks were examined in order to determine the chromosomal locations of the host DNA inserts in 8 host-substituted SV40 variant DNAs. Five of the 8 variants contained more than one linked monkey DNA insert per tandem repeat unit and in all cases but one, the 19 monkey DNA inserts in the 8 variants mapped to different locations in the monkey genome. The 50 parental DNAs (32 monkey and 18 SV40 DNA segments) which spanned the crossover and flanking regions that participated in monkey/monkey and monkey/SV40 recombinations were characterized by substantial levels of microhomology of up to 8 nucleotides in length; the parental DNAs also exhibited direct and inverted repeats at or adjacent to the crossover sequences. We discuss how the host-substituted SV40 variants arose and the nature of the recombination mechanisms involved. Copyright © 2011 Elsevier Inc. All rights reserved.

Illegitimate V(D)J recombination-mediated deletions in Notch1 and Bcl11b are not sufficient for extensive clonal expansion and show minimal age or sex bias in frequency or junctional processing

PubMed Central

Champagne, Devin P.; Shockett, Penny E.

2014-01-01

Illegitimate V(D)J recombination at oncogenes and tumor suppressor genes is implicated in formation of several T cell malignancies. Notch1 and Bcl11b, genes involved in developing T cell specification, selection, proliferation, and survival, were previously shown to contain hotspots for deletional illegitimate V(D)J recombination associated with radiation-induced thymic lymphoma. Interestingly, these deletions were also observed in wild-type animals. In this study, we conducted frequency, clonality, and junctional processing analyses of Notch1 and Bcl11b deletions during mouse development and compared results to published analyses of authentic V(D)J rearrangements at the T cell receptor beta (TCRβ) locus and illegitimate V(D)J deletions observed at the human, nonimmune HPRT1 locus not involved in T cell malignancies. We detect deletions in Notch1 and Bcl11b in thymic and splenic T cell populations, consistent with cells bearing deletions in the circulating lymphocyte pool. Deletions in thymus can occur in utero, increase in frequency between fetal and postnatal stages, are detected at all ages examined between fetal and 7 months, exhibit only limited clonality (contrasting with previous results in radiation-sensitive mouse strains), and consistent with previous reports are more frequent in Bcl11b, partially explained by relatively high Recombination Signal Information Content (RIC) scores. Deletion junctions in Bcl11b exhibit greater germline nucleotide loss, while in Notch1 palindromic (P) nucleotides are more abundant, although average P nucleotide length is similar for both genes and consistent with results at the TCRβ locus. Non-templated (N) nucleotide insertions appear to increase between fetal and postnatal stages for Notch1, consistent with normal terminal deoxynucleotidyl transferase (TdT) activity; however, neonatal Bcl11b junctions contain elevated levels of N insertions. Finally, contrasting with results at the HPRT1 locus, we find no obvious age or gender bias in junctional processing, and inverted repeats at recessed coding ends (Pr nucleotides) correspond mostly to single-base additions consistent with normal TdT activity. PMID:24530429

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

Proteogenomic strategies for identification of aberrant cancer peptides using large-scale Next Generation Sequencing data

DOE PAGES

Woo, Sunghee; Cha, Seong Won; Na, Seungjin; ...

2014-11-17

Cancer is driven by the acquisition of somatic DNA lesions. Distinguishing the early driver mutations from subsequent passenger mutations is key to molecular sub-typing of cancers, and the discovery of novel biomarkers. The availability of genomics technologies (mainly wholegenome and exome sequencing, and transcript sampling via RNA-seq, collectively referred to as NGS) have fueled recent studies on somatic mutation discovery. However, the vision is challenged by the complexity, redundancy, and errors in genomic data, and the difficulty of investigating the proteome using only genomic approaches. Recently, combination of proteomic and genomic technologies are increasingly employed. However, the complexity and redundancymore » of NGS data remains a challenge for proteogenomics, and various trade-offs must be made to allow for the searches to take place. This paperprovides a discussion of two such trade-offs, relating to large database search, and FDR calculations, and their implication to cancer proteogenomics. Moreover, it extends and develops the idea of a unified genomic variant database that can be searched by any mass spectrometry sample. A total of 879 BAM files downloaded from TCGA repository were used to create a 4.34 GB unified FASTA database which contained 2,787,062 novel splice junctions, 38,464 deletions, 1105 insertions, and 182,302 substitutions. Proteomic data from a single ovarian carcinoma sample (439,858 spectra) was searched against the database. By applying the most conservative FDR measure, we have identified 524 novel peptides and 65,578 known peptides at 1% FDR threshold. The novel peptides include interesting examples of doubly mutated peptides, frame-shifts, and non-sample-recruited mutations, which emphasize the strength of our approach.« less

Probing transport mechanisms of BaFe₂As₂ superconducting films and grain boundary junctions by noise spectroscopy.

PubMed

Barone, C; Romeo, F; Pagano, S; Adamo, M; Nappi, C; Sarnelli, E; Kurth, F; Iida, K

2014-08-22

An important step forward for the understanding of high-temperature superconductivity has been the discovery of iron-based superconductors. Among these compounds, iron pnictides could be used for high-field magnet applications, resulting more advantageous over conventional superconductors, due to a high upper critical field as well as its low anisotropy at low temperatures. However, the principal obstacle in fabricating high quality superconducting wires and tapes is given by grain boundaries. In order to study these effects, the dc transport and voltage-noise properties of Co-doped BaFe₂As₂ superconducting films with artificial grain boundary junctions have been investigated. A specific procedure allows the separation of the film noise from that of the junction. While the former shows a standard 1/f behaviour, the latter is characterized by an unconventional temperature-dependent multi-Lorentzian voltage-spectral density. Moreover, below the film superconducting critical temperature, a peculiar noise spectrum is found for the grain boundary junction. Possible theoretical interpretation of these phenomena is proposed.

Topological Phases in Graphene Nanoribbons: Junction States, Spin Centers, and Quantum Spin Chains

NASA Astrophysics Data System (ADS)

Cao, Ting; Zhao, Fangzhou; Louie, Steven G.

2017-08-01

We show that semiconducting graphene nanoribbons (GNRs) of different width, edge, and end termination (synthesizable from molecular precursors with atomic precision) belong to different electronic topological classes. The topological phase of GNRs is protected by spatial symmetries and dictated by the terminating unit cell. We have derived explicit formulas for their topological invariants and shown that localized junction states developed between two GNRs of distinct topology may be tuned by lateral junction geometry. The topology of a GNR can be further modified by dopants, such as a periodic array of boron atoms. In a superlattice consisting of segments of doped and pristine GNRs, the junction states are stable spin centers, forming a Heisenberg antiferromagnetic spin 1 /2 chain with tunable exchange interaction. The discoveries here not only are of scientific interest for studies of quasi-one-dimensional systems, but also open a new path for design principles of future GNR-based devices through their topological characters.

Topological Phases in Graphene Nanoribbons: Junction States, Spin Centers, and Quantum Spin Chains.

PubMed

Cao, Ting; Zhao, Fangzhou; Louie, Steven G

2017-08-18

We show that semiconducting graphene nanoribbons (GNRs) of different width, edge, and end termination (synthesizable from molecular precursors with atomic precision) belong to different electronic topological classes. The topological phase of GNRs is protected by spatial symmetries and dictated by the terminating unit cell. We have derived explicit formulas for their topological invariants and shown that localized junction states developed between two GNRs of distinct topology may be tuned by lateral junction geometry. The topology of a GNR can be further modified by dopants, such as a periodic array of boron atoms. In a superlattice consisting of segments of doped and pristine GNRs, the junction states are stable spin centers, forming a Heisenberg antiferromagnetic spin 1/2 chain with tunable exchange interaction. The discoveries here not only are of scientific interest for studies of quasi-one-dimensional systems, but also open a new path for design principles of future GNR-based devices through their topological characters.

Compact Magic-T using microstrip-slotline transitions

NASA Technical Reports Server (NTRS)

U-Yen, Kongpop (Inventor); Wollack, Edward J. (Inventor); Doiron, Terence (Inventor); Moseley, Samuel H. (Inventor)

2010-01-01

The design of a compact low-loss Magic-T is described. The planar Magic-T incorporates a compact microstrip-slotline tee junction and small microstrip-slotline transition area to reduce slotline radiation. The Magic-T produces broadband in-phase and out-of-phase power combiner/divider responses, has low in-band insertion loss, and small in-band phase and amplitude imbalance.

76 FR 78631 - Questar Pipeline Company; Notice of Intent To Prepare an Environmental Assessment for the...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-19

... are currently exposed, which would be removed. Questar would also construct a pig launcher/receiver \\1\\ facility at its new Mainline 103/68 junction. \\1\\ A pipeline ``pig'' is a device used to clean or inspect the pipeline. A pig launcher/receiver is an aboveground facility where pigs are inserted or retrieved...

Interchromosomal recombination in Zea mays.

PubMed Central

Hu, W; Timmermans, M C; Messing, J

1998-01-01

A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274

Annotation-based genome-wide SNP discovery in the large and complex Aegilops tauschii genome using next-generation sequencing without a reference genome sequence

PubMed Central

2011-01-01

Background Many plants have large and complex genomes with an abundance of repeated sequences. Many plants are also polyploid. Both of these attributes typify the genome architecture in the tribe Triticeae, whose members include economically important wheat, rye and barley. Large genome sizes, an abundance of repeated sequences, and polyploidy present challenges to genome-wide SNP discovery using next-generation sequencing (NGS) of total genomic DNA by making alignment and clustering of short reads generated by the NGS platforms difficult, particularly in the absence of a reference genome sequence. Results An annotation-based, genome-wide SNP discovery pipeline is reported using NGS data for large and complex genomes without a reference genome sequence. Roche 454 shotgun reads with low genome coverage of one genotype are annotated in order to distinguish single-copy sequences and repeat junctions from repetitive sequences and sequences shared by paralogous genes. Multiple genome equivalents of shotgun reads of another genotype generated with SOLiD or Solexa are then mapped to the annotated Roche 454 reads to identify putative SNPs. A pipeline program package, AGSNP, was developed and used for genome-wide SNP discovery in Aegilops tauschii-the diploid source of the wheat D genome, and with a genome size of 4.02 Gb, of which 90% is repetitive sequences. Genomic DNA of Ae. tauschii accession AL8/78 was sequenced with the Roche 454 NGS platform. Genomic DNA and cDNA of Ae. tauschii accession AS75 was sequenced primarily with SOLiD, although some Solexa and Roche 454 genomic sequences were also generated. A total of 195,631 putative SNPs were discovered in gene sequences, 155,580 putative SNPs were discovered in uncharacterized single-copy regions, and another 145,907 putative SNPs were discovered in repeat junctions. These SNPs were dispersed across the entire Ae. tauschii genome. To assess the false positive SNP discovery rate, DNA containing putative SNPs was amplified by PCR from AL8/78 and AS75 and resequenced with the ABI 3730 xl. In a sample of 302 randomly selected putative SNPs, 84.0% in gene regions, 88.0% in repeat junctions, and 81.3% in uncharacterized regions were validated. Conclusion An annotation-based genome-wide SNP discovery pipeline for NGS platforms was developed. The pipeline is suitable for SNP discovery in genomic libraries of complex genomes and does not require a reference genome sequence. The pipeline is applicable to all current NGS platforms, provided that at least one such platform generates relatively long reads. The pipeline package, AGSNP, and the discovered 497,118 Ae. tauschii SNPs can be accessed at (http://avena.pw.usda.gov/wheatD/agsnp.shtml). PMID:21266061

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Twenty-First Bowditch Lecture

ERIC Educational Resources Information Center

Diamond, Jared M.

1977-01-01

Discusses the discovery, physiological function and the three roles (the bridge, the gate, and the fence) of the junctions between epithelial cells. Experimental usefulness of epithelia in studying basic questions common to all cell membranes, such as extraction of channels and carriers, or origin of ion or nonelectrolyte selectivity, is…

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Method for producing a thin sample band in a microchannel device

DOEpatents

Griffiths, Stewart K [Livermore, CA; Nilson, Robert H [Cardiff, CA

2004-08-03

The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

Apparatus for producing a thin sample band in a microchannel system

DOEpatents

Griffiths, Stewart K [Livermore, CA; Nilson, Robert H [Cardiff, CA

2008-05-13

The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Enhanced photovoltaic performances of graphene/Si solar cells by insertion of a MoS₂ thin film.

PubMed

Tsuboi, Yuka; Wang, Feijiu; Kozawa, Daichi; Funahashi, Kazuma; Mouri, Shinichiro; Miyauchi, Yuhei; Takenobu, Taishi; Matsuda, Kazunari

2015-09-14

Transition-metal dichalcogenides exhibit great potential as active materials in optoelectronic devices because of their characteristic band structure. Here, we demonstrated that the photovoltaic performances of graphene/Si Schottky junction solar cells were significantly improved by inserting a chemical vapor deposition (CVD)-grown, large MoS2 thin-film layer. This layer functions as an effective electron-blocking/hole-transporting layer. We also demonstrated that the photovoltaic properties are enhanced with the increasing number of graphene layers and the decreasing thickness of the MoS2 layer. A high photovoltaic conversion efficiency of 11.1% was achieved with the optimized trilayer-graphene/MoS2/n-Si solar cell.

Total internal reflection optical switch using the reverse breakdown of a pn junction in silicon.

PubMed

Kim, Jong-Hun; Park, Hyo-Hoon

2015-11-01

We demonstrate a new type of silicon total-internal-reflection optical switch with a simple pn junction functioning both as a reflector and a heater. The reflector is placed between asymmetrically y-branched multimode waveguides with an inclination angle corresponding to half of the branch angle. When the reflector is at rest, incident light is reflected in accordance to the refractive index difference due to the plasma dispersion effect of the pre-doped carriers. Switching to the transmission state is attained under a reverse breakdown of the pn junction by the thermo-optic effect which smears the refractive index difference. From this switching scheme, we confirmed the switching operation with a shallow total-internal-reflection region of 1 μm width. At a 6° branch angle, an extinction ratio of 12 dB and an insertion loss of -4.2  dB are achieved along with a thermal heating power of 151.5 mW.

Performance tradeoff between lateral and interdigitated doping patterns for high speed carrier-depletion based silicon modulators.

PubMed

Yu, Hui; Pantouvaki, Marianna; Van Campenhout, Joris; Korn, Dietmar; Komorowska, Katarzyna; Dumon, Pieter; Li, Yanlu; Verheyen, Peter; Absil, Philippe; Alloatti, Luca; Hillerkuss, David; Leuthold, Juerg; Baets, Roel; Bogaerts, Wim

2012-06-04

Carrier-depletion based silicon modulators with lateral and interdigitated PN junctions are compared systematically on the same fabrication platform. The interdigitated diode is shown to outperform the lateral diode in achieving a low VπLπ of 0.62 V∙cm with comparable propagation loss at the expense of a higher depletion capacitance. The low VπLπ of the interdigitated PN junction is employed to demonstrate 10 Gbit/s modulation with 7.5 dB extinction ration from a 500 µm long device whose static insertion loss is 2.8 dB. In addition, up to 40 Gbit/s modulation is demonstrated for a 3 mm long device comprising a lateral diode and a co-designed traveling wave electrode.

Subsurface geometry of the San Andreas-Calaveras fault junction: influence of serpentinite and the Coast Range Ophiolite

USGS Publications Warehouse

Watt, Janet Tilden; Ponce, David A.; Graymer, Russell W.; Jachens, Robert C.; Simpson, Robert W.

2014-01-01

While an enormous amount of research has been focused on trying to understand the geologic history and neotectonics of the San Andreas-Calaveras fault (SAF-CF) junction, fundamental questions concerning fault geometry and mechanisms for slip transfer through the junction remain. We use potential-field, geologic, geodetic, and seismicity data to investigate the 3-D geologic framework of the SAF-CF junction and identify potential slip-transferring structures within the junction. Geophysical evidence suggests that the San Andreas and Calaveras fault zones dip away from each other within the northern portion of the junction, bounding a triangular-shaped wedge of crust in cross section. This wedge changes shape to the south as fault geometries change and fault activity shifts between fault strands, particularly along the Calaveras fault zone (CFZ). Potential-field modeling and relocated seismicity suggest that the Paicines and San Benito strands of the CFZ dip 65° to 70° NE and form the southwest boundary of a folded 1 to 3 km thick tabular body of Coast Range Ophiolite (CRO) within the Vallecitos syncline. We identify and characterize two steeply dipping, seismically active cross structures within the junction that are associated with serpentinite in the subsurface. The architecture of the SAF-CF junction presented in this study may help explain fault-normal motions currently observed in geodetic data and help constrain the seismic hazard. The abundance of serpentinite and related CRO in the subsurface is a significant discovery that not only helps constrain the geometry of structures but may also help explain fault behavior and the tectonic evolution of the SAF-CF junction.

77 FR 12278 - Questar Pipeline Company; Notice of Availability of the Environmental Assessment for the Proposed...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-02-29

... Mainline 103; and Construct a pig launcher/receiver \\1\\ at the new Mainline 103/68 junction. \\1\\ A pipeline ``pig'' is a device used to clean or inspect the pipeline. A pig launcher/receiver is an aboveground facility where pigs are inserted or retrieved from the pipeline. The FERC staff mailed copies of the EA to...

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

Modified band alignment effect in ZnO/Cu2O heterojunction solar cells via Cs2O buffer insertion

NASA Astrophysics Data System (ADS)

Eom, Kiryung; Lee, Dongyoon; Kim, Seunghwan; Seo, Hyungtak

2018-02-01

The effects of a complex buffer layer of cesium oxide (Cs2O) on the photocurrent response in oxide heterojunction solar cells (HSCs) were investigated. A p-n junction oxide HSC was fabricated using p-type copper (I) oxide (Cu2O) and n-type zinc oxide (ZnO); the buffer layer was inserted between the Cu2O and fluorine-doped tin oxide (FTO). Ultraviolet-visible (UV-vis) and x-ray and ultraviolet photoelectron spectroscopy analyses were performed to characterize the electronic band structures of cells, both with and without this buffer layer. In conjunction with the measured band electronic structures, the significantly improved visible-range photocurrent spectra of the buffer-inserted HSC were analyzed in-depth. As a result, the 1 sun power conversion efficiency was increased by about three times by the insertion of buffer layer. The physicochemical origin of the photocurrent enhancement was mainly ascribed to the increased photocarrier density in the buffer layer and modified valence band offset to promote the effective hole transfer at the interface to FTO on the band-alignment model.

Tendon healing in a bone tunnel. Part II: Histologic analysis after biodegradable interference fit fixation in a model of anterior cruciate ligament reconstruction in sheep.

PubMed

Weiler, Andreas; Hoffmann, Reinhard F G; Bail, Hermann J; Rehm, Oliver; Südkamp, Norbert P

2002-02-01

Tendon-to-bone healing of soft-tissue grafts has been described to progress by the development of a fibrous interzone that undergoes a maturation process leading to the development of an indirect type of ligament insertion. Previous studies used extra-articular models or fixation far away from the joint line; thus, no data are available investigating tendon-to-bone healing of a soft-tissue graft fixed anatomically. Therefore, we studied the tendon-to-bone healing of the anatomic soft-tissue graft interference fit fixation in a model of anterior cruciate ligament (ACL) reconstruction in sheep. Animal study. Thirty-five mature sheep underwent ACL reconstruction with an autologous Achilles tendon split graft. Grafts were directly fixed with biodegradable poly-(D,L-lactide) interference screws. Animals were euthanized after 6, 9, 12, 24, and 52 weeks and histologic evaluations were performed. Undecalcified specimens were evaluated under normal and polarized light. Additionally, animals received a polychrome sequential labeling (tetracycline, xylenol orange, and calcein green) to determine bone growth per time under fluorescent light. Intratunnel histologic findings at 6 weeks showed a tendon-bone junction with only a partial fibrous interzone between the graft tissue and the surrounding bone. A mature intratunnel tendon-bone junction with a zone of fibrocartilage was found at 9 to 12 weeks. At the tunnel entrance site a wide regular ligamentous insertion site was seen in all specimens after 24 weeks. This insertion showed regular patterns such as the direct type of insertion of a normal ligament with a dense basophilic transition zone consisting of mineralized cartilage. A fibrous interzone between the graft tissue and the bone tunnel was only partially developed, which is in contrast to all previous studies in which nonanatomic fixation was used. Thus, it is reasonable to assume that the tendon-to-bone healing in the present study may progress partially by direct-contact healing without the development of a fibrous interzone. To our knowledge, this is the first report describing the development of a direct type of ligament insertion after ACL replacement with a soft-tissue graft. This is in contrast to previous studies reporting the development of an indirect type of insertion when using nonanatomic fixation far away from the joint line. Thus, histologic data strongly indicate that anatomic interference fit fixation is beneficial for tendon-to-bone incorporation by leading to the development of a direct type of ligament insertion.

Discovery of a photoresponse amplification mechanism in compensated PN junctions

NASA Astrophysics Data System (ADS)

Zhou, Yuchun; Liu, Yu-Hsin; Rahman, Samia N.; Hall, David; Sham, L. J.; Lo, Yu-Hwa

2015-01-01

We report the experimental evidence of uncovering a photoresponse amplification mechanism in heavily doped, partially compensated silicon p-n junctions under very low bias voltage. We show that the observed photocurrent gain occurs at a bias that is more than an order of magnitude below the threshold voltage for conventional impact ionization. Moreover, contrary to the case of avalanche detectors and p-i-n diodes, the amplified photoresponse is enhanced rather than suppressed with increasing temperature. These distinctive characteristics lead us to hypothesize that the inelastic scattering between energetic electrons (holes) and the ionized impurities in the depletion and charge neutral regions of the p-n junction in a cyclic manner plays a significant role in the amplification process. Such an internal signal amplification mechanism, which occurs at much lower bias than impact ionization and favors room temperature over cryogenic temperature, makes it promising for practical device applications.

Discovery of a photoresponse amplification mechanism in compensated PN junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yuchun; Rahman, Samia N.; Hall, David

2015-01-19

We report the experimental evidence of uncovering a photoresponse amplification mechanism in heavily doped, partially compensated silicon p-n junctions under very low bias voltage. We show that the observed photocurrent gain occurs at a bias that is more than an order of magnitude below the threshold voltage for conventional impact ionization. Moreover, contrary to the case of avalanche detectors and p-i-n diodes, the amplified photoresponse is enhanced rather than suppressed with increasing temperature. These distinctive characteristics lead us to hypothesize that the inelastic scattering between energetic electrons (holes) and the ionized impurities in the depletion and charge neutral regions ofmore » the p-n junction in a cyclic manner plays a significant role in the amplification process. Such an internal signal amplification mechanism, which occurs at much lower bias than impact ionization and favors room temperature over cryogenic temperature, makes it promising for practical device applications.« less

Invariant submanifold for series arrays of Josephson junctions.

PubMed

Marvel, Seth A; Strogatz, Steven H

2009-03-01

We study the nonlinear dynamics of series arrays of Josephson junctions in the large-N limit, where N is the number of junctions in the array. The junctions are assumed to be identical, overdamped, driven by a constant bias current, and globally coupled through a common load. Previous simulations of such arrays revealed that their dynamics are remarkably simple, hinting at the presence of some hidden symmetry or other structure. These observations were later explained by the discovery of N-3 constants of motion, the choice of which confines the resulting flow in phase space to a low-dimensional invariant manifold. Here we show that the dimensionality can be reduced further by restricting attention to a special family of states recently identified by Ott and Antonsen. In geometric terms, the Ott-Antonsen ansatz corresponds to an invariant submanifold of dimension one less than that found earlier. We derive and analyze the flow on this submanifold for two special cases: an array with purely resistive loading and another with resistive-inductive-capacitive loading. Our results recover (and in some instances improve) earlier findings based on linearization arguments.

Probing transport mechanisms of BaFe2As2 superconducting films and grain boundary junctions by noise spectroscopy

PubMed Central

Barone, C.; Romeo, F.; Pagano, S.; Adamo, M.; Nappi, C.; Sarnelli, E.; Kurth, F.; Iida, K.

2014-01-01

An important step forward for the understanding of high-temperature superconductivity has been the discovery of iron-based superconductors. Among these compounds, iron pnictides could be used for high-field magnet applications, resulting more advantageous over conventional superconductors, due to a high upper critical field as well as its low anisotropy at low temperatures. However, the principal obstacle in fabricating high quality superconducting wires and tapes is given by grain boundaries. In order to study these effects, the dc transport and voltage-noise properties of Co-doped BaFe2As2 superconducting films with artificial grain boundary junctions have been investigated. A specific procedure allows the separation of the film noise from that of the junction. While the former shows a standard 1/f behaviour, the latter is characterized by an unconventional temperature-dependent multi-Lorentzian voltage-spectral density. Moreover, below the film superconducting critical temperature, a peculiar noise spectrum is found for the grain boundary junction. Possible theoretical interpretation of these phenomena is proposed. PMID:25145385

Regulation of gap junction channels and hemichannels by phosphorylation and redox changes: a revision.

PubMed

Pogoda, Kristin; Kameritsch, Petra; Retamal, Mauricio A; Vega, José L

2016-05-24

Post-translational modifications of connexins play an important role in the regulation of gap junction and hemichannel permeability. The prerequisite for the formation of functional gap junction channels is the assembly of connexin proteins into hemichannels and their insertion into the membrane. Hemichannels can affect cellular processes by enabling the passage of signaling molecules between the intracellular and extracellular space. For the intercellular communication hemichannels from one cell have to dock to its counterparts on the opposing membrane of an adjacent cell to allow the transmission of signals via gap junctions from one cell to the other. The controlled opening of hemichannels and gating properties of complete gap junctions can be regulated via post-translational modifications of connexins. Not only channel gating, but also connexin trafficking and assembly into hemichannels can be affected by post-translational changes. Recent investigations have shown that connexins can be modified by phosphorylation/dephosphorylation, redox-related changes including effects of nitric oxide (NO), hydrogen sulfide (H2S) or carbon monoxide (CO), acetylation, methylation or ubiquitination. Most of the connexin isoforms are known to be phosphorylated, e.g. Cx43, one of the most studied connexin at all, has 21 reported phosphorylation sites. In this review, we provide an overview about the current knowledge and relevant research of responsible kinases, connexin phosphorylation sites and reported effects on gap junction and hemichannel regulation. Regarding the effects of oxidants we discuss the role of NO in different cell types and tissues and recent studies about modifications of connexins by CO and H2S.

Electronic transport across a junction between armchair graphene nanotube and zigzag nanoribbon. Transmission in an armchair nanotube without a zigzag half-line of dimers

NASA Astrophysics Data System (ADS)

Sharma, Basant Lal

2018-05-01

Based on the well known nearest-neighbor tight-binding approximation for graphene, an exact expression for the electronic conductance across a zigzag nanoribbon/armchair nanotube junction is presented for non-interacting electrons. The junction results from the removal of a half-row of zigzag dimers in armchair nanotube, or equivalently by partial rolling of zigzag nanoribbon and insertion of a half-row of zigzag dimers in between. From the former point of view, a discrete form of Dirichlet condition is imposed on a zigzag half-line of dimers assuming the vanishing of wave function outside the physical structure. A closed form expression is provided for the reflection and transmission moduli for the outgoing wave modes for each given electronic wave mode incident from either side of the junction. It is demonstrated that such a contact junction between the nanotube and nanoribbon exhibits negligible backscattering, and the transmission has been found to be nearly ballistic. In contrast to the previously reported studies for partially unzipped carbon nanotubes (CNTs), using the same tight binding model, it is found that due to the "defect" there is certain amount of mixing between the electronic wave modes with even and odd reflection symmetries. But the junction remains a perfect valley filter for CNTs at certain energy ranges. Applications aside from the electronic case, include wave propagation in quasi-one-dimensional honeycomb structures of graphene-like constitution. The paper includes several numerical calculations, analytical derivations, and graphical results, which complement the provision of succinct closed form expressions.

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Where tendons and ligaments meet bone: attachment sites (‘entheses’) in relation to exercise and/or mechanical load

PubMed Central

Benjamin, M; Toumi, H; Ralphs, J R; Bydder, G; Best, T M; Milz, S

2006-01-01

Entheses (insertion sites, osteotendinous junctions, osteoligamentous junctions) are sites of stress concentration at the region where tendons and ligaments attach to bone. Consequently, they are commonly subject to overuse injuries (enthesopathies) that are well documented in a number of sports. In this review, we focus on the structure–function correlations of entheses on both the hard and the soft tissue sides of the junction. Particular attention is paid to mechanical factors that influence form and function and thus to exploring the relationship between entheses and exercise. The molecular parameters indicative of adaptation to mechanical stress are evaluated, and the basis on which entheses are classified is explained. The application of the ‘enthesis organ’ concept (a collection of tissues adjacent to the enthesis itself, which jointly serve the common function of stress dissipation) to understanding enthesopathies is considered and novel roles of adipose tissue at entheses are reviewed. A distinction is made between different locations of fat at entheses, and possible functions include space-filling and proprioception. The basic anchorage role of entheses is considered in detail and comparisons are explored between entheses and other biological ‘anchorage’ sites. The ability of entheses for self-repair is emphasized and a range of enthesopathies common in sport are reviewed (e.g. tennis elbow, golfer's elbow, jumper's knee, plantar fasciitis and Achilles insertional tendinopathies). Attention is drawn to the degenerative, rather than inflammatory, nature of most enthesopathies in sport. The biomechanical factors contributing to the development of enthesopathies are reviewed and the importance of considering the muscle–tendon–bone unit as a whole is recognized. Bony spur formation is assessed in relation to other changes at entheses which parallel those in osteoarthritic synovial joints. PMID:16637873

Triple Junctions, Boninites, and a New Microplate in the Western Pacific

NASA Astrophysics Data System (ADS)

Flores, J. A.; Casey, J.

2017-12-01

A new microplate has been discovered while trying to correlate melting processes in subduction zones that are forming boninites along the southern Mariana Plate. The westward boundary between the Mariana plate and the Philippine Sea plate is along a well-defined back-arc spreading center. The southern extension of this spreading center to the intersection with the Mariana Trench does not have a recognized morphological boundary. Previous work has hypothesized that subduction beneath a spreading center provides conditions required for boninite petrogenesis. Therefore, the exact location of the trench-trench-ridge triple junction needs to be found and correlated with known boninite locations. The triple junction was found using fault plane solutions to constrain the southern boundary of the two plates as it transects across the forearc. Normal faults suggest the triple junction to be at approximately 11.9N 144.1W; slip direction of reverse faults associated with the subducting plate are dominantly north-south west of this junction and northwest-southeast on the east side. While locating the southern boundary, the nucleation of a new spreading center that creates a ridge-ridge-ridge triple junction was found. The main spreading center trends mostly north-south until about 12.5N 143W, where two other spreading centers meet. The western spreading zone trends mostly east-west and seems to be in its infancy whereas there is another spreading center trending northwest-southeast. It is this last spreading center that forms the trench-ridge-trench triple junction. Discovery of these triple junctions isolates a piece of lithosphere that we interpret to be a new microplate that we name the Challenger Microplate.

Development of Balanced SIS Mixers for ALMA Band-10

NASA Astrophysics Data System (ADS)

Shitov, Sergey V.; Koryukin, Oleg V.; Uzawa, Yoshinory; Noguchi, Takashi; Uvarov, Andrey V.; Cohn, Ilya A.

2006-05-01

A few concepts of a wide-band balanced SIS mixer employing submicron-sized SIS junctions are under development for 787-950 GHz frequency range. A quasioptical DSB balanced mixer with integrated cross-slot antenna is considered as the less laborious and cheaper option. The silicon lens-antenna beam efficiency is expected above 80 % across the whole band with first-order sidelobe below -16 dB. To use the conservative horn antenna solution, a single chamber waveguide DSB balanced mixer is developed. Two equal probe-type SIS chips are inserted into a full-height waveguide through its opposite broad walls; these two mixers are driven by the signal waveguide in series. The LO current is transferred to the mixers in parallel via a capacitive probe inserted through the narrow wall of the signal waveguide from the neighboring LO waveguide. The HFSS model demonstrated the LO power coupling efficiency above -3 dB, almost perfect signal transfer and the LO cross talk below -30 dB that take into account misalignment (misbalance) of the chips. It is demonstrated numerically using Tucker's 3-port model that unequal pump of junctions of a twin-SIS mixer can lead, in spite of the perfect signal coupling, to degradation of the gain performance up to -3 dB, especially at the top of the ALMA Band-10.

Obstructive hydrocephalus secondary to odontoid pannus: case report and review of literature.

PubMed

Soon, Wai Cheong; Thanabalasundaram, Gopiga; Thant, Kyaw Zayar; Ogbonnaya, Ebere Sunny; Harrisson, Stuart Edward

2018-04-01

Odontoid pannus or periodontoid pseudotumour is associated with a variety of rheumatological conditions. We report a case of an 80-year old man who presented with acute hydrocephalus following an emergency operation to amputate his infected left big toe. Imaging revealed a large tissue mass causing severe compression at the cervico-medullary junction and obstruction of CSF flow. The acute hydrocephalus was presumed to be related to neck manoeuvring during general anaesthesia. Following an initial emergency CSF diversion through external ventricular drainage catheter insertion, the patient subsequently underwent ventriculo-peritoneal insertion and posterior spinal decompression and fixation. To our knowledge, there have been no reported cases of tophaceous gout of the odontoid pannus causing acute hydrocephalus.

Enhancing electron transport in molecular wires by insertion of a ferrocene center.

PubMed

Sun, Yan-Yan; Peng, Zheng-Lian; Hou, Rong; Liang, Jing-Hong; Zheng, Ju-Fang; Zhou, Xiao-Yi; Zhou, Xiao-Shun; Jin, Shan; Niu, Zhen-Jiang; Mao, Bing-Wei

2014-02-14

We have determined the conductance of alkane-linked ferrocene molecules with carboxylic acid anchoring groups using the STM break junction technique, and three sets of conductance values were found, i.e. high conductance (HC), medium conductance (MC) and low conductance (LC) values. The enhancing effect of the incorporated ferrocene on the electron transport in saturated alkane molecular wires is demonstrated by the increased conductance of the ferrocene molecules, attributed to the reduction of the tunneling barrier and the HOMO-LUMO gap induced by the insertion of ferrocene. Furthermore, the electron-withdrawing carbonyl group on the unconjugated backbone has little or no influence on single-molecule conductance. The current work provides a feasible approach for the design of high-performance molecular wires.

Analytic expression for the giant fieldlike spin torque in spin-filter magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Tang, Y.-H.; Huang, Z.-W.; Huang, B.-H.

2017-08-01

We propose analytic expressions for fieldlike, T⊥, and spin-transfer, T∥, spin torque components in the spin-filter-based magnetic tunnel junction (SFMTJ), by using the single-band tight-binding model with the nonequilibrium Keldysh formalism. In consideration of multireflection processes between noncollinear magnetization of the spin-filter (SF) barrier and the ferromagnetic (FM) electrode, the central spin-selective SF barrier plays an active role in the striking discovery T⊥≫T∥ , which can be further identified by the unusual barrier thickness dependence of giant T⊥. Our general expressions reveal the sinusoidal angular dependence of both spin torque components, even in the presence of the SF barrier.

AlInAsSb for GaSb-based multi-junction solar cells

NASA Astrophysics Data System (ADS)

Tournet, J.; Rouillard, Y.; Tournié, E.

2018-02-01

Bandgap engineering, by means of alloying or inserting nanostructures, is the bedrock of high efficiency photovoltaics. III-V quaternary alloys in particular enable bandgap tailoring of a multi-junction subcell while conserving a single lattice parameter. Among the possible candidates, AlInAsSb could in theory reach the widest range of bandgap energies while being lattice-matched to InP or GaSb. Although these material systems are still emerging photovoltaic segments, they do offer advantages for multi-junction design. GaSbbased structures in particular can make use of highly efficient GaSb/InAs tunnel junctions to connect the subcells. There has been only little information concerning GaSb-lattice matched AlInAsSb in the literature. The alloy's miscibility gap can be circumvented by the use of non-equilibrium techniques. Nevertheless, appropriate growth conditions remain to be found in order to produce a stable alloy. Furthermore, the abnormally low bandgap energies reported for the material need to be confirmed and interpreted with a multi-junction perspective. In this work, we propose a tandem structure made of an AlInAsSb top cell and a GaSb bottom cell. An epitaxy study of the AlInAsSb alloy lattice-matched to GaSb was first performed. The subcells were then grown and processed. The GaSb subcell yielded an efficiency of 5.9% under 1 sun and the tandem cell is under optimization. Preliminary results are presented in this document.

Comparative study of four immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, and optimization of culture conditions, for an in vitro blood–brain barrier model for drug permeability studies

PubMed Central

2013-01-01

Background Reliable human in vitro blood–brain barrier (BBB) models suitable for high-throughput screening are urgently needed in early drug discovery and development for assessing the ability of promising bioactive compounds to overcome the BBB. To establish an improved human in vitro BBB model, we compared four currently available and well characterized immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, with respect to barrier tightness and paracellular permeability. Co-culture systems using immortalized human astrocytes (SVG-A cell line) and immortalized human pericytes (HBPCT cell line) were designed with the aim of positively influencing barrier tightness. Methods Tight junction (TJ) formation was assessed by transendothelial electrical resistance (TEER) measurements using a conventional epithelial voltohmmeter (EVOM) and an automated CellZscope system which records TEER and cell layer capacitance (CCL) in real-time. Paracellular permeability was assessed using two fluorescent marker compounds with low BBB penetration (sodium fluorescein (Na-F) and lucifer yellow (LY)). Conditions were optimized for each endothelial cell line by screening a series of 24-well tissue culture inserts from different providers. For hBMEC cells, further optimization was carried out by varying coating material, coating procedure, cell seeding density, and growth media composition. Biochemical characterization of cell type-specific transmembrane adherens junction protein VE-cadherin and of TJ proteins ZO-1 and claudin-5 were carried out for each endothelial cell line. In addition, immunostaining for ZO-1 in hBMEC cell line was performed. Results The four cell lines all expressed the endothelial cell type-specific adherens junction protein VE-cadherin. The TJ protein ZO-1 was expressed in hCMEC/D3 and in hBMEC cells. ZO-1 expression could be confirmed in hBMEC cells by immunocytochemical staining. Claudin-5 expression was detected in hCMEC/D3, TY10, and at a very low level in hBMEC cells. Highest TEER values and lowest paracellular permeability for Na-F and LY were obtained with mono-cultures of hBMEC cell line when cultivated on 24-well tissue culture inserts from Greiner Bio-one® (transparent PET membrane, 3.0 μm pore size). In co-culture models with SVG-A and HBPCT cells, no increase of TEER could be observed, suggesting that none of the investigated endothelial cell lines responded positively to stimuli from immortalized astrocytic or pericytic cells. Conclusions Under the conditions examined in our experiments, hBMEC proved to be the most suitable human cell line for an in vitro BBB model concerning barrier tightness in a 24-well mono-culture system intended for higher throughput. This BBB model is being validated with several compounds (known to cross or not to cross the BBB), and will potentially be selected for the assessment of BBB permeation of bioactive natural products. PMID:24262108

Comparative study of four immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, and optimization of culture conditions, for an in vitro blood-brain barrier model for drug permeability studies.

PubMed

Eigenmann, Daniela E; Xue, Gongda; Kim, Kwang S; Moses, Ashlee V; Hamburger, Matthias; Oufir, Mouhssin

2013-11-22

Reliable human in vitro blood-brain barrier (BBB) models suitable for high-throughput screening are urgently needed in early drug discovery and development for assessing the ability of promising bioactive compounds to overcome the BBB. To establish an improved human in vitro BBB model, we compared four currently available and well characterized immortalized human brain capillary endothelial cell lines, hCMEC/D3, hBMEC, TY10, and BB19, with respect to barrier tightness and paracellular permeability. Co-culture systems using immortalized human astrocytes (SVG-A cell line) and immortalized human pericytes (HBPCT cell line) were designed with the aim of positively influencing barrier tightness. Tight junction (TJ) formation was assessed by transendothelial electrical resistance (TEER) measurements using a conventional epithelial voltohmmeter (EVOM) and an automated CellZscope system which records TEER and cell layer capacitance (CCL) in real-time.Paracellular permeability was assessed using two fluorescent marker compounds with low BBB penetration (sodium fluorescein (Na-F) and lucifer yellow (LY)). Conditions were optimized for each endothelial cell line by screening a series of 24-well tissue culture inserts from different providers. For hBMEC cells, further optimization was carried out by varying coating material, coating procedure, cell seeding density, and growth media composition. Biochemical characterization of cell type-specific transmembrane adherens junction protein VE-cadherin and of TJ proteins ZO-1 and claudin-5 were carried out for each endothelial cell line. In addition, immunostaining for ZO-1 in hBMEC cell line was performed. The four cell lines all expressed the endothelial cell type-specific adherens junction protein VE-cadherin. The TJ protein ZO-1 was expressed in hCMEC/D3 and in hBMEC cells. ZO-1 expression could be confirmed in hBMEC cells by immunocytochemical staining. Claudin-5 expression was detected in hCMEC/D3, TY10, and at a very low level in hBMEC cells. Highest TEER values and lowest paracellular permeability for Na-F and LY were obtained with mono-cultures of hBMEC cell line when cultivated on 24-well tissue culture inserts from Greiner Bio-one® (transparent PET membrane, 3.0 μm pore size). In co-culture models with SVG-A and HBPCT cells, no increase of TEER could be observed, suggesting that none of the investigated endothelial cell lines responded positively to stimuli from immortalized astrocytic or pericytic cells. Under the conditions examined in our experiments, hBMEC proved to be the most suitable human cell line for an in vitro BBB model concerning barrier tightness in a 24-well mono-culture system intended for higher throughput. This BBB model is being validated with several compounds (known to cross or not to cross the BBB), and will potentially be selected for the assessment of BBB permeation of bioactive natural products.

Effect of graphene tunnel barrier on Schottky barrier height of Heusler alloy Co2MnSi/graphene/n-Ge junction

NASA Astrophysics Data System (ADS)

Gui-fang, Li; Jing, Hu; Hui, Lv; Zhijun, Cui; Xiaowei, Hou; Shibin, Liu; Yongqian, Du

2016-02-01

We demonstrate that the insertion of a graphene tunnel barrier between Heusler alloy Co2MnSi and the germanium (Ge) channel modulates the Schottky barrier height and the resistance-area product of the spin diode. We confirm that the Fermi level is depinned and a reduction in the electron Schottky barrier height (SBH) occurs following the insertion of the graphene layer between Co2MnSi and Ge. The electron SBH is modulated in the 0.34 eV-0.61 eV range. Furthermore, the transport mechanism changes from rectifying to symmetric tunneling following the insertion. This behavior provides a pathway for highly efficient spin injection from a Heusler alloy into a Ge channel with high electron and hole mobility. Project supported by the National Natural Science Foundation of China (Grant No. 61504107) and the Fundamental Research Funds for the Central Universities, China (Grant Nos. 3102014JCQ01059 and 3102015ZY043).

Tuning Carrier Tunneling in van der Waals Heterostructures for Ultrahigh Detectivity.

PubMed

Vu, Quoc An; Lee, Jin Hee; Nguyen, Van Luan; Shin, Yong Seon; Lim, Seong Chu; Lee, Kiyoung; Heo, Jinseong; Park, Seongjun; Kim, Kunnyun; Lee, Young Hee; Yu, Woo Jong

2017-01-11

Semiconducting transition metal dichalcogenides (TMDs) are promising materials for photodetection over a wide range of visible wavelengths. Photodetection is generally realized via a phototransistor, photoconductor, p-n junction photovoltaic device, and thermoelectric device. The photodetectivity, which is a primary parameter in photodetector design, is often limited by either low photoresponsivity or a high dark current in TMDs materials. Here, we demonstrated a highly sensitive photodetector with a MoS 2 /h-BN/graphene heterostructure, by inserting a h-BN insulating layer between graphene electrode and MoS 2 photoabsorber, the dark-carriers were highly suppressed by the large electron barrier (2.7 eV) at the graphene/h-BN junction while the photocarriers were effectively tunneled through small hole barrier (1.2 eV) at the MoS 2 /h-BN junction. With both high photocurrent/dark current ratio (>10 5 ) and high photoresponsivity (180 AW -1 ), ultrahigh photodetectivity of 2.6 × 10 13 Jones was obtained at 7 nm thick h-BN, about 100-1000 times higher than that of previously reported MoS 2 -based devices.

The interface modification for GNWs/Si Schottky junction with PEI/PEIE interlayers

NASA Astrophysics Data System (ADS)

Zhou, Quan; Liu, Xiangzhi; Luo, Wei; Shen, Jun; Wang, Yuefeng; Wei, Dapeng

2018-03-01

Polyethylenimine ethoxylated (PEIE) and polyethyl-enimine (PEI), the two kinds of interface buffer layer, are widely used in the organic light-emitting diodes and solar cells for band alignment adjustment. In this report, we carefully studied the influence of the inserting organic layer on the graphene nanowalls(GNWS)/Si junction quality and the photoresponse of the Schottky devices. We found that thinner layers of PEI could decrease the dark current and improve the photo-to-dark ratio to 105 for n-Si devices. The s-kink effect and degradation of open circuit voltage could be observed for thicker thickness and excessive doping. Relatively, PEIE with stable thin layer not only improve the rectifying characteristics of p-Si devices but also the incident photon conversion efficiency. The maximus IPCE could reach 44% and be adjusted to zero by the reverse bias. The tunneling inhibition for electrons can be alleviated by increasing the barrier height. Our results provide an attractive method to improve the efficiency of pristine GNWs/Si junction with interface doping and passivation.

K-band high power latching switch. [communication satellite system

NASA Technical Reports Server (NTRS)

Mlinar, M. J.; Piotrowski, W. S.; Raue, J. E.

1980-01-01

A 19 GHz waveguide latching switch with a bandwidth of 1400 MHz and an exceptionally low insertion loss of 0.25 dB was demonstrated. The RF and driver ferrites are separate structures and can be optimized individually. This analysis for each structure is separately detailed. Basically, the RF section features a dual turnstile junction. The circulator consists of a dielectric tube which contains two ferrite rods, and a dielectric spacer separating the ferrite parts along the center of symmetry of the waveguide to form two turnstiles. This subassembly is indexed and locked in the center of symmetry of a uniform junction of three waveguides by the metallic transformers installed in the top and bottom walls of the housing. The switching junction and its actuating circuitry met all RF performance objectives and all shock and vibration requirements with no physical damage or performance degradation. It exceeds thermal requirements by operating over a 100 C temperature range (-44 C to +56 C) and has a high power handling capability allowing up to 100 W of CW input power.

Muscular force transmission: a unified, dual or multiple system? A review and some explorative experimental results.

PubMed

Huijing, P

1999-10-01

Structures contributing to force transmission in muscle are reviewed combining some historical and relatively recently published experimental data. Also, effects of aponeurotomy and tenotomy are reviewed shortly as well as some new experimental results regarding these interventions that reinforce the concept of myofascial force transmission. The review is also illustrated by some new images of single muscle fibres from Xenopus Laevis indicative of such transmission and some data about locations of insertion of human gluteus maximus muscle. From this review and the new material, emerges a line of thought indicating that mechanical connections between muscle fibres and intramuscular connective tissue play an important role in force transmission. New experimental observations are presented for non-spanning muscle (i.c., rat biceps femoris muscle), regarding the great variety of types of intramuscular connections that exist i n addition to myo-tendinous junctions at the perimuscular ends of muscle fibres. Such connections are classified as (1) tapered end connections, (2) Myo-myonal junctions, (3) myo-epimysial junctions and (3) Myo-endomysial junctions. This line of thought is followed up by consideration of a possible role of connections of intra- and extramuscular connective tissue in force transmission out of the muscle. Experimental results of an explorative nature, regarding the interactions of extensor digitorum longus (EDL), tibialis anterior (TA) and hallucis longus (HAL) muscles within a relatively intact dorsal flexor compartment of the rat hind leg, indicate that: (1) length force properties of EDL are influenced by TA activity in a length dependent fashion. Depending on TA length, force exerted by EDL, kept at constant origin insertion distance, is variable and the effect is influenced by EDL length itself as well; (2) Force is transmitted from muscle to extramuscular connective tissue and vice versa. As a consequence force exerted at proximal and distal tendons of a muscle are not always equal. The difference being transmitted by extramuscular connective tissue and may appear at the tendons of other muscles or may be transmitted via connective tissue directly to bone. It is concluded that the system of force transmission from skeletal muscle should be considered as a multiple system.

n-B-pi-p Superlattice Infrared Detector

NASA Technical Reports Server (NTRS)

Ting, David Z.; Bandara, Sumith V.; Hill, Cory J.; Gunapala, Sarath D.

2011-01-01

A specially designed barrier (B) is inserted at the n-pi junction [where most GR (generation-recombination) processes take place] in the standard n-pi-p structure to substantially reduce generation-recombination dark currents. The resulting n-Bpi- p structure also has reduced tunneling dark currents, thereby solving some of the limitations to which current type II strained layer superlattice infrared detectors are prone. This innovation is compatible with common read-out integrated circuits (ROICs).

Protein myozap--a late addition to the molecular ensembles of various kinds of adherens junctions.

PubMed

Rickelt, Steffen; Kuhn, Caecilia; Winter-Simanowski, Stefanie; Zimbelmann, Ralf; Frey, Norbert; Franke, Werner Wilhelm

2011-12-01

The protein myozap, a polypeptide of 54 kDa, has recently been identified as a component of the cytoplasmic plaques of the composite junctions (areae compositae) in the myocardiac intercalated disks and of the adherens junctions (AJs) in vascular endothelia. Now we report that using very sensitive new antibodies and drastic localization methods, we have also identified this protein as a component of the AJ plaques in simple and complex epithelia, in the adluminal cell layer of the transitional epithelium of the urinary tract and in certain cell layers of diverse stratified epithelia, including gingiva, tongue, pharynx and esophagus, cervix, vagina and epidermis. Myozap has not been identified in desmosomal and tight junction plaques. We have also detected protein myozap in AJ structures of carcinomas. The discovery of a novel major protein in AJ plaques now calls for re-examinations of molecular interactions in AJ formation and maintenance and also offers a new marker for diagnostic immunocytochemistry. We also discuss the need for progressive unravelling, extractive treatments and buffer rinses of sections and cultured cells to reveal obscured or masked antigens, before definitive negative conclusions in immunohistochemistry can be made.

Spin-transfer torque switched magnetic tunnel junctions in magnetic random access memory

NASA Astrophysics Data System (ADS)

Sun, Jonathan Z.

2016-10-01

Spin-transfer torque (or spin-torque, or STT) based magnetic tunnel junction (MTJ) is at the heart of a new generation of magnetism-based solid-state memory, the so-called spin-transfer-torque magnetic random access memory, or STT-MRAM. Over the past decades, STT-based switchable magnetic tunnel junction has seen progress on many fronts, including the discovery of (001) MgO as the most favored tunnel barrier, which together with (bcc) Fe or FeCo alloy are yielding best demonstrated tunnel magneto-resistance (TMR); the development of perpendicularly magnetized ultrathin CoFeB-type of thin films sufficient to support high density memories with junction sizes demonstrated down to 11nm in diameter; and record-low spin-torque switching threshold current, giving best reported switching efficiency over 5 kBT/μA. Here we review the basic device properties focusing on the perpendicularly magnetized MTJs, both in terms of switching efficiency as measured by sub-threshold, quasi-static methods, and of switching speed at super-threshold, forced switching. We focus on device behaviors important for memory applications that are rooted in fundamental device physics, which highlights the trade-off of device parameters for best suitable system integration.

Discovery of Novel Mammary Developmental and Cancer Genes Using ENU Mutagenesis

DTIC Science & Technology

2002-10-01

death rates we need new therapeutic targets, currently a major challenge facing cancer researchers This requires an understanding of the undiscovered pathways that operate to drive breast cancer cell proliferation, cell survival and cell differentiation, pathways which are also likely to operate during normal mammary development, and which go awry in cancer The discovery of signalling pathways operative in breast cancer has utilised examination of mammary gland development following systemic endocrine ablation or viral insertion, positional cloning in affected families and

Polyamine conjugation of curcumin analogues toward the discovery of mitochondria-directed neuroprotective agents.

PubMed

Simoni, Elena; Bergamini, Christian; Fato, Romana; Tarozzi, Andrea; Bains, Sandip; Motterlini, Roberto; Cavalli, Andrea; Bolognesi, Maria Laura; Minarini, Anna; Hrelia, Patrizia; Lenaz, Giorgio; Rosini, Michela; Melchiorre, Carlo

2010-10-14

Mitochondria-directed antioxidants 2-5 were designed by conjugating curcumin congeners with different polyamine motifs as vehicle tools. The conjugates emerged as efficient antioxidants in mitochondria and fibroblasts and also exerted a protecting role through heme oxygenase-1 activation. Notably, the insertion of a polyamine function into the curcumin-like moiety allowed an efficient intracellular uptake and mitochondria targeting. It also resulted in a significant decrease in the cytotoxicity effects. 2-5 are therefore promising molecules for neuroprotectant lead discovery.

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

SNPServer: a real-time SNP discovery tool.

PubMed

Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David

2005-07-01

SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.

A mutation in the LAMC2 gene causes the Herlitz junctional epidermolysis bullosa (H-JEB) in two French draft horse breeds.

PubMed

Milenkovic, Dragan; Chaffaux, Stéphane; Taourit, Sead; Guérin, Gérard

2003-01-01

Epidermolysis bullosa (EB) is a heterogeneous group of inherited diseases characterised by skin blistering and fragility. In humans, one of the most severe forms of EB known as Herlitz-junctional EB (H-JEB), is caused by mutations in the laminin 5 genes. EB has been described in several species, like cattle, sheep, dogs, cats and horses where the mutation, a cytosine insertion in exon 10 of the LAMC2 gene, was very recently identified in Belgian horses as the mutation responsible for JEB. In this study, the same mutation was found to be totally associated with the JEB phenotype in two French draft horse breeds, Trait Breton and Trait Comtois. This result provides breeders a molecular test to better manage their breeding strategies by genetic counselling.

Experimental demonstration of a broadband two-mode multi/demultiplexer based on asymmetric Y-junctions

NASA Astrophysics Data System (ADS)

Li, Haiqin; Wang, Pengjun; Yang, Tianjun; Dai, Tingge; Wang, Gencheng; Li, Shiqi; Chen, Weiwei; Yang, Jianyi

2018-03-01

A broadband two-mode multi/demultiplexer using asymmetric Y-junctions is designed and experimentally demonstrated on a silicon-on-insulator platform for on-chip mode-division multiplexing applications. Within a bandwidth from 1513 to 1619 nm, the fabricated device, which consists of a two-mode multiplexer, a multimode straight waveguide, and a two-mode demultiplexer, exhibits demultiplexing crosstalk of less than -9.1 dB. The demultiplexing crosstalk as low as -42.1 dB, lower than -12.8 dB over the C band can be obtained. The measured insertion loss varies from 0.40 to 0.56 dB at a wavelength of 1550 nm. A transmission experiment of 10 Gbit/s electrical signals carried on TE0 and TE1 modes is successfully achieved with open and clear eye diagrams.

Laparoscopic transgastric gastroplasty: a novel technique for a large esophagogastric fistula.

PubMed

McKenna, Daniel T; Ziegler, Kathryn; Selzer, Don

2014-08-01

Esophagogastric fistula is a rare complication related to severe inflammation at the gastroesophageal junction. Most causes are related to severe gastroesophageal reflux disease, previous surgery, or malignancy. This is the case of a 72-year-old man who had a laparoscopic Nissen fundoplication. He developed an esophageal obstruction from an intraesophageal pledget. It was removed laparoscopically, and the esophagotomy was buttressed with a Nissen fundoplication. Two months later he developed severe dysphagia, and an esophagogastric fistula was diagnosed. This was a large fistula measuring 20 mm in diameter. A novel hybrid technique was used to divide the fundoplication. Under endoscopic guidance, a 12-mm balloon-tipped trocar was inserted transgastrically. A linear-cutting surgical stapler was used to divide the fundoplication and reopen the gastroesophageal junction. The patient had no further dysphagia or gastroesophageal reflux.

Traveling wave parametric amplifier with Josephson junctions using minimal resonator phase matching

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, T. C.; Mutus, J. Y.; Hoi, I.-C.

Josephson parametric amplifiers have become a critical tool in superconducting device physics due to their high gain and quantum-limited noise. Traveling wave parametric amplifiers (TWPAs) promise similar noise performance, while allowing for significant increases in both bandwidth and dynamic range. We present a TWPA device based on an LC-ladder transmission line of Josephson junctions and parallel plate capacitors using low-loss amorphous silicon dielectric. Crucially, we have inserted λ/4 resonators at regular intervals along the transmission line in order to maintain the phase matching condition between pump, signal, and idler and increase gain. We achieve an average gain of 12 dB acrossmore » a 4 GHz span, along with an average saturation power of −92 dBm with noise approaching the quantum limit.« less

An optimized protocol for generation and analysis of Ion Proton sequencing reads for RNA-Seq.

PubMed

Yuan, Yongxian; Xu, Huaiqian; Leung, Ross Ka-Kit

2016-05-26

Previous studies compared running cost, time and other performance measures of popular sequencing platforms. However, comprehensive assessment of library construction and analysis protocols for Proton sequencing platform remains unexplored. Unlike Illumina sequencing platforms, Proton reads are heterogeneous in length and quality. When sequencing data from different platforms are combined, this can result in reads with various read length. Whether the performance of the commonly used software for handling such kind of data is satisfactory is unknown. By using universal human reference RNA as the initial material, RNaseIII and chemical fragmentation methods in library construction showed similar result in gene and junction discovery number and expression level estimated accuracy. In contrast, sequencing quality, read length and the choice of software affected mapping rate to a much larger extent. Unspliced aligner TMAP attained the highest mapping rate (97.27 % to genome, 86.46 % to transcriptome), though 47.83 % of mapped reads were clipped. Long reads could paradoxically reduce mapping in junctions. With reference annotation guide, the mapping rate of TopHat2 significantly increased from 75.79 to 92.09 %, especially for long (>150 bp) reads. Sailfish, a k-mer based gene expression quantifier attained highly consistent results with that of TaqMan array and highest sensitivity. We provided for the first time, the reference statistics of library preparation methods, gene detection and quantification and junction discovery for RNA-Seq by the Ion Proton platform. Chemical fragmentation performed equally well with the enzyme-based one. The optimal Ion Proton sequencing options and analysis software have been evaluated.

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

Quantitative Mapping of Matrix Content and Distribution across the Ligament-to-Bone Insertion

PubMed Central

Spalazzi, Jeffrey P.; Boskey, Adele L.; Pleshko, Nancy; Lu, Helen H.

2013-01-01

The interface between bone and connective tissues such as the Anterior Cruciate Ligament (ACL) constitutes a complex transition traversing multiple tissue regions, including non-calcified and calcified fibrocartilage, which integrates and enables load transfer between otherwise structurally and functionally distinct tissue types. The objective of this study was to investigate region-dependent changes in collagen, proteoglycan and mineral distribution, as well as collagen orientation, across the ligament-to-bone insertion site using Fourier transform infrared spectroscopic imaging (FTIR-I). Insertion site-related differences in matrix content were also evaluated by comparing tibial and femoral entheses. Both region- and site-related changes were observed. Collagen content was higher in the ligament and bone regions, while decreasing across the fibrocartilage interface. Moreover, interfacial collagen fibrils were aligned parallel to the ligament-bone interface near the ligament region, assuming a more random orientation through the bulk of the interface. Proteoglycan content was uniform on average across the insertion, while its distribution was relatively less variable at the tibial compared to the femoral insertion. Mineral was only detected in the calcified interface region, and its content increased exponentially across the mineralized fibrocartilage region toward bone. In addition to new insights into matrix composition and organization across the complex multi-tissue junction, findings from this study provide critical benchmarks for the regeneration of soft tissue-to-bone interfaces and integrative soft tissue repair. PMID:24019964

Trypanosome RNA Editing Mediator Complex proteins have distinct functions in gRNA utilization.

PubMed

Simpson, Rachel M; Bruno, Andrew E; Chen, Runpu; Lott, Kaylen; Tylec, Brianna L; Bard, Jonathan E; Sun, Yijun; Buck, Michael J; Read, Laurie K

2017-07-27

Uridine insertion/deletion RNA editing is an essential process in kinetoplastid parasites whereby mitochondrial mRNAs are modified through the specific insertion and deletion of uridines to generate functional open reading frames, many of which encode components of the mitochondrial respiratory chain. The roles of numerous non-enzymatic editing factors have remained opaque given the limitations of conventional methods to interrogate the order and mechanism by which editing progresses and thus roles of individual proteins. Here, we examined whole populations of partially edited sequences using high throughput sequencing and a novel bioinformatic platform, the Trypanosome RNA Editing Alignment Tool (TREAT), to elucidate the roles of three proteins in the RNA Editing Mediator Complex (REMC). We determined that the factors examined function in the progression of editing through a gRNA; however, they have distinct roles and REMC is likely heterogeneous in composition. We provide the first evidence that editing can proceed through numerous paths within a single gRNA and that non-linear modifications are essential, generating commonly observed junction regions. Our data support a model in which RNA editing is executed via multiple paths that necessitate successive re-modification of junction regions facilitated, in part, by the REMC variant containing TbRGG2 and MRB8180. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Enhancement of tunneling magnetoresistance by inserting a diffusion barrier in L10-FePd perpendicular magnetic tunnel junctions

NASA Astrophysics Data System (ADS)

Zhang, De-Lin; Schliep, Karl B.; Wu, Ryan J.; Quarterman, P.; Reifsnyder Hickey, Danielle; Lv, Yang; Chao, Xiaohui; Li, Hongshi; Chen, Jun-Yang; Zhao, Zhengyang; Jamali, Mahdi; Mkhoyan, K. Andre; Wang, Jian-Ping

2018-04-01

We studied the tunnel magnetoresistance (TMR) of L10-FePd perpendicular magnetic tunnel junctions (p-MTJs) with an FePd free layer and an inserted diffusion barrier. The diffusion barriers studied here (Ta and W) were shown to enhance the TMR ratio of the p-MTJs formed using high-temperature annealing, which are necessary for the formation of high quality L10-FePd films and MgO barriers. The L10-FePd p-MTJ stack was developed with an FePd free layer with a stack of FePd/X/Co20Fe60B20, where X is the diffusion barrier, and patterned into micron-sized MTJ pillars. The addition of the diffusion barrier was found to greatly enhance the magneto-transport behavior of the L10-FePd p-MTJ pillars such that those without a diffusion barrier exhibited negligible TMR ratios (<1.0%), whereas those with a Ta (W) diffusion barrier exhibited TMR ratios of 8.0% (7.0%) at room temperature and 35.0% (46.0%) at 10 K after post-annealing at 350 °C. These results indicate that diffusion barriers could play a crucial role in realizing high TMR ratios in bulk p-MTJs such as those based on FePd and Mn-based perpendicular magnetic anisotropy materials for spintronic applications.

Reduced junction temperature and enhanced performance of high power light-emitting diodes using reduced graphene oxide pattern

NASA Astrophysics Data System (ADS)

Han, Nam; Jung, Eunjin; Han, Min; Deul Ryu, Beo; Bok Ko, Kang; Park, Young Jae; Cuong, TranViet; Cho, Jaehee; Kim, Hyunsoo; Hong, Chang-Hee

2015-07-01

Thermal management has become a crucial area for further development of high-power light-emitting didoes (LEDs) due to the high operating current densities that are required and result in additional joule heating. This increased joule heating negatively affects the performance of the LEDs since it greatly decreases both the optical performance and the lifetime. To circumvent this problem, a reduced graphene oxide (rGO) layer can be inserted to act as a heat spreader. In this study, current-voltage and light-output-current measurements are systematically performed at different temperatures from 30 to 190 °C to investigate the effect that the embedded rGO pattern has on the device performance. At a high temperature and high operating current, the junction temperature (Tj) is 23% lower and the external quantum efficiency (EQE) is 24% higher for the rGO embedded LEDs relative to those of conventional LEDs. In addition, the thermal activation energy of the rGO embedded LEDs exhibits a 30% enhancement as a function of the temperature at a bias of  -5 V. This indicates that the rGO pattern plays an essential role in decreasing the junction temperature and results in a favorable performance in terms of the temperature of the high power GaN-based LED junction.

Histopathology of tympanic membranes from patients with ventilation tubes.

PubMed

Oktay, Mehmet Faruk; Tansuker, Hasan Deniz; Fukushima, Hisaki; Paparella, Michael M; Schachern, Patricia A; Cureoglu, Sebahattin

2018-06-01

To evaluate the histopathologic changes in tympanic membranes (TMs) with ventilation tubes (VTs). In this retrospective human temporal bone study our overall study group included 4 subgroups of TMs from deceased donors as follows: 24 with a history of VT insertion for chronic otitis media with effusion (COME-VT); 5 with a history of VT insertion for Meniere's disease (MD-VT); 33 without a history of VT insertion for chronic otitis media with effusion (COME); and 14 without a history of VT insertion for Meniere's disease (MD). We classified the extent of migration of the outer keratinized squamous epithelium onto the inner surface of TM perforations and noted the presence and location of tympanosclerosis, of atrophy, of perforation, and/or of cholesteatoma formation. Tympanosclerosis occurred in 14/24 TMs in the COME-VT subgroup; 2/5, MD-VT; 7/33, COME; and 0/14, MD. The VT insertion site was mostly in the anteroinferior (63%) quadrant of the TM; tympanosclerosis occurred more frequently in the posteroinferior (42%) and posterosuperior (33%) quadrants. We found no significant correlation between the location of tympanosclerosis and the VT insertion site (P>0.05). Atrophy occurred in 7/24 TMs in the COME-VT subgroup; 3/5, MD-VT; 8/33, COME; and 2/14, MD. We found no significant correlation between the location of atrophy and the VT insertion site; however, atrophy was located mostly in the anteroinferior quadrant (one of the most common VT insertion sites) of the TM. Regarding the ingrowth of keratinized epithelium, the mucocutanous junction was detected at any point at the inner surface of the TM in 50% of the specimens. We observed intratympanic cholesteatoma formation in 2/24 TMs in the COME-VT subgroup. TM changes due to VT insertion are more common than previously realized. Meticulous otomicroscopic evaluation of the TM is necessary during tympanomastoidectomies in order to prevent the intratympanic inclusion pearls and squamous epithelial ingrowth to prevent any further cholesteatoma formation. Copyright © 2017. Published by Elsevier B.V.

InGaP Heterojunction Barrier Solar Cells

NASA Technical Reports Server (NTRS)

Welser, Roger E. (Inventor)

2014-01-01

A new solar cell structure called a heterojunction barrier solar cell is described. As with previously reported quantum-well and quantum-dot solar cell structures, a layer of narrow band-gap material, such as GaAs or indium-rich InGaP, is inserted into the depletion region of a wide band-gap PN junction. Rather than being thin, however, the layer of narrow band-gap material is about 400-430 nm wide and forms a single, ultrawide well in the depletion region. Thin (e.g., 20-50 nm), wide band-gap InGaP barrier layers in the depletion region reduce the diode dark current. Engineering the electric field and barrier profile of the absorber layer, barrier layer, and p-type layer of the PN junction maximizes photogenerated carrier escape. This new twist on nanostructured solar cell design allows the separate optimization of current and voltage to maximize conversion efficiency.

Left arm/left leg lead reversals at the cable junction box: A cause for an epidemic of errors.

PubMed

Velagapudi, Poonam; Turagam, Mohit K; Ritter, Sherry; Dohrmann, Mary L

Medical errors, especially due to misinterpretation of electrocardiograms (ECG), are extremely common in patients admitted to the hospital and significantly account for increased morbidity, mortality and health care costs in the United States. Inaccurate performance of an ECG can lead to invalid interpretation and in turn may lead to costly cardiovascular evaluation. We report a retrospective series of 58 sequential cases of ECG limb lead reversals in the ER due to inadvertent interchange in the lead cables at the point where they insert into the cable junction box of one ECG machine. This case series highlights recognition of ECG lead reversal originating in the ECG machine itself. This case series also demonstrates an ongoing need for education regarding standardization of ECG testing and for recognizing technical anomalies to deliver appropriate care for the patient. Copyright © 2016. Published by Elsevier Inc.

Chromosome catastrophes involve replication mechanisms generating complex genomic rearrangements

PubMed Central

Liu, Pengfei; Erez, Ayelet; Sreenath Nagamani, Sandesh C.; Dhar, Shweta U.; Kołodziejska, Katarzyna E.; Dharmadhikari, Avinash V.; Cooper, M. Lance; Wiszniewska, Joanna; Zhang, Feng; Withers, Marjorie A.; Bacino, Carlos A.; Campos-Acevedo, Luis Daniel; Delgado, Mauricio R.; Freedenberg, Debra; Garnica, Adolfo; Grebe, Theresa A.; Hernández-Almaguer, Dolores; Immken, LaDonna; Lalani, Seema R.; McLean, Scott D.; Northrup, Hope; Scaglia, Fernando; Strathearn, Lane; Trapane, Pamela; Kang, Sung-Hae L.; Patel, Ankita; Cheung, Sau Wai; Hastings, P. J.; Stankiewicz, Paweł; Lupski, James R.; Bi, Weimin

2011-01-01

SUMMARY Complex genomic rearrangements (CGR) consisting of two or more breakpoint junctions have been observed in genomic disorders. Recently, a chromosome catastrophe phenomenon termed chromothripsis, in which numerous genomic rearrangements are apparently acquired in one single catastrophic event, was described in multiple cancers. Here we show that constitutionally acquired CGRs share similarities with cancer chromothripsis. In the 17 CGR cases investigated we observed localization and multiple copy number changes including deletions, duplications and/or triplications, as well as extensive translocations and inversions. Genomic rearrangements involved varied in size and complexities; in one case, array comparative genomic hybridization revealed 18 copy number changes. Breakpoint sequencing identified characteristic features, including small templated insertions at breakpoints and microhomology at breakpoint junctions, which have been attributed to replicative processes. The resemblance between CGR and chromothripsis suggests similar mechanistic underpinnings. Such chromosome catastrophic events appear to reflect basic DNA metabolism operative throughout an organism’s life cycle. PMID:21925314

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

The underlying micro-mechanism of performance enhancement of non-polar n-ZnO/p-AlGaN ultraviolet light emitting diode with i-ZnO inserted layer

NASA Astrophysics Data System (ADS)

Jiang, Fan; Chen, Jingwen; Bi, Han; Li, Luying; Jing, Wenkui; Zhang, Jun; Dai, Jiangnan; Che, Renchao; Chen, Changqing; Gao, Yihua

2018-01-01

Non-polar a-plane n-ZnO/p-AlGaN and n-ZnO/i-ZnO/p-AlGaN heterojunction film light-emitting diodes (LEDs) are fabricated with good crystalline quality. The optical measurements show obvious performance enhancement with i-ZnO layer insertion. Off-axis electron holography reveals a potential drop of ˜1.5 V across the heterojunctions with typical p-n junction characteristics. It is found that the electrostatic potentials are inclined and the corresponding electrostatic fields are opposite to each other in n-ZnO and p-AlGaN regions. The electrostatic fields are mainly attributed to strain induced piezoelectric polarizations. After an insertion of an i-ZnO layer into the p-n heterojunction, comparatively flat electrostatic potential generates in the intrinsic ZnO region and contributes to faster movements of the injected electrons and holes, making the i-ZnO layer more conductive to the radiative recombination with enhanced exciton recombination possibilities and at last the LED performance enhancement.

Ultrasonic studies of high-temperature superconductors

NASA Astrophysics Data System (ADS)

Feller, Jeffrey Robert

1997-09-01

This dissertation consists roughly of two parts. The first part deals with YBa2Cu3O7-δ (YBCO) films deposited on piezoelectric (LiNbO3) substrates. Interdigital surface acoustic wave (SAW) devices (delay lines operating at center frequencies of 50 and 100 MHz) fabricated from YBCO films are examined; insertion loss measurements are presented, and electrode resistance effects are analyzed using equivalent circuit models. Sheet resistance and 168 MHz SAW attenuation measurements of a granular YBCO film on LiNbO3 are also presented. The experimental data are discussed in terms of a percolation theory that models the film as an array of identical YBCO grains connected by resistive junctions which, in the superconducting state behave as Josephson junctions. The normal state resistances of the junctions are assumed to be randomly distributed. In the second part of the dissertation, a number of novel techniques (SAW 'bridges,' the high frequency interdigital proximity probe, and weak acoustic coupling sampled continuous wave spectrometry), used in the study of the vortex state and structural transitions in the normal state of YBCO films and single crystals, are described. Evidence of the existence of a first order structural transition in the vicinity of 220 K is provided.

An Accessory Muscle of Pectoral Region: A Case Report

PubMed Central

Bannur, B.M.; Mallashetty, Nagaraj; Endigeri, Preetish

2013-01-01

Among the variations of pectoral muscles, this case appears to be unique in the literature. This was a case of an accessory pectoral muscle which was located between pectoralis major and pectoralis minor muscles, which was discovered during a routine anatomy dissection. The accessory muscle originated from 6th and 7th ribs at costo-chondral junction, which travelled supero-laterally and inserted by fusing with fibres of pectoralis minor. This unusual muscle holds importance for surgeons while they perform dissectomies, in avoiding complications. PMID:24179919

Germline transformation of the western corn rootworm, Diabrotica virgifera virgifera.

PubMed

Chu, F; Klobasa, W; Wu, P; Pinzi, S; Grubbs, N; Gorski, S; Cardoza, Y; Lorenzen, M D

2017-08-01

The western corn rootworm (WCR), a major pest of maize, is notorious for rapidly adapting biochemically, behaviourally and developmentally to a variety of control methods. Despite much effort, the genetic basis of WCR adaptation remains a mystery. Since transformation-based applications such as transposon tagging and enhancer trapping have facilitated genetic dissection of model species such as Drosophila melanogaster, we developed a germline-transformation system for WCR in an effort to gain a greater understanding of the basic biology of this economically important insect. Here we report the use of a fluorescent-marked Minos element to create transgenic WCR. We demonstrate that the transgenic strains express both an eye-specific fluorescent marker and piggyBac transposase. We identified insertion-site junction sequences via inverse PCR and assessed insertion copy number using digital droplet PCR (ddPCR). Interestingly, most WCR identified as transgenic via visual screening for DsRed fluorescence proved to carry multiple Minos insertions when tested via ddPCR. A total of eight unique insertion strains were created by outcrossing the initial transgenic strains to nontransgenic WCR mates. Establishing transgenic technologies for this beetle is the first step towards bringing a wide range of transformation-based tools to bear on understanding WCR biology. © 2017 The Royal Entomological Society.

Integrated Cryogenic Electronics Testbed (ICE-T) for Evaluation of Superconductor and Cryo-Semiconductor Integrated Circuits

NASA Astrophysics Data System (ADS)

Dotsenko, V. V.; Sahu, A.; Chonigman, B.; Tang, J.; Lehmann, A. E.; Gupta, V.; Talalevskii, A.; Ruotolo, S.; Sarwana, S.; Webber, R. J.; Gupta, D.

2017-02-01

Research and development of cryogenic application-specific integrated circuits (ASICs), such as high-frequency (tens of GHz) semiconductor and superconductor mixed-signal circuits and large-scale (>10,000 Josephson Junctions) superconductor digital circuits, have long been hindered by the absence of specialized cryogenic test apparatus. During their iterative development phase, most ASICs require many additional input-output lines for applying independent bias controls, injecting test signals, and monitoring outputs of different sub-circuits. We are developing a full suite of modular test apparatus based on cryocoolers that do not consume liquid helium, and support extensive electrical interfaces to standard and custom test equipment. Our design separates the cryogenics from electrical connections, allowing even inexperienced users to conduct testing by simply mounting their ASIC on a removable electrical insert. Thermal connections between the cold stages and the inserts are made with robust thermal links. ICE-T accommodates two independent electrical inserts at the same time. We have designed various inserts, such as universal ones with all 40 or 80 coaxial cables and those with customized wiring and temperature-controlled stages. ICE-T features fast thermal cycling for rapid testing, enables detailed testing over long periods (days to months, if necessary), and even supports automated testing of digital ICs with modular additions.

A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

PubMed

Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

2017-08-15

Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

Gap Junctional Communication in Morphogenesis

PubMed Central

Levin, Michael

2007-01-01

Gap junctions permit the direct passage of small molecules from the cytosol of one cell to that of its neighbor, and thus form a system of cell-cell communication that exists alongside familiar secretion/receptor signaling. Because of the rich potential for regulation of junctional conductance, and directional and molecular gating (specificity), gap junctional communication (GJC) plays a crucial role in many aspects of normal tissue physiology. However, the most exciting role for GJC is in the regulation of information flow that takes place during embryonic development, regeneration, and tumor progression. The molecular mechanisms by which GJC establishes local and long-range instructive morphogenetic cues are just beginning to be understood. This review summarizes the current knowledge of the involvement of GJC in the patterning of both vertebrate and invertebrate systems and discusses in detail several morphogenetic systems in which the properties of this signaling have been molecularly characterized. One model consistent with existing data in the fields of vertebrate left-right patterning and anterior-posterior polarity in flatworm regeneration postulates electrophoretically-guided movement of small molecule morphogens through long-range GJC paths. The discovery of mechanisms controlling embryonic and regenerative GJC-mediated signaling, and identification of the downstream targets of GJC-permeable molecules, represent exciting next areas of research in this fascinating field. PMID:17481700

Performance of High-Efficiency Advanced Triple-Junction Solar Panels for the LILT Mission Dawn

NASA Technical Reports Server (NTRS)

Fatemi, Navid S.; Sharma, Surya; Buitrago, Oscar; Sharps, Paul R.; Blok, Ron; Kroon, Martin; Jalink, Cees; Harris, Robin; Stella, Paul; Distefano, Sal

2005-01-01

NASA's Discovery Mission Dawn is designed to (LILT) conditions. operate within the solar system's Asteroid belt, where the large distance from the sun creates a low-intensity, low-temperature (LILT) condition. To meet the mission power requirements under LlLT conditions, very high-efficiency multi-junction solar cells were selected to power the spacecraft to be built by Orbital Sciences Corporation (OSC) under contract with JPL. Emcore's InGaP/InGaAs/Ge advanced triple-junction (ATJ) solar cells, exhibiting an average air mass zero (AMO) efficiency of greater than 27.6% (one-sun, 28 C), were used to populate the solar panels [1]. The two solar array wings, to be built by Dutch Space, with 5 large- area panels each (total area of 36.4 sq. meters) are projected to produce between 10.3 kWe and 1.3 kWe of end-of life (EOL) power in the 1.0 to 3.0 AU range, respectively. The details of the solar panel design, testing and power analysis are presented.

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

The Peptidoglycan-Binding Protein SjcF1 Influences Septal Junction Function and Channel Formation in the Filamentous Cyanobacterium Anabaena.

PubMed

Rudolf, Mareike; Tetik, Nalan; Ramos-León, Félix; Flinner, Nadine; Ngo, Giang; Stevanovic, Mara; Burnat, Mireia; Pernil, Rafael; Flores, Enrique; Schleiff, Enrico

2015-06-30

Filamentous, heterocyst-forming cyanobacteria exchange nutrients and regulators between cells for diazotrophic growth. Two alternative modes of exchange have been discussed involving transport either through the periplasm or through septal junctions linking adjacent cells. Septal junctions and channels in the septal peptidoglycan are likely filled with septal junction complexes. While possible proteinaceous factors involved in septal junction formation, SepJ (FraG), FraC, and FraD, have been identified, little is known about peptidoglycan channel formation and septal junction complex anchoring to the peptidoglycan. We describe a factor, SjcF1, involved in regulation of septal junction channel formation in the heterocyst-forming cyanobacterium Anabaena sp. strain PCC 7120. SjcF1 interacts with the peptidoglycan layer through two peptidoglycan-binding domains and is localized throughout the cell periphery but at higher levels in the intercellular septa. A strain with an insertion in sjcF1 was not affected in peptidoglycan synthesis but showed an altered morphology of the septal peptidoglycan channels, which were significantly wider in the mutant than in the wild type. The mutant was impaired in intercellular exchange of a fluorescent probe to a similar extent as a sepJ deletion mutant. SjcF1 additionally bears an SH3 domain for protein-protein interactions. SH3 binding domains were identified in SepJ and FraC, and evidence for interaction of SjcF1 with both SepJ and FraC was obtained. SjcF1 represents a novel protein involved in structuring the peptidoglycan layer, which links peptidoglycan channel formation to septal junction complex function in multicellular cyanobacteria. Nonetheless, based on its subcellular distribution, this might not be the only function of SjcF1. Cell-cell communication is central not only for eukaryotic but also for multicellular prokaryotic systems. Principles of intercellular communication are well established for eukaryotes, but the mechanisms and components involved in bacteria are just emerging. Filamentous heterocyst-forming cyanobacteria behave as multicellular organisms and represent an excellent model to study prokaryotic cell-cell communication. A path for intercellular metabolite exchange appears to involve transfer through molecular structures termed septal junctions. They are reminiscent of metazoan gap junctions that directly link adjacent cells. In cyanobacteria, such structures need to traverse the peptidoglycan layers in the intercellular septa of the filament. Here we describe a factor involved in the formation of channels across the septal peptidoglycan layers, thus contributing to the multicellular behavior of these organisms. Copyright © 2015 Rudolf et al.

Electron-rich driven electrochemical solid-state amorphization in Li-Si alloys.

PubMed

Wang, Zhiguo; Gu, Meng; Zhou, Yungang; Zu, Xiaotao; Connell, Justin G; Xiao, Jie; Perea, Daniel; Lauhon, Lincoln J; Bang, Junhyeok; Zhang, Shengbai; Wang, Chongmin; Gao, Fei

2013-09-11

The physical and chemical behaviors of materials used in energy storage devices, such as lithium-ion batteries (LIBs), are mainly controlled by an electrochemical process, which normally involves insertion/extraction of ions into/from a host lattice with a concurrent flow of electrons to compensate charge balance. The fundamental physics and chemistry governing the behavior of materials in response to the ions insertion/extraction is not known. Herein, a combination of in situ lithiation experiments and large-scale ab initio molecular dynamics simulations are performed to explore the mechanisms of the electrochemically driven solid-state amorphization in Li-Si systems. We find that local electron-rich condition governs the electrochemically driven solid-state amorphization of Li-Si alloys. This discovery provides the fundamental explanation of why lithium insertion in semiconductor and insulators leads to amorphization, whereas in metals, it leads to a crystalline alloy. The present work correlates electrochemically driven reactions with ion insertion, electron transfer, lattice stability, and phase equilibrium.

Electron-Rich Driven Electrochemical Solid-State Amorphization in Li-Si Alloys

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Zhiguo; Gu, Meng; Zhou, Yungang

2013-08-14

The physical and chemical behaviors of materials used in energy storage devices, such as lithium-ion batteries (LIBs), are mainly controlled by an electrochemical process, which normally involves insertion/extraction of ions into/from a host lattice with a concurrent flow of electrons to compensate charge balance. The fundamental physics and chemistry governing the behavior of materials in response to the ions insertion/extraction is not known. Herein, a combination of in situ lithiation experiments and large-scale ab initio molecular dynamics simulations are performed to explore the mechanisms of the electrochemically driven solid-state amorphization in Li-Si systems. We find that local electron-rich condition governsmore » the electrochemically driven solid-state amorphization of Li-Si alloys. This discovery provides the fundamental explanation of why lithium insertion in semiconductor and insulators leads to amorphization, whereas in metals, it leads to a crystalline alloy. The present work correlates electrochemically driven reactions with ion insertion, electron transfer, lattice stability and phase equilibrium.« less

Lunar prospector mission design and trajectory support

NASA Technical Reports Server (NTRS)

Lozier, David; Galal, Ken; Folta, David; Beckman, Mark

1998-01-01

The Lunar Prospector mission is the first dedicated NASA lunar mapping mission since the Apollo Orbiter program which was flown over 25 years ago. Competitively selected under the NASA Discovery Program, Lunar Prospector was launched on January 7, 1998 on the new Lockheed Martin Athena 2 launch vehicle. The mission design of Lunar Prospector is characterized by a direct minimum energy transfer trajectory to the moon with three scheduled orbit correction maneuvers to remove launch and cislunar injection errors prior to lunar insertion. At lunar encounter, a series of three lunar orbit insertion maneuvers and a small circularization burn were executed to achieve a 100 km altitude polar mapping orbit. This paper will present the design of the Lunar Prospector transfer, lunar insertion and mapping orbits, including maneuver and orbit determination strategies in the context of mission goals and constraints. Contingency plans for handling transfer orbit injection and lunar orbit insertion anomalies are also summarized. Actual flight operations results are discussed and compared to pre-launch support analysis.

Role of acellular collagen matrix surgisis in the endoscopic management of ureteropelvic junction obstruction.

PubMed

Yohannes, Paulos; Rotariu, Paul; Liatsikos, Evangelos; Malik, Aftab; Alexianu, Mihai; Pinkasov, David; Morgenstern, Nora; Lee, Benjamin R; Smith, Arthur D

2002-10-01

To investigate the role of acellular collagen matrix (Surgisis during endopyelotomy. Nine female pigs (25-35 kg) were enrolled in our protocol. The pigs were categorized as follows. Group I (N = 3) had endopyelotomy + insertion of SIS, Group II (N = 3) creation of UPJ stricture + endopyelotomy + insertion of SIS, and Group III (N = 3) Davis intubated ureterotomy using SIS. The contralateral side served as a control for each group (one pig in each group). In three pigs (two in Group III and one in Group II), Surgisis was treated with India ink prior to insertion at the endopyelotomy site. An endopyelotomy stent (14/8 F x 24 cm) was used to stent the ureteropelvic junction (UPJ) for 4 weeks. Four weeks after the stent was removed, laparoscopic nephroureterectomy was performed, and the animals were euthanized. Histopathologic analysis of the Surgisis-regenerated segment of the UPJ was performed using hematoxylin and eosin, reticular (collagen), smooth muscle actin, and S-100 (nerve) stains. All animals tolerated the procedure. The mean operative time was 162 minutes. One pig (Group II) developed pyonephrosis; one pig (Group III) developed significant ascites and was sacrificed 2 week before the end of the experiment. Histopathologic analysis showed complete epithelializaton at 8 weeks. Reticular stain demonstrated abundant collagen matrix in the submucosa. Smooth muscle staining revealed myofibroblastic proliferation within the SIS-regenerated tissue adjacent to disorganized smooth muscle cells. India ink-stained SIS-regenerated tissue did not show smooth muscle cells. The S-100 stain did not demonstrate neurons at 8 weeks; however, in three pigs, peristaltic activity was noted across the UPJ. The use of acellular collagen matrix in the endoscopic management of UPJ obstruction is a promising technique. The abundance of myofibroblasts and absence of abundant smooth muscle regeneration indicates a need to investigate the role of growth factors in SIS regeneration of host tissue.

Insertion and deletion polymorphisms of the ancient AluS family in the human genome.

PubMed

Kryatova, Maria S; Steranka, Jared P; Burns, Kathleen H; Payer, Lindsay M

2017-01-01

Polymorphic Alu elements account for 17% of structural variants in the human genome. The majority of these belong to the youngest AluY subfamilies, and most structural variant discovery efforts have focused on identifying Alu polymorphisms from these currently retrotranspositionally active subfamilies. In this report we analyze polymorphisms from the evolutionarily older AluS subfamily, whose peak activity was tens of millions of years ago. We annotate the AluS polymorphisms, assess their likely mechanism of origin, and evaluate their contribution to structural variation in the human genome. Of 52 previously reported polymorphic AluS elements ascertained for this study, 48 were confirmed to belong to the AluS subfamily using high stringency subfamily classification criteria. Of these, the majority (77%, 37/48) appear to be deletion polymorphisms. Two polymorphic AluS elements (4%) have features of non-classical Alu insertions and one polymorphic AluS element (2%) likely inserted by a mechanism involving internal priming. Seven AluS polymorphisms (15%) appear to have arisen by the classical target-primed reverse transcription (TPRT) retrotransposition mechanism. These seven TPRT products are 3' intact with 3' poly-A tails, and are flanked by target site duplications; L1 ORF2p endonuclease cleavage sites were also observed, providing additional evidence that these are L1 ORF2p endonuclease-mediated TPRT insertions. Further sequence analysis showed strong conservation of both the RNA polymerase III promoter and SRP9/14 binding sites, important for mediating transcription and interaction with retrotransposition machinery, respectively. This conservation of functional features implies that some of these are fairly recent insertions since they have not diverged significantly from their respective retrotranspositionally competent source elements. Of the polymorphic AluS elements evaluated in this report, 15% (7/48) have features consistent with TPRT-mediated insertion, thus suggesting that some AluS elements have been more active recently than previously thought, or that fixation of AluS insertion alleles remains incomplete. These data expand the potential significance of polymorphic AluS elements in contributing to structural variation in the human genome. Future discovery efforts focusing on polymorphic AluS elements are likely to identify more such polymorphisms, and approaches tailored to identify deletion alleles may be warranted.

Automated fiber tracking and tissue characterization of the anterior cruciate ligament with optical coherence tomography

NASA Astrophysics Data System (ADS)

Balasubramanian, Priya S.; Guo, Jiaqi; Yao, Xinwen; Qu, Dovina; Lu, Helen H.; Hendon, Christine P.

2017-02-01

The directionality of collagen fibers across the anterior cruciate ligament (ACL) as well as the insertion of this key ligament into bone are important for understanding the mechanical integrity and functionality of this complex tissue. Quantitative analysis of three-dimensional fiber directionality is of particular interest due to the physiological, mechanical, and biological heterogeneity inherent across the ACL-to-bone junction, the behavior of the ligament under mechanical stress, and the usefulness of this information in designing tissue engineered grafts. We have developed an algorithm to characterize Optical Coherence Tomography (OCT) image volumes of the ACL. We present an automated algorithm for measuring ligamentous fiber angles, and extracting attenuation and backscattering coefficients of ligament, interface, and bone regions within mature and immature bovine ACL insertion samples. Future directions include translating this algorithm for real time processing to allow three-dimensional volumetric analysis within dynamically moving samples.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

STS-29 MS Bagian juggles audio cassettes on Discovery's, OV-103's, middeck

NASA Technical Reports Server (NTRS)

1989-01-01

On aft middeck, STS-29 Mission Specialist (MS) James P. Bagian juggles TEAC audio cassettes freefloating above foam insert as he attempts to organize them. In front of Bagian are aft middeck lockers and part of the open airlock hatch. Behind him are the starboard wall-mounted sleep restraints.

TopHat: discovering splice junctions with RNA-Seq

PubMed Central

Trapnell, Cole; Pachter, Lior; Salzberg, Steven L.

2009-01-01

Motivation: A new protocol for sequencing the messenger RNA in a cell, known as RNA-Seq, generates millions of short sequence fragments in a single run. These fragments, or ‘reads’, can be used to measure levels of gene expression and to identify novel splice variants of genes. However, current software for aligning RNA-Seq data to a genome relies on known splice junctions and cannot identify novel ones. TopHat is an efficient read-mapping algorithm designed to align reads from an RNA-Seq experiment to a reference genome without relying on known splice sites. Results: We mapped the RNA-Seq reads from a recent mammalian RNA-Seq experiment and recovered more than 72% of the splice junctions reported by the annotation-based software from that study, along with nearly 20 000 previously unreported junctions. The TopHat pipeline is much faster than previous systems, mapping nearly 2.2 million reads per CPU hour, which is sufficient to process an entire RNA-Seq experiment in less than a day on a standard desktop computer. We describe several challenges unique to ab initio splice site discovery from RNA-Seq reads that will require further algorithm development. Availability: TopHat is free, open-source software available from http://tophat.cbcb.umd.edu Contact: cole@cs.umd.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:19289445

New technique for correcting mild types of cryptotia: elevate cavum conchae cartilage and suture to cranial periosteum.

PubMed

Shen, Weimin; Cui, Jie; Chen, Jianbin; Chen, Haini; Zou, Jijun; Ji, Yi

2012-11-01

We have developed a new technique for the treatment of mild types of cryptotia in which the cavum conchae cartilage was pulled superiorly and sutured it to the temporal bone to the temporal parietal junction periosteum securely. Then, the stitches for bolster fixation were inserted parallel to the auricular temporal sulcus and temporarily left untied. Our technique is easy to use and secures a firm bolster fixation, and the scar is hidden. We recommend it for the treatment of mild types of cryptotia.

A Compact Low-loss Magic-T using Microstrip-Slotline Transitions

NASA Technical Reports Server (NTRS)

U-yen, Kongpop; Wollack, Edward J.; Moseley, Samuel H.; Papapolymerou, John; Laskar, Joy

2007-01-01

The design of a compact low-loss magic-T is proposed. The planar magic-T incorporates the compact microstrip-slotline tee junction and small microstrip-slotline transition area to reduce slotline radiation. The experimental results show that the magic-T produces broadband in-phase and out-of-phase power combiner/divider responses, has an average in-band insertion loss of 0.3 dB and small in-band phase and amplitude imbalance of less than plus or minus 1.6 deg. and plus or minus 0.3 dB, respectively.

Superlattice structure modeling and simulation of High Electron Mobility Transistor for improved performance

NASA Astrophysics Data System (ADS)

Munusami, Ravindiran; Yakkala, Bhaskar Rao; Prabhakar, Shankar

2013-12-01

Magnetic tunnel junction were made by inserting the magnetic materials between the source, channel and the drain of the High Electron Mobility Transistor (HEMT) to enhance the performance. Material studio software package was used to design the superlattice layers. Different cases were analyzed to optimize the performance of the device by placing the magnetic material at different positions of the device. Simulation results based on conductivity reveals that the device has a very good electron transport due to the magnetic materials and will amplify very low frequency signals.

Modelling the endothelial blood-CNS barriers: a method for the production of robust in vitro models of the rat blood-brain barrier and blood-spinal cord barrier

PubMed Central

2013-01-01

Background Modelling the blood-CNS barriers of the brain and spinal cord in vitro continues to provide a considerable challenge for research studying the passage of large and small molecules in and out of the central nervous system, both within the context of basic biology and for pharmaceutical drug discovery. Although there has been considerable success over the previous two decades in establishing useful in vitro primary endothelial cell cultures from the blood-CNS barriers, no model fully mimics the high electrical resistance, low paracellular permeability and selective influx/efflux characteristics of the in vivo situation. Furthermore, such primary-derived cultures are typically labour-intensive and generate low yields of cells, limiting scope for experimental work. We thus aimed to establish protocols for the high yield isolation and culture of endothelial cells from both rat brain and spinal cord. Our aim was to optimise in vitro conditions for inducing phenotypic characteristics in these cells that were reminiscent of the in vivo situation, such that they developed into tight endothelial barriers suitable for performing investigative biology and permeability studies. Methods Brain and spinal cord tissue was taken from the same rats and used to specifically isolate endothelial cells to reconstitute as in vitro blood-CNS barrier models. Isolated endothelial cells were cultured to expand the cellular yield and then passaged onto cell culture inserts for further investigation. Cell culture conditions were optimised using commercially available reagents and the resulting barrier-forming endothelial monolayers were characterised by functional permeability experiments and in vitro phenotyping by immunocytochemistry and western blotting. Results Using a combination of modified handling techniques and cell culture conditions, we have established and optimised a protocol for the in vitro culture of brain and, for the first time in rat, spinal cord endothelial cells. High yields of both CNS endothelial cell types can be obtained, and these can be passaged onto large numbers of cell culture inserts for in vitro permeability studies. The passaged brain and spinal cord endothelial cells are pure and express endothelial markers, tight junction proteins and intracellular transport machinery. Further, both models exhibit tight, functional barrier characteristics that are discriminating against large and small molecules in permeability assays and show functional expression of the pharmaceutically important P-gp efflux transporter. Conclusions Our techniques allow the provision of high yields of robust sister cultures of endothelial cells that accurately model the blood-CNS barriers in vitro. These models are ideally suited for use in studying the biology of the blood-brain barrier and blood-spinal cord barrier in vitro and for pre-clinical drug discovery. PMID:23773766

Modelling the endothelial blood-CNS barriers: a method for the production of robust in vitro models of the rat blood-brain barrier and blood-spinal cord barrier.

PubMed

Watson, P Marc D; Paterson, Judy C; Thom, George; Ginman, Ulrika; Lundquist, Stefan; Webster, Carl I

2013-06-18

Modelling the blood-CNS barriers of the brain and spinal cord in vitro continues to provide a considerable challenge for research studying the passage of large and small molecules in and out of the central nervous system, both within the context of basic biology and for pharmaceutical drug discovery. Although there has been considerable success over the previous two decades in establishing useful in vitro primary endothelial cell cultures from the blood-CNS barriers, no model fully mimics the high electrical resistance, low paracellular permeability and selective influx/efflux characteristics of the in vivo situation. Furthermore, such primary-derived cultures are typically labour-intensive and generate low yields of cells, limiting scope for experimental work. We thus aimed to establish protocols for the high yield isolation and culture of endothelial cells from both rat brain and spinal cord. Our aim was to optimise in vitro conditions for inducing phenotypic characteristics in these cells that were reminiscent of the in vivo situation, such that they developed into tight endothelial barriers suitable for performing investigative biology and permeability studies. Brain and spinal cord tissue was taken from the same rats and used to specifically isolate endothelial cells to reconstitute as in vitro blood-CNS barrier models. Isolated endothelial cells were cultured to expand the cellular yield and then passaged onto cell culture inserts for further investigation. Cell culture conditions were optimised using commercially available reagents and the resulting barrier-forming endothelial monolayers were characterised by functional permeability experiments and in vitro phenotyping by immunocytochemistry and western blotting. Using a combination of modified handling techniques and cell culture conditions, we have established and optimised a protocol for the in vitro culture of brain and, for the first time in rat, spinal cord endothelial cells. High yields of both CNS endothelial cell types can be obtained, and these can be passaged onto large numbers of cell culture inserts for in vitro permeability studies. The passaged brain and spinal cord endothelial cells are pure and express endothelial markers, tight junction proteins and intracellular transport machinery. Further, both models exhibit tight, functional barrier characteristics that are discriminating against large and small molecules in permeability assays and show functional expression of the pharmaceutically important P-gp efflux transporter. Our techniques allow the provision of high yields of robust sister cultures of endothelial cells that accurately model the blood-CNS barriers in vitro. These models are ideally suited for use in studying the biology of the blood-brain barrier and blood-spinal cord barrier in vitro and for pre-clinical drug discovery.

Is spin transport through molecules really occurring in organic spin valves? A combined magnetoresistance and inelastic electron tunnelling spectroscopy study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galbiati, Marta; Tatay, Sergio; Delprat, Sophie

2015-02-23

Molecular and organic spintronics is an emerging research field which combines the versatility of chemistry with the non-volatility of spintronics. Organic materials have already proved their potential as tunnel barriers (TBs) or spacers in spintronics devices showing sizable spin valve like magnetoresistance effects. In the last years, a large effort has been focused on the optimization of these organic spintronics devices. Insertion of a thin inorganic tunnel barrier (Al{sub 2}O{sub 3} or MgO) at the bottom ferromagnetic metal (FM)/organic interface seems to improve the spin transport efficiency. However, during the top FM electrode deposition, metal atoms are prone to diffusemore » through the organic layer and potentially short-circuit it. This may lead to the formation of a working but undesired FM/TB/FM magnetic tunnel junction where the organic plays no role. Indeed, establishing a protocol to demonstrate the effective spin dependent transport through the organic layer remains a key issue. Here, we focus on Co/Al{sub 2}O{sub 3}/Alq{sub 3}/Co junctions and show that combining magnetoresistance and inelastic electron tunnelling spectroscopy measurements one can sort out working “organic” and short-circuited junctions fabricated on the same wafer.« less

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

PubMed

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

2007-03-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

Effect of interfacial structures on spin dependent tunneling in epitaxial L1 0-FePt/MgO/FePt perpendicular magnetic tunnel junctions

DOE PAGES

Yang, G.; Li, D. L.; Wang, S. G.; ...

2015-02-24

In this study, epitaxial FePt(001)/MgO/FePt magnetic tunnel junctions with L1 0-FePt electrodes showing perpendicular magnetic anisotropy were fabricated by molecular beam epitaxial growth. Tunnel magnetoresistance ratios of 21% and 53% were obtained at 300 K and 10 K, respectively. Our previous work, based on transmission electron microscopy, confirmed a semi-coherent interfacial structure with atomic steps (Kohn et al., APL 102, 062403 (2013)). Here, we show by x-ray photoemission spectroscopy and first-principles calculation that the bottom FePt/MgO interface is either Pt-terminated for regular growth or when an Fe layer is inserted at the interface, it is chemically bonded to O. Finally,more » both these structures have a dominant role in spin dependent tunneling across the MgO barrier resulting in a decrease of the tunneling magnetoresistance ratio compared with previous predictions.« less

Traumatic Pulmonary Herniation at the Diaphragmatic Junction in a Pediatric Patient: A Rare Complication of Blunt Chest Trauma.

PubMed

Orlik, Kseniya; Simon, Erin Leslie; Hemmer, Carrie; Ramundo, Maria

2016-07-01

We present a case of traumatic intercostal pulmonary herniation in an 11-year-old boy after blunt trauma to the chest, without associated chest wall disruption or pneumothorax. This condition is especially uncommon in children, with only 5 previously reported cases and most occurring after penetrating chest trauma. To date, there are no reports in literature describing traumatic intercostal lung herniation at the diaphragmatic junction with a closed chest cavity in a child. The number of traumatic lung herniation diagnoses may be expanded by a more liberal use of computed tomography when serious injury is suspected. Computed tomography and advanced imaging should be considered in pediatric trauma patients presenting with concern for intrathoracic injury that may not be seen on plain film. Traumatic blunt intrathoracic and intra-abdominal injuries in the pediatric population that are within proximity of diaphragmatic insertion should be thoroughly evaluated to rule out diaphragmatic injury. As in our case, invasive surgical intervention such as thoracoscopy may be necessary.

Ring modulators with enhanced efficiency based on standing-wave operation on a field-matched, interdigitated p-n junction.

PubMed

Pavanello, Fabio; Zeng, Xiaoge; Wade, Mark T; Popović, Miloš A

2016-11-28

We propose ring modulators based on interdigitated p-n junctions that exploit standing rather than traveling-wave resonant modes to improve modulation efficiency, insertion loss and speed. Matching the longitudinal nodes and antinodes of a standing-wave mode with high (contacts) and low (depletion regions) carrier density regions, respectively, simultaneously lowers loss and increases sensitivity significantly. This approach permits further to relax optical constraints on contacts placement and can lead to lower device capacitance. Such structures are well-matched to fabrication in advanced microelectronics CMOS processes. Device architectures that exploit this concept are presented along with their benefits and drawbacks. A temporal coupled mode theory model is used to investigate the static and dynamic response. We show that modulation efficiencies or loss Q factors up to 2 times higher than in previous traveling-wave geometries can be achieved leading to much larger extinction ratios. Finally, we discuss more complex doping geometries that can improve carrier dynamics for higher modulation speeds in this context.

5.0 kV breakdown-voltage vertical GaN p-n junction diodes

NASA Astrophysics Data System (ADS)

Ohta, Hiroshi; Hayashi, Kentaro; Horikiri, Fumimasa; Yoshino, Michitaka; Nakamura, Tohru; Mishima, Tomoyoshi

2018-04-01

A high breakdown voltage of 5.0 kV has been achieved for the first time in vertical GaN p-n junction diodes by using our newly developed guard-ring structures. A resistance device was inserted between the main diode portion and the guard-ring portion in a ring-shaped p-n diode to generate a voltage drop over the resistance device by leakage current flowing through the guard-ring portion under negatively biased conditions before breakdown. The voltage at the outer mesa edge of the guard-ring portion, where the electric field intensity is highest and the destructive breakdown usually occurs, is decreased by the voltage drop, so the electric field concentration in the portion is reduced. By adopting this structure, the breakdown voltage (V B) is raised by about 200 V. Combined with a low measured on-resistance (R on) of 1.25 mΩ cm2, Baliga’s figure of merit (V\\text{B}2/R\\text{on}) was as high as 20 GW/cm2.

Effect of interfacial structures on spin dependent tunneling in epitaxial L1{sub 0}-FePt/MgO/FePt perpendicular magnetic tunnel junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, G.; Li, D. L.; Wang, S. G., E-mail: Sgwang@iphy.ac.cn

2015-02-28

Epitaxial FePt(001)/MgO/FePt magnetic tunnel junctions with L1{sub 0}-FePt electrodes showing perpendicular magnetic anisotropy were fabricated by molecular beam epitaxial growth. Tunnel magnetoresistance ratios of 21% and 53% were obtained at 300 K and 10 K, respectively. Our previous work, based on transmission electron microscopy, confirmed a semi-coherent interfacial structure with atomic steps (Kohn et al., APL 102, 062403 (2013)). Here, we show by x-ray photoemission spectroscopy and first-principles calculation that the bottom FePt/MgO interface is either Pt-terminated for regular growth or when an Fe layer is inserted at the interface, it is chemically bonded to O. Both these structures have a dominantmore » role in spin dependent tunneling across the MgO barrier resulting in a decrease of the tunneling magnetoresistance ratio compared with previous predictions.« less

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces

NASA Astrophysics Data System (ADS)

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M. D.

2017-09-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal-metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism.

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces.

PubMed

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M D

2017-09-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism.

Spin-orbit torques from interfacial spin-orbit coupling for various interfaces

PubMed Central

Kim, Kyoung-Whan; Lee, Kyung-Jin; Sinova, Jairo; Lee, Hyun-Woo; Stiles, M. D.

2017-01-01

We use a perturbative approach to study the effects of interfacial spin-orbit coupling in magnetic multilayers by treating the two-dimensional Rashba model in a fully three-dimensional description of electron transport near an interface. This formalism provides a compact analytic expression for current-induced spin-orbit torques in terms of unperturbed scattering coefficients, allowing computation of spin-orbit torques for various contexts, by simply substituting scattering coefficients into the formulas. It applies to calculations of spin-orbit torques for magnetic bilayers with bulk magnetism, those with interface magnetism, a normal metal/ferromagnetic insulator junction, and a topological insulator/ferromagnet junction. It predicts a dampinglike component of spin-orbit torque that is distinct from any intrinsic contribution or those that arise from particular spin relaxation mechanisms. We discuss the effects of proximity-induced magnetism and insertion of an additional layer and provide formulas for in-plane current, which is induced by a perpendicular bias, anisotropic magnetoresistance, and spin memory loss in the same formalism. PMID:29333523

Pilot study on preventing anastomotic leakage in stapled gastroesophageal anastomosis

PubMed Central

Huang, Weiming; Liu, Xiangzheng; Li, Jian

2017-01-01

Background This study explored how to improve the surgical technique to reduce or avoid anastomotic leakage. Methods From January 2012 to December 2016, 101 consecutive patients with cancer of the esophagus or gastroesophageal junction underwent stapled gastroesophageal anastomosis. The procedure included creating a tube‐type stomach, fixing an inserted anvil, inspecting mucosa‐to‐mucosa alignment in the lumen under direct vision after firing the stapler, and, if found, manually repairing a rupture of the mucous membrane of the anastomosis. Results A rupture of the mucous membrane of the anastomosis was found in four out of the 101 patients and manually repaired. No postsurgical anastomotic leakage occurred. All patients recovered well and the average postoperative stay was 10.4 days. There was no mortality within 30 days after surgery. Conclusion It is critical to inspect the integrality of the luminal mucous membrane of the anastomosis under direct vision in order to prevent anastomotic leakage in surgical resection of esophageal and gastroesophageal junction malignancies. PMID:29130643

Metalliclike behavior of the exchange coupling in (001) Fe/MgO/Fe junctions

NASA Astrophysics Data System (ADS)

Bellouard, C.; Duluard, A.; Snoeck, E.; Lu, Y.; Negulescu, B.; Lacour, D.; Senet, C.; Robert, S.; Maloufi, N.; Andrieu, S.; Hehn, M.; Tiusan, C.

2017-10-01

Exchange magnetic coupling between Fe electrodes through a thin MgO interlayer in epitaxial junctions has been investigated as a function of temperature, MgO thickness, and interface quality. Depending on the MgO thickness, which has been varied from 1.5 to 4 monolayers, two opposite temperature dependences are clearly disentangled. For a thin MgO spacer, the main component decreases with temperature following a metalliclike behavior. On the contrary, for the thickest MgO layers, the main component increases with temperature, following an Arrhenius law. Moreover, the insertion of a monoatomic roughness at the bottom MgO interface, induced by the addition of a fraction of a Fe monolayer, exacerbates the metallic features as an oscillatory behavior from antiferromagnetic to ferromagnetic is observed. These results allow questioning the simple tunneling mechanism usually invoked for MgO coupling, and suggest a crossover behavior of the thin MgO spacer from metallic to insulating with a progressive opening of the gap.

Bridging the gap to therapeutic strategies based on connexin/pannexin biology.

PubMed

Naus, Christian C; Giaume, Christian

2016-11-29

A unique workshop was recently held focusing on enhancing collaborations leading to identify and update the development of therapeutic strategies targeting connexin/pannexin large pore channels. Basic scientists exploring the functions of these channels in various pathologies gathered together with leading pharma companies which are targeting gap junction proteins for specific therapeutic applications. This highlights how paths of discovery research can converge with therapeutic strategies in innovative ways to enhance target identification and validation.

Examination of a Junction-Box Adhesion Test for Use in Photovoltaic Module Qualification: Preprint

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, D. C.; Wohlgemuth, J. H.

2012-08-01

Engineering robust adhesion of the junction-box (j-box) is a hurdle typically encountered by photovoltaic (PV) module manufacturers during product development. There are historical incidences of adverse effects (e.g., fires) caused when the j-box/adhesive/module system has failed in the field. The addition of a weight to the j-box during the 'damp heat' IEC qualification test is proposed to verify the basic robustness of its adhesion system. The details of the proposed test will be described, in addition to the preliminary results obtained using representative materials and components. The described discovery experiments examine moisture-cured silicone, foam tape, and hot-melt adhesives used inmore » conjunction with PET or glass module 'substrates.' To be able to interpret the results, a set of material-level characterizations was performed, including thermogravimetric analysis, differential scanning calorimetry, and dynamic mechanical analysis. PV j-boxes were adhered to a substrate, loaded with a prescribed weight, and then placed inside an environmental chamber (at 85C, 85% relative humidity). Some systems did not remain attached through the discovery experiments. Observed failure modes include delamination (at the j-box/adhesive or adhesive/substrate interface) and phase change/creep. The results are discussed in the context of the application requirements, in addition to the plan for the formal experiment supporting the proposed modification to the qualification test.« less

User Evaluation of Automatically Generated Semantic Hypertext Links in a Heavily Used Procedural Manual.

ERIC Educational Resources Information Center

Tebbutt, John

1999-01-01

Discusses efforts at National Institute of Standards and Technology (NIST) to construct an information discovery tool through the fusion of hypertext and information retrieval that works by parsing a contiguous document base into smaller documents and inserting semantic links between them. Also presents a case study that evaluated user reactions.…

Discovery of Cationic Polymers for Non-viral Gene Delivery using Combinatorial Approaches

PubMed Central

Barua, Sutapa; Ramos, James; Potta, Thrimoorthy; Taylor, David; Huang, Huang-Chiao; Montanez, Gabriela; Rege, Kaushal

2015-01-01

Gene therapy is an attractive treatment option for diseases of genetic origin, including several cancers and cardiovascular diseases. While viruses are effective vectors for delivering exogenous genes to cells, concerns related to insertional mutagenesis, immunogenicity, lack of tropism, decay and high production costs necessitate the discovery of non-viral methods. Significant efforts have been focused on cationic polymers as non-viral alternatives for gene delivery. Recent studies have employed combinatorial syntheses and parallel screening methods for enhancing the efficacy of gene delivery, biocompatibility of the delivery vehicle, and overcoming cellular level barriers as they relate to polymer-mediated transgene uptake, transport, transcription, and expression. This review summarizes and discusses recent advances in combinatorial syntheses and parallel screening of cationic polymer libraries for the discovery of efficient and safe gene delivery systems. PMID:21843141

Two different types of double-strand breaks in Saccharomyces cerevisiae are repaired by similar RAD52-independent, nonhomologous recombination events.

PubMed Central

Kramer, K M; Brock, J A; Bloom, K; Moore, J K; Haber, J E

1994-01-01

In haploid rad52 Saccharomyces cerevisiae strains unable to undergo homologous recombination, a chromosomal double-strand break (DSB) can be repaired by imprecise rejoining of the broken chromosome ends. We have used two different strategies to generate broken chromosomes: (i) a site-specific DSB generated at the MAT locus by HO endonuclease cutting or (ii) a random DSB generated by mechanical rupture during mitotic segregation of a conditionally dicentric chromosome. Broken chromosomes were repaired by deletions that were highly variable in size, all of which removed more sequences than was required either to prevent subsequent HO cleavage or to eliminate a functional centromere, respectively. The junction of the deletions frequently occurred where complementary strands from the flanking DNA could anneal to form 1 to 5 bp, although 12% (4 of 34) of the events appear to have occurred by blunt-end ligation. These types of deletions are very similar to the junctions observed in the repair of DSBs by mammalian cells (D. B. Roth and J. H. Wilson, Mol. Cell. Biol. 6:4295-4304, 1986). When a high level of HO endonuclease, expressed in all phases of the cell cycle, was used to create DSBs, we also recovered a large class of very small (2- or 3-bp) insertions in the HO cleavage site. These insertions appear to represent still another mechanism of DSB repair, apparently by annealing and filling in the overhanging 3' ends of the cleavage site. These types of events have also been well documented for vertebrate cells. PMID:8289808

Simulation of miniature endplate potentials in neuromuscular junctions by using a cellular automaton

NASA Astrophysics Data System (ADS)

Avella, Oscar Javier; Muñoz, José Daniel; Fayad, Ramón

2008-01-01

Miniature endplate potentials are recorded in the neuromuscular junction when the acetylcholine contents of one or a few synaptic vesicles are spontaneously released into the synaptic cleft. Since their discovery by Fatt and Katz in 1952, they have been among the paradigms in neuroscience. Those potentials are usually simulated by means of numerical approaches, such as Brownian dynamics, finite differences and finite element methods. Hereby we propose that diffusion cellular automata can be a useful alternative for investigating them. To illustrate this point, we simulate a miniature endplate potential by using experimental parameters. Our model reproduces the potential shape, amplitude and time course. Since our automaton is able to track the history and interactions of each single particle, it is very easy to introduce non-linear effects with little computational effort. This makes cellular automata excellent candidates for simulating biological reaction-diffusion processes, where no other external forces are involved.

[Palisade endings of extraocular muscles in eyes with congenital nystagmus].

PubMed

Shang, Yan-feng; Zhang, Jing; Gong, Hua-qing; Chen, Xia

2012-09-01

To evaluate the morphology, distribution and function of palisade endings (PE) in human extraocular muscles (EOM), and observe the alterations in eyes with congenital nystagmus (CN). The etiology and pathogenesis of CN were also investigated. It was a experimental study. The distal myotendinous junctions of the EOM were obtained during operation for CN (CN group) and concomitant strabismus (control group). The samples from patients with similar age and same extraction sites in the two groups were compared. The muscles cut during operation were immediately put into 4% glutaraldehyde fixative solution. And 1-2 transverse bands of tissue were cut every 1 mm from tendon insertion for specimens processing. The ultrastructure of EOM and PE in the two groups was observed by transmission electron microscopy. The distal parts of EOM cut during operation were put into 4% paraformaldehyde promptly. Myotendinous junction region whole mounts were labeled with antibodies against choline acetyltransferase (ChAT). Muscle fibers were counterstained with phalloidin. And longitudinal and transverse cryostat serial sections were cut at 25 µm and analyzed by confocal laser scanning microscopy. The ChAT expression, morphology and distribution of PE were observed. The same fragment of myotendinous junction in the two groups was selected. After the total protein was extracted, ChAT was detected by western blot. The expression level of ChAT was analyzed. Compared with the controls, the ultrastructure in the CN group had considerable variations. The axon of PE was swelled and deformed partly. The electron density was increased and presented as addicted to osmic acid. In the muscle cells, mitochondria was swelled, and sarcoplasmic reticulum was dilated. All PE exhibited ChAT immunoreactivity in human EOM. In the longitudinal section, nerve fibers extended from the muscle into the tendon, looped back and divided into several terminal arborizations (palisade endings) around the muscle fiber tip. The PE of medial rectus were richest at the location 3 - 4 mm from tendon insertion. In the cross section, the amount of PE in the CN group was higher than the control group (t = -5.613, P < 0.05). The expression level of ChAT in the CN group was higher than the control group (t = -3.730, P < 0.05). Palisade endings in myotendinous junction of human EOM are cholinergic nerves, which might innervate the contraction of EOM. Significant changes of palisade endings in the EOM of the CN subjects may affect eye movement.

MOSAIK: a hash-based algorithm for accurate next-generation sequencing short-read mapping.

PubMed

Lee, Wan-Ping; Stromberg, Michael P; Ward, Alistair; Stewart, Chip; Garrison, Erik P; Marth, Gabor T

2014-01-01

MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me).

MOSAIK: A Hash-Based Algorithm for Accurate Next-Generation Sequencing Short-Read Mapping

PubMed Central

Lee, Wan-Ping; Stromberg, Michael P.; Ward, Alistair; Stewart, Chip; Garrison, Erik P.; Marth, Gabor T.

2014-01-01

MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me). PMID:24599324

In vitro study of stem cell communication via gap junctions for fibrocartilage regeneration at entheses.

PubMed

Nayak, Bibhukalyan Prasad; Goh, James Cho Hong; Toh, Siew Lok; Satpathy, Gyan Ranjan

2010-03-01

Entheses are fibrocartilaginous organs that bridge ligament with bone at their interface and add significant insertional strength. To replace a severely damaged ligament, a tissue-engineered graft preinstalled with interfacial fibrocartilage, which is being regenerated from stem cells, appears to be more promising than ligament-alone graft. Such a concept can be realized by a biomimetic approach of establishing a dynamic communication of stem cells with bone cells and/or ligament fibroblasts in vitro. The current study has two objectives. The first objective is to demonstrate functional coculture of bone marrow-derived stem cells (BMSCs) with mature bone cells/ligament fibroblasts as evidenced by gap-junctional communication in vitro. The second objective is to investigate the role of BMSCs in the regeneration of fibrocartilage within the coculture. Rabbit bone/ligament fibroblasts were dual-stained with DiI-Red and calcein (gap-junction permeable dye), and cocultured with unlabeled BMSCs at fixed ratio (1:10). The functional gap junction was demonstrated by the transfer of calcein from donor to recipient cells that was confirmed and quantified by flow cytometry. Type 2 collagen (cartilage extracellular matrix-specific protein) expressed by the mixed cell lines in the cocultures were estimated by real-time reverse transcription PCR and compared with that of the ligament-bone coculture (control). Significant transfer of calcein into BMSCs was observed and flow cytometry analyses showed a gradual increase in the percentage of BMSCs acquiring calcein with time. Cocultures that included BMSCs expressed significantly more type 2 collagen compared with the control. The current study, for the first time, reported the expression of gap-junctional communication of BMSCs with two adherent cell lines of musculoskeletal system in vitro and also confirmed that incorporation of stem cells augments fibrocartilage regeneration. The results open up a path to envisage a composite graft preinstalled with enthesial fibrocartilage using a stem cell-based coculture system.

The mid-sternal length, a practical anatomical landmark for optimal positioning of long-term central venous catheters

PubMed Central

Salimi, Fereshte; Imani, Mohammad Reza; Ghasemi, Navab; Keshavarzian, Amir; Jazi, Amir Hosein Davarpanah

2013-01-01

Background: Long-term tunneled catheters are used for the hemodialysis or chemotherapy in many patients. Proper placement of the catheter tip could reduce early and late catheter related complications. Aim of the present study was to evaluate a new formula for proper placement of tunneled hemodialysis or infusion port device by using an external anatomic landmark. Materials and Methods: A total of 64 adult patients undergoing elective placement of tunneled Central Venous Catheter (CVC) requiring hemodialysis or chemotherapy were enrolled in this prospective study during 2011-2012 in the university hospital. The catheter length to be inserted in the right internal jugular vein (IJV) was calculated by adding two measurements (the shortest straight length between the insertion point of the needle and the suprasternal notch plus and half of sternal length). The catheter position was considered correct if the tip was positioned in the right atrium (RA) or Superior vena cava (SVC)-RA junction. Results: The patients were 55.28 ± 19.85 years of age, weighed 5.78 ± 16.62 kg and were 166.07 ± 10.27 cm tall. Catheters were inserted successfully in 88% of patients (n = 56). Catheter tip positions in the failures were SVC (n = 5), tricuspid valve (n = 2), and right ventricle (n = 1) in our patients. Conclusion: Long-term hemodialysis or port CVC could easily insert in the right IJV by using half of the sternal length as an external land marks among adult patients. PMID:24174941

37. DETAIL OF CYANIDE LEACHING TANK DRAIN DOOR AND PIPING ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

37. DETAIL OF CYANIDE LEACHING TANK DRAIN DOOR AND PIPING SYSTEM. NOTE SPIGOT UNDER BOARD AT UPPER LEFT INSERTS INTO HOLE IN PIPE AT BOTTOM OF FRAME. CYANIDE SOLUTION WAS PUMPED INTO THE TANKS AND THE PREGNANT SOLUTION DRAINED OUT OF THE TANKS THROUGH THIS PIPE, AND BACK INTO A SEPARATE HOLDING TANK ON THE EAST SIDE OF THE MILL. TAILINGS WERE REMOVED FROM THE TANKS THROUGH THE ROUND DRAIN DOOR IN THE BOTTOM OF THE TANK (MISSING) SEEN AT TOP CENTER. - Skidoo Mine, Park Route 38 (Skidoo Road), Death Valley Junction, Inyo County, CA

Effects of Fe-Oxide and Mg Layer Insertion on Tunneling Magnetoresistance Properties of CoFeB/MgO/CoFeB Magnetic Tunnel Junctions

NASA Astrophysics Data System (ADS)

Lou, Yong-Le; Zhang, Yu-Ming; Guo, Hui; Xu, Da-Qing; Zhang, Yi-Men

2016-11-01

Not Available Supported by the National Defense Advance Research Foundation under Grant No 9140A08XXXXXX0DZ106, the Basic Research Program of Ministry of Education of China under Grant No JY10000925005, the Scientific Research Program Funded by Shaanxi Provincial Education Department under Grant No 11JK0912, the Scientific Research Foundation of Xi'an University of Science and Technology under Grant No 2010011, and the Doctoral Research Startup Fund of Xi'an University of Science and Technology under Grant No 2010QDJ029.

Gingival microleakage of class V composite restorations with fiber inserts.

PubMed

Ahmed, Walaa; El-Badrawy, Wafa; Kulkarni, Gajanan; Prakki, Anuradha; El-Mowafy, Omar

2013-07-01

This study investigated the effect of different fiber inserts (glass and polyethylene), bonding agents, and resin composites on the gingival margin microleakage of class V composite restorations. Sixty premolars were sterilized and mounted in acrylic resin bases. Class V cavities were prepared buccally and lingually, 1 mm below the cementoenamel junction, comprising 12 groups (n = 10). In the experimental groups fiber inserts were cut and placed at the gingival seat, while the control groups had no inserts. Combinations of two composite materials, Filtek-Z250 and Filtek-LS (3M-ESPE), and four bonding agents, Clearfil SE bond (Kuraray) (C), Scotch Bond Multipurpose (3M-ESPE) (SB), Prime and Bond NT (Dentsply) (PB), and Filtek-LS (3M-ESPE) (LS) were used. Restorations were incrementally inserted and polymerized for 40s. Specimens were then stored in distilled water for 7 days and thermocycled for 500 cycles. Teeth surfaces were sealed with nail polish except for 1 mm around restoration margins and immersed in 2% red procion dye. Teeth were then sectioned buccolingually and dye penetration was assessed with five-point scale. Data were statistically-analyzed by Kruskal-Wallis, ANOVA and Tukey's tests (α = 5%). Mean microleakage scores varied from 0.40 (Groups C, C with polyethylene, LS, LS with polyethylene) to 1.50 (SB). Different bonding agents led to differences in microleakage scores where C and LS showed significantly lower microleakage than PB. SB had highest mean microleakage score, however, incorporation of fibers resulted in significant reduction in microleakage. Class V resin composite restorations bonded with a total-etch adhesive had a significant reduction in mean microleakage scores when glass or polyethylene fibers were placed at the gingival cavo-surface margin. In contrast, for two self-etch adhesive systems, the incorporation of fibers had no significant effect on mean microleakage scores.

Modified C1 lateral mass screw insertion using a high entry point to avoid postoperative occipital neuralgia.

PubMed

Lee, Sun-Ho; Kim, Eun-Sang; Eoh, Whan

2013-01-01

For the past decade, a screw-rod construct has been used commonly to stabilize the atlantoaxial joint, but the insertion of the screw through the C1 lateral mass (LM) can cause several complications. We evaluated whether using a higher screw entry point for C1 lateral mass (LM) fixation than in the standard procedure could prevent screw-induced occipital neuralgia. We enrolled 12 consecutive patients who underwent bilateral C1 LM fixation, with the modified screw insertion point at the junction of the C1 posterior arch and the midpoint of the posterior inferior portion of the C1 LM. We measured postoperative clinical and radiological parameters and recorded intraoperative complications, postoperative neurological deficits and the occurrence of occipital neuralgia. Postoperative plain radiographs were used to check for malpositioning of the screw or failure of the construct. Four patients underwent atlantoaxial stabilization for a transverse ligament injury or a C1 or C2 fracture, six patients for os odontoideum, and two patients for C2 metastasis. No patient experienced vertebral artery injury or cerebrospinal fluid leak, and all had minimal blood loss. No patient suffered significant occipital neuralgia, although one patient developed mild, transient unilateral neuralgia. There was also no radiographic evidence of construct failure. Twenty screws were positioned correctly through the intended entry points, but three screws were placed inferiorly (that is, below the arch), and one screw was inserted too medially. When performing C1-C2 fixation using the standard (Harms) construct, surgeons should be aware of the possible development of occipital neuralgia. A higher entry point may prevent this complication; therefore, we recommend that the screw should be inserted into the arch of C1 if it can be accommodated. Copyright © 2012 Elsevier Ltd. All rights reserved.

Insertion of a solo LTR retrotransposon associates with spur mutations in 'Red Delicious' apple (Malus × domestica).

PubMed

Han, Mengxue; Sun, Qibao; Zhou, Junyong; Qiu, Huarong; Guo, Jing; Lu, Lijuan; Mu, Wenlei; Sun, Jun

2017-09-01

Insertion of a solo LTR, which possesses strong bidirectional, stem-specific promoter activities, is associated with the evolution of a dwarfing apple spur mutation. Spur mutations in apple scions revolutionized global apple production. Since long terminal repeat (LTR) retrotransposons are tightly related to natural mutations, inter-retrotransposon-amplified polymorphism technique and genome walking were used to find sequences in the apple genome based on these LTRs. In 'Red Delicious' spur mutants, a novel, 2190-bp insertion was identified as a spur-specific, solo LTR (sLTR) located at the 1038th nucleotide of another sLTR, which was 1536 bp in length. This insertion-within-an-insertion was localized within a preexisting Gypsy-50 retrotransposon at position 3,762,767 on chromosome 4. The analysis of transcriptional activity of the two sLTRs (the 2190- and 1536-bp inserts) indicated that the 2190-bp sLTR is a promoter, capable of bidirectional transcription. GUS expression in the 2190-bp-sense and 2190-bp-antisense transgenic lines was prominent in stems. In contrast, no promoter activity from either the sense or the antisense strand of the 1536-bp sLTR was detected. From ~150 kb of DNA on each side of the 2190 bp, sLTR insertion site, corresponding to 300 kb of the 'Golden Delicious' genome, 23 genes were predicted. Ten genes had predicted functions that could affect shoot development. This first report, of a sLTR insertion associated with the evolution of apple spur mutation, will facilitate apple breeding, cloning of spur-related genes, and discovery of mechanisms behind dwarf habit.

Transient bradycardia induced by thiopentone sodium: a unique challenge in the management of refractory status epilepticus

PubMed Central

Sharma, Sushma; Nair, Pradeep P; Murgai, Aditya; Selvaraj, Raja J

2013-01-01

Thiopentone sodium is one of the important drugs in the armamentarium for terminating refractory status epilepticus, a neurological emergency. We report a case of thiopentone-related bradycardia during the management of the new onset refractory status epilepticus in a young man, which was circumvented by prophylactic insertion of temporary pacemaker while thiopentone infusion was continued. A systematic approach was employed to manage the status epilepticus, including infusion of thiamine and glucose followed by antiepileptic drugs. The patient was ventilated and infused with lorazepam, phenytoin, sodium valproate, levetiracetam and midazolam followed by thiopentone sodium. With the introduction of thiopentone the seizures could be controlled but the patient developed severe bradycardia and junctional rhythm. The bradycardia disappeared when thiopentone was withdrawn and reappeared when the drug was reintroduced. Propofol infusion was tried with no respite in seizures. Later thiopentone sodium was reintroduced after inserting temporary cardiac pacemaker. Seizure was controlled and patient was weaned off the ventilator. PMID:24130206

Transient bradycardia induced by thiopentone sodium: a unique challenge in the management of refractory status epilepticus.

PubMed

Sharma, Sushma; Nair, Pradeep P; Murgai, Aditya; Selvaraj, Raja J

2013-10-15

Thiopentone sodium is one of the important drugs in the armamentarium for terminating refractory status epilepticus, a neurological emergency. We report a case of thiopentone-related bradycardia during the management of the new onset refractory status epilepticus in a young man, which was circumvented by prophylactic insertion of temporary pacemaker while thiopentone infusion was continued. A systematic approach was employed to manage the status epilepticus, including infusion of thiamine and glucose followed by antiepileptic drugs. The patient was ventilated and infused with lorazepam, phenytoin, sodium valproate, levetiracetam and midazolam followed by thiopentone sodium. With the introduction of thiopentone the seizures could be controlled but the patient developed severe bradycardia and junctional rhythm. The bradycardia disappeared when thiopentone was withdrawn and reappeared when the drug was reintroduced. Propofol infusion was tried with no respite in seizures. Later thiopentone sodium was reintroduced after inserting temporary cardiac pacemaker. Seizure was controlled and patient was weaned off the ventilator.

Graphene/h-BN/GaAs sandwich diode as solar cell and photodetector.

PubMed

Li, Xiaoqiang; Lin, Shisheng; Lin, Xing; Xu, Zhijuan; Wang, Peng; Zhang, Shengjiao; Zhong, Huikai; Xu, Wenli; Wu, Zhiqian; Fang, Wei

2016-01-11

In graphene/semiconductor heterojunction, the statistic charge transfer between graphene and semiconductor leads to decreased junction barrier height and limits the Fermi level tuning effect in graphene, which greatly affects the final performance of the device. In this work, we have designed a sandwich diode for solar cells and photodetectors through inserting 2D hexagonal boron nitride (h-BN) into graphene/GaAs heterostructure to suppress the static charge transfer. The barrier height of graphene/GaAs heterojunction can be increased from 0.88 eV to 1.02 eV by inserting h-BN. Based on the enhanced Fermi level tuning effect with interface h-BN, through adopting photo-induced doping into the device, power conversion efficiency (PCE) of 10.18% has been achieved for graphene/h-BN/GaAs compared with 8.63% of graphene/GaAs structure. The performance of graphene/h-BN/GaAs based photodetector is also improved with on/off ratio increased by one magnitude compared with graphene/GaAs structure.

A Developmental Framework for Complex Plasmodesmata Formation Revealed by Large-Scale Imaging of the Arabidopsis Leaf Epidermis[W

PubMed Central

Fitzgibbon, Jessica; Beck, Martina; Zhou, Ji; Faulkner, Christine; Robatzek, Silke; Oparka, Karl

2013-01-01

Plasmodesmata (PD) form tubular connections that function as intercellular communication channels. They are essential for transporting nutrients and for coordinating development. During cytokinesis, simple PDs are inserted into the developing cell plate, while during wall extension, more complex (branched) forms of PD are laid down. We show that complex PDs are derived from existing simple PDs in a pattern that is accelerated when leaves undergo the sink–source transition. Complex PDs are inserted initially at the three-way junctions between epidermal cells but develop most rapidly in the anisocytic complexes around stomata. For a quantitative analysis of complex PD formation, we established a high-throughput imaging platform and constructed PDQUANT, a custom algorithm that detected cell boundaries and PD numbers in different wall faces. For anticlinal walls, the number of complex PDs increased with increasing cell size, while for periclinal walls, the number of PDs decreased. Complex PD insertion was accelerated by up to threefold in response to salicylic acid treatment and challenges with mannitol. In a single 30-min run, we could derive data for up to 11k PDs from 3k epidermal cells. This facile approach opens the door to a large-scale analysis of the endogenous and exogenous factors that influence PD formation. PMID:23371949

The History of the Discovery of the Molybdenum Cofactor and Novel Aspects of its Biosynthesis in Bacteria

PubMed Central

Leimkühler, Silke; Wuebbens, Margot M.; Rajagopalan, K.V.

2010-01-01

Biosynthesis of the molybdenum cofactor in bacteria is described with a detailed analysis of each individual reaction leading to the formation of stable intermediates during the synthesis of molybdopterin from GTP. As a starting point, the discovery of molybdopterin and the elucidation of its structure through the study of stable degradation products are described. Subsequent to molybdopterin synthesis, the molybdenum atom is added to the molybdopterin dithiolene group to form the molybdenum cofactor. This cofactor is either inserted directly into specific molybdoenzymes or is further modified by the addition of nucleotides to the molybdopterin phosphate group or the replacement of ligands at the molybdenum center. PMID:21528011

Targeting diseased tissues by pHLIP insertion at low cell surface pH.

PubMed

Andreev, Oleg A; Engelman, Donald M; Reshetnyak, Yana K

2014-01-01

The discovery of the pH Low Insertion Peptides (pHLIPs®) provides an opportunity to develop imaging and drug delivery agents targeting extracellular acidity. Extracellular acidity is associated with many pathological states, such as those in cancer, ischemic stroke, neurotrauma, infection, lacerations, and others. The metabolism of cells in injured or diseased tissues often results in the acidification of the extracellular environment, so acidosis might be useful as a general marker for the imaging and treatment of diseased states if an effective targeting method can be developed. The molecular mechanism of a pHLIP peptide is based on pH-dependent membrane-associated folding. pHLIPs, being moderately hydrophobic peptides, have high affinities for cellular membranes at normal pH, but fold and insert across membranes at low pH, allowing them to sense pH at the surfaces of cells in diseased tissues, where it is the lowest. Here we discuss the main principles of pHLIP interactions with membrane lipid bilayers at neutral and low pHs, the possibility of tuning the folding and insertion pH by peptide sequence variation, and potential applications of pHLIPs for imaging, therapy and image-guided interventions.

The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

PubMed Central

Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

2007-01-01

Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

Arynes and Heteroarynes in the Synthesis of Dibenzocinnolines, Diazaxanthyledenes, and Triptycenes

NASA Astrophysics Data System (ADS)

Suh, Sung-Eun

Arynes are known as useful synthons in organic synthesis. In particular, reactions accompanying multiple arynes have been employed for the construction of arenes and heteroarenes of complex molecules. Employing known reactivity modes of arynes such as cycloadditions, nucleophilic addition, bond insertion, Alder-ene, annulation, desaturation, and polymerization, a wide variety of transformation of reactive starting materials led to the development of novel fluorophores and energy materials, as well as the synthesis of natural products. Harnessing the highly reactive arynes, the triple aryne-tetrazine (TAT) reaction was disclosed as a novel metal-free synthetic method for the preparation of dibenzo[de,g]cinnoline derivatives in a single operation. Dibenzo[de,g]cinnolines have been shown as potential fluorescent probes in cells. For the mechanism, multiple mechanistic steps of the TAT reaction were scrutinized by isolation of intermediates and byproducts as well as a computational study on the transition states and the competitive reactions pathways. A facile two-step synthesis of the reported structure of xylopyridine A was developed from a pyridyne precursor and 2-fluorobenzoic acid utilizing a pyridyne insertion reaction followed by reductive coupling. Simple transformation of the reported xylopyridine A structure have given photoactivatable dyes and specific organelle staining probes in either live or fixed cells and tissues, exhibiting high quantum yields, photostability, cell permeability and low toxicity. On the basis of these results, the synthesis of multistage photoactivatable dyes was designed and studied. Utilization of arynes allowed access to the synthesis of 9-substituted triptycene derivatives which have been recognized as three-way junction binders. Accompanying solid-phase peptide synthesis, the rapid diversification of the triptycene scaffold was achieved for screening in a nucleic acid junction binding assay.

Accuracy of Intravenous Electrocardiography Confirmation of Peripherally Inserted Central Catheter for Parenteral Nutrition.

PubMed

Mundi, Manpreet S; Edakkanambeth Varayil, Jithinraj; McMahon, Megan T; Okano, Akiko; Vallumsetla, Nishanth; Bonnes, Sara L; Andrews, James C; Hurt, Ryan T

2016-04-01

Parenteral nutrition (PN) is a life-saving therapy for patients with intestinal failure. Safe delivery of hyperosmotic solution requires a central venous catheter (CVC) with tip in the lower superior vena cava (SVC) or at the SVC-right atrium (RA) junction. To reduce cost and delay in use of CVC, new techniques such as intravascular electrocardiogram (ECG) are being used for tip confirmation in place of chest x-ray (CXR). The present study assessed for accuracy of ECG confirmation in home PN (HPN). Records for all patients consulted for HPN from December 17, 2014, to June 16, 2015, were reviewed for patient demographics, diagnosis leading to HPN initiation, and ECG and CXR confirmation. CXRs were subsequently reviewed by a radiologist to reassess location of the CVC tip and identify those that should be adjusted. Seventy-three patients were eligible, and after assessment for research authorization and postplacement CXR, 17 patients (30% male) with an age of 54 ± 14 years were reviewed. In all patients, postplacement intravascular ECG reading stated tip in the SVC. However, based on CXR, the location of the catheter tip was satisfactory (low SVC or SVC-RA junction) in 10 of 17 patients (59%). Due to the high osmolality of PN, CVC tip location is of paramount importance. After radiology review of CXR, we noted that 7 of 17 (41%) peripherally inserted central catheter lines were in an unsatisfactory position despite ECG confirmation. With current data available, intravenous ECG confirmation should not be used as the sole source of tip confirmation in patients receiving HPN. © 2016 American Society for Parenteral and Enteral Nutrition.

Export of a Toxoplasma gondii Rhoptry Neck Protein Complex at the Host Cell Membrane to Form the Moving Junction during Invasion

PubMed Central

Poncet, Joël; Dubremetz, Jean-François; Lebrun, Maryse

2009-01-01

One of the most conserved features of the invasion process in Apicomplexa parasites is the formation of a moving junction (MJ) between the apex of the parasite and the host cell membrane that moves along the parasite and serves as support to propel it inside the host cell. The MJ was, up to a recent period, completely unknown at the molecular level. Recently, proteins originated from two distinct post-Golgi specialised secretory organelles, the micronemes (for AMA1) and the neck of the rhoptries (for RON2/RON4/RON5 proteins), have been shown to form a complex. AMA1 and RON4 in particular, have been localised to the MJ during invasion. Using biochemical approaches, we have identified RON8 as an additional member of the complex. We also demonstrated that all RON proteins are present at the MJ during invasion. Using metabolic labelling and immunoprecipitation, we showed that RON2 and AMA1 were able to interact in the absence of the other members. We also discovered that all MJ proteins are subjected to proteolytic maturation during trafficking to their respective organelles and that they could associate as non-mature forms in vitro. Finally, whereas AMA1 has previously been shown to be inserted into the parasite membrane upon secretion, we demonstrated, using differential permeabilization and loading of RON-specific antibodies into the host cell, that the RON complex is targeted to the host cell membrane, where RON4/5/8 remain associated with the cytoplasmic face. Globally, these results point toward a model of MJ organization where the parasite would be secreting and inserting interacting components on either side of the MJ, both at the host and at its own plasma membranes. PMID:19247437

Tunneling spin polarization in planar tunnel junctions: measurements using NbN superconducting electrodes and evidence for Kondo-assisted tunneling

NASA Astrophysics Data System (ADS)

Yang, Hyunsoo

2006-03-01

The fundamental origin of tunneling magnetoresistance in magnetic tunnel junctions (MTJs) is the spin-polarized tunneling current, which can be measured directly using superconducting tunneling spectroscopy (STS). The STS technique was first developed by Meservey and Tedrow using aluminum superconducting electrodes. Al has been widely used because of its low spin orbit scattering. However, measurements must be made at low temperatures (<0.4 K) because of the low superconducting transition temperature of Al. Here, we demonstrate that superconducting electrodes formed from NbN can be used to measure tunneling spin polarization (TSP) at higher temperatures up to ˜1.2K. The tunneling magnetoresistance and polarization of the tunneling current in MTJs is highly sensitive to the detailed structure of the tunneling barrier. Using MgO tunnel barriers we find TSP values as high as 90% at 0.25K. The TMR is, however, depressed by insertion of ultra thin layers of both non-magnetic and magnetic metals in the middle of the MgO barrier. For ultra-thin, discontinuous magnetic layers of CoFe, we find evidence of Kondo assisted tunneling, from increased conductance at low temperatures (<50K) and bias voltage (<20 mV). Over the same temperature and bias voltage regimes the tunneling magnetoresistance is strongly depressed. We present other evidence of Kondo resonance including the logarithmic temperature dependence of the zero bias conductance peak. We infer the Kondo temperature from both the spectra width of this conductance peak as well as the temperature dependence of the TMR depression. The Kondo temperature is sensitive to the thickness of the inserted CoFe layer and decreases with increased CoFe thickness. * performed in collaboration with S-H. Yang, C. Kaiser, and S. Parkin.

Distinct patterns of alteration of myc genes associated with integration of human papillomavirus type 16 or type 45 DNA in two genital tumours.

PubMed

Sastre-Garau, X; Favre, M; Couturier, J; Orth, G

2000-08-01

We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.

Papaya (Carica papaya L.).

PubMed

Zhu, Yun J; Fitch, Maureen M M; Moore, Paul H

2006-01-01

Transgenic papaya plants were initially obtained using particle bombardment, a method having poor efficiency in producing intact, single-copy insertion of transgenes. Single-copy gene insertion was improved using Agrobacterium tumefaciens. With progress being made in genome sequencing and gene discovery, there is a need for more efficient methods of transformation in order to study the function of these genes. We describe a protocol for Agrobacterium-mediated transformation using carborundum-wounded papaya embryogenic calli. This method should lead to high-throughput transformation, which on average produced at least one plant that was positive in polymerase chain reaction (PCR), histochemical staining, or by Southern blot hybridization from 10 to 20% of the callus clusters that had been co-cultivated with Agrobacterium. Plants regenerated from the callus clusters in 9 to 13 mo.

ACFIS: a web server for fragment-based drug discovery

PubMed Central

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-01-01

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown ‘chemical space’ to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for ‘chemical space’, which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. PMID:27150808

ACFIS: a web server for fragment-based drug discovery.

PubMed

Hao, Ge-Fei; Jiang, Wen; Ye, Yuan-Nong; Wu, Feng-Xu; Zhu, Xiao-Lei; Guo, Feng-Biao; Yang, Guang-Fu

2016-07-08

In order to foster innovation and improve the effectiveness of drug discovery, there is a considerable interest in exploring unknown 'chemical space' to identify new bioactive compounds with novel and diverse scaffolds. Hence, fragment-based drug discovery (FBDD) was developed rapidly due to its advanced expansive search for 'chemical space', which can lead to a higher hit rate and ligand efficiency (LE). However, computational screening of fragments is always hampered by the promiscuous binding model. In this study, we developed a new web server Auto Core Fragment in silico Screening (ACFIS). It includes three computational modules, PARA_GEN, CORE_GEN and CAND_GEN. ACFIS can generate core fragment structure from the active molecule using fragment deconstruction analysis and perform in silico screening by growing fragments to the junction of core fragment structure. An integrated energy calculation rapidly identifies which fragments fit the binding site of a protein. We constructed a simple interface to enable users to view top-ranking molecules in 2D and the binding mode in 3D for further experimental exploration. This makes the ACFIS a highly valuable tool for drug discovery. The ACFIS web server is free and open to all users at http://chemyang.ccnu.edu.cn/ccb/server/ACFIS/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

TCF21 hypermethylation in genetically quiescent clear cell sarcoma of the kidney | Office of Cancer Genomics

Cancer.gov

Clear Cell Sarcoma of the Kidney (CCSK) is a rare childhood tumor whose molecular pathogenesis remains poorly understood. We analyzed a discovery set of 13 CCSKs for changes in chromosome copy number, mutations, rearrangements, global gene expression and global DNA methylation. No recurrent segmental chromosomal copy number changes or somatic variants (single nucleotide or small insertion/deletion) were identified.

Chemotherapy versus self-expanding metal stent as primary treatment of severe dysphagia from unresectable oesophageal or gastro-oesophageal junction cancer.

PubMed

Touchefeu, Yann; Archambeaud, Isabelle; Landi, Bruno; Lièvre, Astrid; Lepère, Céline; Rougier, Philippe; Mitry, Emmanuel

2014-03-01

To compare chemotherapy first (group 1) versus self-expanding metal stent first (group 2) for the management of malignant dysphagia in unresectable oesophageal or gastro-oesophageal junction cancer. Patients from two university hospitals with severe malignant dysphagia (dysphagia score ≥ 2) uneligible for surgery or radiochemotherapy were evaluated retrospectively. Forty-two patients were included in group 1, and 29 in group 2. After 4 weeks, dysphagia scores improved by at least 1 point in 67% of patients in group 1 versus 93% in group 2 (p=0.01); 48% of patients in group 1 were able to eat solid food versus 68% in group 2 (p=0.054). In group 1, a self-expanding metal stent was secondarily placed in 18 patients (42.9%), whereas in group 2 dysphagia required a second self-expanding metal stent placement in 33.3% of patients. Chemotherapy as the first treatment may be a valid option, avoiding self-expanding metal stent insertion in half of the patients. Copyright © 2013 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

The moving junction of apicomplexan parasites: a key structure for invasion.

PubMed

Besteiro, Sébastien; Dubremetz, Jean-François; Lebrun, Maryse

2011-06-01

Most Apicomplexa are obligate intracellular parasites and many are important pathogens of human and domestic animals. For a successful cell invasion, they rely on their own motility and on a firm anchorage to their host cell, depending on the secretion of proteins and the establishment of a structure called the moving junction (MJ). The MJ moves from the apical to the posterior end of the parasite, leading to the internalization of the parasite into a parasitophorous vacuole. Based on recent data obtained in Plasmodium and Toxoplasma, an emerging model emphasizes a cooperative role of secreted parasitic proteins in building the MJ and driving this crucial invasive process. More precisely, the parasite exports the microneme protein AMA1 to its own surface and the rhoptry neck RON2 protein as a receptor inserted into the host cell together with other RON partners. Ongoing and future research will certainly help refining the model by characterizing the molecular organization within the MJ and its interactions with both host and parasite cytoskeleton for anchoring of the complex. © 2011 Blackwell Publishing Ltd.

Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

PubMed

Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

2016-10-15

Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Discovery of selective ATP-competitive eIF4A3 inhibitors.

PubMed

Ito, Masahiro; Iwatani, Misa; Kamada, Yusuke; Sogabe, Satoshi; Nakao, Shoichi; Tanaka, Toshio; Kawamoto, Tomohiro; Aparicio, Samuel; Nakanishi, Atsushi; Imaeda, Yasuhiro

2017-04-01

Eukaryotic initiation factor 4A3 (eIF4A3), an ATP-dependent RNA helicase, is a core component of exon junction complex (EJC). EJC has a variety of roles in RNA metabolism such as translation, surveillance, and localization of spliced RNA. It is worthwhile to identify selective eIF4A3 inhibitors with a view to investigating the functions of eIF4A3 and EJC further to clarify the roles of the ATPase and helicase activities in cells. Our chemical optimization of hit compound 2 culminated in the discovery of ATP-competitive eIF4A3 inhibitor 18 with submicromolar ATPase inhibitory activity and excellent selectivity over other helicases. Hence, compound 18 could be a valuable chemical probe to elucidate the detailed functions of eIF4A3 and EJC. Copyright © 2017 Elsevier Ltd. All rights reserved.

Advances in graphene-based optoelectronics, plasmonics and photonics

NASA Astrophysics Data System (ADS)

Nguyen, Bich Ha; Hieu Nguyen, Van

2016-03-01

Since the early works on graphene it has been remarked that graphene is a marvelous electronic material. Soon after its discovery, graphene was efficiently utilized in the fabrication of optoelectronic, plasmonic and photonic devices, including graphene-based Schottky junction solar cells. The present work is a review of the progress in the experimental research on graphene-based optoelectronics, plasmonics and photonics, with the emphasis on recent advances. The main graphene-based optoelectronic devices presented in this review are photodetectors and modulators. In the area of graphene-based plasmonics, a review of the plasmonic nanostructures enhancing or tuning graphene-light interaction, as well as of graphene plasmons is presented. In the area of graphene-based photonics, we report progress on fabrication of different types of graphene quantum dots as well as functionalized graphene and graphene oxide, the research on the photoluminescence and fluorescence of graphene nanostructures as well as on the energy exchange between graphene and semiconductor quantum dots. In particular, the promising achievements of research on graphene-based Schottky junction solar cells is presented.

Remaining Sites Verification Package for the 100-F-44:2, Discovery Pipeline Near 108-F Building, Waste Site Reclassification Form 2007-006

DOE Office of Scientific and Technical Information (OSTI.GOV)

J. M. Capron

2008-05-30

The 100-F-44:2 waste site is a steel pipeline that was discovered in a junction box during confirmatory sampling of the 100-F-26:4 pipeline from December 2004 through January 2005. The 100-F-44:2 pipeline feeds into the 100-F-26:4 subsite vitrified clay pipe (VCP) process sewer pipeline from the 108-F Biology Laboratory at the junction box. In accordance with this evaluation, the confirmatory sampling results support a reclassification of this site to No Action. The current site conditions achieve the remedial action objectives and the corresponding remedial action goals established in the Remaining Sites ROD. The results of confirmatory sampling show that residual contaminantmore » concentrations do not preclude any future uses and allow for unrestricted use of shallow zone soils. The results also demonstrate that residual contaminant concentrations are protective of groundwater and the Columbia River.« less

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing.

PubMed

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing.

New Approach to Identify Ischemic Stroke Patients at Risk to Develop Hemorrhagic Transformation

PubMed Central

MANOLESCU, Bogdan Nicolae; JICKLING, Glen C.

2012-01-01

ABSTRACT Some patients with ischemic stroke are subject to hemorrhagic transformation, a complication leading to increased patient morbidity and mortality. The discovery of biomarkers that can be used to identify ischemic strokes prone to this complication are very important for the clinical practice because therapy could be altered to mitigate the risk. We discuss here the results of a trial that evaluated for the first time tight junction proteins as biomarkers of blood-brain barrier disruption and hemorrhagic transformation in ischemic stroke. PMID:23482691

Optimization of oligonucleotide arrays and RNA amplification protocols for analysis of transcript structure and alternative splicing

PubMed Central

Castle, John; Garrett-Engele, Phil; Armour, Christopher D; Duenwald, Sven J; Loerch, Patrick M; Meyer, Michael R; Schadt, Eric E; Stoughton, Roland; Parrish, Mark L; Shoemaker, Daniel D; Johnson, Jason M

2003-01-01

Microarrays offer a high-resolution means for monitoring pre-mRNA splicing on a genomic scale. We have developed a novel, unbiased amplification protocol that permits labeling of entire transcripts. Also, hybridization conditions, probe characteristics, and analysis algorithms were optimized for detection of exons, exon-intron edges, and exon junctions. These optimized protocols can be used to detect small variations and isoform mixtures, map the tissue specificity of known human alternative isoforms, and provide a robust, scalable platform for high-throughput discovery of alternative splicing. PMID:14519201

Magnetotransport properties of spin-valve structures with Mg spacer layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez-Boubeta, C., E-mail: cboubeta@gmail.com; Ferrante, Y.; Graduate School of Excellence, Materials Science in Mainz, 55128 Mainz

2015-01-19

A theoretical prediction by Wang et al. [Phys. Rev. B 82, 054405 (2010)] suggests the preferential transmission of majority-spin states with Δ{sub 1} symmetry across a magnesium interlayer in Fe/Mg/MgO/Fe based magnetic tunnel junctions. Here, we report experiments to probe this question in CoFe/Mg/CoFe structures. We find that the strength of the interlayer coupling decays exponentially with increasing the spacer thickness, however, a non-monotonic variation of the magnetoresistance as a function of the Mg layer is observed. These data may help revisit the role of the insertion of a Mg interface layer in MgO-based devices.

Coax-to-channelised coplanar waveguide in-phase N-way, radial power divider

NASA Technical Reports Server (NTRS)

Simons, R. N.; Ponchak, G. E.

1990-01-01

A novel nonplanar, wideband power divider which makes use of a coax-to-CCPW transition is demonstrated. The transition utilizes a coaxial transformer whose outer conductor is slotted along the length for RF power division and also for exciting the CCPWs in equal amplitude and phase at the radial junction. The measured (8-16 GHz) excess insertion loss at the output ports is 0.5 dB for a four-way divider. The amplitude and phase balance are within 0.5 dB and 5 deg, respectively. The power divider should find applications in the feed network of phased arrays.

Huge maternal hydronephrosis: a rare complication in pregnancy.

PubMed

Peng, Hsiu-Huei; Wang, Chin-Jung; Yen, Chih-Feng; Chou, Chien-Chung; Lee, Chyi-Long

2003-06-10

A huge maternal hydronephrosis is uncommon in pregnancy and might be mistaken as a pelvic mass. A 21-year-old primigravida was noted at 25th week of gestation to have a visible bulging mass on her left flank. The mass was originally mistaken as a large ovarian cyst but later proved to be a huge hydronephrosis. Retrograde insertion of ureteroscope and a ureteric stent failed, so we performed repeated ultrasound-guided needle aspiration to decompress the huge hydronephrosis, which enabled the patient to proceed to a successful term vaginal delivery. Nephrectomy was performed after delivery and proved the diagnosis of congenital ureteropelvic junction obstruction.

Modeling Long-Term Host Cell-Giardia lamblia Interactions in an In Vitro Co-Culture System

PubMed Central

Fisher, Bridget S.; Estraño, Carlos E.; Cole, Judith A.

2013-01-01

Globally, there are greater than 700,000 deaths per year associated with diarrheal disease. The flagellated intestinal parasite, Giardia lamblia, is one of the most common intestinal pathogens in both humans and animals throughout the world. While attached to the gastrointestinal epithelium, Giardia induces epithelial cell apoptosis, disrupts tight junctions, and increases intestinal permeability. The underlying cellular and molecular mechanisms of giardiasis, including the role lamina propria immune cells, such as macrophages, play in parasite control or clearance are poorly understood. Thus far, one of the major obstacles in ascertaining the mechanisms of Giardia pathology is the lack of a functionally relevant model for the long-term study of the parasite in vitro. Here we report on the development of an in vitro co-culture model which maintains the basolateral-apical architecture of the small intestine and allows for long-term survival of the parasite. Using transwell inserts, Caco-2 intestinal epithelial cells and IC-21 macrophages are co-cultured in the presence of Giardia trophozoites. Using the developed model, we show that Giardia trophozoites survive over 21 days and proliferate in a combination media of Caco-2 cell and Giardia medium. Giardia induces apoptosis of epithelial cells through caspase-3 activation and macrophages do not abrogate this response. Additionally, macrophages induce Caco-2 cells to secrete the pro-inflammatory cytokines, GRO and IL-8, a response abolished by Giardia indicating parasite induced suppression of the host immune response. The co-culture model provides additional complexity and information when compared to a single-cell model. This model will be a valuable tool for answering long-standing questions on host-parasite biology that may lead to discovery of new therapeutic interventions. PMID:24312526

Catheter ablation as a treatment of atrioventricular block.

PubMed

Tuohy, Stephen; Saliba, Walid; Pai, Manjunath; Tchou, Patrick

2018-01-01

Symptomatic second-degree atrioventricular (AV) block is typically treated by implantation of a pacemaker. An otherwise healthy AV conduction system can nevertheless develop AV block due to interference from junctional extrasystoles. When present with a high burden, these can produce debilitating symptoms from AV block despite an underlying normal AV node and His-Purkinje system properties. The purpose of this study was to describe a catheter ablation approach for alleviating symptomatic AV block due to a ventricular nodal pathway interfering with AV conduction. Common clinical monitoring techniques such as Holter and event recorders were used. Standard electrophysiological study techniques using multipolar recording and ablation catheters were utilized during procedures. A 55-year-old woman presented with highly symptomatic, high-burden second-degree AV block due to concealed and manifest junctional premature beats. Electrophysiological characteristics indicated interference of AV conduction due to a concealed ventricular nodal pathway as the cause of the AV block. The patient's AV nodal and His-Purkinje system conduction characteristics were otherwise normal. Radiofrequency catheter ablation of the pathway was successful in restoring normal AV conduction and eliminating her clinical symptoms. Pathways inserting into the AV junction can interfere with AV conduction. When present at a high burden, this type of AV block can be highly symptomatic. Catheter ablation techniques can be used to alleviate this type of AV block and restore normal AV conduction. Copyright © 2017 Heart Rhythm Society. Published by Elsevier Inc. All rights reserved.

Examination of Msh6- and Msh3-deficient mice in class switching reveals overlapping and distinct roles of MutS homologues in antibody diversification.

PubMed

Li, Ziqiang; Scherer, Stefan J; Ronai, Diana; Iglesias-Ussel, Maria D; Peled, Jonathan U; Bardwell, Philip D; Zhuang, Min; Lee, KyeRyoung; Martin, Alberto; Edelmann, Winfried; Scharff, Matthew D

2004-07-05

Somatic hypermutation and class switch recombination (CSR) contribute to the somatic diversification of antibodies. It has been shown that MutS homologue (Msh)6 (in conjunction with Msh2) but not Msh3 is involved in generating A/T base substitutions in somatic hypermutation. However, their roles in CSR have not yet been reported. Here we show that Msh6(-)(/)(-) mice have a decrease in CSR, whereas Msh3(-)(/)(-) mice do not. When switch regions were analyzed for mutations, deficiency in Msh6 was associated with an increase in transition mutations at G/C basepairs, mutations at RGYW/WRCY hotspots, and a small increase in the targeting of G/C bases. In addition, Msh6(-)(/)(-) mice exhibited an increase in the targeting of recombination sites to GAGCT/GGGGT consensus repeats and hotspots in Sgamma3 but not in Smicro. In contrast to Msh2(-)(/)(-) mice, deficiency in Msh6 surprisingly did not change the characteristics of Smicro-Sgamma3 switch junctions. However, Msh6(-)(/)(-) mice exhibited a change in the positioning of Smicro and Sgamma3 junctions. Although none of these changes were seen in Msh3(-)(/)(-) mice, they had a higher percentage of large inserts in their switch junctions. Together, our data suggest that MutS homologues Msh2, Msh3, and Msh6 play overlapping and distinct roles during antibody diversification processes.

Initial Approaches for Discovery of Undocumented Functionality in FPGAs

DTIC Science & Technology

2017-03-01

commercial pressures such as IP protection, support cost, and time to market , modern COTS devices contain many functions that are not exposed to the... market pressures have increased, industry increasingly uses the current generation device to do trial runs of next-generation architecture features...the product of industry operating in a highly cost competitive market , and are not inserted with malicious intent, however, this does not preclude

Ligand-accelerated enantioselective methylene C(sp3)-H bond activation.

PubMed

Chen, Gang; Gong, Wei; Zhuang, Zhe; Andrä, Michal S; Chen, Yan-Qiao; Hong, Xin; Yang, Yun-Fang; Liu, Tao; Houk, K N; Yu, Jin-Quan

2016-09-02

Effective differentiation of prochiral carbon-hydrogen (C-H) bonds on a single methylene carbon via asymmetric metal insertion remains a challenge. Here, we report the discovery of chiral acetyl-protected aminoethyl quinoline ligands that enable asymmetric palladium insertion into prochiral C-H bonds on a single methylene carbon center. We apply these palladium complexes to catalytic enantioselective functionalization of β-methylene C-H bonds in aliphatic amides. Using bidentate ligands to accelerate C-H activation of otherwise unreactive monodentate substrates is crucial for outcompeting the background reaction driven by substrate-directed cyclopalladation, thereby avoiding erosion of enantioselectivity. The potential of ligand acceleration in C-H activation is also demonstrated by enantioselective β-C-H arylation of simple carboxylic acids without installing directing groups. Copyright © 2016, American Association for the Advancement of Science.

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

The mechano-sensing role of the unique SH3 insertion in plakin domains revealed by Molecular Dynamics simulations.

PubMed

Daday, Csaba; Kolšek, Katra; Gräter, Frauke

2017-09-15

The plakin family of proteins, important actors in cross-linking force-bearing structures in the cell, contain a curious SH3 domain insertion in their chain of spectrin repeats (SRs). While SH3 domains are known to mediate protein-protein interactions, here, its canonical binding site is autoinhibited by the preceding SR. Under force, however, this SH3 domain could be released, and possibly launch a signaling cascade. We performed large-scale force-probe molecular dynamics simulations, across two orders of magnitude of loading rates, to test this hypothesis, on two prominent members of the plakin family: desmoplakin and plectin, obligate proteins at desmosomes and hemidesmosomes, respectively. Our simulations show that force unravels the SRs and abolishes the autoinhibition of the SH3 domain, an event well separated from the unfolding of this domain. The SH3 domain is free and fully functional for a significant portion of the unfolding trajectories. The rupture forces required for the two proteins significantly decrease when the SH3 domain is removed, which implies that the SH3 domain also stabilizes this junction. Our results persist across all simulations, and support a force-sensing as well as a stabilizing role of the unique SH3 insertion, putting forward this protein family as a new class of mechano-sensors.

Cross-sectional evaluation of the prevalence and factors associated with soft tissue scarring after the removal of miniscrews.

PubMed

Jung, Sung-ah; Choi, Yoon Jeong; Lee, Dong-Won; Kim, Kyung-Ho; Chung, Chooryung J

2015-05-01

To investigate the prevalence of distinguishable soft tissue scarring after the removal of temporary anchorage devices (TADs) such as orthodontic miniscrews and to analyze the factors associated with scar formation. The prevalence of soft tissue scarring in 66 patients (202 miniscrew removal sites) was clinically investigated at least 1 year after miniscrew removal. To determine the clinical factors associated with soft tissue scar formation, miniscrew stability; host factors including age, gender, and gingival biotype; and miniscrew-related factors such as insertion site, vertical position, and insertion period were evaluated. The prevalence of a distinguishable scar remaining at least 1 year after miniscrew removal was 44.6%. Patients with flat gingiva showed a significantly higher prevalence of soft tissue scar formation than did those with pronounced scalloped gingiva (P < .05). Maxillary buccal removal sites showed a significantly higher prevalence of soft tissue scar formation than did those in the mandible or palatal slope (P < .05). Miniscrew sites at the alveolar mucosa showed a significantly lower prevalence of soft tissue scar formation than did those in the mucogingival junction or the attached gingiva (P < .01). The prevalence of distinguishable scarring after miniscrew removal was fairly high. On the basis of our results, patients with flat gingiva and buccal interdental gingival insertion sites are more susceptible to scar formation.

[Insert Your Science Here] Week: Creating science-driven public awareness campaigns

NASA Astrophysics Data System (ADS)

Mattson, Barbara; Mitchell, Sara; McElvery, Raleigh; Reddy, Francis; Wiessinger, Scott; Skelly, Clare; Saravia, Claire; Straughn, Amber N.; Washington, Dewayne

2018-01-01

NASA Goddard’s in-house Astrophysics Communications Team is responsible for facilitating the production of traditional and social media products to provide understanding and inspiration about NASA’s astrophysics missions and discoveries. Our team is largely driven by the scientific news cycle of launches, mission milestones, anniversaries, and discoveries, which can leave a number of topics behind, waiting for a discovery to be highlighted. These overlooked topics include compelling stories about ongoing research, underlying science, and science not tied to a specific mission. In looking for a way to boost coverage of these unsung topics, we struck upon an idea of creating “theme weeks” which bring together the broader scientific community around a topic, object, or scientific concept. This poster will present the first two of our Goddard-led theme weeks: Pulsar Week and Dark Energy Week. We will describe the efforts involved, our metrics, and the benefits and challenges we encountered. We will also suggest a template for doing this for your own science based on our successes.

Epitaxial insertion of gold silicide nanodisks during the growth of silicon nanowires.

PubMed

Um, Han-Don; Jee, Sang-Won; Park, Kwang-Tae; Jung, Jin-Young; Guo, Zhongyi; Lee, Jung-Ho

2011-07-01

Nanodisk-shaped, single-crystal gold silicide heterojunctions were inserted into silicon nanowires during vapor-liquid-solid growth using Au as a catalyst within a specific range of chlorine-to-hydrogen atomic ratio. The mechanism of nanodisk formation has been investigated by changing the source gas ratio of SiCl4 to H2. We report that an over-supply of silicon into the Au-Si liquid alloy leads to highly supersaturated solution and enhances the precipitation of Au in the silicon nanowires due to the formation of unstable phases within the liquid alloy. It is shown that the gold precipitates embedded in the silicon nanowires consisted of a metastable gold silicide. Interestingly, faceting of gold silicide was observed at the Au/Si interfaces, and silicon nanowires were epitaxially grown on the top of the nanodisk by vapor-liquid-solid growth. High resolution transmission electron microscopy confirmed that gold silicide nanodisks are epitaxially connected to the silicon nanowires in the direction of growth direction. These gold silicide nanodisks would be useful as nanosized electrical junctions for future applications in nanowire interconnections.

Laboratory management of cervical intraepithelial neoplasia: proposing a new paradigm.

PubMed

Herfs, Michael; Crum, Christopher P

2013-03-01

Since the discovery of human papillomavirus (HPV) type 16 in early 80s, the link between HPV and cervical cancer has been established with certainty, a function of the discovery and cloning of a range of HPV types associated with both cancer precursors (cervical intraepithelial neoplasia or CIN) and carcinomas and extensive epidemiologic, clinical, pathologic, and experimental data. These accumulated results have culminated in new paradigms of cancer prevention through screening and triage. Despite this, the management of women with CIN is still suboptimal and the overtreatment of these conditions still occurs, largely due to the lack of clarity regarding which precancerous lesions are most likely to progress in grade. Recently, a discrete population of cuboidal cells was discovered at the cervical squamocolumnar junction, the anatomic site where the large majority of HPV-related (pre)neoplastic lesions develop. These cells seem to be embryonic in nature and participate both in benign metaplasias and the initial phase of precancer development. This review summarizes the historical evolution of precursor management, assesses the potential role of this and other discoveries in segregating lower from higher-risk precursors, and examines their potential impact on the management of women with real or potential cervical cancer precursors.

Unexpected superconductivity at nanoscale junctions made on the topological crystalline insulator Pb0.6Sn0.4Te

NASA Astrophysics Data System (ADS)

Das, Shekhar; Aggarwal, Leena; Roychowdhury, Subhajit; Aslam, Mohammad; Gayen, Sirshendu; Biswas, Kanishka; Sheet, Goutam

2016-09-01

Discovery of exotic phases of matter from the topologically non-trivial systems not only makes the research on topological materials more interesting but also enriches our understanding of the fascinating physics of such materials. Pb0.6Sn0.4Te was recently shown to be a topological crystalline insulator. Here, we show that by forming a mesoscopic point-contact using a normal non-superconducting elemental metal on the surface of Pb0.6Sn0.4Te, a superconducting phase is created locally in a confined region under the point-contact. This happens when the bulk of the sample remains to be non-superconducting, and the superconducting phase emerges as a nano-droplet under the point-contact. The superconducting phase shows a high transition temperature Tc that varies for different point-contacts and falls in a range between 3.7 K and 6.5 K. Therefore, this Letter presents the discovery of a superconducting phase on the surface of a topological crystalline insulator, and the discovery is expected to shed light on the mechanism of induced superconductivity in topologically non-trivial systems in general.

Biomechanical properties of double- and single-row suture anchor repair for surgical treatment of insertional Achilles tendinopathy.

PubMed

Beitzel, Knut; Mazzocca, Augustus D; Obopilwe, Elifho; Boyle, James W; McWilliam, James; Rincon, Lina; Dhar, Yasmin; Arciero, Robert A; Amendola, Annunziato

2013-07-01

Because of intratendinous ossifications, retrocalcaneal bursitis, or intratendinous necrosis commonly found in insertional tendinosis, it is often necessary to detach the tendon partially or entirely from its tendon-to-bone junction. Double-row repair for insertional Achilles tendinopathy will generate an increased contact area and demonstrate higher biomechanical stability. Controlled laboratory study. Eighteen cadaver Achilles tendons were split longitudinally and detached, exposing the calcaneus; an ostectomy was performed and the tendon was reattached to the calcaneus in 1 of 2 ways: 2 suture anchors (single row) or a 4-anchor (double row) construct. Footprint area measurements over time, displacement after cyclic loading (2000 cycles), and final load to failure were measured. The double-row refixation technique was statistically superior to the single-row technique in footprint area measurement initially and 5 minutes after repair (P = .009 and P = .01, respectively) but not after 24 hours (P = .713). The double-row construct demonstrated significantly improved measures for peak load (433.9 ± 84.3 N vs 212.0 ± 49.7 N; P = .042), load at yield (354.7 ± 106.2 N vs 198.7 ± 39.5 N; P = .01), and slope (51.8 ± 9.9 N/mm vs 66.7 ± 16.2 N/mm; P = .021). Cyclic loading did not demonstrate significant differences between the 2 constructs. Double-row construct for reinsertion of a completely detached Achilles tendon using proximal and distal rows resulted in significantly larger contact area initially and 5 minutes after repair and led to significantly higher peak load to failure on destructive testing. In treatment for insertional Achilles tendinosis, the tendon often has to be detached and anatomically reattached to its insertion at the calcaneus. To our knowledge there is a lack of biomechanical studies supporting either a number or a pattern of suture anchor fixation. Because the stresses going across the insertion site of the Achilles tendon are significant during rehabilitation and weightbearing activities, it is imperative to have a strong construct that allows satisfactory healing during the early postoperative process.

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

PubMed

Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

2017-02-01

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

Optical mapping reveals a large genetic inversion between two methicillin-resistant Staphylococcus aureus strains.

PubMed

Shukla, Sanjay K; Kislow, Jennifer; Briska, Adam; Henkhaus, John; Dykes, Colin

2009-09-01

Staphylococcus aureus is a highly versatile and evolving bacterium of great clinical importance. S. aureus can evolve by acquiring single nucleotide polymorphisms and mobile genetic elements and by recombination events. Identification and location of novel genomic elements in a bacterial genome are not straightforward, unless the whole genome is sequenced. Optical mapping is a new tool that creates a high-resolution, in situ ordered restriction map of a bacterial genome. These maps can be used to determine genomic organization and perform comparative genomics to identify genomic rearrangements, such as insertions, deletions, duplications, and inversions, compared to an in silico (virtual) restriction map of a known genome sequence. Using this technology, we report here the identification, approximate location, and characterization of a genetic inversion of approximately 500 kb of a DNA element between the NRS387 (USA800) and FPR3757 (USA300) strains. The presence of the inversion and location of its junction sites were confirmed by site-specific PCR and sequencing. At both the left and right junction sites in NRS387, an IS1181 element and a 73-bp sequence were identified as inverted repeats, which could explain the possible mechanism of the inversion event.

Perpendicular magnetic tunnel junctions with Mn-modified ultrathin MnGa layer

NASA Astrophysics Data System (ADS)

Suzuki, K. Z.; Miura, Y.; Ranjbar, R.; Bainsla, L.; Ono, A.; Sasaki, Y.; Mizukami, S.

2018-02-01

Perpendicular magnetic tunnel junctions (p-MTJs) with a MgO barrier and a 1-nm-thick MnGa electrode were investigated by inserting several monolayers (MLs) of Mn. The tunnel magnetoresistance (TMR) ratio systematically increased when increasing the Mn layer thickness with a maximum of 18 (38.4)% at 300 (5) K for a Mn layer thickness of 0.6-0.8 nm. This ratio is five times higher compared to that without the Mn layer. The perpendicular magnetic anisotropy (PMA) field and the PMA constant of the ultrathin MnGa layer also increased up to 62-90 kOe and 6.2-11.3 Merg/cm3, respectively, with an increase in the Mn interlayer thickness, even for the ultrathin regime of the MnGa layer. For p-MTJs showing a high TMR and PMA, electron microscopy indicated the presence of 3-4 MLs of Mn at the MnGa/MgO interface; thus, the Mn modification enhanced the TMR as well as improved the PMA. This may be a promising finding to develop a Mn-based free layer for spin-transfer-torque devices for high-recording-density magnetoresistive random access memory and a sub-THz oscillator/detector.

Screening charge localization at LiNbO{sub 3} surface with Schottky junction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagata, Takahiro, E-mail: NAGATA.Takahiro@nims.go.jp; Chikyow, Toyohiro; Kitamura, Kenji

2016-04-25

Screening charge localization was demonstrated by using a Schottky contact with LiNbO{sub 3} (LN). A Cr/LN stack structure with a 2 μm diameter hole array penetrating the Cr layer localized the screening charge of LN in the hole, although the Al/LN stack structure exhibited no surface charge localization behavior. X-ray photoelectron spectroscopy revealed that Cr formed a Schottky contact with LN, which prevents the screening charge from escaping from the hole arrays. The screening charge localization was enhanced by inserting SiO{sub 2} between the metal and LN, which moved the position of the Fermi level to mid gap.

Application of memory metallic stents to urinary tract disorders in pediatric patients.

PubMed

Kamata, Shinkichi; Usui, Noriaki; Kamiyama, Masafumi; Yoneda, Akihiro; Tazuke, Yuko; Ooue, Takaharu

2005-03-01

The use of memory metallic stents for the urinary tract in pediatric patients has not been reported. The authors report on 2 patients with urinary tract disorders who were successfully treated with a memory metallic stent. A thermoexpandable, nickel-titanium alloy stent was placed at the urethroureteral junction of a 4-year-old boy with ureteral stenosis associated with cloacal exstrophy for 18 months and at the urethra of a 2-year-old girl with ischuria after a repair of cloacal anomaly for 6 months. Temporary insertion of a memory metallic stent is a safe and effective alternative for organic stricture or functional obstruction of the urinary tract in pediatric patients.

Peroperative electrocardiographic control of catheter tip position during implantation of femoral venous ports.

PubMed

Gibault, Pierre; Desruennes, Eric; Bourgain, Jean-Louis

2015-01-01

Electrocardiographic (ECG) guidance has been shown to be as effective than fluoroscopy to position the tip of central venous devices close to the superior vena cava (SVC)-right atrium (RA) junction. When SVC access is contraindicated, a femoral access may be used. The aim of this prospective study is to evaluate the effectiveness of ECG guidance to position the tip of femoral ports at inferior vena cava (IVC)-RA junction. Inclusion criterion was the need for femoral port implantation. After insertion of the dilator in the femoral vein, the catheter with the guide wire inside was introduced and the ECG signal collected at the tip of the guide (Celsite™ ECG, B. Braun, Germany) or via saline injected in the catheter (Nautilus™, Perouse, France). Fluoroscopy was performed at each change of the P-wave from IVC to RA. A final X-ray was performed after withdrawing the catheter 2 cm below the first P-wave change. A total of 18 patients were included between December 2011 and June 2013. The P-wave was most often negative in IVC, biphasic when the catheter entered RA and giant and positive at the top of RA. When the catheter was withdraw 2 cm below the first biphasic P-wave the tip was just below the IVC-RA junction in 17 patients. In one patient P-wave changes were not significant and the final position was adjusted under fluoroscopy. ECG guidance is effective to assess catheter tip position during femoral port placement and avoids the need for radiological methods.

Nerve supply of the subscapularis during anterior shoulder surgery: definition of a potential risk area.

PubMed

Leschinger, Tim; Hackl, Michael; Zeifang, Felix; Scaal, Martin; Müller, Lars Peter; Wegmann, Kilian

2017-01-01

The purpose of the study was to evaluate the position of the subscapular nerves relative to surgical landmarks during exposure and to analyze the pattern of innervation of the subscapularis to avoid injury during anterior shoulder surgery. 20 embalmed human cadaveric shoulder specimens were used in the study. The muscular insertions of the subscapular nerves were marked and their closest branches to the musculotendinous junction and the coracoid process were measured in horizontal and vertical distances. In addition, the innervation pattern of each specimen was documented. 14/20 specimens showed an innervation of the subscapularis with an upper, middle and lower subscapular nerve branch. Even though the nerve branches were in average more than 2 cm medial to the musculotendinous junction, minimal distances of 1.1-1.3 cm were found. The mean vertical distance as measured from the medial base of the coracoid to the nerve innervation point into the muscle was 0.7 cm for the upper nerve branch, 2.2 cm for the middle nerve branch and 4.4 cm for the lower nerve branch. The subscapularis has a variable nerve supply, which increases the risk of muscle denervation during open shoulder surgery. Dissection or release should be avoided at the anterior aspect of the subscapularis muscle more than 1 cm medial to the musculotendinous junction. In approaches with a horizontal incision of the subscapularis, splitting should be performed at a vertical distance of 3.2-3.6 cm to the coracoid base to avoid iatrogenic subscapular nerve injuries.

C1 lateral mass screw-induced occipital neuralgia: a report of two cases.

PubMed

Conroy, Eimear; Laing, Alan; Kenneally, Rory; Poynton, A R

2010-03-01

C1-2 polyaxial screw-rod fixation is a relatively new technique. While recognizing the potential for inadvertent vertebral artery injury, there have been few reports in the literature outlining all the possible complications. Aim of this study is to review all cases of C1 lateral mass screws insertion with emphasis on the evaluation of potential structures at risk during the procedure. We retrospectively reviewed all patients in our unit who had C1 lateral mass screw insertion over a 2-year period. The C1 lateral mass screw was inserted as part of an atlantoaxial stabilization or incorporated into a modular occiput/subaxial construct. Outcome measures included clinical and radiological parameters. Clinical indicators included age, gender, neurologic status, surgical indication and the number of levels stabilized. Intraoperative complications including blood loss, vertebral artery injury or dural tears were recorded. Postoperative pain distribution and neurological deficit were recorded. Radiological indicators included postoperative plain radiographs to assess sagittal alignment and to check for screw malposition or construct failure. A total of 18 lateral mass screws were implanted in 9 patients. There were three male and six female patients who had C1 lateral mass screw insertion in this unit. Two patients had atlantoaxial stabilization for C2 fracture. There were four patients with rheumatoid arthritis whose C1 lateral mass screws were inserted as part of an occipitocervical or subaxial cervical stabilization. There was no vertebral artery injury, no cerebrospinal fluid leak and minimal blood loss in all patients. Three patients developed postoperative occipital neuralgia. This neuralgia was transient, in one of the patients having settled at 6-week follow-up. In the other two patients the neuralgia was unresolved at time of latest follow-up but was adequately controlled with appropriate pain management. Postoperatively no patient had radiographic evidence of construct failure and all demonstrated excellent sagittal alignment. It has been reported that the absence of threads on the upper portion of the long shank screw may protect against neural irritation. However, insertion of the C1 lateral mass screw necessitates careful caudal retraction of the C2 dorsal root ganglion. The insertion point for the C1 lateral mass screw is at the junction of the C1 posterior arch and the midpoint of the posterior inferior part of the C1 lateral mass. Two patients in our series suffered occipital neuralgia post-insertion of C1 lateral mass screws. This highlights the potential for damage to the C2 nerve root during C1 lateral mass screw placement.

C1 lateral mass screw-induced occipital neuralgia: a report of two cases

PubMed Central

Laing, Alan; Kenneally, Rory; Poynton, A. R.

2009-01-01

C1–2 polyaxial screw-rod fixation is a relatively new technique. While recognizing the potential for inadvertent vertebral artery injury, there have been few reports in the literature outlining all the possible complications. Aim of this study is to review all cases of C1 lateral mass screws insertion with emphasis on the evaluation of potential structures at risk during the procedure. We retrospectively reviewed all patients in our unit who had C1 lateral mass screw insertion over a 2-year period. The C1 lateral mass screw was inserted as part of an atlantoaxial stabilization or incorporated into a modular occiput/subaxial construct. Outcome measures included clinical and radiological parameters. Clinical indicators included age, gender, neurologic status, surgical indication and the number of levels stabilized. Intraoperative complications including blood loss, vertebral artery injury or dural tears were recorded. Postoperative pain distribution and neurological deficit were recorded. Radiological indicators included postoperative plain radiographs to assess sagittal alignment and to check for screw malposition or construct failure. A total of 18 lateral mass screws were implanted in 9 patients. There were three male and six female patients who had C1 lateral mass screw insertion in this unit. Two patients had atlantoaxial stabilization for C2 fracture. There were four patients with rheumatoid arthritis whose C1 lateral mass screws were inserted as part of an occipitocervical or subaxial cervical stabilization. There was no vertebral artery injury, no cerebrospinal fluid leak and minimal blood loss in all patients. Three patients developed postoperative occipital neuralgia. This neuralgia was transient, in one of the patients having settled at 6-week follow-up. In the other two patients the neuralgia was unresolved at time of latest follow-up but was adequately controlled with appropriate pain management. Postoperatively no patient had radiographic evidence of construct failure and all demonstrated excellent sagittal alignment. It has been reported that the absence of threads on the upper portion of the long shank screw may protect against neural irritation. However, insertion of the C1 lateral mass screw necessitates careful caudal retraction of the C2 dorsal root ganglion. The insertion point for the C1 lateral mass screw is at the junction of the C1 posterior arch and the midpoint of the posterior inferior part of the C1 lateral mass. Two patients in our series suffered occipital neuralgia post-insertion of C1 lateral mass screws. This highlights the potential for damage to the C2 nerve root during C1 lateral mass screw placement. PMID:19856190

Efficient CRISPR/Cas9-Based Genome Engineering in Human Pluripotent Stem Cells.

PubMed

Kime, Cody; Mandegar, Mohammad A; Srivastava, Deepak; Yamanaka, Shinya; Conklin, Bruce R; Rand, Tim A

2016-01-01

Human pluripotent stem cells (hPS cells) are rapidly emerging as a powerful tool for biomedical discovery. The advent of human induced pluripotent stem cells (hiPS cells) with human embryonic stem (hES)-cell-like properties has led to hPS cells with disease-specific genetic backgrounds for in vitro disease modeling and drug discovery as well as mechanistic and developmental studies. To fully realize this potential, it will be necessary to modify the genome of hPS cells with precision and flexibility. Pioneering experiments utilizing site-specific double-strand break (DSB)-mediated genome engineering tools, including zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have paved the way to genome engineering in previously recalcitrant systems such as hPS cells. However, these methods are technically cumbersome and require significant expertise, which has limited adoption. A major recent advance involving the clustered regularly interspaced short palindromic repeats (CRISPR) endonuclease has dramatically simplified the effort required for genome engineering and will likely be adopted widely as the most rapid and flexible system for genome editing in hPS cells. In this unit, we describe commonly practiced methods for CRISPR endonuclease genomic editing of hPS cells into cell lines containing genomes altered by insertion/deletion (indel) mutagenesis or insertion of recombinant genomic DNA. Copyright © 2016 John Wiley & Sons, Inc.

Discovery of rare, diagnostic AluYb8/9 elements in diverse human populations.

PubMed

Feusier, Julie; Witherspoon, David J; Scott Watkins, W; Goubert, Clément; Sasani, Thomas A; Jorde, Lynn B

2017-01-01

Polymorphic human Alu elements are excellent tools for assessing population structure, and new retrotransposition events can contribute to disease. Next-generation sequencing has greatly increased the potential to discover Alu elements in human populations, and various sequencing and bioinformatics methods have been designed to tackle the problem of detecting these highly repetitive elements. However, current techniques for Alu discovery may miss rare, polymorphic Alu elements. Combining multiple discovery approaches may provide a better profile of the polymorphic Alu mobilome. Alu Yb8/9 elements have been a focus of our recent studies as they are young subfamilies (~2.3 million years old) that contribute ~30% of recent polymorphic Alu retrotransposition events. Here, we update our ME-Scan methods for detecting Alu elements and apply these methods to discover new insertions in a large set of individuals with diverse ancestral backgrounds. We identified 5,288 putative Alu insertion events, including several hundred novel Alu Yb8/9 elements from 213 individuals from 18 diverse human populations. Hundreds of these loci were specific to continental populations, and 23 non-reference population-specific loci were validated by PCR. We provide high-quality sequence information for 68 rare Alu Yb8/9 elements, of which 11 have hallmarks of an active source element. Our subfamily distribution of rare Alu Yb8/9 elements is consistent with previous datasets, and may be representative of rare loci. We also find that while ME-Scan and low-coverage, whole-genome sequencing (WGS) detect different Alu elements in 41 1000 Genomes individuals, the two methods yield similar population structure results. Current in-silico methods for Alu discovery may miss rare, polymorphic Alu elements. Therefore, using multiple techniques can provide a more accurate profile of Alu elements in individuals and populations. We improved our false-negative rate as an indicator of sample quality for future ME-Scan experiments. In conclusion, we demonstrate that ME-Scan is a good supplement for next-generation sequencing methods and is well-suited for population-level analyses.

A comprehensive assessment of RNA-seq accuracy, reproducibility and information content by the Sequencing Quality Control consortium

PubMed Central

2014-01-01

We present primary results from the Sequencing Quality Control (SEQC) project, coordinated by the United States Food and Drug Administration. Examining Illumina HiSeq, Life Technologies SOLiD and Roche 454 platforms at multiple laboratory sites using reference RNA samples with built-in controls, we assess RNA sequencing (RNA-seq) performance for junction discovery and differential expression profiling and compare it to microarray and quantitative PCR (qPCR) data using complementary metrics. At all sequencing depths, we discover unannotated exon-exon junctions, with >80% validated by qPCR. We find that measurements of relative expression are accurate and reproducible across sites and platforms if specific filters are used. In contrast, RNA-seq and microarrays do not provide accurate absolute measurements, and gene-specific biases are observed, for these and qPCR. Measurement performance depends on the platform and data analysis pipeline, and variation is large for transcript-level profiling. The complete SEQC data sets, comprising >100 billion reads (10Tb), provide unique resources for evaluating RNA-seq analyses for clinical and regulatory settings. PMID:25150838

Stem cells in the Drosophila digestive system.

PubMed

Zeng, Xiankun; Chauhan, Chhavi; Hou, Steven X

2013-01-01

Adult stem cells maintain tissue homeostasis by continuously replenishing damaged, aged and dead cells in any organism. Five types of region and organ-specific multipotent adult stem cells have been identified in the Drosophila digestive system: intestinal stem cells (ISCs) in the posterior midgut; hindgut intestinal stem cells (HISCs) at the midgut/hindgut junction; renal and nephric stem cells (RNSCs) in the Malpighian Tubules; type I gastric stem cells (GaSCs) at foregut/midgut junction; and type II gastric stem cells (GSSCs) at the middle of the midgut. Despite the fact that each type of stem cell is unique to a particular organ, they share common molecular markers and some regulatory signaling pathways. Due to the simpler tissue structure, ease of performing genetic analysis, and availability of abundant mutants, Drosophila serves as an elegant and powerful model system to study complex stem cell biology. The recent discoveries, particularly in the Drosophila ISC system, have greatly advanced our understanding of stem cell self-renewal, differentiation, and the role of stem cells play in tissue homeostasis/regeneration and adaptive tissue growth.

Evaluation of human recession defects treated with coronally advanced flaps and either purified recombinant human platelet-derived growth factor-BB with beta tricalcium phosphate or connective tissue: a histologic and microcomputed tomographic examination.

PubMed

McGuire, Michael K; Scheyer, Todd; Nevins, Myron; Schupbach, Peter

2009-02-01

The current study examined the histologic and microcomputed tomographic (micro CT) outcomes of the treatment of gingival recession defects with either a subepithelial connective tissue graft (CTG) or 0.3 mg/mL recombinant human platelet-derived growth factor (rhPDGF-BB) on a beta tricalcium phosphate (beta-TCP) matrix. Gingival recession defects were surgically created in six premolar teeth with no more than 3 mm of keratinized marginal tissue, an osseous crest 2 to 3 mm apical to the newly created gingival margin, and recession depth of at least 3 mm. The defects were left untouched for 2 months; then, four defects were grafted with rhPDGF-BB + beta-TCP + a wound healing dressing, and two defects received CTGs. A coronally advanced flap covered each grafted site. Nine months later, sections were obtained for examination. All four sites treated with rhPDGF-BB + beta-TCP showed connective tissue fibers (Sharpey fibers) perpendicularly inserting into newly formed cementum and alveolar bone. In the two sites treated with CTGs, a long junctional epithelium was seen coronal to the osseous crest and connective tissue fibers ran parallel to the adjacent root surfaces, with no evidence of insertion into cementum or bone. There was no evidence of regeneration of cementum, inserting connective tissue fibers, or supporting alveolar bone. Regeneration of the periodontium in gingival recession defects is possible through growth factor-mediated therapy.

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Generation and validation of homozygous fluorescent knock-in cells using CRISPR-Cas9 genome editing.

PubMed

Koch, Birgit; Nijmeijer, Bianca; Kueblbeck, Moritz; Cai, Yin; Walther, Nike; Ellenberg, Jan

2018-06-01

Gene tagging with fluorescent proteins is essential for investigations of the dynamic properties of cellular proteins. CRISPR-Cas9 technology is a powerful tool for inserting fluorescent markers into all alleles of the gene of interest (GOI) and allows functionality and physiological expression of the fusion protein. It is essential to evaluate such genome-edited cell lines carefully in order to preclude off-target effects caused by (i) incorrect insertion of the fluorescent protein, (ii) perturbation of the fusion protein by the fluorescent proteins or (iii) nonspecific genomic DNA damage by CRISPR-Cas9. In this protocol, we provide a step-by-step description of our systematic pipeline to generate and validate homozygous fluorescent knock-in cell lines.We have used the paired Cas9D10A nickase approach to efficiently insert tags into specific genomic loci via homology-directed repair (HDR) with minimal off-target effects. It is time-consuming and costly to perform whole-genome sequencing of each cell clone to check for spontaneous genetic variations occurring in mammalian cell lines. Therefore, we have developed an efficient validation pipeline of the generated cell lines consisting of junction PCR, Southern blotting analysis, Sanger sequencing, microscopy, western blotting analysis and live-cell imaging for cell-cycle dynamics. This protocol takes between 6 and 9 weeks. With this protocol, up to 70% of the targeted genes can be tagged homozygously with fluorescent proteins, thus resulting in physiological levels and phenotypically functional expression of the fusion proteins.

Application of Fragment Based Drug Discovery to Membrane Proteins: Biophysical Identification of Ligands of the Integral Membrane Enzyme DsbB

PubMed Central

Früh, Virginie; Zhou, Yunpeng; Chen, Dan; Loch, Caroline; Eiso, AB; Grinkova, Yelena N.; Verheij, Herman; Sligar, Stephen G; Bushweller, John H.; Siegal, Gregg

2014-01-01

Summary Membrane proteins are important pharmaceutical targets, but they pose significant challenges for fragment based drug discovery approaches. Here we present the first successful use of biophysical methods to screen for fragment ligands to an integral membrane protein. The E. coli inner membrane protein DsbB was solubilized in detergent micelles and lipid bilayer nanodiscs. The solubilized protein was immobilized with retention of functionality and used to screen 1,071 drug fragments for binding using Target Immobilized NMR Screening. Biochemical and biophysical validation of the 8 most potent hits revealed an IC50 range of 7 to 200 μM. The ability to insert a broad array of membrane proteins into nanodiscs, combined with the efficiency of TINS, demonstrates the feasibility of finding fragments targeting membrane proteins. PMID:20797617

Molecular Cytogenetics Guides Massively Parallel Sequencing of a Radiation-Induced Chromosome Translocation in Human Cells.

PubMed

Cornforth, Michael N; Anur, Pavana; Wang, Nicholas; Robinson, Erin; Ray, F Andrew; Bedford, Joel S; Loucas, Bradford D; Williams, Eli S; Peto, Myron; Spellman, Paul; Kollipara, Rahul; Kittler, Ralf; Gray, Joe W; Bailey, Susan M

2018-05-11

Chromosome rearrangements are large-scale structural variants that are recognized drivers of oncogenic events in cancers of all types. Cytogenetics allows for their rapid, genome-wide detection, but does not provide gene-level resolution. Massively parallel sequencing (MPS) promises DNA sequence-level characterization of the specific breakpoints involved, but is strongly influenced by bioinformatics filters that affect detection efficiency. We sought to characterize the breakpoint junctions of chromosomal translocations and inversions in the clonal derivatives of human cells exposed to ionizing radiation. Here, we describe the first successful use of DNA paired-end analysis to locate and sequence across the breakpoint junctions of a radiation-induced reciprocal translocation. The analyses employed, with varying degrees of success, several well-known bioinformatics algorithms, a task made difficult by the involvement of repetitive DNA sequences. As for underlying mechanisms, the results of Sanger sequencing suggested that the translocation in question was likely formed via microhomology-mediated non-homologous end joining (mmNHEJ). To our knowledge, this represents the first use of MPS to characterize the breakpoint junctions of a radiation-induced chromosomal translocation in human cells. Curiously, these same approaches were unsuccessful when applied to the analysis of inversions previously identified by directional genomic hybridization (dGH). We conclude that molecular cytogenetics continues to provide critical guidance for structural variant discovery, validation and in "tuning" analysis filters to enable robust breakpoint identification at the base pair level.

Predicition and Discovery of High Tunneling Magnetoresistance in Magnetic Tunnel Junctions with Crystalline Barriers

NASA Astrophysics Data System (ADS)

Butler, William

2005-03-01

Tunneling magnetoresistance in excess of 200% has recently been observed in magnetic tunnel junctions using bcc Fe or bcc CoFe electrodes with crystalline MgO tunnel barriers[1,2]. These results demonstrate that tunneling magnetoresistance depends on more than the ``electrode polarization''. This talk will describe the calculations that predicted high TMR in these and other systems[3,4,5]. These calculations helped us to understand certain principles that may lead to high TMR through coherent electron tunneling. They can be briefly summarized as follows: (1) If the symmetry of a Bloch state can be preserved as electrons cross the interfaces between the electrode and the tunnel barrier, this be used to advantage for spin filtering. (2) Evanescent states of different symmetries decay at different rates in the barrier. (3) Interfacial bonding can be very important in determining the probability that an electron can traverse the interface. (4) Electrons of disallowed symmetry cannot propagate in an electrode. Once these simple principles are understood, simple band codes can be used to screen and to develop heterostructures with the proper symmetries to obtain high TMR. [1] S. S. P. Parkin, C. Kaiser, A. Panchula, P. M. Rice, B. Hughes, M. Samant AND S.-H. Yang, ``Giant tunnelling magnetoresistance at room temperature with MgO (100) tunnel barriers,'' Nature Materials, Advance Online Publication [2] S. Yuasa, T. Nagahama, A. Fukushima, Y. Suzuki, K. Ando, ``Giant room-temperature magnetoresistance in single-crystal Fe/MgO/Fe magnetic tunnel junctions,'' Nature Materials, Advance Online Publication [3] W. H. Butler, X.-G. Zhang, T. C. Schulthess, and J. M. MacLaren, ``Spin-dependent tunneling conductance of Fe | MgO | Fe sandwiches'' Phys. Rev. B 63, 054416 (2001) [4] J. Mathon, A. Umerski, ``Theory of tunneling magnetoresistance of an epitaxial Fe/MgO/Fe(001) junction,'' Phys. Rev. B 63, 220403(R) (2001). [5] X.-G. Zhang, and W. H. Butler, ``Large magnetoresistance in bcc Co/MgO/Co and FeCo/MgO/FeCo tunnel junctions,'' Phys. Rev. B 70, 172407 (2004)

[Technology and humanization in critical care environments].

PubMed

Marques, Isaac Rosa; Souza, Agnaldo Rodrigues de

2010-01-01

Because of the advances made with the industrial revolution through technological discoveries in machinery, professional-patient relationship has become increasingly automated, leaving the humanization in the background. The purpose of this paper was to reflect about the humanization process in intensive environments and its relation with the technology insertion. Technology contributes as an effective way to treat patients who require extreme care. However, if it is associated with humanization can achieves satisfactory results, improving the host of customer who receives the care provided by technology.

KSC-04pd0950

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod is lowered toward the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0948

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod is maneuvered toward the engine interfaces on the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

S Elements: A Family of Tc1-like Transposons in the Genome of Drosophila Melanogaster

PubMed Central

Merriman, P. J.; Grimes, C. D.; Ambroziak, J.; Hackett, D. A.; Skinner, P.; Simmons, M. J.

1995-01-01

The S elements form a diverse family of long-inverted-repeat transposons within the genome of Drosophila melanogaster. These elements vary in size and sequence, the longest consisting of 1736 bp with 234-bp inverted terminal repeats. The longest open reading frame in an intact S element could encode a 345-amino acid polypeptide. This polypeptide is homologous to the transposases of the mariner-Tc1 superfamily of transposable elements. S elements are ubiquitous in D. melanogaster populations and also appear to be present in the genomes of two sibling species; however, they seem to be absent from 17 other Drosophila species that were examined. Within D. melanogaster strains, there are, on average, 37.4 cytologically detectable S elements per diploid genome. These elements are scattered throughout the chromosomes, but several sites in both the euchromatin and β heterochromatin are consistently occupied. The discovery of an S-element-insertion mutation and a reversion of this mutation indicates that S elements are at least occasionally mobile in the D. melanogaster genome. These elements seem to insert at an AT dinucleotide within a short palindrome and apparently duplicate that dinucleotide upon insertion. PMID:8601484

Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

2014-01-01

The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

Micro-droplet formation via 3D printed micro channel

NASA Astrophysics Data System (ADS)

Jian, Zhen; Zhang, Jiaming; Li, Erqiang; Thoroddsen, Sigurdur T.

2016-11-01

Low cost, fast-designed and fast-fabricated 3D micro channel was used to create micro-droplets. Capillary with an outer diameter of 1.5 mm and an inner diameter of 150 μm was inserted into a 3D printed cylindrical channel with a diameter of 2 mm . Flow rate of the two inlets, insert depth, liquid (density, viscosity and surface tension) and solid (roughness, contact angle) properties all play a role in the droplet formation. Different regimes - dripping, jetting, unstable state - were observed in the micro-channel on varying these parameters. With certain parameter combinations, successive formation of micro-droplets with equal size was observed and its size can be much smaller than the smallest channel size. Based on our experimental results, the droplet formation via 3D printed micro T-junction was investigated through direct numerical simulations with a code called Gerris. Reynolds numbers Re = ρUL / μ and Weber numbers We = ρU2 L / σ of the two liquids were introduced to measure the liquid effect. The parameter regime where different physical dynamics occur was studied and the regime transition was observed with certain threshold values. Qualitative and quantitative analysis were performed as well between simulations and experiments.

Recombineering: A Homologous Recombination-Based Method of Genetic Engineering

PubMed Central

Sharan, Shyam K.; Thomason, Lynn C.; Kuznetsov, Sergey G.; Court, Donald L.

2009-01-01

Recombineering is an efficient method of in vivo genetic engineering applicable to chromosomal as well as episomal replicons in E. coli. This method circumvents the need for most standard in vitro cloning techniques. Recombineering allows construction of DNA molecules with precise junctions without constraints being imposed by restriction enzyme site location. Bacteriophage homologous recombination proteins catalyze these recombineering reactions using double- and single-strand linear DNA substrates, so-called targeting constructs, introduced by electroporation. Gene knockouts, deletions and point mutations are readily made, gene tags can be inserted, and regions of bacterial artificial chromosomes (BACs) or the E. coli genome can be subcloned by gene retrieval using recombineering. Most of these constructs can be made within about a week's time. PMID:19180090

SPLICEFINDER – A Fast and Easy Screening Method for Active Protein Trans-Splicing Positions

PubMed Central

Eppmann, Simone; Busche, Alena; Dikovskaya, Dina; Dötsch, Volker; Mootz, Henning D.

2013-01-01

Split intein enabled protein trans-splicing (PTS) is a powerful method for the ligation of two protein fragments, thereby paving the way for various protein modification or protein function control applications. PTS activity is strongly influenced by the amino acids directly flanking the splice junctions. However, to date no reliable prediction can be made whether or not a split intein is active in a particular foreign extein context. Here we describe SPLICEFINDER, a PCR-based method, allowing fast and easy screening for active split intein insertions in any target protein. Furthermore we demonstrate the applicability of SPLICEFINDER for segmental isotopic labeling as well as for the generation of multi-domain and enzymatically active proteins. PMID:24023792

Detection of Hepatocyte Clones Containing Integrated Hepatitis B Virus DNA Using Inverse Nested PCR.

PubMed

Tu, Thomas; Jilbert, Allison R

2017-01-01

Chronic hepatitis B virus (HBV) infection is a major cause of liver cirrhosis and hepatocellular carcinoma (HCC), leading to ~600,000 deaths per year worldwide. Many of the steps that occur during progression from the normal liver to cirrhosis and/or HCC are unknown. Integration of HBV DNA into random sites in the host cell genome occurs as a by-product of the HBV replication cycle and forms a unique junction between virus and cellular DNA. Analyses of integrated HBV DNA have revealed that HCCs are clonal and imply that they develop from the transformation of hepatocytes, the only liver cell known to be infected by HBV. Integrated HBV DNA has also been shown, at least in some tumors, to cause insertional mutagenesis in cancer driver genes, which may facilitate the development of HCC. Studies of HBV DNA integration in the histologically normal liver have provided additional insight into HBV-associated liver disease, suggesting that hepatocytes with a survival or growth advantage undergo high levels of clonal expansion even in the absence of oncogenic transformation. Here we describe inverse nested PCR (invPCR), a highly sensitive method that allows detection, sequencing, and enumeration of virus-cell DNA junctions formed by the integration of HBV DNA. The invPCR protocol is composed of two major steps: inversion of the virus-cell DNA junction and single-molecule nested PCR. The invPCR method is highly specific and inexpensive and can be tailored to DNA extracted from large or small amounts of liver. This procedure also allows detection of genome-wide random integration of any known DNA sequence and is therefore a useful technique for molecular biology, virology, and genetic research.

Anatomical association between wrist extensor musculature and topographical pain sensitivity maps of the elbow area.

PubMed

Prados-Frutos, Juan Carlos; Ruiz-Ruiz, Beatriz; De-la-Llave-Rincón, Ana Isabel; Arendt-Nielsen, Lars; Madeleine, Pascal; Fernández-de-Las-Peñas, César

2012-06-01

High-density topographical sensitivity maps have been developed to visualize nonuniformity deep tissue pain sensitivity in, for example, lateral epicondylitis (LE). The aim of this cadaveric study was to determine the anatomical association between the topographical sensitivity maps over the elbow area and wrist extensor musculature. A topographical pressure sensitivity map consisting of 12 points forming a 3 × 4 matrix: 4 points in the superior part, 4 points in the middle, and 4 points in the lower part around the lateral epicondyle was marker on a 50-year embalmed cadaver. Color marker pins were inserted into each point. Pins were removed during the process of dissection, but the small holes created by their removal assured accurate relocation. Progressive dissection revealed that points 1 to 4 (superior line) were placed over the musculotendinous junction and belly of the extensor carpi radialis brevis (ECRB) muscle, points 6 to 8 (middle line) were placed over the musculotendinous junction and belly of the extensor digitorum communis muscle, and points 9 to 12 (inferior line) were located over the musculotendinous junction and belly of the extensor carpi ulnaris muscle. It was also observed that the superficial branch of the radial nerve runs between the belly of the ECRB and extensor digitorum communis muscles. This study confirmed that anatomical location previously assumed supporting the important wrist extensor muscles, particularly the ECRB, in patients with LE as depicted by pressure pain sensitivity maps. This study also suggests a potential role of the superficial branch of the radial nerve in LE. Copyright © 2012 National University of Health Sciences. Published by Mosby, Inc. All rights reserved.

Stabilization of acetylcholine receptors at the neuromuscular synapse: the role of the nerve.

PubMed

Ramsay, D A; Drachman, D B; Drachman, R J; Stanley, E F

1992-05-29

The majority of acetylcholine receptors (AChRs) at innervated neuromuscular junctions (NMJs) are stable, with half-lives averaging about 11 days in rodent muscles. In addition to the stable AChRs, approximately 18% of AChRs at these innervated junctions are rapidly turned over (RTOs), with half lives of less than 24 h. We have postulated that RTOs may be precursors of stable AChRs, and that the motor nerve may influence their stabilization. This hypothesis was tested by: (i) labeling AChRs in mouse sternomastoid (SM) muscles with 125I-alpha-BuTx; (ii) denervating one SM muscle in each mouse, and (iii) following the fate of the labeled AChRs through a 5-day period when RTOs were either stabilized or degraded. The hypothesis predicts that denervation should preclude stabilization of RTOs, resulting in a deficit of stable AChRs in denervated muscles. The results showed a highly significant (P less than 0.002) deficit of stable AChRs in denervated as compared with innervated muscles. Control experiments excluded the possibility that this deficit could be attributed to independent accelerated degradation of either RTOs or pre-existing stable AChRs. The observed deficit was quantitatively consistent with the deficit predicted by a mathematical model based on interruption of stabilization following denervation. We conclude that: (i) the observed deficit after denervation of NMJs is due to failure of stabilization of pre-existing RTOs; (ii) RTOs at normally innervated NMJs are precursors of stable AChRs; (iii) stabilization occurs after the insertion of AChRs at NMJs, and (iv) motor nerves play a key role in stabilization of RTOs. The concept of receptor stabilization has important implications for understanding the biology of the neuromuscular junction and post-synaptic plasticity.

The crystal structure of an oligo(U):pre-mRNA duplex from a trypanosome RNA editing substrate

PubMed Central

Mooers, Blaine H.M.; Singh, Amritanshu

2011-01-01

Guide RNAs bind antiparallel to their target pre-mRNAs to form editing substrates in reaction cycles that insert or delete uridylates (Us) in most mitochondrial transcripts of trypanosomes. The 5′ end of each guide RNA has an anchor sequence that binds to the pre-mRNA by base-pair complementarity. The template sequence in the middle of the guide RNA directs the editing reactions. The 3′ ends of most guide RNAs have ∼15 contiguous Us that bind to the purine-rich unedited pre-mRNA upstream of the editing site. The resulting U-helix is rich in G·U wobble base pairs. To gain insights into the structure of the U-helix, we crystallized 8 bp of the U-helix in one editing substrate for the A6 mRNA of Trypanosoma brucei. The fragment provides three samples of the 5′-AGA-3′/5′-UUU-3′ base-pair triple. The fusion of two identical U-helices head-to-head promoted crystallization. We obtained X-ray diffraction data with a resolution limit of 1.37 Å. The U-helix had low and high twist angles before and after each G·U wobble base pair; this variation was partly due to shearing of the wobble base pairs as revealed in comparisons with a crystal structure of a 16-nt RNA with all Watson–Crick base pairs. Both crystal structures had wider major grooves at the junction between the poly(U) and polypurine tracts. This junction mimics the junction between the template helix and the U-helix in RNA-editing substrates and may be a site of major groove invasion by RNA editing proteins. PMID:21878548

Sulfadiazine-Induced Obstructive Nephropathy Presenting with Upper Urinary Tract Extravasation.

PubMed

Kabha, Maharan; Dekalo, Snir; Barnes, Sophie; Mintz, Ishay; Matzkin, Haim; Sofer, Mario

2016-01-01

Background: Obstructive nephropathy is an uncommon side effect of sulfadiazine, which is used for the treatment of toxoplasmosis. We present a case of acute renal colic and urine extravasation of a patient shortly after she was started on this medication. Case Presentation: A 31-year-old female presented with acute renal colic 2 weeks after starting treatment with sulfadiazine and pyrimethamine for ocular toxoplasmosis. Results: A noncontrast computed tomography revealed left hydronephrosis and fluid located around the kidney and in the left gutter. There were no urinary stones. Administration of intravenous contrast revealed significant urine extravasation at the level of the ureteropelvic junction. Intravenous contrast injection confirmed that the extravasation consisted of urine leakage at the ureteropelvic junction. Her clinical condition improved with the insertion of an internal stent, which was left in place for 4 weeks. A retrograde pyelography performed at the time of the internal stent removal ruled out persistent extravasation and filling defects in the left upper urinary tract. Considering the clinical circumstances and the imaging results, it appears that this is a first reported case of sulfadiazine-induced obstructive uropathy associated with urine extravasation. Conclusion: Although rare, obstructive uropathy related to sulfadiazine medication should be promptly suspected, diagnosed, and treated. Patients should be instructed to substantially increase their liquid intake while on that medication.

Molecular epidemiology demonstrated three emerging clusters of human immunodeficiency virus type 1 subtype B infection in Hong Kong.

PubMed

Leung, Tommy W C; Mak, Darwin; Wong, K H; Wang, Y; Song, Y H; Tsang, D N C; Wong, C; Shao, Y M; Lim, W L

2008-07-01

We conducted a molecular epidemiological study on newly diagnosed human immunodeficiency virus type 1 (HIV-1)-infected patients in Hong Kong to identify the epidemiological linkage of HIV-1 infection in the locality. Reverse transcription polymerase chain reaction (RT-PCR) for HIV-1 was performed on newly diagnosed HIV-1-positive sera collected from January 2002 to December 2006. PCR products correspond to the env C2V3V4 region and gag p17/p24 junction of the HIV-1 genome were nucleotide sequenced. Phylogenetic analyses performed on the acquired nucleotide sequences revealed that CRF01_AE and subtype B were the two dominant HIV-1 subtypes. Analyses also demonstrated the presence of three emerging HIV-1 clusters among the subtype B sequences in Hong Kong. Individual cluster possesses a unique cluster-specific amino acid signature for identification. Data show that one of the clusters (Cluster I) is rapidly expanding. In addition to the unique cluster-specific amino acid signature, the majority of sequences in Cluster I harbor a 6-amino acid insertion at the gag p17/p24 junction in a region that is thought to be closely associated with HIV-1 infectivity.

Changes in the distribution of type II transmembrane serine protease, TMPRSS2 and in paracellular permeability in IPEC-J2 cells exposed to oxidative stress.

PubMed

Paszti-Gere, Erzsebet; Barna, Reka Fanni; Kovago, Csaba; Szauder, Ipoly; Ujhelyi, Gabriella; Jakab, Csaba; Meggyesházi, Nóra; Szekacs, Andras

2015-04-01

The effect of oxidative stress on barrier integrity and localization of transmembrane serine proteinase 2 (TMPRSS2) were studied using porcine epithelial IPEC-J2 cells on membrane inserts. Increased paracellular permeability of FITC-dextran 4 kDa (fluorescence intensity 43,508 ± 2,391 versus 3,550 ± 759) and that of gentamicin (3.41 ± 0.06 % increase to controls) were measured parallel with the reduced transepithelial electrical resistance (23.3 ± 4.06 % decrease) of cell layers 6 h after 1 h 1 mM H2O2 treatment. The immunohistochemical localization of adherens junctional β-catenin was not affected by reactive oxygen species (ROS) up to 4 mM H2O2. Peroxide-triggered enhanced paracellular permeability of IPEC-J2 cell layer was accompanied by predominantly cytoplasmic occurrence of TMPRSS2 embedded in cell membrane under physiological conditions. These results support that ROS can influence paracellular gate opening via multifaceted mode of action without involvement of β-catenin redistribution in adherens junction. Altered distribution pattern of TMPRSS2 and relocalized transmembrane serine protease activity may contribute to weakening of epithelial barrier integrity under acute oxidative stress.

Homeostatic Regulation of the PI(4,5)P2-Ca2+ Signaling System at ER-PM Junctions

PubMed Central

Chang, Chi-Lun; Liou, Jen

2016-01-01

The phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2)-Ca2+ signaling system is important for cell activation in response to various extracellular stimuli. This signaling system is initiated by receptor-induced hydrolysis of PI(4,5)P2 in the plasma membrane (PM) to generate the soluble second messenger inositol 1,4,5-trisphosphate (IP3). IP3 subsequently triggers the release of Ca2+ from the endoplasmic reticulum (ER) store to the cytosol to activate Ca2+-mediated responses, such as secretion and proliferation. The consumed PM PI(4,5)P2 and ER Ca2+ must be quickly restored to sustain signaling responses, and to maintain the homeostasis of PI(4,5)P2 and Ca2+. Since phosphatidylinositol (PI), the precursor lipid for PM PI(4,5)P2, is synthesized in the ER membrane, and a Ca2+ influx across the PM is required to refill the ER Ca2+ store, efficient communications between the ER and the PM are critical for the homeostatic regulation of the PI(4,5)P2-Ca2+ signaling system. This review describes the major findings that established the framework of the PI(4,5)P2-Ca2+ signaling system, and recent discoveries on feedback control mechanisms at ER-PM junctions that sustain the PI(4,5)P2-Ca2+ signaling system. Particular emphasis is placed on the characterization of ER-PM junctions where efficient communications between the ER and the PM occurs, and the activation mechanisms of proteins that dynamically localize to ER-PM junctions to provide the feedback control during PI(4,5)P2-Ca2+ signaling, including the ER Ca2+ sensor STIM1, the extended synaptotagmin E-Syt1, and the PI transfer protein Nir2. This review is part of a Special Issue entitled The Cellular Lipid Landscape. PMID:26924250

Synthetic biology approaches: Towards sustainable exploitation of marine bioactive molecules.

PubMed

Seghal Kiran, G; Ramasamy, Pasiyappazham; Sekar, Sivasankari; Ramu, Meenatchi; Hassan, Saqib; Ninawe, A S; Selvin, Joseph

2018-06-01

The discovery of genes responsible for the production of bioactive metabolites via metabolic pathways combined with the advances in synthetic biology tools, has allowed the establishment of numerous microbial cell factories, for instance the yeast cell factories, for the manufacture of highly useful metabolites from renewable biomass. Genome mining and metagenomics are two platforms provide base-line data for reconstruction of genomes and metabolomes which is based in the development of synthetic/semi-synthetic genomes for marine natural products discovery. Engineered biofilms are being innovated on synthetic biology platform using genetic circuits and cell signalling systems as represillators controlling biofilm formation. Recombineering is a process of homologous recombination mediated genetic engineering, includes insertion, deletion or modification of any sequence specifically. Although this discipline considered new to the scientific domain, this field has now developed as promising endeavor on the accomplishment of sustainable exploitation of marine natural products. Copyright © 2018 Elsevier B.V. All rights reserved.

Endogenous Retroviruses: With Us and Against Us

NASA Astrophysics Data System (ADS)

Meyer, Thomas J.; Rosenkrantz, Jimi L.; Carbone, Lucia; Chavez, Shawn L.

2017-04-01

Mammalian genomes are scattered with thousands of copies of endogenous retroviruses (ERVs), mobile genetic elements that are relics of ancient retroviral infections. After inserting copies into the germ line of a host, most ERVs accumulate mutations that prevent the normal assembly of infectious viral particles, becoming trapped in host genomes and unable to leave to infect other cells. While most copies of ERVs are inactive, some are transcribed and encode the proteins needed to generate new insertions at novel loci. In some cases, old copies are removed via recombination and other mechanisms. This creates a shifting landscape of ERV copies within host genomes. New insertions can disrupt normal expression of nearby genes via directly inserting into key regulatory elements or by containing regulatory motifs within their sequences. Further, the transcriptional silencing of ERVs via epigenetic modification may result in changes to the epigenetic regulation of adjacent genes. In these ways, ERVs can be potent sources of regulatory disruption as well as genetic innovation. Here, we provide a brief review of the association between ERVs and gene expression, especially as observed in pre-implantation development and placentation. Moreover, we will describe the roles ERVs may play in somatic tissues, mostly in the context of human disease, including cancer, neurodegenerative disorders, and schizophrenia. Lastly, we discuss the recent discovery that some ERVs may have been pressed into the service of their host genomes to aid in the innate immune response to exogenous viral infections.

Anatomy of the depressor septi nasi muscle: the basis for correction of deformities of the nose/lip junction.

PubMed

Barbosa, Marcus Vinícius Jardini; Nahas, Fábio Xerfan; Ferreira, Lydia Masako

2013-04-01

The purpose of this study was to analyse the macroscopic aspect of the depressor septi nasi muscle in cadavers according to its relations with the nasolabial region, and to describe a surgical technique developed out of the knowledge gained from its study to take care of nasal tip drooping and gummy smile. Twenty fresh adult cadavers were studied. All of them were men. A transverse incision was done at the gingivo-labial sulcus, through the frenulum, to expose the orbicularis oris and the depressor nasi muscles. These muscles were isolated and their anatomical aspect, localisation, origin, and insertion were registered. Sixteen of the cadavers presented the muscle. From these, 14 were bilateral and two were unilateral. Four cadavers did not present the muscle. Muscular fibres were vertically disposed and presented oblique direction towards the midline, in a quadrangular shape. From the 16 cadavers of the subgroup in whom the muscle was present, 14 originated in the orbicularis oris and its insertion was in the maxilla. Two of the cadavers presented the origin and insertion at the maxilla. According to these findings, a surgical approach of the muscles was proposed to treat the gummy smile deformity during rhinoplasty and two clinical cases are presented. The depressor nasi muscles presented an anatomical variation. In most cases it is intimately related with the orbicularis oris and the maxilla, being a relatively thick structure. We suggest its treatment simultaneously during rhinoplasty for a better result of the nasal tip and it benefits the "tense nose" aspect and the smiling deformity.

The gastro-esophageal reflux barrier: biophysical analysis on 3D models of anatomy from magnetic resonance imaging.

PubMed

Roy, S; Fox, M R; Curcic, J; Schwizer, W; Pal, A

2012-07-01

The function and structure of the gastro-esophageal junction (GEJ) determine its efficacy as a reflux barrier. This study presents a novel methodology for the quantitative assessment of GEJ and proximal gastric morphology from magnetic resonance (MR) imaging. Based on this data we propose a new conceptualization of the hypothesis that a flap valve mechanism contributes to reflux protection. 3D models of the GEJ and proximal stomach were reconstructed from MR images in 12 healthy volunteers during respiration and on eating a test meal to maximum satiation. A rotating plane analysis measured the gastro-esophageal insertion angle and span of contact. An ellipsoid fit provided quantitative assessment of gastric shape and orientation relative to a fixed anatomical reference point. Position of the esophageal insertion on the 'gastric ellipse' was noted. An ellipsoid-cylinder model was designed to analyze the relationships among parameters describing the GEJ morphology. The insertion angle became more acute on expiration, but did not change with meal ingestion. In contrast the span of contact did not vary with respiration, but increased with gastric filling. Changes in gastric morphology with distension further augmented the span of gastro-esophageal contact in almost 70% of the studies. Novel MR imaging and biophysical analysis of the GEJ and proximal stomach provide a quantitative description of structures contributing to the reflux barrier. Changes in these parameters during respiration and on eating support the hypothesis that structural components of a functional 'flap valve' like mechanism contribute to reflux protection. © 2012 Blackwell Publishing Ltd.

Recombinant Parainfluenza Virus 5 Expressing Hemagglutinin of Influenza A Virus H5N1 Protected Mice against Lethal Highly Pathogenic Avian Influenza Virus H5N1 Challenge

PubMed Central

Li, Zhuo; Mooney, Alaina J.; Gabbard, Jon D.; Gao, Xiudan; Xu, Pei; Place, Ryan J.; Hogan, Robert J.; Tompkins, S. Mark

2013-01-01

A safe and effective vaccine is the best way to prevent large-scale highly pathogenic avian influenza virus (HPAI) H5N1 outbreaks in the human population. The current FDA-approved H5N1 vaccine has serious limitations. A more efficacious H5N1 vaccine is urgently needed. Parainfluenza virus 5 (PIV5), a paramyxovirus, is not known to cause any illness in humans. PIV5 is an attractive vaccine vector. In our studies, a single dose of a live recombinant PIV5 expressing a hemagglutinin (HA) gene of H5N1 (rPIV5-H5) from the H5N1 subtype provided sterilizing immunity against lethal doses of HPAI H5N1 infection in mice. Furthermore, we have examined the effect of insertion of H5N1 HA at different locations within the PIV5 genome on the efficacy of a PIV5-based vaccine. Interestingly, insertion of H5N1 HA between the leader sequence, the de facto promoter of PIV5, and the first viral gene, nucleoprotein (NP), did not lead to a viable virus. Insertion of H5N1 HA between NP and the next gene, V/phosphorprotein (V/P), led to a virus that was defective in growth. We have found that insertion of H5N1 HA at the junction between the small hydrophobic (SH) gene and the hemagglutinin-neuraminidase (HN) gene gave the best immunity against HPAI H5N1 challenge: a dose as low as 1,000 PFU was sufficient to protect against lethal HPAI H5N1 challenge in mice. The work suggests that recombinant PIV5 expressing H5N1 HA has great potential as an HPAI H5N1 vaccine. PMID:23077314

miR156a Mimic Represses the Epithelial-Mesenchymal Transition of Human Nasopharyngeal Cancer Cells by Targeting Junctional Adhesion Molecule A.

PubMed

Tian, Yunhong; Cai, Longmei; Tian, Yunming; Tu, Yinuo; Qiu, Huizhi; Xie, Guofeng; Huang, Donglan; Zheng, Ronghui; Zhang, Weijun

2016-01-01

MicroRNAs (miRNAs) have been documented as having an important role in the development of cancer. Broccoli is very popular in large groups of the population and has anticancer properties. Junctional adhesion molecule A (JAMA) is preferentially concentrated at tight junctions and influences cell morphology and migration. Epithelial-mesenchymal transition (EMT) is a developmental program associated with cancer progression and metastasis. In this study we aimed to investigate the role of miRNAs from broccoli in human nasopharyngeal cancer (NPC). We demonstrated that a total of 84 conserved miRNAs and 184 putative novel miRNAs were found in broccoli by sequencing technology. Among these, miR156a was expressed the most. In addition, synthetic miR156a mimic inhibited the EMT of NPC cells in vitro. Furthermore, it was confirmed that JAMA was the target of miR156a mimic as validated by 3' UTR luciferase reporter assays and western blotting. Knockdown of JAMA was consistent with the effects of miR156a mimic on the EMT of NPC, and the up-regulation of JAMA could partially restore EMT repressed by miR156a mimic. In conclusion, these results indicate that the miR156a mimic inhibits the EMT of NPC cells by targeting the 3' UTR of JAMA. These miRNA profiles of broccoli provide a fundamental basis for further research. Moreover, the discovery of miR156a may have clinical implications for the treatment of patients with NPC.

Cervico-occipital meningioma in a 5-year-old child: a case report.

PubMed

Ben Nsir, Atef; Boubaker, Adnene; Jemel, Hafedh

2014-01-01

Childhood meningiomas are scarce in clinical practice with an incidence ranging from 0.4 to 4.6% of all pediatric central nervous system (CNS) tumors. Cervico-occipital meningiomas account for 3.7% of childhood meningiomas and are slightly more frequent in male. A 5-year-old female presented with febrile posterior cervico-occipital pain for 3 weeks. She was diagnosed with meningitis and treated for a similar period with adapted antibiotics. The pain persisted even after treatment. Magnetic resonance imaging revealed an enhancing subdural extra medullary mass of the cervico occipital junction, developing around the left vertebral artery. The characteristics of the lesion were strongly suggestive of a neuroma. Surgical removal of the tumor aiming the decompression of the spinal cord and nerve roots was performed with a surprising discovery: The tumor was tightly attached to the dura at the entry of the left vertebral artery. The resection was total and only a thin part close to the artery was left. The pathological findings confirmed the diagnosis of meningothelial meningioma. Meningioma should be considered in the differential diagnosis of contrast enhancing subdural extra medullary lesions of the cervico-occipital junction in children.

Fidelity by design: Yoctoreactor and binder trap enrichment for small-molecule DNA-encoded libraries and drug discovery.

PubMed

Blakskjaer, Peter; Heitner, Tara; Hansen, Nils Jakob Vest

2015-06-01

DNA-encoded small-molecule library (DEL) technology allows vast drug-like small molecule libraries to be efficiently synthesized in a combinatorial fashion and screened in a single tube method for binding, with an assay readout empowered by advances in next generation sequencing technology. This approach has increasingly been applied as a viable technology for the identification of small-molecule modulators to protein targets and as precursors to drugs in the past decade. Several strategies for producing and for screening DELs have been devised by both academic and industrial institutions. This review highlights some of the most significant and recent strategies along with important results. A special focus on the production of high fidelity DEL technologies with the ability to eliminate screening noise and false positives is included: using a DNA junction called the Yoctoreactor, building blocks (BBs) are spatially confined at the center of the junction facilitating both the chemical reaction between BBs and encoding of the synthetic route. A screening method, known as binder trap enrichment, permits DELs to be screened robustly in a homogeneous manner delivering clean data sets and potent hits for even the most challenging targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

KSC-04pd0942

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod (seen from the back) is lifted off its transporter. The OMS pod will be installed on the orbiter Discovery. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0949

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, workers stand by as the left-hand Orbital Maneuvering System (OMS) pod is maneuvered toward the engine interfaces on the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0944

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod is lifted at an angle from the transporter below. The OMS pod will be installed on the orbiter Discovery. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0947

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod (top of photo) is poised behind the engine interfaces on the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0946

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, workers on an upper level watch as the left-hand Orbital Maneuvering System (OMS) pod is lifted high to maneuver it toward the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0943

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, workers check the lifting of the left-hand Orbital Maneuvering System (OMS) pod. The OMS pod will be installed on the orbiter Discovery. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0941

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, the left-hand Orbital Maneuvering System (OMS) pod (seen from the front) is lifted off its transporter. The OMS pod will be installed on the orbiter Discovery. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

KSC-04pd0945

NASA Image and Video Library

2004-04-21

KENNEDY SPACE CENTER, FLA. - In the Orbiter Processing Facility, a worker on an upper level watches as the left-hand Orbital Maneuvering System (OMS) pod is lifted high to maneuver it toward the orbiter Discovery for installation. The Orbital Maneuvering System provides the thrust for orbit insertion, orbit circularization, orbit transfer, rendezvous, deorbit, abort to orbit and abort once around. It can provide up to 1,000 pounds of propellant to the aft reaction control system. Each pod contains one OMS engine and the hardware needed to pressurize, store and distribute the propellants to perform the velocity maneuvers.

Probing for Binding Regions of the FtsZ Protein Surface through Site-Directed Insertions: Discovery of Fully Functional FtsZ-Fluorescent Proteins

PubMed Central

Moore, Desmond A.; Whatley, Zakiya N.; Joshi, Chandra P.; Osawa, Masaki

2016-01-01

ABSTRACT FtsZ, a bacterial tubulin homologue, is a cytoskeletal protein that assembles into protofilaments that are one subunit thick. These protofilaments assemble further to form a “Z ring” at the center of prokaryotic cells. The Z ring generates a constriction force on the inner membrane and also serves as a scaffold to recruit cell wall remodeling proteins for complete cell division in vivo. One model of the Z ring proposes that protofilaments associate via lateral bonds to form ribbons; however, lateral bonds are still only hypothetical. To explore potential lateral bonding sites, we probed the surface of Escherichia coli FtsZ by inserting either small peptides or whole fluorescent proteins (FPs). Among the four lateral surfaces on FtsZ protofilaments, we obtained inserts on the front and back surfaces that were functional for cell division. We concluded that these faces are not sites of essential interactions. Inserts at two sites, G124 and R174, located on the left and right surfaces, completely blocked function, and these sites were identified as possible sites for essential lateral interactions. However, the insert at R174 did not interfere with association of protofilaments into sheets and bundles in vitro. Another goal was to find a location within FtsZ that supported insertion of FP reporter proteins while allowing the FtsZ-FPs to function as the sole source of FtsZ. We discovered one internal site, G55-Q56, where several different FPs could be inserted without impairing function. These FtsZ-FPs may provide advances for imaging Z-ring structure by superresolution techniques. IMPORTANCE One model for the Z-ring structure proposes that protofilaments are assembled into ribbons by lateral bonds between FtsZ subunits. Our study excluded the involvement of the front and back faces of the protofilament in essential interactions in vivo but pointed to two potential lateral bond sites, on the right and left sides. We also identified an FtsZ loop where various fluorescent proteins could be inserted without blocking function; these FtsZ-FPs functioned as the sole source of FtsZ. This advance provides improved tools for all fluorescence imaging of the Z ring and may be especially important for superresolution imaging. PMID:27795325

The Mobile Element Locator Tool (MELT): population-scale mobile element discovery and biology

PubMed Central

Gardner, Eugene J.; Lam, Vincent K.; Harris, Daniel N.; Chuang, Nelson T.; Scott, Emma C.; Pittard, W. Stephen; Mills, Ryan E.; Devine, Scott E.

2017-01-01

Mobile element insertions (MEIs) represent ∼25% of all structural variants in human genomes. Moreover, when they disrupt genes, MEIs can influence human traits and diseases. Therefore, MEIs should be fully discovered along with other forms of genetic variation in whole genome sequencing (WGS) projects involving population genetics, human diseases, and clinical genomics. Here, we describe the Mobile Element Locator Tool (MELT), which was developed as part of the 1000 Genomes Project to perform MEI discovery on a population scale. Using both Illumina WGS data and simulations, we demonstrate that MELT outperforms existing MEI discovery tools in terms of speed, scalability, specificity, and sensitivity, while also detecting a broader spectrum of MEI-associated features. Several run modes were developed to perform MEI discovery on local and cloud systems. In addition to using MELT to discover MEIs in modern humans as part of the 1000 Genomes Project, we also used it to discover MEIs in chimpanzees and ancient (Neanderthal and Denisovan) hominids. We detected diverse patterns of MEI stratification across these populations that likely were caused by (1) diverse rates of MEI production from source elements, (2) diverse patterns of MEI inheritance, and (3) the introgression of ancient MEIs into modern human genomes. Overall, our study provides the most comprehensive map of MEIs to date spanning chimpanzees, ancient hominids, and modern humans and reveals new aspects of MEI biology in these lineages. We also demonstrate that MELT is a robust platform for MEI discovery and analysis in a variety of experimental settings. PMID:28855259

Optimization of Materials and Interfaces for Spintronic Devices

NASA Astrophysics Data System (ADS)

Clark, Billy

In recent years' Spintronic devices have drawn a significant amount of research attention. This interest comes in large part from their ability to enable interesting and new technology such as Spin Torque Transfer Random Access Memory or improve existing technology such as High Signal Read Heads for Hard Disk Drives. For the former we worked on optimizing and improving magnetic tunnel junctions by optimizing their thermal stability by using Ta insertion layers in the free layer. We further tried to simplify the design of the MTJ stack by attempting to replace the Co/Pd multilayer with CoPd alloy. In this dissertation, we detail its development and examine the switching characteristics. Lastly we look at a highly spin polarized material, Fe2MnGe, for optimizing Hard Drive Disk read heads.

Measuring water potential (activity) from free water to oven dryness.

PubMed

Wiebe, H H

1981-12-01

Water activities (potentials) in plant materials were measured over the range from free water to oven dryness with a Spanner thermocouple psychrometer. In a two-step procedure, water was first condensed on the thermocouple junction for several minutes. The sample was then inserted under the wet thermocouple and the maximum psychrometric cooling was measured in about 10 seconds. Calibration was with saturated salt slurries of known water activities. Psychrometric cooling was a nearly linear function of the water activity and of the negative log of the water potential. The psychrometric cooling to water activity relationship agreed with wetbulb temperature depression to relative humidity relationships given in tables. Water activities of wheat grains and leaves decreased sharply in a curvilinear fashion as their water contents decreased. Some problems of the procedure are discussed.

Central venous access: techniques and indications in oncology.

PubMed

Marcy, Pierre-Yves

2008-10-01

Long lines can be inserted centrally or peripherally through patent veins into the central venous system down to the atrial caval junction. Traditionally surgeons, anesthetists, cardiologists and more recently interventional radiologists have been placing them using vein cutdown or percutaneous needle puncture techniques. Typical candidates for implanted venous catheters are cancer patients undergoing long-term chemotherapy. The most important issues, in addition to the patency of central veins and the history of previous indwelling catheters, pacewires or venous thrombosis, are the patient's performance status, body mass index, medical history and respiratory status, and the relevant technique. The present article will give an overview of the radiological and surgical implantation techniques and will highlight the impact of imaging means on the technical feasibility, assessment and treatment of device-related complications.

Broadband notch filter design for millimeter-wave plasma diagnostics.

PubMed

Furtula, V; Michelsen, P K; Leipold, F; Salewski, M; Korsholm, S B; Meo, F; Nielsen, S K; Stejner, M; Moseev, D; Johansen, T

2010-10-01

Notch filters are integrated in plasma diagnostic systems to protect millimeter-wave receivers from intensive stray radiation. Here we present a design of a notch filter with a center frequency of 140 GHz, a rejection bandwidth of ∼900 MHz, and a typical insertion loss below 2 dB in the passband of ±9 GHz. The design is based on a fundamental rectangular waveguide with eight cylindrical cavities coupled by T-junction apertures formed as thin slits. Parameters that affect the notch performance such as physical lengths and conductor materials are discussed. The excited resonance mode in the cylindrical cavities is the fundamental TE(11). The performance of the constructed filter is measured using a vector network analyzer monitoring a total bandwidth of 30 GHz. We compare the measurements with numerical simulations.

Enhancement of the anti-damping spin torque efficacy of platinum by interface modification

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, Minh-Hai; Pai, Chi-Feng; Nguyen, Kayla X.

2015-06-01

We report a strong enhancement of the efficacy of the spin Hall effect (SHE) of Pt for exerting anti-damping spin torque on an adjacent ferromagnetic layer by the insertion of ≈0.5 nm layer of Hf between a Pt film and a thin, ≤2 nm, Fe{sub 60}Co{sub 20}B{sub 20} ferromagnetic layer. This enhancement is quantified by measurement of the switching current density when the ferromagnetic layer is the free electrode in a magnetic tunnel junction. The results are explained as the suppression of spin pumping through a substantial decrease in the effective spin-mixing conductance of the interface, but without a concomitant reduction ofmore » the ferromagnet's absorption of the SHE generated spin current.« less

The Science of Detached Bridgman Growth and Solutocapillary Convection in Solid Solution Crystals

NASA Technical Reports Server (NTRS)

Szofran, F. R.; Volz, M. P.; Cobb, S. D.; Motakef, S.; Croell, A.; Dold, P.

2001-01-01

Bridgman and Float-zone crystal growth experiments are planned for NASA's First Materials Science Research Rack using the European Space Agency's Materials Science Laboratory with the Low Gradient Furnace (LGF) and Float Zone Furnace with Rotating Magnetic Field (FMF) inserts, respectively. Samples will include germanium and germanium-silicon alloys with up to 10 atomic percent silicon. The Bridgman part of the investigation includes detached growth samples and so there will be a solid-liquid-gas tri-junction in those experiments just as there will be in all float-zone experiments. There are other similarities as well as significant differences between the types of growth that will be discussed. The presentation will call attention to the reasons that experiments in microgravity will provide information unattainable from Earth-based experiments.

Influence of shifting positions of Ser, Thr, and Cys residues in prenisin on the efficiency of modification reactions and on the antimicrobial activities of the modified prepeptides.

PubMed

Lubelski, Jacek; Overkamp, Wout; Kluskens, Leon D; Moll, Gert N; Kuipers, Oscar P

2008-08-01

Since the recent discovery that the nisin modification and transport machinery can be used to produce and modify peptides unrelated to nisin, specific questions arose concerning the specificity of the modification enzymes involved and the limits of their promiscuity with respect to the dehydration and cyclization processes. The nisin leader peptide has been postulated to fulfill a recognition and binding function required for these modifications. Here, we investigated whether the relative positions of the modifiable residues in the nisin prepeptide, with respect to the leader peptide, could influence the efficiency of their modification. We conducted a systematic study on the insertion of one to four alanines in front of either ring A or ring D to change the "reading frame" of modifiable residues, resulting in altered distance and topology of the modifiable residues relative to the leader. The insertion of N-terminal and hinge-located Ala residues had only a modest influence on the modification efficiency, demonstrating that the "phasing" of these residues relative to the leader peptide is not a critical factor in determining modification. However, in all cases, but especially with the N-terminal insertions, the antimicrobial activities of the fully modified nisin species were decreased.

Translation regulation of mammalian selenoproteins.

PubMed

Vindry, Caroline; Ohlmann, Théophile; Chavatte, Laurent

2018-05-09

Interest in selenium research has considerably grown over the last decades owing to the association of selenium deficiencies with an increased risk of several human diseases, including cancers, cardiovascular disorders and infectious diseases. The discovery of a genetically encoded 21 st amino acid, selenocysteine, is a fascinating breakthrough in molecular biology as it is the first addition to the genetic code deciphered in the 1960s. Selenocysteine is a structural and functional analog of cysteine, where selenium replaces sulfur, and its presence is critical for the catalytic activity of selenoproteins. The insertion of selenocysteine is a non-canonical translational event, based on the recoding of a UGA codon in selenoprotein mRNAs, normally used as a stop codon in other cellular mRNAs. Two RNA molecules and associated partners are crucial components of the selenocysteine insertion machinery, the Sec-tRNA [Ser]Sec devoted to UGA codon recognition and the SECIS elements located in the 3'UTR of selenoprotein mRNAs. The translational UGA recoding event is a limiting stage of selenoprotein expression and its efficiency is regulated by several factors. The control of selenoproteome expression is crucial for redox homeostasis and antioxidant defense of mammalian organisms. In this review, we summarize current knowledge on the co-translational insertion of selenocysteine into selenoproteins, and its layers of regulation. Copyright © 2018. Published by Elsevier B.V.

Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

PubMed

Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

2014-08-01

The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Assessment of possible allergenicity of hypothetical ORFs in common food crops using current bioinformatic guidelines and its implications for the safety assessment of GM crops.

PubMed

Young, Gregory J; Zhang, Shiping; Mirsky, Henry P; Cressman, Robert F; Cong, Bin; Ladics, Gregory S; Zhong, Cathy X

2012-10-01

Before a genetically modified (GM) crop can be commercialized it must pass through a rigorous regulatory process to verify that it is safe for human and animal consumption, and to the environment. One particular area of focus is the potential introduction of a known or cross-reactive allergen not previously present within the crop. The assessment of possible allergenicity uses the guidelines outlined by the Food and Agriculture Organization (FAO) and World Health Organization's (WHO) Codex Alimentarius Commission (Codex) to evaluate all newly expressed proteins. Some regulatory authorities have broadened the scope of the assessment to include all DNA reading frames between stop codons across the insert and spanning the insert/genomic DNA junctions. To investigate the utility of this bioinformatic assessment, all naturally occurring stop-to-stop frames in the non-transgenic genomes of maize, rice, and soybean, as well as the human genome, were compared against the AllergenOnline (www.allergenonline.org) database using the Codex criteria. We discovered thousands of frames that exceeded the Codex defined threshold for potential cross-reactivity suggesting that evaluating hypothetical ORFs (stop-to-stop frames) has questionable value for making decisions on the safety of GM crops. Copyright © 2012 Elsevier Ltd. All rights reserved.

In vivo and in vitro disease modeling with CRISPR/Cas9.

PubMed

Kato, Tomoko; Takada, Shuji

2017-01-01

In the past few years, extensive progress has been made in the development of genome-editing technology. Among several genome-editing tools, the clustered regularly interspaced short palindrome repeat-associated Cas9 nuclease (CRISPR/Cas9) system is particularly widely used owing to the ease of sequence-specific nuclease construction and the highly efficient introduction of mutations. The CRISPR/Cas9 system was originally constructed to induce small insertion and deletion mutations, but various methods have been developed to introduce point mutations, deletions, insertions, chromosomal translocations and so on. These methods should be useful for the reconstruction of disease-causing mutations in cultured cell lines and living organisms to elucidate disease pathogenesis and for disease prevention, treatment and drug discovery. This review summarizes the current technical aspects of the CRISPR/Cas9 system for disease modeling in cultured cells and living organisms, mainly mice. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq.

PubMed

Barrick, Jeffrey E; Colburn, Geoffrey; Deatherage, Daniel E; Traverse, Charles C; Strand, Matthew D; Borges, Jordan J; Knoester, David B; Reba, Aaron; Meyer, Austin G

2014-11-29

Mutations that alter chromosomal structure play critical roles in evolution and disease, including in the origin of new lifestyles and pathogenic traits in microbes. Large-scale rearrangements in genomes are often mediated by recombination events involving new or existing copies of mobile genetic elements, recently duplicated genes, or other repetitive sequences. Most current software programs for predicting structural variation from short-read DNA resequencing data are intended primarily for use on human genomes. They typically disregard information in reads mapping to repeat sequences, and significant post-processing and manual examination of their output is often required to rule out false-positive predictions and precisely describe mutational events. We have implemented an algorithm for identifying structural variation from DNA resequencing data as part of the breseq computational pipeline for predicting mutations in haploid microbial genomes. Our method evaluates the support for new sequence junctions present in a clonal sample from split-read alignments to a reference genome, including matches to repeat sequences. Then, it uses a statistical model of read coverage evenness to accept or reject these predictions. Finally, breseq combines predictions of new junctions and deleted chromosomal regions to output biologically relevant descriptions of mutations and their effects on genes. We demonstrate the performance of breseq on simulated Escherichia coli genomes with deletions generating unique breakpoint sequences, new insertions of mobile genetic elements, and deletions mediated by mobile elements. Then, we reanalyze data from an E. coli K-12 mutation accumulation evolution experiment in which structural variation was not previously identified. Transposon insertions and large-scale chromosomal changes detected by breseq account for ~25% of spontaneous mutations in this strain. In all cases, we find that breseq is able to reliably predict structural variation with modest read-depth coverage of the reference genome (>40-fold). Using breseq to predict structural variation should be useful for studies of microbial epidemiology, experimental evolution, synthetic biology, and genetics when a reference genome for a closely related strain is available. In these cases, breseq can discover mutations that may be responsible for important or unintended changes in genomes that might otherwise go undetected.

Chromosome arm-specific BAC end sequences permit comparative analysis of homoeologous chromosomes and genomes of polyploid wheat

PubMed Central

2012-01-01

Background Bread wheat, one of the world’s staple food crops, has the largest, highly repetitive and polyploid genome among the cereal crops. The wheat genome holds the key to crop genetic improvement against challenges such as climate change, environmental degradation, and water scarcity. To unravel the complex wheat genome, the International Wheat Genome Sequencing Consortium (IWGSC) is pursuing a chromosome- and chromosome arm-based approach to physical mapping and sequencing. Here we report on the use of a BAC library made from flow-sorted telosomic chromosome 3A short arm (t3AS) for marker development and analysis of sequence composition and comparative evolution of homoeologous genomes of hexaploid wheat. Results The end-sequencing of 9,984 random BACs from a chromosome arm 3AS-specific library (TaaCsp3AShA) generated 11,014,359 bp of high quality sequence from 17,591 BAC-ends with an average length of 626 bp. The sequence represents 3.2% of t3AS with an average DNA sequence read every 19 kb. Overall, 79% of the sequence consisted of repetitive elements, 1.38% as coding regions (estimated 2,850 genes) and another 19% of unknown origin. Comparative sequence analysis suggested that 70-77% of the genes present in both 3A and 3B were syntenic with model species. Among the transposable elements, gypsy/sabrina (12.4%) was the most abundant repeat and was significantly more frequent in 3A compared to homoeologous chromosome 3B. Twenty novel repetitive sequences were also identified using de novo repeat identification. BESs were screened to identify simple sequence repeats (SSR) and transposable element junctions. A total of 1,057 SSRs were identified with a density of one per 10.4 kb, and 7,928 junctions between transposable elements (TE) and other sequences were identified with a density of one per 1.39 kb. With the objective of enhancing the marker density of chromosome 3AS, oligonucleotide primers were successfully designed from 758 SSRs and 695 Insertion Site Based Polymorphisms (ISBPs). Of the 96 ISBP primer pairs tested, 28 (29%) were 3A-specific and compared to 17 (18%) for 96 SSRs. Conclusion This work reports on the use of wheat chromosome arm 3AS-specific BAC library for the targeted generation of sequence data from a particular region of the huge genome of wheat. A large quantity of sequences were generated from the A genome of hexaploid wheat for comparative genome analysis with homoeologous B and D genomes and other model grass genomes. Hundreds of molecular markers were developed from the 3AS arm-specific sequences; these and other sequences will be useful in gene discovery and physical mapping. PMID:22559868

Production of transgenic chickens using an avian retroviral vector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kopchick, J.; Mills, E.; Rosenblum C.

1987-05-01

The authors efforts to insert genes into the chicken germ line are dependent upon the ability of exogenous avian retroviruses to infect chicken germ cells. They have used a transformation defective Schmidt Ruppin A strain of Rous Sarcoma Virus (RSV-SRA) in their initial experiments. The general protocol involved generating RSV-SRA viremic female chickens (Go), which shed exogenous virus via the oviduct. As the fertilized egg passes through the oviduct, embryonic cells are exposed to the virus. If the germ cell precursors are infected by the virus, offspring (G1) should be generated which are capable of passing the viral DNA tomore » the next generation (G2). Fifteen viremic G1 males were selected for breeding and progeny testing. Since male chickens do not congenitally pass retroviruses through semen, production of viremic G2 offspring indicates germ line DNA transmission. This is confirmed by DNA analysis of the experimental chickens. Using a specific probe for exogenous retrovirus, they have detected the presence of RSV-SRA DNA in viremic chickens. Southern DNA analysis revealed junction fragments for RSV-SRA DNA in viremic G2 chickens, but not in non-viremic siblings. Furthermore, DNA isolated from various tissues of a viremic G2 chicken showed an identical DNA junction fragment pattern, indicating all tissues were derived from the same embryonic cell which contained integrated provirus. To date they have generated 50 transgenic chickens.« less

Breakpoint Features of Genomic Rearrangements in Neuroblastoma with Unbalanced Translocations and Chromothripsis

PubMed Central

Daveau, Romain; Combaret, Valérie; Pierre-Eugène, Cécile; Cazes, Alex; Louis-Brennetot, Caroline; Schleiermacher, Gudrun; Ferrand, Sandrine; Pierron, Gaëlle; Lermine, Alban; Frio, Thomas Rio; Raynal, Virginie; Vassal, Gilles; Barillot, Emmanuel; Delattre, Olivier; Janoueix-Lerosey, Isabelle

2013-01-01

Neuroblastoma is a pediatric cancer of the peripheral nervous system in which structural chromosome aberrations are emblematic of aggressive tumors. In this study, we performed an in-depth analysis of somatic rearrangements in two neuroblastoma cell lines and two primary tumors using paired-end sequencing of mate-pair libraries and RNA-seq. The cell lines presented with typical genetic alterations of neuroblastoma and the two tumors belong to the group of neuroblastoma exhibiting a profile of chromothripsis. Inter and intra-chromosomal rearrangements were identified in the four samples, allowing in particular characterization of unbalanced translocations at high resolution. Using complementary experiments, we further characterized 51 rearrangements at the base pair resolution that revealed 59 DNA junctions. In a subset of cases, complex rearrangements were observed with templated insertion of fragments of nearby sequences. Although we did not identify known particular motifs in the local environment of the breakpoints, we documented frequent microhomologies at the junctions in both chromothripsis and non-chromothripsis associated breakpoints. RNA-seq experiments confirmed expression of several predicted chimeric genes and genes with disrupted exon structure including ALK, NBAS, FHIT, PTPRD and ODZ4. Our study therefore indicates that both non-homologous end joining-mediated repair and replicative processes may account for genomic rearrangements in neuroblastoma. RNA-seq analysis allows the identification of the subset of abnormal transcripts expressed from genomic rearrangements that may be involved in neuroblastoma oncogenesis. PMID:23991058

Prediction of the mid-tracheal level using surface anatomical landmarks in adults

PubMed Central

Jang, Young-Eun; Kim, Eun-Hee; Song, In-Kyung; Lee, Ji-Hyun; Ryu, Ho-Geoul; Kim, Hee-Soo; Kim, Jin-Tae

2017-01-01

Abstract Endotracheal tube (ETT) should be placed at the optimal level to avoid single lung ventilation or accidental extubation. This study was performed to estimate the mid-tracheal level by using surface anatomical landmarks in adult patients. Neck computed tomography images of 329 adult patients between the ages of 16 and 79 years were reviewed. In the midline sagittal plane, the levels corresponding to the vocal cords, cricoid cartilage, suprasternal notch, manubriosternal junction, and carina were identified. The surface distances from the cricoid cartilage to the suprasternal notch (extCC-SSN) and that from the suprasternal notch to the manubriosternal junction (extSSN-MSJ) were measured. The relationship between mid-tracheal level and the surface distances was analyzed using Bland–Altman plot. The difference between the extCC-SSN and the mid-tracheal level was −6.6 (12.5) mm, and the difference between the extSSN-MSJ and the mid-tracheal level was −19.2 (6.1) mm. The difference between the extCC-SSN and the mid-tracheal level was smaller in females compared with males [−1.7 (11.7) mm vs −12.8 (10.7) mm; P < 0.001]. The mid-tracheal level, which is helpful in planning the insertion depth of an ETT, can be predicted by the surface distance between the cricoid cartilage and suprasternal notch in adults, especially in females. PMID:28328810

Numerical Computation of Electric Field and Potential Along Silicone Rubber Insulators Under Contaminated and Dry Band Conditions

NASA Astrophysics Data System (ADS)

Arshad; Nekahi, A.; McMeekin, S. G.; Farzaneh, M.

2016-09-01

Electrical field distribution along the insulator surface is considered one of the important parameters for the performance evaluation of outdoor insulators. In this paper numerical simulations were carried out to investigate the electric field and potential distribution along silicone rubber insulators under various polluted and dry band conditions. Simulations were performed using commercially available simulation package Comsol Multiphysics based on the finite element method. Various pollution severity levels were simulated by changing the conductivity of pollution layer. Dry bands of 2 cm width were inserted at the high voltage end, ground end, middle part, shed, sheath, and at the junction of shed and sheath to investigate the effect of dry band location and width on electric field and potential distribution. Partial pollution conditions were simulated by applying pollution layer on the top and bottom surface respectively. It was observed from the simulation results that electric field intensity was higher at the metal electrode ends and at the junction of dry bands. Simulation results showed that potential distribution is nonlinear in the case of clean and partially polluted insulator and linear for uniform pollution layer. Dry band formation effect both potential and electric field distribution. Power dissipated along the insulator surface and the resultant heat generation was also studied. The results of this study could be useful in the selection of polymeric insulators for contaminated environments.

A comparitive clinical study between self tapping and drill free screws as a source of rigid orthodontic anchorage.

PubMed

Gupta, Nishant; Kotrashetti, S M; Naik, Vijay

2012-03-01

Self-tapping miniscrews are commonly being used as a temporary anchorage device for orthodontic purpose. A prerequisite for the insertion of these screws is the preparation of a pilot hole, which is time consuming and may result in damage to nerves, tooth root, drill bit breakage and thermal necrosis of bone. On the other hand the design of drill-free screws enables them to be inserted without drilling. The aim of this prospective study was to compare the stability and clinical response of the soft tissue around the self tapping and drill free screws when used for orthodontic anchorage for en mass retraction of maxillary anterior teeth. The study sample consisted of 20 patients requiring retraction of maxillary anterior teeth. The screws were placed in the alveolar bone between maxillary 2nd premolar and 1st molar bilaterally at the junction of attached gingiva and moveable mucosa. Pilot hole was drilled on the side which was selected for insertion of the self tapping screw under copious irrigation, after which it was inserted. Drill free screw was inserted on the contralateral side without predrilling. All screws were immediately loaded with 150-200 gm of retraction force. Patients were recalled for regular follow up for a period of 6 months. If the screws became mobile or showed any signs of inflammation during the course of the study, they were considered to be a failure. After a period of 6 months an overall success rate of 77.5% was noted. Four self tapping and five drill-free screws failed during the study. There was no statistically significant difference between the two types of screws with respect to success/failure. Mobility was found to be the major cause for the failure. Both self-tapping and the drill-free screws are effective anchorage units. But the latter have an edge over the conventional self-tapping screws because of decrease in operative time, little bone debris, less thermal damage, lower morbidity, and minimal patient discomfort as predrilling is not required, thus they can be used as a viable alternative. But self-tapping screws are still recommended for areas with high bone density and thick cortical bone.

Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot

NASA Technical Reports Server (NTRS)

Su, L.; Chen, L.; Egli, M.; Berger, J. M.; Rich, A.

1999-01-01

Many viruses regulate translation of polycistronic mRNA using a -1 ribosomal frameshift induced by an RNA pseudoknot. A pseudoknot has two stems that form a quasi-continuous helix and two connecting loops. A 1.6 A crystal structure of the beet western yellow virus (BWYV) pseudoknot reveals rotation and a bend at the junction of the two stems. A loop base is inserted in the major groove of one stem with quadruple-base interactions. The second loop forms a new minor-groove triplex motif with the other stem, involving 2'-OH and triple-base interactions, as well as sodium ion coordination. Overall, the number of hydrogen bonds stabilizing the tertiary interactions exceeds the number involved in Watson-Crick base pairs. This structure will aid mechanistic analyses of ribosomal frameshifting.

Measuring Water Potential (Activity) from Free Water to Oven Dryness 1

PubMed Central

Wiebe, Herman H.

1981-01-01

Water activities (potentials) in plant materials were measured over the range from free water to oven dryness with a Spanner thermocouple psychrometer. In a two-step procedure, water was first condensed on the thermocouple junction for several minutes. The sample was then inserted under the wet thermocouple and the maximum psychrometric cooling was measured in about 10 seconds. Calibration was with saturated salt slurries of known water activities. Psychrometric cooling was a nearly linear function of the water activity and of the negative log of the water potential. The psychrometric cooling to water activity relationship agreed with wetbulb temperature depression to relative humidity relationships given in tables. Water activities of wheat grains and leaves decreased sharply in a curvilinear fashion as their water contents decreased. Some problems of the procedure are discussed. Images PMID:16662081

Site-specificity of abnormal excision: the mechanism of formation of a specialized transducing bacteriophage lambda plac5.

PubMed Central

Shpakovski, G V; Berlin, Y A

1984-01-01

Molecular mechanism of the specialized transducing bacteriophage lambda plac5 formation has been studied. Phage-bacterial DNA junctions in lambda plac5 DNA are localized and primary structure of regions of the abnormal excisional recombination leading to the phage formation is elucidated; the crossover region proved to be comparable with the central part of attP and attB sites (the core and the adjacent tetranucleotide) in length and degree of homology. Bacterial insert in lambda plac5 DNA is shown to end immediately after Z-Y spacer, the DNA not containing lacY gene segments. The data obtained led to the conclusion of site-specific (homologous) character of abnormal excision upon formation of lambda transducing bacteriophages. Possible mechanisms of the excision are discussed. Images PMID:6091038

Precise Maps of RNA Polymerase Reveal How Promoters Direct Initiation and Pausing

PubMed Central

Kwak, Hojoong; Fuda, Nicholas J.; Core, Leighton J.; Lis, John T.

2014-01-01

Transcription regulation occurs frequently through promoter-associated pausing of RNA polymerase II (Pol II). We developed a Precision nuclear Run-On and sequencing assay (PRO-seq) to map the genome-wide distribution of transcriptionally-engaged Pol II at base-pair resolution. Pol II accumulates immediately downstream of promoters, at intron-exon junctions that are efficiently used for splicing, and over 3' poly-adenylation sites. Focused analyses of promoters reveal that pausing is not fixed relative to initiation sites nor is it specified directly by the position of a particular core promoter element or the first nucleosome. Core promoter elements function beyond initiation, and when optimally positioned they act collectively to dictate the position and strength of pausing. We test this ‘Complex Interaction’ model with insertional mutagenesis of the Drosophila Hsp70 core promoter. PMID:23430654

Stepwise Synthesis of Giant Unilamellar Vesicles on a Microfluidic Assembly Line

PubMed Central

2011-01-01

Among the molecular milieu of the cell, the membrane bilayer stands out as a complex and elusive synthetic target. We report a microfluidic assembly line that produces uniform cellular compartments from droplet, lipid, and oil/water interface starting materials. Droplets form in a lipid-containing oil flow and travel to a junction where the confluence of oil and extracellular aqueous media establishes a flow-patterned interface that is both stable and reproducible. A triangular post mediates phase transfer bilayer assembly by deflecting droplets from oil, through the interface, and into the extracellular aqueous phase to yield a continuous stream of unilamellar phospholipid vesicles with uniform and tunable size. The size of the droplet precursor dictates vesicle size, encapsulation of small-molecule cargo is highly efficient, and the single bilayer promotes functional insertion of a bacterial transmembrane pore. PMID:21309555

A reinterpretation of certain disorders affecting the eye muscles and their tissues

PubMed Central

Poonyathalang, Anuchit; Khanna, Sangeeta; Leigh, R John

2007-01-01

Recent discoveries about the orbital tissues prompt a re-evaluation of the way that clinicians think about disorders affecting the extraocular muscles, their nerves and motoneurons in the brainstem. The revolutionary discovery that the orbital layers of the extraocular muscles insert not onto the eyeball, but into fibromuscular pulleys that guide the orbital layers, provides explanations for the kinematic properties of eye rotations and clinical findings in some patients with strabismus. The demonstration that all extraocular fibers types, except pale global fibers, lack synaptic folding provides an explanation for why saccades may remain fast in patients with limited ocular mobility due to myasthenia gravis. More than one mechanism may account for the observation that patients with disorders affecting the eye muscles or their nerves can present with the appearance of central disorders of ocular motility, such as internuclear ophthalmoplegia. New approaches to analyzing saccades in patients with disjunctive eye movements provide the means to identify disorders affecting the peripheral or central components of the ocular motor system, or both. PMID:19668518

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

The Role of the Acid Pocket in Gastroesophageal Reflux Disease.

PubMed

Mitchell, David R; Derakhshan, Mohammad H; Robertson, Elaine V; McColl, Kenneth E L

2016-02-01

Gastroesophageal reflux disease is one of the commonest chronic conditions in the western world and its prevalence is increasing worldwide. The discovery of the acid pocket explained the paradox of acid reflux occurring more frequently in the postprandial period despite intragastric acidity being low due to the buffering effect of the meal. The acid pocket was first described in 2001 when it was detected as an area of low pH immediately distal to the cardia using dual pH electrode pull-through studies 15 minutes after a meal. It was hypothesized that there was a local pocket of acid close to the gastroesophageal junction that escapes the buffering effect of the meal, and that this is the source of postprandial acidic reflux. The presence of the acid pocket has been confirmed in other studies using different techniques including high-resolution pHmetry, Bravo capsule, magnetic resonance imaging, and scintigraphy. This review aims to describe what we know about the acid pocket including its length, volume, fluid constituents, and its relationship to the lower esophageal sphincter and squamocolumnar junction. We will discuss the possible mechanisms that lead to the formation of the acid pocket and examine what differences exist in patients who suffer from acid reflux. Treatments for reflux disease that affect the acid pocket will also be discussed.

Neuromuscular Junction Formation between Human Stem cell-derived Motoneurons and Human Skeletal Muscle in a Defined System

PubMed Central

Guo, Xiufang; Gonzalez, Mercedes; Stancescu, Maria; Vandenburgh, Herman; Hickman, James

2011-01-01

Functional in vitro models composed of human cells will constitute an important platform in the next generation of system biology and drug discovery. This study reports a novel human-based in vitro Neuromuscular Junction (NMJ) system developed in a defined serum-free medium and on a patternable non-biological surface. The motoneurons and skeletal muscles were derived from fetal spinal stem cells and skeletal muscle stem cells. The motoneurons and skeletal myotubes were completely differentiated in the co-culture based on morphological analysis and electrophysiology. NMJ formation was demonstrated by phase contrast microscopy, immunocytochemistry and the observation of motoneuron-induced muscle contractions utilizing time lapse recordings and their subsequent quenching by D-Tubocurarine. Generally, functional human based systems would eliminate the issue of species variability during the drug development process and its derivation from stem cells bypasses the restrictions inherent with utilization of primary human tissue. This defined human-based NMJ system is one of the first steps in creating functional in vitro systems and will play an important role in understanding NMJ development, in developing high information content drug screens and as test beds in preclinical studies for spinal or muscular diseases/injuries such as muscular dystrophy, Amyotrophic lateral sclerosis and spinal cord repair. PMID:21944471

Neuromuscular junction formation between human stem cell-derived motoneurons and human skeletal muscle in a defined system.

PubMed

Guo, Xiufang; Gonzalez, Mercedes; Stancescu, Maria; Vandenburgh, Herman H; Hickman, James J

2011-12-01

Functional in vitro models composed of human cells will constitute an important platform in the next generation of system biology and drug discovery. This study reports a novel human-based in vitro Neuromuscular Junction (NMJ) system developed in a defined serum-free medium and on a patternable non-biological surface. The motoneurons and skeletal muscles were derived from fetal spinal stem cells and skeletal muscle stem cells. The motoneurons and skeletal myotubes were completely differentiated in the co-culture based on morphological analysis and electrophysiology. NMJ formation was demonstrated by phase contrast microscopy, immunocytochemistry and the observation of motoneuron-induced muscle contractions utilizing time-lapse recordings and their subsequent quenching by d-Tubocurarine. Generally, functional human based systems would eliminate the issue of species variability during the drug development process and its derivation from stem cells bypasses the restrictions inherent with utilization of primary human tissue. This defined human-based NMJ system is one of the first steps in creating functional in vitro systems and will play an important role in understanding NMJ development, in developing high information content drug screens and as test beds in preclinical studies for spinal or muscular diseases/injuries such as muscular dystrophy, Amyotrophic lateral sclerosis and spinal cord repair. Copyright © 2011 Elsevier Ltd. All rights reserved.

A nucleator arms race: cellular control of actin assembly.

PubMed

Campellone, Kenneth G; Welch, Matthew D

2010-04-01

For over a decade, the actin-related protein 2/3 (ARP2/3) complex, a handful of nucleation-promoting factors and formins were the only molecules known to directly nucleate actin filament formation de novo. However, the past several years have seen a surge in the discovery of mammalian proteins with roles in actin nucleation and dynamics. Newly recognized nucleation-promoting factors, such as WASP and SCAR homologue (WASH), WASP homologue associated with actin, membranes and microtubules (WHAMM), and junction-mediating regulatory protein (JMY), stimulate ARP2/3 activity at distinct cellular locations. Formin nucleators with additional biochemical and cellular activities have also been uncovered. Finally, the Spire, cordon-bleu and leiomodin nucleators have revealed new ways of overcoming the kinetic barriers to actin polymerization.

New transmitters and new targets in the autonomic nervous system.

PubMed

Barajas-López, C; Huizinga, J D

1993-12-01

Several recent findings have made research into the autonomic nervous system even more exciting, such as the revelation that nitric oxide is a major neurotransmitter, the delineation of the physiological roles for purines and vasoactive intestinal peptide, and the discovery that the interstitial cells of Cajal are major target cells for enteric innervation. Nitric oxide is probably the major neurotransmitter evoking inhibitory junction potentials in smooth muscle. ATP is a mediator of non-adrenergic non-cholinergic enteric innervation, as well as being a fast neurotransmitter in peripheral and autonomic neuro-neuronal synapses. The interactions between enteric nerves and both immune cells and interstitial cells of Cajal (as pacemaker cells of gut smooth muscle) are forcing a rethink of many aspects of gut physiology.

ASC Induces Apoptosis via Activation of Caspase-9 by Enhancing Gap Junction-Mediated Intercellular Communication

PubMed Central

Hida, Shigeaki; Fujii, Chifumi; Taniguchi, Shun’ichiro; Ito, Kensuke; Matsumura, Tomio; Okada, Nagisa; Sakaizawa, Takashi; Kobayashi, Akira; Takeoka, Michiko; Miyagawa, Shin-ichi

2017-01-01

ASC (apoptosis-associated speck-like protein containing a CARD) is a key adaptor molecule of inflammasomes that mediates inflammatory and apoptotic signals. Aberrant methylation-induced silencing of ASC has been observed in a variety of cancer cells, thus implicating ASC in tumor suppression, although this role remains incompletely defined especially in the context of closely neighboring cell proliferation. As ASC has been confirmed to be silenced by abnormal methylation in HT1080 fibrosarcoma cells as well, this cell line was investigated to characterize the precise role and mechanism of ASC in tumor progression. The effects of ASC were examined using in vitro cell cultures based on comparisons between low and high cell density conditions as well as in a xenograft murine model. ASC overexpression was established by insertion of the ASC gene into pcDNA3 and pMX-IRES-GFP vectors, the latter being packed into a retrovirus and subjected to reproducible competitive assays using parental cells as an internal control, for evaluation of cell viability. p21 and p53 were silenced using shRNA. Cell viability was suppressed in ASC-expressing transfectants as compared with control cells at high cell density conditions in in vitro culture and colony formation assays and in in vivo ectopic tumor formation trials. This suppression was not detected in low cell density conditions. Furthermore, remarkable progression of apoptosis was observed in ASC-introduced cells at a high cell density, but not at a low one. ASC-dependent apoptosis was mediated not by p21, p53, or caspase-1, but rather by cleavage of caspase-9 as well as by suppression of the NF-κB-related X-linked inhibitor-of-apoptosis protein. Caspase-9 cleavage was observed to be dependent on gap junction formation. The remarkable effect of ASC on the induction of apoptosis through caspase-9 and gap junctions revealed in this study may lead to promising new approaches in anticancer therapy. PMID:28056049

How to secure the connection between thoracostomy tube and drainage system?

PubMed

Li, Ka Ki Pat; Wong, Kit Shing John; Wong, Yau Hang Henry; Cheng, Ka Lok; So, Fung Ling; Lau, Chu Leung; Kam, Chak Wah

2014-01-01

Thoracostomy tube insertion is one of the common bedside procedures in emergency medicine and many acute specialties. Dislodgement of thoracostomy tube from the connection tube of chest drainage system is an important problem with potential complications such as contamination, infection and pneumothorax. Besides, mere loosening can also lead to malfunction. It is a common practice to tape the connection of the system. This study aimed to evaluate the materials and methods of connection of chest drain system to minimize drainage dislodgement. We conducted an experimental study to assess the tightness of the connection with various taping materials and methods. We selected three commonly used adhesive materials (3M™ Transpore™ Medical tape, 3M™ Micropore™ Medical tape, 3M™ Soft Cloth Tape on Liner) and three different methods (cross method, straight method, nylon band) to secure the junction between the thoracostomy tube and the bi-conical adaptor in the drainage system. The measured outcome was the weight causing visible loosening of the junction between thoracotomy tube and the adaptor. For each taping material and taping method, 10 trials were performed. The median weight required to disconnect the junction is 26.22 lb for Transpore™, 31.29 lb for Micropore™ and 32.44 lb for Soft Cloth Tape on Liner. A smaller force was required to disconnect if Transpore™ is used (P<0.001). There was no statistical significant difference between Micropore™ and Soft Cloth Tape on Liner (P=0.98). The median disconnecting force is 32.44 lb for straight taping method, 40.55 lb for cross taping method and 21.15 lb for plastic band. The cross-taping method was the more secure method (P<0.0001 when compared with plastic band) (P=0.033 when compared with straight method). Cross-taping is the most secure method among the tested varieties in connecting the thoracostomy tube to the chest drainage system. Transpore™ is not a recommended material for thoracostomy tube taping.

Adaptive properties of human cementum and cementum dentin junction with age

PubMed Central

Jang, Andrew T.; Lin, Jeremy D.; Choi, Ryan M.; Choi, Erin M.; Seto, Melanie L.; Ryder, Mark I.; Gansky, Stuart A.; Curtis, Donald A.; Ho, Sunita P.

2014-01-01

Objectives The objective of this study was to evaluate age related changes age related changes in physical (structure/mechanical properties) and chemical (elemental/inorganic mineral content) properties of cementum layers interfacing dentin. Methods Human mandibular molars (N=43) were collected and sorted by age (younger = 19–39, middle = 40–60, older = 61–81 years). The structures of primary and secondary cementum (PC, SC) types were evaluated using light and atomic force microscopy (AFM) techniques. Chemical composition of cementum layers were characterized through gravimetric analysis by estimating ash weight and concentrations of Ca, Mn, and Zn trace elements in the analytes through inductively coupled plasma mass spectroscopy. The hardness of PC and SC was determined using microindentation and site-specific reduced elastic modulus properties were determined using nanoindentation techniques. Results PC contained fibrous, 1–3 µm wide hygroscopic radial PDL-inserts. SC illustrated PC-like structure adjacent to a multilayered architecture composing of regions that contained mineral dominant lamellae. The width of cementum dentin junction (CDJ) decreased as measured from cementum enamel junction (CEJ) to the tooth apex (49–21µm), and significantly decreased with age (44–23µm; p<0.05). The inorganic ratio defined as the ratio of post-burn to pre-burn increased with age within primary cementum (PC) and secondary cementum (SC). Cementum showed an increase in hardness with age (PC (0.40–0.46GPa), SC (0.37–0.43GPa)), while dentin showed a decreasing trend (coronal dentin (0.70–0.72GPa); apical dentin (0.63 – 0.73 GPa)). Significance The observed physicochemical changes are indicative of an increased mineralization of cementum and CDJ over time. Changes in tissue properties of the teeth can alter overall tooth biomechanics, and in turn the entire bone-tooth complex including the periodontal ligament. This study provides baseline information about the changes in physicochemical properties of cementum with age, which can be identified as adaptive in nature. PMID:25133753

Unearthing the Fossorial Tadpoles of the Indian Dancing Frog Family Micrixalidae.

PubMed

Senevirathne, Gayani; Garg, Sonali; Kerney, Ryan; Meegaskumbura, Madhava; Biju, S D

2016-01-01

Tadpoles of the monotypic Indian dancing frog family Micrixalidae have remained obscure for over 125 years. Here we report the discovery of the elusive tadpoles of Micrixalus herrei from the sand beds of a forested stream in southern Western Ghats, and confirm their identity through DNA barcoding. These actively burrowing tadpoles lead an entirely fossorial life from eggs to late metamorphic stages. We describe their internal and external morphological characters while highlighting the following features: eel-like appearance, extensively muscularized body and tail, reduced tail fins, skin-covered eyes, delayed development of eye pigmentation in early pre-metamorphic stages (Gosner stages 25-29), prominent tubular sinistral spiracle, large transverse processes on vertebrae II and III, ankylosed ribs on transverse processes of vertebra II, notochord terminating before the atlantal cotyle-occipital condyle junction, absence of keratodonts, serrated well-formed jaw sheaths, and extensive calcified endolymphatic sacs reaching sacrum posteriorly. The tadpole gut contains mostly fine sediments and sand. We discuss the eel-like morphology and feeding habits of M. herrei in the context of convergence with other well-known fossorial tadpoles. This discovery builds the knowledge base for further comparative analyses and conservation of Micrixalus, an ancient and endemic lineage of Indian frogs.

Contribution of transposable elements in the plant's genome.

PubMed

Sahebi, Mahbod; Hanafi, Mohamed M; van Wijnen, Andre J; Rice, David; Rafii, M Y; Azizi, Parisa; Osman, Mohamad; Taheri, Sima; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat; Noor, Yusuf Muhammad

2018-07-30

Plants maintain extensive growth flexibility under different environmental conditions, allowing them to continuously and rapidly adapt to alterations in their environment. A large portion of many plant genomes consists of transposable elements (TEs) that create new genetic variations within plant species. Different types of mutations may be created by TEs in plants. Many TEs can avoid the host's defense mechanisms and survive alterations in transposition activity, internal sequence and target site. Thus, plant genomes are expected to utilize a variety of mechanisms to tolerate TEs that are near or within genes. TEs affect the expression of not only nearby genes but also unlinked inserted genes. TEs can create new promoters, leading to novel expression patterns or alternative coding regions to generate alternate transcripts in plant species. TEs can also provide novel cis-acting regulatory elements that act as enhancers or inserts within original enhancers that are required for transcription. Thus, the regulation of plant gene expression is strongly managed by the insertion of TEs into nearby genes. TEs can also lead to chromatin modifications and thereby affect gene expression in plants. TEs are able to generate new genes and modify existing gene structures by duplicating, mobilizing and recombining gene fragments. They can also facilitate cellular functions by sharing their transposase-coding regions. Hence, TE insertions can not only act as simple mutagens but can also alter the elementary functions of the plant genome. Here, we review recent discoveries concerning the contribution of TEs to gene expression in plant genomes and discuss the different mechanisms by which TEs can affect plant gene expression and reduce host defense mechanisms. Copyright © 2018 Elsevier B.V. All rights reserved.

Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

PubMed

Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

2018-01-01

Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use the resulting information to derive a consensus atomic structure that is then subjected to rigorous validation. In this paper, we summarize our efforts to obtain and validate atomic models of the open and voltage-driven closed states of undocked connexin hemichannels. This article is part of a Special Issue entitled: Gap Junction Proteins edited by Jean Claude Herve. Copyright © 2017 Elsevier B.V. All rights reserved.

RF Reference Switch for Spaceflight Radiometer Calibration

NASA Technical Reports Server (NTRS)

Knuble, Joseph

2013-01-01

The goal of this technology is to provide improved calibration and measurement sensitivity to the Soil Moisture Active Passive Mission (SMAP) radiometer. While RF switches have been used in the past to calibrate microwave radiometers, the switch used on SMAP employs several techniques uniquely tailored to the instrument requirements and passive remote-sensing in general to improve radiometer performance. Measurement error and sensitivity are improved by employing techniques to reduce thermal gradients within the device, reduce insertion loss during antenna observations, increase insertion loss temporal stability, and increase rejection of radar and RFI (radio-frequency interference) signals during calibration. The two legs of the single-pole double-throw reference switch employ three PIN diodes per leg in a parallel-shunt configuration to minimize insertion loss and increase stability while exceeding rejection requirements at 1,413 MHz. The high-speed packaged diodes are selected to minimize junction capacitance and resistance while ensuring the parallel devices have very similar I-V curves. Switch rejection is improved by adding high-impedance quarter-wave tapers before and after the diodes, along with replacing the ground via of one diode per leg with an open circuit stub. Errors due to thermal gradients in the switch are reduced by embedding the 50-ohm reference load within the switch, along with using a 0.25-in. (approximately equal to 0.6-cm) aluminum prebacked substrate. Previous spaceflight microwave radiometers did not embed the reference load and thermocouple directly within the calibration switch. In doing so, the SMAP switch reduces error caused by thermal gradients between the load and switch. Thermal issues are further reduced by moving the custom, highspeed regulated driver circuit to a physically separate PWB (printed wiring board). Regarding RF performance, previous spaceflight reference switches have not employed high-impedance tapers to improve rejection. The use of open-circuit stubs instead of a via to provide an improved RF short is unique to this design. The stubs are easily tunable to provide high rejection at specific frequencies while maintaining very low insertion loss in-band.

Additional Surgical Method Aimed to Increase Distractive Force during Occipitocervical Stabilization : Technical Note.

PubMed

Antar, Veysel; Turk, Okan

2018-03-01

Craniovertebral junctional anomalies constitute a technical challenge. Surgical opening of atlantoaxial joint region is a complex procedure especially in patients with nuchal deformity like basilar invagination. This region has actually very complicated anatomical and functional characteristics, including multiple joints providing extension, flexion, and wide rotation. In fact, it is also a bottleneck region where bones, neural structures, and blood vessels are located. Stabilization surgery regarding this region should consider the fact that the area exposes excessive and life-long stress due to complex movements and human posture. Therefore, all options should be considered for surgical stabilization, and they could be interchanged during the surgery, if required. A 53-year-old male patient applied to outpatients' clinic with complaints of head and neck pain persisting for a long time. Physical examination was normal except increased deep tendon reflexes. The patient was on long-term corticosteroid due to an allergic disease. Magnetic resonance imaging and computed tomography findings indicated basilar invagination and atlantoaxial dislocation. The patient underwent C0-C3-C4 (lateral mass) and additional C0-C2 (translaminar) stabilization surgery. In routine practice, the sites where rods are bound to occipital plates were placed as paramedian. Instead, we inserted lateral mass screw to the sites where occipital screws were inserted on the occipital plate, thereby creating a site where extra rod could be bound. When C2 translaminar screw is inserted, screw caps remain on the median plane, which makes them difficult to bind to contralateral system. These bind directly to occipital plate without any connection from this region to the contralateral system. Advantages of this technique include easy insertion of C2 translaminar screws, presence of increased screw sizes, and exclusion of pullout forces onto the screw from neck movements. Another advantage of the technique is the median placement of the rod; i.e., thick part of the occipital bone is in alignment with axial loading. We believe that this technique, which could be easily performed as adjuvant to classical stabilization surgery with no need for special screw and rod, may improve distraction force in patients with low bone density.

The Plasma Proton Environment within Saturn's inner magnetosphere as Observed by the Cassini Plasma Spectrometer (CAPS) during Saturn Orbit Insertion

NASA Astrophysics Data System (ADS)

Sittler, E. C., Jr.; Elrod, M. K.; Johnson, R. E.; Cooper, J. F.; Tseng, W. L.; Smith, H. T.; Chornay, D. J.; Shappirio, M.; Simpson, D. G.

2017-12-01

In analyzing the Cassini data between Saturn's A-ring outer edge and Mimas' L shell numerous inconsistencies have been reported in estimates of total ionic charge and electron density. The primary focus of our work is to understand these inconsistencies. We present our recent discovery of plasma protons during Saturn Orbit Insertion (SOI) outbound pass of the magnetospheric region between the F and G rings. We also searched for H2+ ions but no such events were found. The discovery of protons was made possible by a recent analysis of the CAPS Ion Mass Spectrometer's (IMS's) time-of-flight (TOF) composition data in a mode of reduced post-acceleration voltage at 6 kV instead of the usual 14.6 kV. All previous work for this region had not considered the TOF data. The new proton analysis was enabled by minimum scattering of 6 kV protons in the instrument's ultrathin carbon foils (CF), in comparison to larger scattering for the heavier ions such as for O+ and O2+. We use a SIMION model of the CAPS IMS including the effects of energy straggling and scattering by the instrument's CFs in an attempt to understand the TOF composition data for the heavier ions. This analysis within the uncertainties of the instrument allows us to estimate the relative abundances of the heavier ions and thus run our 2D velocity ion moments code to get ion densities, temperatures and velocities during the SOI outbound pass through the F-ring and G-ring gap. Comparisons with other data sets will be made.

Lensless, ultra-wideband fiber optic rotary joint for biomedical applications.

PubMed

Kim, Wihan; Chen, Xi; Jo, Javier A; Applegate, Brian E

2016-05-01

The demands of optical fiber-based biomedical applications can, in many cases, outstrip the capabilities of lens-based commercially available fiber optic rotary joints. In some circumstances, it is necessary to use very broad spectral bandwidths (near UV to short-wave IR) and specialized optical fibers, such as double-clad fiber, and have the capacity to accommodate high rotational velocities. The broad spectrum, stretching down into the UV, presents two problems: (1) adequate chromatic correction in the lenses across the entire bandwidth and (2) strong UV absorption by the fluids used to lubricate the rotary joint. To accommodate these types of applications, we have developed an ultra-wideband lensless fiber optic rotary joint based on the principle that when two optical fibers are coaligned and placed in contact (or very close), the optical losses at the junction are very low. The advances demonstrated here enable excellent performance (<0.2  dB insertion loss), even down into the UV and spanning a wavelength range of at least 355-1360 nm with single-mode, multimode, and double-clad fibers. We also demonstrate excellent performance, ∼0.38  dB insertion loss, at rotational velocities up to 8800 rpm (146 Hz). To the best of our knowledge, this is the first demonstration of this type of rotary joint capable of such a wide bandwidth and high rotational velocities.

Evaluation of Bar, Barnase, and Barstar recombinant proteins expressed in genetically engineered Brassica juncea (Indian mustard) for potential risks of food allergy using bioinformatics and literature searches.

PubMed

Siruguri, Vasanthi; Bharatraj, Dinesh Kumar; Vankudavath, Raju Naik; Mendu, Vishnu Vardhana Rao; Gupta, Vibha; Goodman, Richard E

2015-09-01

The potential allergenicity of Bar, Barnase, and Barstar recombinant proteins expressed in genetically engineered mustard for pollination control in plant breeding was evaluated for regulatory review. To evaluate the potential allergenicity of the Bar, Barnase and Barstar proteins amino acid sequence comparisons were made to those of known and putative allergens, and search for published evidence to the sources of the genes using the AllergenOnline.org database. Initial comparisons in 2012 were performed with version 12 by methods recommended by the Codex Alimentarius Commission and the Indian Council of Medical Research, Government of India. Searches were repeated with version 15 in 2015. A literature search was performed using PubMed to identify reports of allergy associated with the sources of the three transgenes. Potential open reading frames at the DNA insertion site were evaluated for matches to allergens. No significant sequence identity matches were identified with Bar, Barnase or Barstar proteins or potential fusion peptides at the genomic-insert junctions compared to known allergens. No references were identified that associated the sources of the genes with allergy. Based on these results we conclude that the Bar, Barnase and Barstar proteins are unlikely to present any significant risk of food allergy to consumers. Copyright © 2015 Elsevier Ltd. All rights reserved.

Percutaneous endoscopic colostomy of the left colon: a new technique for management of intractable constipation in children.

PubMed

Rawat, David J; Haddad, Munther; Geoghegan, Niamh; Clarke, Simon; Fell, John M

2004-07-01

The antegrade colonic enema is accepted as effective for management of intractable constipation in children when conventional bowel management has failed. This study describes experience with a new, minimally invasive technique, the distal antegrade colonic enema, which involves percutaneous endoscopic colostomy of the left colon. Fifteen children with refractory constipation and soiling who had radiographic evidence of megarectum and/or distal colonic delay were selected for the procedure. The junction of the descending and the sigmoid colon was identified colonoscopically, and the percutaneous endoscopic colostomy tube, through which antegrade distal colonic enema are administered, was inserted. Fourteen children underwent distal percutaneous endoscopic colostomy insertion. The median time required for the procedure was 30 minutes (20-50 minutes). Excluding one child (technical difficulties with percutaneous endoscopic colostomy placement), median post-procedural hospital stay was 4 days (2-27 days). Thirteen children were no longer soiling, and improvement in quality of life was reported at 2 months' follow-up. At 6 months' follow-up, 90% of children were clean during intervals between enemas. All children evaluated at 12 months' follow-up remained clean. Median duration of follow-up was 12.5 months (2-51 months). The distal percutaneous endoscopic colostomy is a simple alternative to established methods for delivery of antegrade enemas. It is less invasive and on reversal leaves only minor scarring.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maleux, Geert; Pirenne, Jacques; Vaninbroukx, Johan

Our purpose was to assess the feasibility of orthotopic liver transplantation (OLT) in patients priorly having undergone transjugular intrahepatic portosystemic shunt (TIPS) with an expanded tetrafluoroethylene (e-PTFE)-covered endoprosthesis. In 48 patients an e- PTFE-covered endoprosthesis was inserted to treat severe complications of portal hypertension. In 36 patients the endoprosthesis was inserted during TIPS creation (de novo TIPS); in the other 12 patients the endoprosthesis was placed to repermeabilize the previously created, but occluded bare stent (revision TIPS). Eight of them (5 de novo and 3 revision cases) later underwent an OLT. The hospital records of these patients were reviewed frommore » initial admission, through TIPS, the pre-OLT period, and OLT to current postoperative status. Five de novo and 3 revision cases underwent OLT 4-279 days (mean delay: 80.8 days) after TIPS procedure. All OLT's were performed under veno-venous bypass surgery. De visu surgical inspection confirmed correct positioning of the fully patent stent graft, starting in the portal vein and ending at the junction of the hepatic vein to the inferior caval vein. No surgical difficulty was observed during proximal or distal clamping or during resection of the diseased liver. Correctly positioned e-PTFE-covered nitinol endoprostheses do not interfere with a later OLT and may not be considered as a contraindication in patients who need a TIPS as a bridge to OLT.« less

Transformation of Chloroplast Ribosomal RNA Genes in Chlamydomonas: Molecular and Genetic Characterization of Integration Events

PubMed Central

Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.

1990-01-01

Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764

The developmental transcriptome of Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.

Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, predictionmore » and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes. Whereas, 20% of Drosophila genes are annotated as encoding alternatively spliced premRNAs, splice-junction microarray experiments indicate that this number is at least 40% (ref. 7). Determining the diversity of mRNAs generated by alternative promoters, alternative splicing and RNA editing will substantially increase the inferred protein repertoire. Non-coding RNA genes (ncRNAs) including short interfering RNAs (siRNAs) and microRNAS (miRNAs) (reviewed in ref. 10), and longer ncRNAs such as bxd (ref. 11) and rox (ref. 12), have important roles in gene regulation, whereas others such as small nucleolar RNAs (snoRNAs)and small nuclear RNAs (snRNAs) are important components of macromolecular machines such as the ribosome and spliceosome. The transcription and processing of these ncRNAs must also be fully documented and mapped. As part of the modENCODE project to annotate the functional elements of the D. melanogaster and Caenorhabditis elegans genomes, we used RNA-Seq and tiling microarrays to sample the Drosophila transcriptome at unprecedented depth throughout development from early embryo to ageing male and female adults. We report on a high-resolution view of the discovery, structure and dynamic expression of the D. melanogaster transcriptome.« less

Expressing genes do not forget their LINEs: transposable elements and gene expression

PubMed Central

Kines, Kristine J.; Belancio, Victoria P.

2012-01-01

1. ABSTRACT Historically the accumulated mass of mammalian transposable elements (TEs), particularly those located within gene boundaries, was viewed as a genetic burden potentially detrimental to the genomic landscape. This notion has been strengthened by the discovery that transposable sequences can alter the architecture of the transcriptome, not only through insertion, but also long after the integration process is completed. Insertions previously considered harmless are now known to impact the expression of host genes via modification of the transcript quality or quantity, transcriptional interference, or by the control of pathways that affect the mRNA life-cycle. Conversely, several examples of the evolutionary advantageous impact of TEs on the host gene structure that diversified the cellular transcriptome are reported. TE-induced changes in gene expression can be tissue-or disease-specific, raising the possibility that the impact of TE sequences may vary during development, among normal cell types, and between normal and disease-affected tissues. The understanding of the rules and abundance of TE-interference with gene expression is in its infancy, and its contribution to human disease and/or evolution remains largely unexplored. PMID:22201807

Diazo Reagents with Small Steric Footprints for Simultaneous Arming/SAR Studies of Alcohol-Containing Natural Products via O–H Insertion

PubMed Central

Chamni, Supakarn; He, Qing-Li; Dang, Yongjun; Bhat, Shridhar; Liu, Jun O.; Romo, Daniel

2011-01-01

Natural products are essential tools for basic cellular studies leading to the identification of medically relevant protein targets and the discovery of potential therapeutic leads. The development of methods that enable mild and selective derivatization of natural products continues to be of significant interest for mining their information-rich content. Herein, we describe novel diazo reagents for simultaneous arming and structure-activity relationship (SAR) studies of alcohol-containing natural products with a small steric footprint, namely an α-trifluoroethyl (HTFB) substituted reagent. The Rh(II)-catalyzed O–H insertion reaction of several natural products, including the potent translation inhibitor lactimidomycin, was investigated and useful reactivity and both chemo- and site (chemosite) selectivities were observed. Differential binding to the known protein targets of both FK506 and fumagillol was demonstrated, validating the advantage of the smaller steric footprint of trifluoroethyl derivatives. A p-azidophenyl diazo reagent is also described that will prove useful for photoaffinity labeling of low affinity small molecule protein receptors. PMID:21894934

Mechanotransductive Regulation of Gap-Junction Activity Between MLO-Y4 Osteocyte-Like and MC3T3-E1 Osteoblast-Like Cells in Three-Dimensional Co-Culture.

NASA Technical Reports Server (NTRS)

Juran, C. M.; Blaber, E. A.; Almeida, E. A. C.

2016-01-01

Cell and animal studies conducted onboard the International Space Station and formerly on Shuttle flights have provided groundbreaking data illuminating the deleterious biological response of bone to mechanical unloading. However the intercellular communicative mechanisms associated with the regulation of bone synthesis and bone resorption cells are still largely unknown. Connexin-43 (CX43), a gap junction protein, is hypothesized to play a significant role in osteoblast and osteocyte signaling. The purpose of this investigation was to evaluate within a novel three-dimensional microenvironment how the osteocyte-osteoblast gap-junction expression changes when cultures are exposed to exaggerated mechanical load. MLO-Y4 osteocyte-like cells were cultured on a 3D-Biotek polystyrene insert and placed in direct contact with an MC3T3-E1 pre-osteoblast co-cultured monolayer and exposed to 48 h of mechanical stimulation (pulsatile fluid flow (PFF) or monolayer cyclic stretch (MCS)) then evaluated for viability, proliferation, metabolism, and CX43 expression. Mono-cultured MLO-Y4 and MC3T3-E1 control experiments were conducted under PFF and MCS stimulation to observe how strain application stimuli (PFF cell membrane shear or MCS cell focal adhesion/attachment loading) initiates different signaling pathways or downstream regulatory controls. TotalLive cell count, viability and metabolic reduction (Trypan Blue, LIVEDead and Alamar Blue analysis respectively) indicate that mechanical activation of MC3T3-E1 cells inhibits proliferation while maintaining an average 1.04E4 reductioncell metabolic rate, *p0.05 n4. MLO-Y4s in monolayer culture increase in number when exposed to MCS loading but the percent of live cells within the population is low (46.3 total count, *p0.05 n4), these results may indicate an apoptotic signaling cascade. PFF stimulation of the three-dimensional co-cultures elicits a universal increase in CX43 in MLO-Y4 and MC3T3-E1 cells, illustrated by immunohistological observation. Increased CX43 expression is also observed with the three-dimensional co-cultures with MC3T3-E1 MCS stimulation but the increased gap-junction protein presence was limited to the osteoblast-osteocyte interface region. Previously reported PCR evaluation of osteogenic markers further corroborate that the co-cultured populations communicative networks play a role in translating mechanical signals to molecular messaging. These findings suggests an osteocyte-osteoblast gap-junction signaling feedback mechanism may regulate mechanotransduction of apoptosis initiation and transcription of cytokine signaling proteins responsible for stem cell niche recruitment much more directly than previously believed.

BOOK REVIEW: The Harvest of a Century: Discoveries of Modern Physics in 100 Episodes

NASA Astrophysics Data System (ADS)

Pisut, Ján

2009-07-01

The subtitle of the book is exact: the book presents an impression of the development of physics between 1895 (Röntgen's x-rays) and 2001 (Neutrinos have mass). Each episode describes a particular discovery in about five pages in an easily readable style. More demanding explanations are presented in inserted boxes. A nice feature of the book is that many episodes contain the original drawing of the scheme of the experiment, so that the reader can see how it really happened. For most of the past century, certainly for its first half, physics was the leading science and brought fundamental discoveries in the structure of matter, including the structure of nuclei and particles, and the structure of space-time. Most of the episodes in the book concern these two general fields. Among the episodes are the discoveries of radioactivity, the atomic nucleus, the structure of the atom, quantum mechanics, the theory of relativity, accelerators, superconductivity, superfluidity, nuclear reactions in stars, and also transistors, masers, lasers, black-body radiation of the Universe and Bose-Einstein condensation of atoms in traps amongst others. The author is to be congratulated for the selection of the 100 episodes, as it must have been a difficult task. The discovery of the structure of haemoglobin in Bragg's laboratory received only two lines, and there is no mention of the explanation of the chemical bond in hydrogen molecules or on the construction of fantastic medical instruments based on discoveries in physics. Perhaps there is scope in the future for another 100 episodes of discoveries in multidisciplinary fields where physics has played an essential role. Even some discoveries in pure physics could not be included, for instance, super-heavy nuclei. I would like to recommend this book to all those who like the history of physics and admire its achievements in the past century. In particular, I would also like to recommend it to teachers of introductory courses in atomic and nuclear physics at universities. The schemes of classical experiments in some of the episodes can be used to show how it really was, and material on the physicists themselves can be used for motivating students. Some of the episodes may also be useful for high-school students.

Circulation of spoof surface plasmon polaritons: Implementation and verification

NASA Astrophysics Data System (ADS)

Pan, Junwei; Wang, Jiafu; Qiu, Tianshuo; Pang, Yongqiang; Li, Yongfeng; Zhang, Jieqiu; Qu, Shaobo

2018-05-01

In this letter, we are dedicated to implementation and experimental verification of broadband circulator for spoof surface plasmon polaritons (SSPPs). For the ease of fabrication, a circulator operating in X band was firstly designed. The comb-like transmission lines (CL-TLs), a typical SSPP structure, are adopted as the three branches of the Y-junction. To enable broadband coupling of SSPP, a transition section is added on each end of the CL-TLs. Through such a design, the circulator can operate under the sub-wavelength SSPP mode in a broad band. The simulation results show that the insertion loss is less than 0.5dB while the isolation and return loss are higher than 20dB in 9.4-12.0GHz. A prototype was fabricated and measured. The experimental results are consistent with the simulation results and verify the broadband circulation performance in X band.

Mutation testing in Treacher Collins Syndrome.

PubMed

Ellis, P E; Dawson, M; Dixon, M J

2002-12-01

To report on a study where 97 subjects were screened for mutations in the Treacher Collins syndrome (TCS) gene TCOF1. Ninety-seven subjects with a clinical diagnosis of TCS were screened for potential mutations in TCOF1, by means of single strand conformation polymorphism (SSCP) analysis. In those subjects where potential mutations were detected, sequence analysis was performed to determine the site and type of mutation present. Thirty-six TCS-specific mutations are reported including 27 deletions, six point mutations, two splice junction mutations, and one insertion/deletion. This brings the total number of mutations reported to date to 105. The importance of detection of these mutations is mainly in postnatal diagnosis and genetic counselling. Knowledge of the family specific mutation may also be used in prenatal diagnosis to confirm whether the foetus is affected or not, and give the parents the choice of whether to continue with the pregnancy.

Instantaneous centers of rotation in dorsi/plantar flexion movements of posterior-type plastic ankle-foot orthoses.

PubMed

Sumiya, T; Suzuki, Y; Kasahara, T; Ogata, H

1997-07-01

Hingeless plastic ankle-foot orthoses (PAFOs) achieve ankle motion by flexing about the ankle joint. Instantaneous centers of rotation (ICRs) in dorsi- and plantarflexion movements, used as a measure of PAFO axes of movement, were measured to evaluate their fit to ankle motion. Thirty different PAFOs were fabricated and their stiffness modified in three stages. They were dorsi- and plantarflexed 16 degrees at 2 degrees-intervals using an original device. Displacement of two marks on the lateral calf-cuff were traced photographically, and ICRs were determined by plotting intersections of vertical bisectors for each displacement. The ICRs converged on the junction between the calf shell and the shoe insert. They deviated posteriorly from the anatomical ankle axis and caused the calf-cuff to move up-down during dorsi- and plantarflexion movements. However, this poor fit of the PAFO to ankle motion can be sufficiently compensated for by fastening straps more loosely.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dinh, Phat X.; Panda, Debasis; Das, Phani B.

Using a recombinant vesicular stomatitis virus encoding eGFP fused in-frame with an essential viral replication protein, the phosphoprotein P, we show that during passage in culture, the virus mutates the nucleotide C289 within eGFP of the fusion protein PeGFP to A or T, resulting in R97S/C amino acid substitution and loss of fluorescence. The resultant non-fluorescent virus exhibits increased fitness and growth advantage over its fluorescent counterpart. The growth advantage of the non-fluorescent virus appears to be due to increased transcription and replication activities of the PeGFP protein carrying the R97S/C substitution. Further, our results show that the R97S/C mutationmore » occurs prior to accumulation of mutations that can result in loss of expression of the gene inserted at the G-L gene junction. These results suggest that fitness gain is more important for the recombinant virus than elimination of expression of the heterologous gene.« less

Organic/Inorganic Hybrid p-n Junction with PEDOT Nanoparticles for Light-Emitting Diode

NASA Astrophysics Data System (ADS)

Kim, M. S.; Jin, S. M.; Cho, M. Y.; Choi, H. Y.; Kim, G. S.; Jeon, S. M.; Yim, K. G.; Kim, H. G.; Shim, K. B.; Kang, B. K.; Kim, Y.; Lee, D. Y.; Kim, J. S.; Kim, J. S.; Leem, J. Y.

2011-12-01

A heavily Si-doped GaN/polymer hybrid structure with p-type poly(3,4-ethylene-dioxythiophene):beta-1,3-glucan (PEDOT nanoparticle) interface layer has been fabricated. The Si-doped GaN thin film with carrier concentration of 1×1019 cm-3 was grown by metal-organic chemical vapor deposition (MOCVD). The PEDOT nanoparticle with various sizes ranging from 60 to 120 nm was synthesized via a miniemulsion polymerization process. The electrical conductivity of the PEDOT nanoparticle is less than 1.2 S/cm. The current-voltage (I-V) characteristic of the hybrid structure shows diode-like behavior. The I-V characteristic was examined in the framework of the thermionic emission model. The ideality factor and barrier height of the hybrid structure were obtained as 5.6 and 0.41 eV, respectively. The value of ideality factor is decreased by inserting the PEDOT nanoparticle interface layer.

Connexin 32 is involved in mitosis.

PubMed

Mones, Saleh; Bordignon, Benoit; Fontes, Michel

2012-03-01

The X-linked form of Charcot-Marie-Tooth disorder (CMTX) is the second most frequent type (15% of CMT forms). It involves the GJB1 gene coding for connexin 32, a protein involved in gap junction formation and function. There is no curative treatment for CMTX. We present data on transgenic lines that was accomplished by inserting a human BAC carrying the GJB1 gene, in which two different mutations in connexin 32 (Cx32) observed in patients were introduced. Investigation of these models implicated Cx32 in the control of mitotic stability. The model in which Gjb1 has been invalidated had the same phenotype. This new function for Cx32 was recently confirmed by results from the Mitocheck program. Locomotor impediment was seen in the behavior of these animals, the severity of which correlated with transgene copy number and RNA expression. Copyright © 2011 Wiley Periodicals, Inc.

Laparoscopic repair of ureter damaged during laparoscopic hysterectomy: Presentation of two cases

PubMed Central

Api, Murat; Boza, Ayşen; Kayataş, Semra; Boza, Barış

2017-01-01

Ureter injuries are uncommon but dreaded complications in gynecologic surgery and a frequent cause of conversion to laparotomy. Recently, a few papers reported the repair of gynecologic ureteral injuries using laparoscopy with encouraging results. In these case reports, we aimed to present two laparoscopically repaired ureter injuries during total laparoscopic hysterectomies (TLH). In the first case, the ureter was transected during the dissection of the cardinal ligament, approximately 7 to 8 cm distal to the ureterovesical junction (UVJ), and in the second case, it was damaged approximately 10 cm distal to the UVJ. Both transections were identified during surgery. The injured ureter was repaired without converting to laparotomy or additional trocar insertion. Ureteroureterostomy was performed in both cases uneventfully. Although ureteric injury is a rare complication during TLH, it can be managed by the same surgeon laparoscopically during the same procedure. PMID:29085711

International ring trial for the validation of an event-specific Golden Rice 2 quantitative real-time polymerase chain reaction method.

PubMed

Jacchia, Sara; Nardini, Elena; Bassani, Niccolò; Savini, Christian; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-05-27

This article describes the international validation of the quantitative real-time polymerase chain reaction (PCR) detection method for Golden Rice 2. The method consists of a taxon-specific assay amplifying a fragment of rice Phospholipase D α2 gene, and an event-specific assay designed on the 3' junction between transgenic insert and plant DNA. We validated the two assays independently, with absolute quantification, and in combination, with relative quantification, on DNA samples prepared in haploid genome equivalents. We assessed trueness, precision, efficiency, and linearity of the two assays, and the results demonstrate that both the assays independently assessed and the entire method fulfill European and international requirements for methods for genetically modified organism (GMO) testing, within the dynamic range tested. The homogeneity of the results of the collaborative trial between Europe and Asia is a good indicator of the robustness of the method.

Recombinant Measles AIK-C Vaccine Strain Expressing the prM-E Antigen of Japanese Encephalitis Virus.

PubMed

Higuchi, Akira; Toriniwa, Hiroko; Komiya, Tomoyoshi; Nakayama, Tetsuo

2016-01-01

An inactivated Japanese encephalitis virus (JEV) vaccine, which induces neutralizing antibodies, has been used for many years in Japan. In the present study, the JEV prM-E protein gene was cloned, inserted at the P/M junction of measles AIK-C cDNA, and an infectious virus was recovered. The JEV E protein was expressed in B95a cells infected with the recombinant virus. Cotton rats were inoculated with recombinant virus. Measles PA antibodies were detected three weeks after immunization. Neutralizing antibodies against JEV developed one week after inoculation, and EIA antibodies were detected three weeks after immunization. The measles AIK-C-based recombinant virus simultaneously induced measles and JEV immune responses, and may be a candidate for infant vaccines. Therefore, the present strategy of recombinant viruses based on a measles vaccine vector would be applicable to the platform for vaccine development.

The transverse occipital ligament: anatomy and potential functional significance.

PubMed

Tubbs, R Shane; Griessenauer, Christoph J; McDaniel, Jenny Gober; Burns, Amanda M; Kumbla, Anjali; Cohen-Gadol, Aaron A

2010-03-01

Knowledge of the anatomy of ligaments that bind the craniocervical junction is important for treating patients with lesions of this region. Although the anatomy and function of these ligaments have been well described, those of the transverse occipital ligament (TOL) have remained enigmatic. To describe the anatomy and functions of the transverse occipital ligament. Via a posterior approach, 9 cadaveric specimens underwent dissection of the craniocervical junction with special attention to the presence and anatomy of the TOL. The TOL was identified in 77.8% of the specimens. The ligament was found to be rectangular with fibers running horizontally between the lateral aspects of the foramen magnum. The attachment of each ligament near the occipital condyle was consistent, and each ligament was found superior to the transverse portion of the cruciform ligament and inserted just posterior to the lateral attachment sites of the alar ligaments. The average width, length, and thickness of the TOL was 0.34, 1.94, and 0.13 cm, respectively. The TOL in some specimens also had connections to the alar and transverse ligaments. The TOL was found in the majority of our specimens. The possible functions of this ligament when attached to the alar ligaments include providing additional support to these structures in stabilizing lateral bending, flexion, and axial rotation of the head. Knowledge of this ligament may aid in further understanding craniocervical stability and help in differentiating normal from pathology via imaging modalities.

[Clinical results of percutaneous pyeloplasty for ureteropelvic junction obstruction: 5 years follow-up].

PubMed

Nishio, S; Hamada, S; Nabeshima, S; Yokoyama, M; Takeuchi, M; Takeda, H

1994-11-01

We performed percutaneous endopyeloplasty on 20 patients between February, 1988 and July, 1993. Eighteen patients had primary and two had secondary ureteropelvic junction (UPJ) obstructions. There were 15 female and 5 male patients, whose ages ranged from 14 to 77, with an average of 43.6. The length of the follow-up after pyeloplasty ranged from 4 to 69 months with an average of 28.7 months. Among the 20 patients, there were 4 high insertion type cases, a bifid renal pelvis in one case and one case combined with a renal stone. Incisions were made with a hook-shaped cold knife and Ono's transpelvic extraureteral approach was used in most patients. Catheters were placed at the upper and the lower of renal pelvis in the patient with a bifid renal pelvis. In the case with a renal stone, pyeloplasty was successively performed after percutaneous nephrolithotomy in a single session. An endopyelotomy stent (14 Fr) was indwelled for 6 weeks in all patients except one. All patients had a low grade fever and abdominal pain for a few days after their operations, but there were no major complications. In nineteen patients (95%), the symptoms improved and their obstructive patterns disappeared or improved during follow-up. Complete ureteral stricture was found in one case at the removal of the stent and open pyeloplasty was performed. Percutaneous endopyeloplasty is a safe and useful technique, but further evaluation and/or better techniques are needed for avoiding recurrence of obstruction.

Comparative study of upper lip frenectomy with the CO2 laser versus the Er, Cr: YSGG laser

PubMed Central

Pié-Sánchez, Jordi; España-Tost, Antonio J.; Arnabat-Domínguez, Josep

2012-01-01

Objectives: To compare upper lip frenulum reinsertion, bleeding, surgical time and surgical wound healing in frenectomies performed with the CO2 laser versus the Er, Cr:YSGG laser. Study design: A prospective study was carried out on 50 randomized pediatric patients who underwent rhomboidal resection of the upper lip frenulum with either the CO2 laser or the Er,Cr:YSGG laser. Twenty-five patients were assigned to each laser system. All patients were examined at 7, 14, 21 days and 4 months after the operation in order to assess the surgical wound healing. Results: Insertion of the frenulum, which was preoperatively located between the upper central incisors, migrated to the mucogingival junction as a result of using both laser systems in all patients. Only two patients required a single dose of 650 mg of paracetamol, one of either study group. CO2 laser registered improved intraoperative bleeding control results and shorter surgical times. On the other hand, the Er,Cr:YSGG laser achieved faster healing. Conclusions: Upper lip laser frenectomy is a simple technique that results in minimum or no postoperative swelling or pain, and which involves upper lip frenulum reinsertion at the mucogingival junction. The CO2 laser offers a bloodless field and shorter surgical times compared with the Er,Cr:YSGG laser. On the other hand, the Er,Cr:YSGG laser achieved faster wound healing. Key words:Frenectomy, upper lip frenulum, CO2 laser, Er,Cr:YSGG laser, laser. PMID:22143683

Enhanced annealing stability and perpendicular magnetic anisotropy in perpendicular magnetic tunnel junctions using W layer

NASA Astrophysics Data System (ADS)

Chatterjee, Jyotirmoy; Sousa, Ricardo C.; Perrissin, Nicolas; Auffret, Stéphane; Ducruet, Clarisse; Dieny, Bernard

2017-05-01

The magnetic properties of the perpendicular storage electrode (buffer/MgO/FeCoB/Cap) were studied as a function of annealing temperature by replacing Ta with W and W/Ta cap layers with variable thicknesses. W in the cap boosts up the annealing stability and increases the effective perpendicular anisotropy by 30% compared to the Ta cap. Correspondingly, an increase in the FeCoB critical thickness characterizing the transition from perpendicular to in-plane anisotropy was observed. Thicker W layer in the W(t)/Ta 1 nm cap layer makes the storage electrode highly robust against annealing up to 570 °C. The stiffening of the overall stack resulting from the W insertion due to its very high melting temperature seems to be the key mechanism behind the extremely high thermal robustness. The Gilbert damping constant of FeCoB with the W/Ta cap was found to be lower when compared with the Ta cap and stable with annealing. The evolution of the magnetic properties of bottom pinned perpendicular magnetic tunnel junctions (p-MTJ) stack with the W2/Ta1 nm cap layer shows back-end-of-line compatibility with increasing tunnel magnetoresistance up to the annealing temperature of 425 °C. The pMTJ thermal budget is limited by the synthetic antiferromagnetic hard layer which is stable up to 425 °C annealing temperature while the storage layer is stable up to 455 °C.

Large room-temperature tunneling anisotropic magnetoresistance and electroresistance in single ferromagnet/Nb:SrTiO3 Schottky devices.

PubMed

Kamerbeek, Alexander M; Ruiter, Roald; Banerjee, Tamalika

2018-01-22

There is a large effort in research and development to realize electronic devices capable of storing information in new ways - for instance devices which simultaneously exhibit electro and magnetoresistance. However it remains a challenge to create devices in which both effects coexist. In this work we show that the well-known electroresistance in noble metal-Nb:SrTiO 3 Schottky junctions can be augmented by a magnetoresistance effect in the same junction. This is realized by replacing the noble metal electrode with ferromagnetic Co. This magnetoresistance manifests as a room temperature tunneling anisotropic magnetoresistance (TAMR). The maximum room temperature TAMR (1.6%) is significantly larger and robuster with bias than observed earlier, not using Nb:SrTiO 3 . In a different set of devices, a thin amorphous AlO x interlayer inserted between Co and Nb:SrTiO 3 , reduces the TAMR by more than 2 orders of magnitude. This points to the importance of intimate contact between the Co and Nb:SrTiO 3 for the TAMR effect. This is explained by electric field enhanced spin-orbit coupling of the interfacial Co layer in contact with Nb:SrTiO 3 . We propose that the large TAMR likely has its origin in the 3d orbital derived conduction band and large relative permittivity of Nb:SrTiO 3 and discuss ways to further enhance the TAMR.

Tissue-like phantoms

DOEpatents

Frangioni, John V.; De Grand, Alec M.

2007-10-30

The invention is based, in part, on the discovery that by combining certain components one can generate a tissue-like phantom that mimics any desired tissue, is simple and inexpensive to prepare, and is stable over many weeks or months. In addition, new multi-modal imaging objects (e.g., beads) can be inserted into the phantoms to mimic tissue pathologies, such as cancer, or merely to serve as calibration standards. These objects can be imaged using one, two, or more (e.g., four) different imaging modalities (e.g., x-ray computed tomography (CT), positron emission tomography (PET), single photon emission computed tomography (SPECT), and near-infrared (NIR) fluorescence) simultaneously.

Discovery and Optimization of Imidazopyridine-Based Inhibitors of Diacylglycerol Acyltransferase 2 (DGAT2).

PubMed

Futatsugi, Kentaro; Kung, Daniel W; Orr, Suvi T M; Cabral, Shawn; Hepworth, David; Aspnes, Gary; Bader, Scott; Bian, Jianwei; Boehm, Markus; Carpino, Philip A; Coffey, Steven B; Dowling, Matthew S; Herr, Michael; Jiao, Wenhua; Lavergne, Sophie Y; Li, Qifang; Clark, Ronald W; Erion, Derek M; Kou, Kou; Lee, Kyuha; Pabst, Brandon A; Perez, Sylvie M; Purkal, Julie; Jorgensen, Csilla C; Goosen, Theunis C; Gosset, James R; Niosi, Mark; Pettersen, John C; Pfefferkorn, Jeffrey A; Ahn, Kay; Goodwin, Bryan

2015-09-24

The medicinal chemistry and preclinical biology of imidazopyridine-based inhibitors of diacylglycerol acyltransferase 2 (DGAT2) is described. A screening hit 1 with low lipophilic efficiency (LipE) was optimized through two key structural modifications: (1) identification of the pyrrolidine amide group for a significant LipE improvement, and (2) insertion of a sp(3)-hybridized carbon center in the core of the molecule for simultaneous improvement of N-glucuronidation metabolic liability and off-target pharmacology. The preclinical candidate 9 (PF-06424439) demonstrated excellent ADMET properties and decreased circulating and hepatic lipids when orally administered to dyslipidemic rodent models.

[Auricular arrhythmia in Steinert's myotonia. Apropos of a case with a familial study].

PubMed

Chagnon, A; Vidal, M E

1983-02-24

A case of bradycardia-tachycardia syndrome leading to the late discovery of Steinert syndrome is reported. There is a discrepancy between the frequency of the main features of the bradycardia-tachycardia syndrome (sinoatrial block and atrial flutter in our observation) usually reported in Steinert disease and the fact that no case similar to ours seems to have yet been reported; this suggests definite underrating. Insertion of a pacemaker should avoid sudden death from a conduction disturbance. The heart should be carefully monitored in patients with myotonic dystrophy; conversely, this diagnosis should be considered in the etiologic diagnosis of myocardiopathies.

POROUS ALUMINOPHOSPHATES :From Molecular Sieves to Designed Acid Catalysts

NASA Astrophysics Data System (ADS)

Pastore, H. O.; Coluccia, S.; Marchese, L.

2005-08-01

This review covers the synthesis, characterization, and physico-chemical properties of microporous and mesoporous aluminophosphates and silicoaluminophosphates molecular sieves. Particular emphasis is given to the materials that have found applications as acid catalysts. We consider the evolution of the synthesis procedures from the first discoveries to the current methodologies and give perspectives for new possible synthesis strategies. Emphasis is given to the use of specially prepared precursors/reactants designed for the use as molecular sieves. Experimental (especially MAS-NMR and FTIR spectroscopy) and theoretical approaches to the description of the Si insertion into the ALPO framework and to the acidic properties of SAPOs and MeAPSOs materials are discussed.

The myosin ID pathway and left-right asymmetry in Drosophila.

PubMed

Géminard, Charles; González-Morales, Nicanor; Coutelis, Jean-Baptiste; Noselli, Stéphane

2014-06-01

Drosophila is a classical model to study body patterning, however left-right (L/R) asymmetry had remained unexplored, until recently. The discovery of the conserved myosin ID gene as a major determinant of L/R asymmetry has revealed a novel L/R pathway involving the actin cytoskeleton and the adherens junction. In this process, the HOX gene Abdominal-B plays a major role through the control of myosin ID expression and therefore symmetry breaking. In this review, we present organs and markers showing L/R asymmetry in Drosophila and discuss our current understanding of the underlying molecular genetic mechanisms. Drosophila represents a valuable model system revealing novel strategies to establish L/R asymmetry in invertebrates and providing an evolutionary perspective to the problem of laterality in bilateria. © 2014 Wiley Periodicals, Inc.

Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis.

PubMed

Vishwakarma, Manish K; Kale, Sandip M; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K; Varshney, Rajeev K

2017-01-01

Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis , we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut ( Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis . The majority of the InDels were of single bp (43.7%) and 2-10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of "K" genome, although distinct from both the "A" and "B" genomes, but more similar to "B" genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications.

Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis

PubMed Central

Vishwakarma, Manish K.; Kale, Sandip M.; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K.; Varshney, Rajeev K.

2017-01-01

Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis, we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut (Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis. The majority of the InDels were of single bp (43.7%) and 2–10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of “K” genome, although distinct from both the “A” and “B” genomes, but more similar to “B” genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications. PMID:29312366

Protein-DNA interactions define the mechanistic aspects of circle formation and insertion reactions in IS2 transposition.

PubMed

Lewis, Leslie A; Astatke, Mekbib; Umekubo, Peter T; Alvi, Shaheen; Saby, Robert; Afrose, Jehan; Oliveira, Pedro H; Monteiro, Gabriel A; Prazeres, Duarte Mf

2012-01-26

Transposition in IS3, IS30, IS21 and IS256 insertion sequence (IS) families utilizes an unconventional two-step pathway. A figure-of-eight intermediate in Step I, from asymmetric single-strand cleavage and joining reactions, is converted into a double-stranded minicircle whose junction (the abutted left and right ends) is the substrate for symmetrical transesterification attacks on target DNA in Step II, suggesting intrinsically different synaptic complexes (SC) for each step. Transposases of these ISs bind poorly to cognate DNA and comparative biophysical analyses of SC I and SC II have proven elusive. We have prepared a native, soluble, active, GFP-tagged fusion derivative of the IS2 transposase that creates fully formed complexes with single-end and minicircle junction (MCJ) substrates and used these successfully in hydroxyl radical footprinting experiments. In IS2, Step I reactions are physically and chemically asymmetric; the left imperfect, inverted repeat (IRL), the exclusive recipient end, lacks donor function. In SC I, different protection patterns of the cleavage domains (CDs) of the right imperfect inverted repeat (IRR; extensive in cis) and IRL (selective in trans) at the single active cognate IRR catalytic center (CC) are related to their donor and recipient functions. In SC II, extensive binding of the IRL CD in trans and of the abutted IRR CD in cis at this CC represents the first phase of the complex. An MCJ substrate precleaved at the 3' end of IRR revealed a temporary transition state with the IRL CD disengaged from the protein. We propose that in SC II, sequential 3' cleavages at the bound abutted CDs trigger a conformational change, allowing the IRL CD to complex to its cognate CC, producing the second phase. Corroborating data from enhanced residues and curvature propensity plots suggest that CD to CD interactions in SC I and SC II require IRL to assume a bent structure, to facilitate binding in trans. Different transpososomes are assembled in each step of the IS2 transposition pathway. Recipient versus donor end functions of the IRL CD in SC I and SC II and the conformational change in SC II that produces the phase needed for symmetrical IRL and IRR donor attacks on target DNA highlight the differences.

Protein-DNA interactions define the mechanistic aspects of circle formation and insertion reactions in IS2 transposition

PubMed Central

2012-01-01

Background Transposition in IS3, IS30, IS21 and IS256 insertion sequence (IS) families utilizes an unconventional two-step pathway. A figure-of-eight intermediate in Step I, from asymmetric single-strand cleavage and joining reactions, is converted into a double-stranded minicircle whose junction (the abutted left and right ends) is the substrate for symmetrical transesterification attacks on target DNA in Step II, suggesting intrinsically different synaptic complexes (SC) for each step. Transposases of these ISs bind poorly to cognate DNA and comparative biophysical analyses of SC I and SC II have proven elusive. We have prepared a native, soluble, active, GFP-tagged fusion derivative of the IS2 transposase that creates fully formed complexes with single-end and minicircle junction (MCJ) substrates and used these successfully in hydroxyl radical footprinting experiments. Results In IS2, Step I reactions are physically and chemically asymmetric; the left imperfect, inverted repeat (IRL), the exclusive recipient end, lacks donor function. In SC I, different protection patterns of the cleavage domains (CDs) of the right imperfect inverted repeat (IRR; extensive in cis) and IRL (selective in trans) at the single active cognate IRR catalytic center (CC) are related to their donor and recipient functions. In SC II, extensive binding of the IRL CD in trans and of the abutted IRR CD in cis at this CC represents the first phase of the complex. An MCJ substrate precleaved at the 3' end of IRR revealed a temporary transition state with the IRL CD disengaged from the protein. We propose that in SC II, sequential 3' cleavages at the bound abutted CDs trigger a conformational change, allowing the IRL CD to complex to its cognate CC, producing the second phase. Corroborating data from enhanced residues and curvature propensity plots suggest that CD to CD interactions in SC I and SC II require IRL to assume a bent structure, to facilitate binding in trans. Conclusions Different transpososomes are assembled in each step of the IS2 transposition pathway. Recipient versus donor end functions of the IRL CD in SC I and SC II and the conformational change in SC II that produces the phase needed for symmetrical IRL and IRR donor attacks on target DNA highlight the differences. PMID:22277150

Sharp Curvature of Frontal Lobe White Matter Pathways in Children with Autism Spectrum Disorder: Tract-Based Morphometry Analysis

PubMed Central

Jeong, Jeong-Won; Kumar, Ajay; Sundaram, Senthil K.; Chugani, Harry T.; Chugani, Diane C.

2013-01-01

Background and Purpose As we had previously observed geometrical changes of frontal lobe association pathways in children with autism spectrum disorder (ASD), in the present study we analyzed the curvature of these white matter pathways using an objective tract based morphometry (TBM) analysis. Materials and Methods Diffusion tensor imaging (DTI) was performed in 32 children with ASD and 14 children with typical development. Curvature, fractional anisotropy (FA), axial diffusivity (AD), and radial diffusivity (RD) of bilateral arcuate fasciculus (AF), uncinate fasciculus (UF), and genu of corpus callosum (gCC) were investigated using the TBM group analysis assessed by False Discovery Rate p-value (PFDR) for multiple comparisons. Results Significantly higher curvatures were found in children with ASD especially at the parieto-temporal junction for AF (left: PFDR < 0.001; right: PFDR < 0.01), at the fronto-temporal junction for UF (left: PFDR < 0.005; right: PFDR < 0.03), and at the midline of the gCC (PFDR < 0.0001). RD was significantly higher in children with ASD at the same bending regions of AF (left: PFDR < 0.03, right: PFDR < 0.02), UF (left: PFDR < 0.04), and gCC (PFDR < 0.01). Conclusion Higher curvature and curvature dependent RD changes in children with ASD may be the result of higher density of thinner axons in these frontal lobe tracts. PMID:21757519

Extensive morphological divergence and rapid evolution of the larval neuromuscular junction in Drosophila.

PubMed

Campbell, Megan; Ganetzky, Barry

2012-03-13

Although the complexity and circuitry of nervous systems undergo evolutionary change, we lack understanding of the general principles and specific mechanisms through which it occurs. The Drosophila larval neuromuscular junction (NMJ), which has been widely used for studies of synaptic development and function, is also an excellent system for studies of synaptic evolution because the genus spans >40 Myr of evolution and the same identified synapse can be examined across the entire phylogeny. We have now characterized morphology of the NMJ on muscle 4 (NMJ4) in >20 species of Drosophila. Although there is little variation within a species, NMJ morphology and complexity vary extensively between species. We find no significant correlation between NMJ phenotypes and phylogeny for the species examined, suggesting that drift alone cannot explain the phenotypic variation and that selection likely plays an important role. However, the nature of the selective pressure is still unclear because basic parameters of synaptic function remain uniform. Whatever the mechanism, NMJ morphology is evolving rapidly in comparison with other morphological features because NMJ phenotypes differ even between several sibling species pairs. The discovery of this unexpectedly extensive divergence in NMJ morphology among Drosophila species provides unique opportunities to investigate mechanisms that regulate synaptic growth; the interrelationships between synaptic morphology, neural function, and behavior; and the evolution of nervous systems and behavior in natural populations.

Defenders and Challengers of Endothelial Barrier Function

PubMed Central

Rahimi, Nader

2017-01-01

Regulated vascular permeability is an essential feature of normal physiology and its dysfunction is associated with major human diseases ranging from cancer to inflammation and ischemic heart diseases. Integrity of endothelial cells also play a prominent role in the outcome of surgical procedures and organ transplant. Endothelial barrier function and integrity are regulated by a plethora of highly specialized transmembrane receptors, including claudin family proteins, occludin, junctional adhesion molecules (JAMs), vascular endothelial (VE)-cadherin, and the newly identified immunoglobulin (Ig) and proline-rich receptor-1 (IGPR-1) through various distinct mechanisms and signaling. On the other hand, vascular endothelial growth factor (VEGF) and its tyrosine kinase receptor, VEGF receptor-2, play a central role in the destabilization of endothelial barrier function. While claudins and occludin regulate cell–cell junction via recruitment of zonula occludens (ZO), cadherins via catenin proteins, and JAMs via ZO and afadin, IGPR-1 recruits bullous pemphigoid antigen 1 [also called dystonin (DST) and SH3 protein interacting with Nck90/WISH (SH3 protein interacting with Nck)]. Endothelial barrier function is moderated by the function of transmembrane receptors and signaling events that act to defend or destabilize it. Here, I highlight recent advances that have provided new insights into endothelial barrier function and mechanisms involved. Further investigation of these mechanisms could lead to the discovery of novel therapeutic targets for human diseases associated with endothelial dysfunction. PMID:29326721

Tools to covisualize and coanalyze proteomic data with genomes and transcriptomes: validation of genes and alternative mRNA splicing.

PubMed

Pang, Chi Nam Ignatius; Tay, Aidan P; Aya, Carlos; Twine, Natalie A; Harkness, Linda; Hart-Smith, Gene; Chia, Samantha Z; Chen, Zhiliang; Deshpande, Nandan P; Kaakoush, Nadeem O; Mitchell, Hazel M; Kassem, Moustapha; Wilkins, Marc R

2014-01-03

Direct links between proteomic and genomic/transcriptomic data are not frequently made, partly because of lack of appropriate bioinformatics tools. To help address this, we have developed the PG Nexus pipeline. The PG Nexus allows users to covisualize peptides in the context of genomes or genomic contigs, along with RNA-seq reads. This is done in the Integrated Genome Viewer (IGV). A Results Analyzer reports the precise base position where LC-MS/MS-derived peptides cover genes or gene isoforms, on the chromosomes or contigs where this occurs. In prokaryotes, the PG Nexus pipeline facilitates the validation of genes, where annotation or gene prediction is available, or the discovery of genes using a "virtual protein"-based unbiased approach. We illustrate this with a comprehensive proteogenomics analysis of two strains of Campylobacter concisus . For higher eukaryotes, the PG Nexus facilitates gene validation and supports the identification of mRNA splice junction boundaries and splice variants that are protein-coding. This is illustrated with an analysis of splice junctions covered by human phosphopeptides, and other examples of relevance to the Chromosome-Centric Human Proteome Project. The PG Nexus is open-source and available from https://github.com/IntersectAustralia/ap11_Samifier. It has been integrated into Galaxy and made available in the Galaxy tool shed.

Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

PubMed Central

Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

2014-01-01

The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

Competing Anisotropy-Tunneling Correlation of the CoFeB/MgO Perpendicular Magnetic Tunnel Junction: An Electronic Approach

PubMed Central

Yang, Chao-Yao; Chang, Shu-Jui; Lee, Min-Han; Shen, Kuei-Hung; Yang, Shan-Yi; Lin, Horng-Ji; Tseng, Yuan-Chieh

2015-01-01

We intensively investigate the physical principles regulating the tunneling magneto-resistance (TMR) and perpendicular magnetic anisotropy (PMA) of the CoFeB/MgO magnetic tunnel junction (MTJ) by means of angle-resolved x-ray magnetic spectroscopy. The angle-resolved capability was easily achieved, and it provided greater sensitivity to symmetry-related d-band occupation compared to traditional x-ray spectroscopy. This added degree of freedom successfully solved the unclear mechanism of this MTJ system renowned for controllable PMA and excellent TMR. As a surprising discovery, these two physical characteristics interact in a competing manner because of opposite band-filling preference in space-correlated symmetry of the 3d-orbital. An overlooked but harmful superparamagnetic phase resulting from magnetic inhomogeneity was also observed. This important finding reveals that simultaneously achieving fast switching and a high tunneling efficiency at an ultimate level is improbable for this MTJ system owing to its fundamental limit in physics. We suggest that the development of independent TMR and PMA mechanisms is critical towards a complementary relationship between the two physical characteristics, as well as the realization of superior performance, of this perpendicular MTJ. Furthermore, this study provides an easy approach to evaluate the futurity of any emerging spintronic candidates by electronically examining the relationship between their magnetic anisotropy and transport. PMID:26596778

Indel variant analysis of short-read sequencing data with Scalpel

PubMed Central

Fang, Han; Bergmann, Ewa A; Arora, Kanika; Vacic, Vladimir; Zody, Michael C; Iossifov, Ivan; O’Rawe, Jason A; Wu, Yiyang; Barron, Laura T Jimenez; Rosenbaum, Julie; Ronemus, Michael; Lee, Yoon-ha; Wang, Zihua; Dikoglu, Esra; Jobanputra, Vaidehi; Lyon, Gholson J; Wigler, Michael; Schatz, Michael C; Narzisi, Giuseppe

2017-01-01

As the second most common type of variation in the human genome, insertions and deletions (indels) have been linked to many diseases, but the discovery of indels of more than a few bases in size from short-read sequencing data remains challenging. Scalpel (http://scalpel.sourceforge.net) is an open-source software for reliable indel detection based on the microassembly technique. It has been successfully used to discover mutations in novel candidate genes for autism, and it is extensively used in other large-scale studies of human diseases. This protocol gives an overview of the algorithm and describes how to use Scalpel to perform highly accurate indel calling from whole-genome and whole-exome sequencing data. We provide detailed instructions for an exemplary family-based de novo study, but we also characterize the other two supported modes of operation: single-sample and somatic analysis. Indel normalization, visualization and annotation of the mutations are also illustrated. Using a standard server, indel discovery and characterization in the exonic regions of the example sequencing data can be completed in ~5 h after read mapping. PMID:27854363

Population-based structural variation discovery with Hydra-Multi.

PubMed

Lindberg, Michael R; Hall, Ira M; Quinlan, Aaron R

2015-04-15

Current strategies for SNP and INDEL discovery incorporate sequence alignments from multiple individuals to maximize sensitivity and specificity. It is widely accepted that this approach also improves structural variant (SV) detection. However, multisample SV analysis has been stymied by the fundamental difficulties of SV calling, e.g. library insert size variability, SV alignment signal integration and detecting long-range genomic rearrangements involving disjoint loci. Extant tools suffer from poor scalability, which limits the number of genomes that can be co-analyzed and complicates analysis workflows. We have developed an approach that enables multisample SV analysis in hundreds to thousands of human genomes using commodity hardware. Here, we describe Hydra-Multi and measure its accuracy, speed and scalability using publicly available datasets provided by The 1000 Genomes Project and by The Cancer Genome Atlas (TCGA). Hydra-Multi is written in C++ and is freely available at https://github.com/arq5x/Hydra. aaronquinlan@gmail.com or ihall@genome.wustl.edu Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

Genetic and evolutionary analysis of the Drosophila larval neuromuscular junction

NASA Astrophysics Data System (ADS)

Campbell, Megan

Although evolution of brains and behaviors is of fundamental biological importance, we lack comprehensive understanding of the general principles governing these processes or the specific mechanisms and molecules through which the evolutionary changes are effected. Because synapses are the basic structural and functional units of nervous systems, one way to address these problems is to dissect the genetic and molecular pathways responsible for morphological evolution of a defined synapse. I have undertaken such an analysis by examining morphology of the larval neuromuscular junction (NMJ) in wild caught D. melanogaster as well as in over 20 other species of Drosophila. Whereas variation in NMJ morphology within a species is limited, I discovered a surprisingly extensive variation among different species. Compared with evolution of other morphological traits, NMJ morphology appears to be evolving very rapidly. Moreover, my data indicate that natural selection rather than genetic drift is primarily responsible for evolution of NMJ morphology. To dissect underlying molecular mechanisms that may govern NMJ growth and evolutionary divergence, I focused on a naturally occurring variant in D. melanogaster that causes NMJ overgrowth. I discovered that the variant mapped to Mob2, a gene encoding a kinase adapter protein originally described in yeast as a member of the Mitotic Exit Network (MEN). I have subsequently examined mutations in the Drosophila orthologs of all the core components of the yeast MEN and found that all of them function as part of a common pathway that acts presynaptically to negatively regulate NMJ growth. As in the regulation of yeast cytokinesis, these components of the MEN appear to act ultimately by regulating actin dynamics during the process of bouton growth and division. These studies have thus led to the discovery of an entirely new role for the MEN---regulation of synaptic growth---that is separate from its function in cell division. This work has identified a rich source of material for discovery of novel genes and mechanisms that regulate synaptic growth and development, and has also provided new insights into the mechanisms that underlie morphological evolution of nervous systems.

Polar Domain Discovery with Sparkler

NASA Astrophysics Data System (ADS)

Duerr, R.; Khalsa, S. J. S.; Mattmann, C. A.; Ottilingam, N. K.; Singh, K.; Lopez, L. A.

2017-12-01

The scientific web is vast and ever growing. It encompasses millions of textual, scientific and multimedia documents describing research in a multitude of scientific streams. Most of these documents are hidden behind forms which require user action to retrieve and thus can't be directly accessed by content crawlers. These documents are hosted on web servers across the world, most often on outdated hardware and network infrastructure. Hence it is difficult and time-consuming to aggregate documents from the scientific web, especially those relevant to a specific domain. Thus generating meaningful domain-specific insights is currently difficult. We present an automated discovery system (Figure 1) using Sparkler, an open-source, extensible, horizontally scalable crawler which facilitates high throughput and focused crawling of documents pertinent to a particular domain such as information about polar regions. With this set of highly domain relevant documents, we show that it is possible to answer analytical questions about that domain. Our domain discovery algorithm leverages prior domain knowledge to reach out to commercial/scientific search engines to generate seed URLs. Subject matter experts then annotate these seed URLs manually on a scale from highly relevant to irrelevant. We leverage this annotated dataset to train a machine learning model which predicts the `domain relevance' of a given document. We extend Sparkler with this model to focus crawling on documents relevant to that domain. Sparkler avoids disruption of service by 1) partitioning URLs by hostname such that every node gets a different host to crawl and by 2) inserting delays between subsequent requests. With an NSF-funded supercomputer Wrangler, we scaled our domain discovery pipeline to crawl about 200k polar specific documents from the scientific web, within a day.

Challenges in searching for therapeutics against Botulinum Neurotoxins.

PubMed

Pirazzini, Marco; Rossetto, Ornella

2017-05-01

Botulinum neurotoxins (BoNTs) are the most potent toxins known. BoNTs are responsible for botulism, a deadly neuroparalytic syndrome caused by the inactivation of neurotransmitter release at peripheral nerve terminals. Thanks to their specificity and potency, BoNTs are both considered potential bio-weapons and therapeutics of choice for a variety of medical syndromes. Several variants of BoNTs have been identified with individual biological properties and little antigenic relation. This expands greatly the potential of BoNTs as therapeutics but poses a major safety problem, increasing the need for finding appropriate antidotes. Areas covered: The authors describe the multi-step molecular mechanism through which BoNTs enter nerve terminals and discuss the many levels at which the toxins can be inhibited. They review the outcomes of the different strategies adopted to limit neurotoxicity and counter intoxication. Potential new targets arising from the last discoveries of the mechanism of action and the approaches to promote neuromuscular junction recovery are also discussed. Expert opinion: Current drug discovery efforts have mainly focused on BoNT type A and addressed primarily light chain proteolytic activity. Development of pan-BoNT inhibitors acting independently of BoNT immunological properties and targeting a common step of the intoxication process should be encouraged.

Unearthing the Fossorial Tadpoles of the Indian Dancing Frog Family Micrixalidae

PubMed Central

Senevirathne, Gayani; Garg, Sonali; Kerney, Ryan; Meegaskumbura, Madhava; Biju, S. D.

2016-01-01

Tadpoles of the monotypic Indian dancing frog family Micrixalidae have remained obscure for over 125 years. Here we report the discovery of the elusive tadpoles of Micrixalus herrei from the sand beds of a forested stream in southern Western Ghats, and confirm their identity through DNA barcoding. These actively burrowing tadpoles lead an entirely fossorial life from eggs to late metamorphic stages. We describe their internal and external morphological characters while highlighting the following features: eel-like appearance, extensively muscularized body and tail, reduced tail fins, skin-covered eyes, delayed development of eye pigmentation in early pre-metamorphic stages (Gosner stages 25–29), prominent tubular sinistral spiracle, large transverse processes on vertebrae II and III, ankylosed ribs on transverse processes of vertebra II, notochord terminating before the atlantal cotyle-occipital condyle junction, absence of keratodonts, serrated well-formed jaw sheaths, and extensive calcified endolymphatic sacs reaching sacrum posteriorly. The tadpole gut contains mostly fine sediments and sand. We discuss the eel-like morphology and feeding habits of M. herrei in the context of convergence with other well-known fossorial tadpoles. This discovery builds the knowledge base for further comparative analyses and conservation of Micrixalus, an ancient and endemic lineage of Indian frogs. PMID:27027870

Congenital Myasthenic Syndromes or Inherited Disorders of Neuromuscular Transmission: Recent Discoveries and Open Questions

PubMed Central

Nicole, Sophie; Azuma, Yoshiteru; Bauché, Stéphanie; Eymard, Bruno; Lochmüller, Hanns; Slater, Clarke

2017-01-01

Congenital myasthenic syndromes (CMS) form a heterogeneous group of rare diseases characterized by fatigable muscle weakness. They are genetically-inherited and caused by defective synaptic transmission at the cholinergic neuromuscular junction (NMJ). The number of genes known to cause CMS when mutated is currently 30, and the relationship between fatigable muscle weakness and defective functions is quite well-understood for many of them. However, some of the most recent discoveries in individuals with CMS challenge our knowledge of the NMJ, where the basis of the pathology has mostly been investigated in animal models. Frontier forms between CMS and congenital myopathy, which have been genetically and clinically identified, underline the poorly understood interplay between the synaptic and extrasynaptic molecules in the neuromuscular system. In addition, precise electrophysiological and histopathological investigations of individuals with CMS suggest an important role of NMJ plasticity in the response to CMS pathogenesis. While efficient drug-based treatments are already available to improve neuromuscular transmission for most forms of CMS, others, as well as neurological and muscular comorbidities, remain resistant. Taken together, the available pathological data point to physiological issues which remain to be understood in order to achieve precision medicine with efficient therapeutics for all individuals suffering from CMS. PMID:29125502

Cervical microleakage in Class II cavities restored with the Sonicsys approx system.

PubMed

Rominu, Mihai; Florita, Zeno; Lakatos, Sorin; Rominu, Roxana Otilia

2009-04-01

To investigate the cervical microleakage in Class II cavities restored with Sonicsys approx ceramic inserts and four resin-based materials. Forty noncarious and crack-free mandibular third molars were used. These teeth were randomly assigned to four groups each containing 10 teeth. No control group was created. On each tooth, one mesial boxlike cavity was prepared using the active head Sonicsys approx no. 3. The cervical margin of each cavity was in enamel about 1 mm coronal to the cementoenamel junction. According to manufacturer's instructions, the prepared cavities were restored using a Sonicsys approx ceramic inserts no.3 and four resin-based materials as follows: group 1, Tetric Flow; group 2, Admira Flow; group 3, Nexus 2; group 4, X-Flow. After finishing and polishing, all specimens were stored in distilled water for 7 days at 37 degrees C, thermocycled 1,000 cycles between 5 degrees and 55 degrees C, and stored for 24 hours in basic fuchsine 2%. All specimens were then embedded in clear acrylic resin and sectioned along a mesial-distal plane through the middle of the cervical margin. The cervical areas of the resulting sections were examined using an optical microscope to assess the dye penetration. The registered scores were analyzed using Kruskal-Wallis and Mann-Whitney U tests. Microleakage was detected in each experimental group. Kruskal-Wallis test revealed statistically significant differences among groups (P = .009, alpha = .01). The Mann-Whitney U test showed significant differences between Admira Flow group and Tetric Flow (P = .011, alpha = .05), Nexus 2 (P = .001, alpha = .01), and X-Flow (P = .004, alpha = .01), respectively. Within the limitations of this study, the extent of microleakage in the cervical area (enamel) of Class II cavities restored with Sonicsys approx ceramic inserts depends on the material used for luting. The highest leakage occurred when Admira flow was used.

A Cholinergic-Regulated Circuit Coordinates the Maintenance and Bi-Stable States of a Sensory-Motor Behavior during Caenorhabditis elegans Male Copulation

PubMed Central

Liu, Yishi; LeBeouf, Brigitte; Guo, Xiaoyan; Correa, Paola A.; Gualberto, Daisy G.; Lints, Robyn; Garcia, L. Rene

2011-01-01

Penetration of a male copulatory organ into a suitable mate is a conserved and necessary behavioral step for most terrestrial matings; however, the detailed molecular and cellular mechanisms for this distinct social interaction have not been elucidated in any animal. During mating, the Caenorhabditis elegans male cloaca is maintained over the hermaphrodite's vulva as he attempts to insert his copulatory spicules. Rhythmic spicule thrusts cease when insertion is sensed. Circuit components consisting of sensory/motor neurons and sex muscles for these steps have been previously identified, but it was unclear how their outputs are integrated to generate a coordinated behavior pattern. Here, we show that cholinergic signaling between the cloacal sensory/motor neurons and the posterior sex muscles sustains genital contact between the sexes. Simultaneously, via gap junctions, signaling from these muscles is transmitted to the spicule muscles, thus coupling repeated spicule thrusts with vulval contact. To transit from rhythmic to sustained muscle contraction during penetration, the SPC sensory-motor neurons integrate the signal of spicule's position in the vulva with inputs from the hook and cloacal sensilla. The UNC-103 K+ channel maintains a high excitability threshold in the circuit, so that sustained spicule muscle contraction is not stimulated by fewer inputs. We demonstrate that coordination of sensory inputs and motor outputs used to initiate, maintain, self-monitor, and complete an innate behavior is accomplished via the coupling of a few circuit components. PMID:21423722

Three-junction solar cell

DOEpatents

Ludowise, Michael J.

1986-01-01

A photovoltaic solar cell is formed in a monolithic semiconductor. The cell contains three junctions. In sequence from the light-entering face, the junctions have a high, a medium, and a low energy gap. The lower junctions are connected in series by one or more metallic members connecting the top of the lower junction through apertures to the bottom of the middle junction. The upper junction is connected in voltage opposition to the lower and middle junctions by second metallic electrodes deposited in holes 60 through the upper junction. The second electrodes are connected to an external terminal.

EVA 2 activity on Flight Day 5 to service the Hubble Space Telescope

NASA Image and Video Library

1997-02-15

STS082-742-047 (11-21 Feb. 1997) --- On Flight Day 5, astronaut Joseph R. Tanner (left) holds a 500 pound piece of hardware as he stands on the end of the Space Shuttle Discovery's Remote Manipulator System (RMS) arm, as tethered astronaut Gregory J. Harbaugh works nearby. The piano-shaped object held aloft by Tanner is actually the Fine Guidance Sensor 1 (FGS-1), which Tanner had just removed from the Hubble Space Telescope (HST). Harbaugh is inspecting the FGS' bay to set the stage for the two to insert the replacement hardware. EDITOR'S NOTE: For orientation purposes, the picture should be held with Space Shuttle's OMS pods at top.

800 C Silicon Carbide (SiC) Pressure Sensors for Engine Ground Testing

NASA Technical Reports Server (NTRS)

Okojie, Robert S.

2016-01-01

MEMS-based 4H-SiC piezoresistive pressure sensors have been demonstrated at 800 C, leading to the discovery of strain sensitivity recovery with increasing temperatures above 400 C, eventually achieving up to, or near, 100 recovery of the room temperature values at 800 C. This result will allow the insertion of highly sensitive pressure sensors closer to jet, rocket, and hypersonic engine combustion chambers to improve the quantification accuracy of combustor dynamics, performance, and increase safety margin. Also, by operating at higher temperature and locating closer to the combustion chamber, reduction of the length (weight) of pressure tubes that are currently used will be achieved. This will result in reduced costlb to access space.

Next-generation sequencing library preparation method for identification of RNA viruses on the Ion Torrent Sequencing Platform.

PubMed

Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng

2018-05-09

Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.

KSC-05PD-0565

NASA Technical Reports Server (NTRS)

2005-01-01

KENNEDY SPACE CENTER, FLA. In the Vehicle Assembly Building at NASAs Kennedy Space Center, a digital still camera has been mounted in the External Tank (ET) umbilical well on the aft end of Space Shuttle Discovery. The camera is being used to obtain and downlink high-resolution images of the disconnect point on the ET following ET separation from the orbiter after launch. The Kodak camera will record 24 images, at one frame per 1.5 seconds, on a flash memory card. After orbital insertion, the crew will transfer the images from the memory card to a laptop computer. The files will then be downloaded through the Ku-band system to the Mission Control Center in Houston for analysis.

KSC-05PD-0562

NASA Technical Reports Server (NTRS)

2005-01-01

KENNEDY SPACE CENTER, FLA. In the Vehicle Assembly Building at NASAs Kennedy Space Center, workers check the digital still camera they will mount in the External Tank (ET) umbilical well on the aft end of Space Shuttle Discovery. The camera is being used to obtain and downlink high-resolution images of the disconnect point on the ET following the tank's separation from the orbiter after launch. The Kodak camera will record 24 images, at one frame per 1.5 seconds, on a flash memory card. After orbital insertion, the crew will transfer the images from the memory card to a laptop computer. The files will then be downloaded through the Ku-band system to the Mission Control Center in Houston for analysis.

KSC-05PD-0564

NASA Technical Reports Server (NTRS)

2005-01-01

KENNEDY SPACE CENTER, FLA. In the Vehicle Assembly Building at NASAs Kennedy Space Center, a worker mounts a digital still camera in the External Tank (ET) umbilical well on the aft end of Space Shuttle Discovery. The camera is being used to obtain and downlink high-resolution images of the disconnect point on the ET following the ET separation from the orbiter after launch. The Kodak camera will record 24 images, at one frame per 1.5 seconds, on a flash memory card. After orbital insertion, the crew will transfer the images from the memory card to a laptop computer. The files will then be downloaded through the Ku-band system to the Mission Control Center in Houston for analysis.

KSC-05PD-0561

NASA Technical Reports Server (NTRS)

2005-01-01

KENNEDY SPACE CENTER, FLA. In the Vehicle Assembly Building at NASAs Kennedy Space Center, workers prepare a digital still camera they will mount in the External Tank (ET) umbilical well on the aft end of Space Shuttle Discovery. The camera is being used to obtain and downlink high-resolution images of the disconnect point on the ET following its separation from the orbiter after launch. The Kodak camera will record 24 images, at one frame per 1.5 seconds, on a flash memory card. After orbital insertion, the crew will transfer the images from the memory card to a laptop computer. The files will then be downloaded through the Ku-band system to the Mission Control Center in Houston for analysis.

KSC-05PD-0563

NASA Technical Reports Server (NTRS)

2005-01-01

KENNEDY SPACE CENTER, FLA. In the Vehicle Assembly Building at NASAs Kennedy Space Center, workers prepare a digital still camera they will mount in the External Tank (ET) umbilical well on the aft end of Space Shuttle Discovery. The camera is being used to obtain and downlink high-resolution images of the disconnect point on the ET following the ET separation from the orbiter after launch. The Kodak camera will record 24 images, at one frame per 1.5 seconds, on a flash memory card. After orbital insertion, the crew will transfer the images from the memory card to a laptop computer. The files will then be downloaded through the Ku-band system to the Mission Control Center in Houston for analysis.

Early Cambrian sipunculan worms from southwest China.

PubMed Central

Huang, Di-Ying; Chen, Jun-Yuan; Vannier, Jean; Saiz Salinas, J. I.

2004-01-01

We report the discovery of sipunculan worms from the Lower Cambrian Maotianshan Shale, near Kunming (southwest China). Their sipunculan identity is evidenced by the general morphology of the animals (sausage-shaped body with a slender retractable introvert and a wider trunk) and by other features, both external (e.g. perioral crown of tentacles, and hooks, papillae and wrinkle rings on the body surface) and internal (U-shaped gut, and the anus opening near the introvert-trunk junction). The three fossil forms (Archaeogolfingia caudata gen. et sp. nov., Cambrosipunculus tentaculatus gen. et sp. nov. and Cambrosipunculus sp.) have striking similarities to modern sipunculans, especially the Golfingiidae to which their evolutionary relationships are discussed. This study suggests that most typical features of extant sipunculans have undergone only limited changes since the Early Cambrian, thus indicating a possible evolutionary stasis over the past 520 Myr. PMID:15306286

Early Cambrian sipunculan worms from southwest China.

PubMed

Huang, Di-Ying; Chen, Jun-Yuan; Vannier, Jean; Saiz Salinas, J I

2004-08-22

We report the discovery of sipunculan worms from the Lower Cambrian Maotianshan Shale, near Kunming (southwest China). Their sipunculan identity is evidenced by the general morphology of the animals (sausage-shaped body with a slender retractable introvert and a wider trunk) and by other features, both external (e.g. perioral crown of tentacles, and hooks, papillae and wrinkle rings on the body surface) and internal (U-shaped gut, and the anus opening near the introvert-trunk junction). The three fossil forms (Archaeogolfingia caudata gen. et sp. nov., Cambrosipunculus tentaculatus gen. et sp. nov. and Cambrosipunculus sp.) have striking similarities to modern sipunculans, especially the Golfingiidae to which their evolutionary relationships are discussed. This study suggests that most typical features of extant sipunculans have undergone only limited changes since the Early Cambrian, thus indicating a possible evolutionary stasis over the past 520 Myr.

X-MATE: a flexible system for mapping short read data

PubMed Central

Pearson, John V.; Cloonan, Nicole; Grimmond, Sean M.

2011-01-01

Summary: Accurate and complete mapping of short-read sequencing to a reference genome greatly enhances the discovery of biological results and improves statistical predictions. We recently presented RNA-MATE, a pipeline for the recursive mapping of RNA-Seq datasets. With the rapid increase in genome re-sequencing projects, progression of available mapping software and the evolution of file formats, we now present X-MATE, an updated version of RNA-MATE, capable of mapping both RNA-Seq and DNA datasets and with improved performance, output file formats, configuration files, and flexibility in core mapping software. Availability: Executables, source code, junction libraries, test data and results and the user manual are available from http://grimmond.imb.uq.edu.au/X-MATE/. Contact: n.cloonan@uq.edu.au; s.grimmond@uq.edu.au Supplementary information: Supplementary data are available at Bioinformatics Online. PMID:21216778

Regulation of protein activity with small-molecule-controlled inteins

PubMed Central

Skretas, Georgios; Wood, David W.

2005-01-01

Inteins are the protein analogs of self-splicing RNA introns, as they post-translationally excise themselves from a variety of protein hosts. Intein insertion abolishes, in general, the activity of its host protein, which is subsequently restored upon intein excision. These protein elements therefore have the potential to be used as general molecular “switches” for the control of arbitrary target proteins. Based on rational design, an intein-based protein switch has been constructed whose splicing activity is conditionally triggered in vivo by the presence of thyroid hormone or synthetic analogs. This modified intein was used in Escherichia coli to demonstrate that a number of different proteins can be inactivated by intein insertion and then reactivated by the addition of thyroid hormone via ligand-induced splicing. This conditional activation was also found to occur in a dose-dependent manner. Rational protein engineering was then combined with genetic selection to evolve an additional intein whose activity is controlled by the presence of synthetic estrogen ligands. The ability to regulate protein function post-translationally through the use of ligand-controlled intein splicing will most likely find applications in metabolic engineering, drug discovery and delivery, biosensing, molecular computation, as well as many additional areas of biotechnology. PMID:15632292

Discovery of Rapid and Reversible Water Insertion in Rare Earth Sulfates: A New Process for Thermochemical Heat Storage.

PubMed

Hatada, Naoyuki; Shizume, Kunihiko; Uda, Tetsuya

2017-07-01

Thermal energy storage based on chemical reactions is a prospective technology for the reduction of fossil-fuel consumption by storing and using waste heat. For widespread application, a critical challenge is to identify appropriate reversible reactions that occur below 250 °C, where abundant low-grade waste heat and solar energy might be available. Here, it is shown that lanthanum sulfate monohydrate La 2 (SO 4 ) 3 ⋅H 2 O undergoes rapid and reversible dehydration/hydration reactions in the temperature range from 50 to 250 °C upon heating/cooling with remarkably small thermal hysteresis (<50 °C), and thus it emerges as a new candidate system for thermal energy storage. Thermogravimetry and X-ray diffraction analyses reveal that the reactions proceed through an unusual mechanism for sulfates: water is removed from, or inserted in La 2 (SO 4 ) 3 ⋅H 2 O with progressive change in hydration number x without phase change. It is also revealed that only a specific structural modification of La 2 (SO 4 ) 3 exhibits this reversible dehydration/hydration behavior. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ultrasonic Inspection to Quantify Failure Pathologies of Crimped Electrical Connections

NASA Technical Reports Server (NTRS)

Cramer, K. Elliott; Perey, Daniel F.; Yost, William T.

2014-01-01

Previous work has shown that ultrasonic inspection provides a means of assessing electrical crimp quality that ensures the electrical and mechanical integrity of an initial crimp before the installation process is completed. The amplitude change of a compressional ultrasonic wave propagating at right angles to the wire axis and through the junction of a crimp termination was shown to correlate with the results of destructive pull tests, which is a standard for assessing crimp wire junction quality. Of additional concern are crimps made at high speed assembly lines for wiring harnesses, which are used for critical applications, such as in aircraft. During high-speed assembly it is possible that many faulty crimps go undetected until long after assembly, and fail in service. The position and speed of the crimping jaw become factors as the high-speed crimp is formed. The work presented in this paper is designed to cover the more difficult and more subtle area of high-speed crimps by taking into account the rate change of the measurements. Building on the previous work, we present an analysis methodology, based on transmitted ultrasonic energy and timing of the first received pulse that is shown to correlate to the gauge of the crimp/ferrule combination and the position of the crimping jaw. Results demonstrating the detectability of a number of the crimp failure pathologies, such as missing strands, partially inserted wires and incomplete crimp compression, are presented. The ability of this technique to estimate crimp height, a mechanical measure of crimp quality, is discussed.

The accuracy and safety of fluoroscopically guided percutaneous pedicle screws in the lumbosacral junction and the lumbar spine: a review of 880 screws.

PubMed

Chiu, C K; Kwan, M K; Chan, C Y W; Schaefer, C; Hansen-Algenstaedt, N

2015-08-01

We undertook a retrospective study investigating the accuracy and safety of percutaneous pedicle screws placed under fluoroscopic guidance in the lumbosacral junction and lumbar spine. The CT scans of patients were chosen from two centres: European patients from University Medical Center Hamburg-Eppendorf, Germany, and Asian patients from the University of Malaya, Malaysia. Screw perforations were classified into grades 0, 1, 2 and 3. A total of 880 percutaneous pedicle screws from 203 patients were analysed: 614 screws from 144 European patients and 266 screws from 59 Asian patients. The mean age of the patients was 58.8 years (16 to 91) and there were 103 men and 100 women. The total rate of perforation was 9.9% (87 screws) with 7.4% grade 1, 2.0% grade 2 and 0.5% grade 3 perforations. The rate of perforation in Europeans was 10.4% and in Asians was 8.6%, with no significant difference between the two (p = 0.42). The rate of perforation was the highest in S1 (19.4%) followed by L5 (14.9%). The accuracy and safety of percutaneous pedicle screw placement are comparable to those cited in the literature for the open method of pedicle screw placement. Greater caution must be taken during the insertion of L5 and S1 percutaneous pedicle screws owing to their more angulated pedicles, the anatomical variations in their vertebral bodies and the morphology of the spinal canal at this location. ©2015 The British Editorial Society of Bone & Joint Surgery.

Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.

PubMed

Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan

2008-11-01

Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.

Ankle morphology amplifies calcaneus movement relative to triceps surae muscle shortening.

PubMed

Csapo, R; Hodgson, J; Kinugasa, R; Edgerton, V R; Sinha, S

2013-08-15

The present study investigated the mechanical role of the dorsoventral curvature of the Achilles tendon in the conversion of the shortening of the plantarflexor muscles into ankle joint rotation. Dynamic, sagittal-plane magnetic resonance spin-tagged images of the ankle joint were acquired in six healthy subjects during both passive and active plantarflexion movements driven by a magnetic resonance compatible servomotor-controlled foot-pedal device. Several points on these images were tracked to determine the 1) path and deformation of the Achilles tendon, 2) ankle's center of rotation, and 3) tendon moment arms. The degree of mechanical amplification of joint movement was calculated as the ratio of the displacements of the calcaneus and myotendinous junction. In plantarflexion, significant deflection of the Achilles tendon was evident in both the passive (165.7 ± 7.4°; 180° representing a straight tendon) and active trials (166.9 ± 8.8°). This bend in the dorsoventral direction acts to move the Achilles tendon closer to the ankle's center of rotation, resulting in an ∼5% reduction of moment arm length. Over the entire range of movement, the overall displacement of the calcaneus exceeded the displacement of the myotendinous junction by ∼37%, with the mechanical gains being smaller in dorsi- and larger in plantarflexed joint positions. This is the first study to assess noninvasively and in vivo using MRI the curvature of the Achilles tendon during both passive and active plantarflexion movements. The dorsoventral tendon curvature amplifies the shortening of the plantarflexor muscles, resulting in a greater displacement of the tendon's insertion into the calcaneus compared with its origin.

Self-locked aptamer probe mediated cascade amplification strategy for highly sensitive and selective detection of protein and small molecule.

PubMed

Li, Wei; Jiang, Wei; Wang, Lei

2016-10-12

In this work, a novel self-locked aptamer probe mediated cascade amplification strategy has been constructed for highly sensitive and specific detection of protein. First, the self-locked aptamer probe was designed with three functions: one was specific molecular recognition attributed to the aptamer sequence, the second was signal transduction owing to the transduction sequence, and the third was self-locking through the hybridization of the transduction sequence and part of the aptamer sequence. Then, the aptamer sequence specific recognized the target and folded into a three-way helix junction, leading to the release of the transduction sequence. Next, the 3'-end of this three-way junction acted as primer to trigger the strand displacement amplification (SDA), yielding a large amount of primers. Finally, the primers initiated the dual-exponential rolling circle amplification (DE-RCA) and generated numerous G-quadruples sequences. By inserting the fluorescent dye N-methyl mesoporphyrin IX (NMM), enhanced fluorescence signal was achieved. In this strategy, the self-locked aptamer probe was more stable to reduce the interference signals generated by the uncontrollable folding in unbounded state. Through the cascade amplification of SDA and DE-RCA, the sensitivity was further improved with a detection limit of 3.8 × 10(-16) mol/L for protein detection. Furthermore, by changing the aptamer sequence of the probe, sensitive and selective detection of adenosine has been also achieved, suggesting that the proposed strategy has good versatility and can be widely used in sensitive and selective detection of biomolecules. Copyright © 2016 Elsevier B.V. All rights reserved.

Ultrasonic inspection to quantify failure pathologies of crimped electrical connections

NASA Astrophysics Data System (ADS)

Cramer, K. Elliott; Perey, Daniel F.; Yost, William T.

2015-03-01

Previous work has shown that ultrasonic inspection provides a means of assessing electrical crimp quality that ensures the electrical and mechanical integrity of an initial crimp before the installation process is completed. The amplitude change of a compressional ultrasonic wave propagating at right angles to the wire axis and through the junction of a crimp termination was shown to correlate with the results of destructive pull tests, which is a standard for assessing crimp wire junction quality. Of additional concern are crimps made at high speed assembly lines for wiring harnesses, which are used for critical applications, such as in aircraft. During high-speed assembly it is possible that many faulty crimps go undetected until long after assembly, and fail in service. The position and speed of the crimping jaw become factors as the high-speed crimp is formed. The work presented in this paper is designed to cover the more difficult and more subtle area of high-speed crimps by taking into account the rate change of the measurements. Building on the previous work, we present an analysis methodology, based on transmitted ultrasonic energy and timing of the first received pulse that is shown to correlate to the gauge of the crimp/ferrule combination and the position of the crimping jaw. Results demonstrating the detectability of a number of the crimp failure pathologies, such as missing strands, partially inserted wires and incomplete crimp compression, are presented. The ability of this technique to estimate crimp height, a mechanical measure of crimp quality, is discussed.

Removing or Truncating Connexin 43 in Murine Osteocytes Alters Cortical Geometry, Nanoscale Morphology, and Tissue Mechanics in the Tibia

PubMed Central

Hammond, Max A.; Berman, Alycia G.; Pacheco-Costa, Rafael; Davis, Hannah M.; Plotkin, Lilian I.; Wallace, Joseph M.

2016-01-01

Gap junctions are formed from ubiquitously expressed proteins called connexins that allow the transfer of small signaling molecules between adjacent cells. Gap junctions are especially important for signaling between osteocytes and other bone cell types. The most abundant type of connexin in bone is connexin 43 (Cx43). The C-terminal domain of Cx43 is thought to be an important modulator of gap junction function but the role that this domain plays in regulating tissue-level mechanics is largely unknown. We hypothesized that the lack of the C-terminal domain of Cx43 would cause morphological and compositional changes as well as differences in how bone responds to reference point indentation (RPI) and fracture toughness testing. The effects of the C-terminal domain of Cx43 in osteocytes and other cell types were assessed in a murine model (C57BL/6 background). Mice with endogenous Cx43 in their osteocytes removed via a Cre-loxP system were crossed with knock-in mice which expressed Cx43 that lacked the C-terminal domain in all cell types due to the insertion of a truncated allele to produce the four groups used in the study. The main effect of removing the C-terminal domain from osteocytic Cx43 increased cortical mineral crystallinity (p=0.036) and decreased fracture toughness (p=0.017). The main effect of the presence of the C-terminal domain in other cell types increased trabecular thickness (p<0.001), cortical thickness (p=0.008), and average RPI unloading slope (p=0.004). Collagen morphology was altered when either osteocytes lacked Cx43 (p=0.008) or some truncated Cx43 was expressed in all cell types (p<0.001) compared to controls but not when only the truncated form of Cx43 was expressed in osteocytes (p=0.641). In conclusion, the presence of the C-terminal domain of Cx43 in osteocytes and other cell types is important to maintain normal structure and mechanical integrity of bone. PMID:27113527

DOP-2 D2-Like Receptor Regulates UNC-7 Innexins to Attenuate Recurrent Sensory Motor Neurons during C. elegans Copulation

PubMed Central

Correa, Paola A.; Gruninger, Todd

2015-01-01

Neuromodulation of self-amplifying circuits directs context-dependent behavioral executions. Although recurrent networks are found throughout the Caenorhabditis elegans connectome, few reports describe the mechanisms that regulate reciprocal neural activity during complex behavior. We used C. elegans male copulation to dissect how a goal-oriented motor behavior is regulated by recurrently wired sensory-motor neurons. As the male tail presses against the hermaphrodite's vulva, cholinergic and glutamatergic reciprocal innervations of post cloaca sensilla (PCS) neurons (PCA, PCB, and PCC), hook neurons (HOA, HOB), and their postsynaptic sex muscles execute rhythmic copulatory spicule thrusts. These repetitive spicule movements continue until the male shifts off the vulva or genital penetration is accomplished. However, the signaling mechanism that temporally and spatially restricts repetitive intromission attempts to vulva cues was unclear. Here, we report that confinement of spicule insertion attempts to the vulva is facilitated by D2-like receptor modulation of gap-junctions between PCB and the hook sensillum. We isolated a missense mutation in the UNC-7(L) gap-junction isoform, which perturbs DOP-2 signaling in the PCB neuron and its electrical partner, HOA. The glutamate-gated chloride channel AVR-14 is expressed in HOA. Our analysis of the unc-7 mutant allele indicates that when DOP-2 promotes UNC-7 electrical communication, AVR-14-mediated inhibitory signals pass from HOA to PCB. As a consequence, PCB is less receptive to be stimulated by its recurrent synaptic partner, PCA. Behavioral observations suggest that dopamine neuromodulation of UNC-7 ensures attenuation of recursive intromission attempts when the male disengages or is dislodged from the hermaphrodite genitalia. SIGNIFICANCE STATEMENT Using C. elegans male copulation as a model, we found that the neurotransmitter dopamine stimulates D2-like receptors in two sensory circuits to terminate futile behavioral loops. The D2-like receptors promote inhibitory electrical junction activity between a chemosensory and a mechanosensory circuit. Therefore, both systems are attenuated and the animal ceases the recursive behavior. PMID:26156999

Supramolecular Systems and Chemical Reactions in Single-Molecule Break Junctions.

PubMed

Li, Xiaohui; Hu, Duan; Tan, Zhibing; Bai, Jie; Xiao, Zongyuan; Yang, Yang; Shi, Jia; Hong, Wenjing

2017-04-01

The major challenges of molecular electronics are the understanding and manipulation of the electron transport through the single-molecule junction. With the single-molecule break junction techniques, including scanning tunneling microscope break junction technique and mechanically controllable break junction technique, the charge transport through various single-molecule and supramolecular junctions has been studied during the dynamic fabrication and continuous characterization of molecular junctions. This review starts from the charge transport characterization of supramolecular junctions through a variety of noncovalent interactions, such as hydrogen bond, π-π interaction, and electrostatic force. We further review the recent progress in constructing highly conductive molecular junctions via chemical reactions, the response of molecular junctions to external stimuli, as well as the application of break junction techniques in controlling and monitoring chemical reactions in situ. We suggest that beyond the measurement of single molecular conductance, the single-molecule break junction techniques provide a promising access to study molecular assembly and chemical reactions at the single-molecule scale.

Monolithic multi-color light emission/detection device

DOEpatents

Wanlass, Mark W.

1995-01-01

A single-crystal, monolithic, tandem, multi-color optical transceiver device is described, including (a) an InP substrate having upper and lower surfaces, (b) a first junction on the upper surface of the InP substrate, (c) a second junction on the first junction. The first junction is preferably GaInAsP of defined composition, and the second junction is preferably InP. The two junctions are lattice matched. The second junction has a larger energy band gap than the first junction. Additional junctions having successively larger energy band gaps may be included. The device is capable of simultaneous and distinct multi-color emission and detection over a single optical fiber.

Electronic thermometry in tunable tunnel junction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maksymovych, Petro

A tunable tunnel junction thermometry circuit includes a variable width tunnel junction between a test object and a probe. The junction width is varied and a change in thermovoltage across the junction with respect to the change in distance across the junction is determined. Also, a change in biased current with respect to a change in distance across the junction is determined. A temperature gradient across the junction is determined based on a mathematical relationship between the temperature gradient, the change in thermovoltage with respect to distance and the change in biased current with respect to distance. Thermovoltage may bemore » measured by nullifying a thermoelectric tunneling current with an applied voltage supply level. A piezoelectric actuator may modulate the probe, and thus the junction width, to vary thermovoltage and biased current across the junction. Lock-in amplifiers measure the derivatives of the thermovoltage and biased current modulated by varying junction width.« less

YBCO High-Temperature Superconducting Filters on M-Plane Sapphire Substrates

NASA Technical Reports Server (NTRS)

Sabataitis, J. C.; Mueller, C. H.; Miranda, F. A.; Warner, J.; Bhasin, K. B.

1996-01-01

Since the discovery of High Temperature Superconductors (HTS) in 1986, microwave circuits have been demonstrated using HTS films on various substrates. These HTS-based circuits have proven to operate with less power loss than their metallic film counterparts at 77 K. This translates into smaller and lighter microwave circuits for space communication systems such as multiplexer filter banks. High quality HTS films have conventionally been deposited on lanthanum aluminate (LaAlO3) substrates. However, LaAlO3 has a relative dielectric constant (epsilon(sub r)) of 24. With a epsilon(sub r) approx. 9.4-11.6, sapphire (Al2O3) would be a preferable substrate for the fabrication of HTS-based components since the lower dielectric constant would permit wider microstrip lines to be used in filter design, since the lower dielectric constant would permit wider microstrip lines to be used for a given characteristic impedance (Z(sub 0)), thus lowering the insertion losses and increasing the power handling capabilities of the devices. We report on the fabrication and characterization of YBa2Cu3O(7-delta) (YBCO) on M-plane sapphire bandpass filters at 4.0 GHz. For a YBCO 'hairpin' filter, a minimum insertion loss of 0.5 dB was measured at 77 K as compared with 1.4 dB for its gold counterpart. In an 'edge-coupled' configuration, the insertion loss went down from 0.9 dB for the gold film to 0.8 dB for the YBCO film at the same temperature.

Gap junctions contain different amounts of cholesterol which undergo unique sequestering processes during fiber cell differentiation in the embryonic chicken lens.

PubMed

Biswas, Sondip K; Lo, Woo-Kuen

2007-03-09

To determine the possible changes in the distribution of cholesterol in gap junction plaques during fiber cell differentiation and maturation in the embryonic chicken lens. The possible mechanism by which cholesterol is removed from gap junction plaques is also investigated. Filipin cytochemistry in conjunction with freeze-fracture TEM was used to visualize cholesterol, as represented by filipin-cholesterol complexes (FCCs) in gap junction plaques. Quantitative analysis on the heterogeneous distribution of cholesterol in gap junction plaques was conducted from outer and inner cortical regions. A novel technique combining filipin cytochemistry with freeze-fracture replica immunogold labeling (FRIL) was used to label Cx45.6 and Cx56 antibodies in cholesterol-containing gap junctions. Filipin cytochemistry and freeze-fracture TEM and thin-section TEM were used to examine the appearance and nature of the cholesterol-containing vesicular structures associated with gap junction plaques. Chicken lens fibers contain cholesterol-rich, cholesterol-intermediate and cholesterol-free gap junction populations in both outer and inner cortical regions. Filipin cytochemistry and FRIL studies confirmed that cholesterol-containing junctions were gap junctions. Quantitative analysis showed that approximately 86% of gap junctions in the outer cortical zone were cholesterol-rich gap junctions, whereas approximately 81% of gap junctions in the inner cortical zone were cholesterol-free gap junctions. A number of pleiomorphic cholesterol-rich vesicles of varying sizes were often observed in the gap junction plaques. They appear to be involved in the removal of cholesterol from gap junction plaques through endocytosis. Gap junctions in the young fibers are enriched with cholesterol because they are assembled in the unique cholesterol-rich cell membranes in the lens. A majority of cholesterol-rich gap junctions in the outer young fibers are transformed into cholesterol-free ones in the inner mature fibers during fiber cell maturation. A distinct endocytotic process appears to be involved in removing cholesterol from the cholesterol-containing gap junctions, and it may play a major role in the transformation of cholesterol-rich gap junctions into cholesterol-free ones during fiber cell maturation.

Monolithic multi-color light emission/detection device

DOEpatents

Wanlass, M.W.

1995-02-21

A single-crystal, monolithic, tandem, multi-color optical transceiver device is described, including (a) an InP substrate having upper and lower surfaces, (b) a first junction on the upper surface of the InP substrate, (c) a second junction on the first junction. The first junction is preferably GaInAsP of defined composition, and the second junction is preferably InP. The two junctions are lattice matched. The second junction has a larger energy band gap than the first junction. Additional junctions having successively larger energy band gaps may be included. The device is capable of simultaneous and distinct multi-color emission and detection over a single optical fiber. 5 figs.

The Escherichia coli O157:H7 cattle immuno-proteome includes outer membrane protein A (OmpA), a modulator of adherence to bovine recto-anal junction squamous epithelial (RSE) cells

PubMed Central

Kudva, Indira T.; Krastins, Bryan; Torres, Alfredo G.; Griffin, Robert W.; Sheng, Haiqing; Sarracino, David A.; Hovde, Carolyn J.; Calderwood, Stephen B.; John, Manohar

2015-01-01

SUMMARY Building on previous studies, we defined the repertoire of proteins comprising the immuno-proteome of E. coli O157:H7 (O157) cultured in DMEM supplemented with norepinephrine (NE; O157 immuno-proteome), a β-adrenergic hormone that regulates E. coli O157 gene expression in the gastrointestinal tract, using a variation of a novel proteomics-based platform proteome mining tool for antigen discovery, called Proteomics-based Expression Library Screening (PELS; Kudva et al., 2006). The E. coli O157 immuno-proteome (O157-IP) comprised 91 proteins, and included those identified previously using PELS, and also proteins comprising DMEM- and bovine rumen fluid- proteomes. Outer membrane protein A (OmpA), a common component of the above proteomes, and reportedly a contributor to E. coli O157 adherence to cultured Hep-2 epithelial cells, was interestingly found to be a modulator rather than a contributor to E. coli O157 adherence to bovine recto-anal junction squamous epithelial (RSE) cells. Our results point to a role for yet to be identified members of the O157-IP in E. coli O157 adherence to RSE-cells, and additionally implicate a possible role for the OmpA regulator, TdcA, in the expression of such adhesins. Our observations have implications for development of efficacious vaccines for preventing E. coli O157 colonization of the bovine gastrointestinal tract. PMID:25643951

Connexin Type and Fluorescent Protein Fusion Tag Determine Structural Stability of Gap Junction Plaques.

PubMed

Stout, Randy F; Snapp, Erik Lee; Spray, David C

2015-09-25

Gap junctions (GJs) are made up of plaques of laterally clustered intercellular channels and the membranes in which the channels are embedded. Arrangement of channels within a plaque determines subcellular distribution of connexin binding partners and sites of intercellular signaling. Here, we report the discovery that some connexin types form plaque structures with strikingly different degrees of fluidity in the arrangement of the GJ channel subcomponents of the GJ plaque. We uncovered this property of GJs by applying fluorescence recovery after photobleaching to GJs formed from connexins fused with fluorescent protein tags. We found that connexin 26 (Cx26) and Cx30 GJs readily diffuse within the plaque structures, whereas Cx43 GJs remain persistently immobile for more than 2 min after bleaching. The cytoplasmic C terminus of Cx43 was required for stability of Cx43 plaque arrangement. We provide evidence that these qualitative differences in GJ arrangement stability reflect endogenous characteristics, with the caveat that the sizes of the GJs examined were necessarily large for these measurements. We also uncovered an unrecognized effect of non-monomerized fluorescent protein on the dynamically arranged GJs and the organization of plaques composed of multiple connexin types. Together, these findings redefine our understanding of the GJ plaque structure and should be considered in future studies using fluorescent protein tags to probe dynamics of highly ordered protein complexes. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Gap/silicon Tandem Solar Cell with Extended Temperature Range

NASA Technical Reports Server (NTRS)

Landis, Geoffrey A. (Inventor)

2006-01-01

A two-junction solar cell has a bottom solar cell junction of crystalline silicon, and a top solar cell junction of gallium phosphide. A three (or more) junction solar cell has bottom solar cell junctions of silicon, and a top solar cell junction of gallium phosphide. The resulting solar cells exhibit improved extended temperature operation.

High Efficiency Quantum Well Waveguide Solar Cells and Methods for Constructing the Same

NASA Technical Reports Server (NTRS)

Sood, Ashok K. (Inventor); Welser, Roger E. (Inventor)

2014-01-01

Photon absorption, and thus current generation, is hindered in conventional thin-film solar cell designs, including quantum well structures, by the limited path length of incident light passing vertically through the device. Optical scattering into lateral waveguide structures provides a physical mechanism to increase photocurrent generation through in-plane light trapping. However, the insertion of wells of high refractive index material with lower energy gap into the device structure often results in lower voltage operation, and hence lower photovoltaic power conversion efficiency. The voltage output of an InGaAs quantum well waveguide photovoltaic device can be increased by employing a III-V material structure with an extended wide band gap emitter heterojunction. Analysis of the light IV characteristics reveals that non-radiative recombination components of the underlying dark diode current have been reduced, exposing the limiting radiative recombination component and providing a pathway for realizing solar-electric conversion efficiency of 30% or more in single junction cells.

Unilateral lag screw fixation of isolated non-union atlas lateral mass fracture: a new technical note.

PubMed

Farrokhi, Majid Reza; Kiani, Arash; Rezaei, Hamid

2018-01-15

We describe a novel and new technique of posterior unilateral lag screw fixation of non-union atlas lateral mass fracture. A 46-year-old man presented with cervical pain and tenderness after a vehicle turn over accident and he was diagnosed to have left atlas lateral mass fracture. He was initially treated by immobilization using Minerva orthosis. About 2 months later, he developed severe neck pain and limitation of motion and thus he was scheduled for operation due to non-union atlas lateral mass fracture. A 28 mm lag screw was inserted under anterior-posterior and lateral fluoroscopic views. The entrance point was at the dorsal aspect of left atlas posterior arc at its junction to the lateral mass, and by using the trajectory of 10 degrees medial and 22 degrees cephalad fracture reduction was achieved. Unilateral lag screw fixation of atlas fractures is an appropriate, safe and effective surgical technique for the management of unilateral atlas fractures.

LCR-initiated rearrangements at the IDS locus, completed with Alu-mediated recombination or non-homologous end joining.

PubMed

Oshima, Junko; Lee, Jennifer A; Breman, Amy M; Fernandes, Priscilla H; Babovic-Vuksanovic, Dusica; Ward, Patricia A; Wolfe, Lynne A; Eng, Christine M; Del Gaudio, Daniela

2011-07-01

Mucopolysaccharidosis type II (MPS II) is caused by mutations in the IDS gene, which encodes the lysosomal enzyme iduronate-2-sulfatase. In ∼20% of MPS II patients the disorder is caused by gross IDS structural rearrangements. We identified two male cases harboring complex rearrangements involving the IDS gene and the nearby pseudogene, IDSP1, which has been annotated as a low-copy repeat (LCR). In both cases the rearrangement included a partial deletion of IDS and an inverted insertion of the neighboring region. In silico analyses revealed the presence of repetitive elements as well as LCRs at the junctions of rearrangements. Our models illustrate two alternative consequences of rearrangements initiated by non-allelic homologous recombination of LCRs: resolution by a second recombination event (that is, Alu-mediated recombination), or resolution by non-homologous end joining repair. These complex rearrangements have the potential to be recurrent and may be present among those MSP II cases with previously uncharacterized aberrations involving IDS.

Development, optimization, and single laboratory validation of an event-specific real-time PCR method for the detection and quantification of Golden Rice 2 using a novel taxon-specific assay.

PubMed

Jacchia, Sara; Nardini, Elena; Savini, Christian; Petrillo, Mauro; Angers-Loustau, Alexandre; Shim, Jung-Hyun; Trijatmiko, Kurniawan; Kreysa, Joachim; Mazzara, Marco

2015-02-18

In this study, we developed, optimized, and in-house validated a real-time PCR method for the event-specific detection and quantification of Golden Rice 2, a genetically modified rice with provitamin A in the grain. We optimized and evaluated the performance of the taxon (targeting rice Phospholipase D α2 gene)- and event (targeting the 3' insert-to-plant DNA junction)-specific assays that compose the method as independent modules, using haploid genome equivalents as unit of measurement. We verified the specificity of the two real-time PCR assays and determined their dynamic range, limit of quantification, limit of detection, and robustness. We also confirmed that the taxon-specific DNA sequence is present in single copy in the rice genome and verified its stability of amplification across 132 rice varieties. A relative quantification experiment evidenced the correct performance of the two assays when used in combination.

The preclinical discovery and development of dolutegravir for the treatment of HIV.

PubMed

Bailly, Fabrice; Cotelle, Philippe

2015-01-01

Integration of the viral genome into the host cell chromatin is a central step in the replication cycle of HIV. Blocking the viral integrase (IN) enzyme therefore provides an attractive therapeutic strategy, as evidenced by the recent clinical approval of three IN strand transfer inhibitors. Dolutegravir is a therapy that is unique in its ability to evade HIV drug resistance in treatment-naïve patients. This review starts by providing a brief summary of the history of HIV-1 IN inhibitors. The authors follow this with details of the discovery and preclinical and clinical developments of dolutegravir. Finally, the authors provide details of dolutegravir's post-launch including the launch of the combination pill of dolutegravir, abacavir and lamivudine in August 2014. The launch of raltegravir, the first IN inhibitor from Merck & Co., has created new hopes for the patient. Indeed, pharmaceutical companies have not lost courage by attempting to address the major drawbacks of this first-in-class molecule. And while the drug elvitegravir has been inserted into a four-drug combination pill providing a once-daily dosing alternative, dolutegravir has demonstrated superiority in terms of its efficacy and resistance.

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification.

PubMed

Herner, András; Marjanovic, Jasmina; Lewandowski, Tracey M; Marin, Violeta; Patterson, Melanie; Miesbauer, Laura; Ready, Damien; Williams, Jon; Vasudevan, Anil; Lin, Qing

2016-11-09

Photoaffinity labels are powerful tools for dissecting ligand-protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C-H/X-H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery.

Exploring the world of human development and reproduction.

PubMed

Red-Horse, Kristy; Drake, Penelope M; Fisher, Susan

2014-01-01

Susan Fisher has spent her career studying human development, proteomics, and the intersection between the two. When she began studying human placentation, there had been extensive descriptive studies of this fascinating organ that intertwines with the mother's vasculature during pregnancy. Susan can be credited with numerous major findings on the mechanisms that regulate placental cytotrophoblast invasion. These include the discovery that cytotrophoblasts undergo vascular mimicry to insert themselves into uterine arteries, the finding that oxygen tension greatly effects placentation, and identifying how these responses go awry in pregnancy complications such as preeclamsia. Other important work has focused on the effect of post-translational modifications such as glycosylation on bacterial adhesion and reproduction. Susan has also forayed into the world of proteomics to identify cancer biomarkers. Because her work is truly groundbreaking, many of these findings inspire research in other laboratories around the world resulting in numerous follow up papers. Likewise, her mentoring and support inspires young scientists to go on and make their own important discoveries. In this interview, Susan shares what drove her science, how she continued to do important research while balancing other aspects of life, and provides insights for the next generation.

2-Aryl-5-carboxytetrazole as a New Photoaffinity Label for Drug Target Identification

PubMed Central

2016-01-01

Photoaffinity labels are powerful tools for dissecting ligand–protein interactions, and they have a broad utility in medicinal chemistry and drug discovery. Traditional photoaffinity labels work through nonspecific C–H/X–H bond insertion reactions with the protein of interest by the highly reactive photogenerated intermediate. Herein, we report a new photoaffinity label, 2-aryl-5-carboxytetrazole (ACT), that interacts with the target protein via a unique mechanism in which the photogenerated carboxynitrile imine reacts with a proximal nucleophile near the target active site. In two distinct case studies, we demonstrate that the attachment of ACT to a ligand does not significantly alter the binding affinity and specificity of the parent drug. Compared with diazirine and benzophenone, two commonly used photoaffinity labels, in two case studies ACT showed higher photo-cross-linking yields toward their protein targets in vitro based on mass spectrometry analysis. In the in situ target identification studies, ACT successfully captured the desired targets with an efficiency comparable to the diazirine. We expect that further development of this class of photoaffinity labels will lead to a broad range of applications across target identification, and validation and elucidation of the binding site in drug discovery. PMID:27740749

Gap and tight junctions in the formation of feather branches: A descriptive ultrastructural study.

PubMed

Alibardi, Lorenzo

2010-08-20

The present study has focused on the distribution and ultrastructure of gap and tight junctions responsible for the formation of the barb/barbule branching in developing feathers using immunocytochemical detection. Apart from desmosomes, both tight and gap junctions are present between differentiating barb/barbule cells and during keratinization. While gap junctions are rare along the perimeter of these cells, tight junctions tend to remain localized in nodes joining barbule cells and between barb cells of the ramus. Occludin and connexin-26 but not connexin-43 have been detected between barb medullary, barb cortical and barbule cells during formation of barbs. Gap junctions are present in supportive cells located in the vicinity of barbule cells and destined to degenerate, but no close junctions are present between supportive and barb/barbule cells. Close junctions mature into penta-laminar junctions that are present between mature barb/barbule cells. Immunolabeling for occludin and Cx26 is rare along these cornified junctions. The junctions allow barb/barbule cells to remain connected until feather-keratin form the mature corneous syncytium that constitutes the barbs. A discussion of the role of gap and tight junctions during feather morphogenesis is presented. 2010 Elsevier GmbH. All rights reserved.

An EMMPRIN-γ-catenin-Nm23 complex drives ATP production and actomyosin contractility at endothelial junctions.

PubMed

Moreno, Vanessa; Gonzalo, Pilar; Gómez-Escudero, Jesús; Pollán, Ángela; Acín-Pérez, Rebeca; Breckenridge, Mark; Yáñez-Mó, María; Barreiro, Olga; Orsenigo, Fabrizio; Kadomatsu, Kenji; Chen, Christopher S; Enríquez, José A; Dejana, Elisabetta; Sánchez-Madrid, Francisco; Arroyo, Alicia G

2014-09-01

Cell-cell adhesions are important sites through which cells experience and resist forces. In endothelial cells, these forces regulate junction dynamics and determine endothelial barrier strength. We identify the Ig superfamily member EMMPRIN (also known as basigin) as a coordinator of forces at endothelial junctions. EMMPRIN localization at junctions correlates with endothelial junction strength in different mouse vascular beds. Accordingly, EMMPRIN-deficient mice show altered junctions and increased junction permeability. Lack of EMMPRIN alters the localization and function of VE-cadherin (also known as cadherin-5) by decreasing both actomyosin contractility and tugging forces at endothelial cell junctions. EMMPRIN ensures proper actomyosin-driven maturation of competent endothelial junctions by forming a molecular complex with γ-catenin (also known as junction plakoglobin) and Nm23 (also known as NME1), a nucleoside diphosphate kinase, thereby locally providing ATP to fuel the actomyosin machinery. These results provide a novel mechanism for the regulation of actomyosin contractility at endothelial junctions and might have broader implications in biological contexts such as angiogenesis, collective migration and tissue morphogenesis by coupling compartmentalized energy production to junction assembly. © 2014. Published by The Company of Biologists Ltd.

An EMMPRIN–γ-catenin–Nm23 complex drives ATP production and actomyosin contractility at endothelial junctions

PubMed Central

Moreno, Vanessa; Gonzalo, Pilar; Gómez-Escudero, Jesús; Pollán, Ángela; Acín-Pérez, Rebeca; Breckenridge, Mark; Yáñez-Mó, María; Barreiro, Olga; Orsenigo, Fabrizio; Kadomatsu, Kenji; Chen, Christopher S.; Enríquez, José A.; Dejana, Elisabetta; Sánchez-Madrid, Francisco; Arroyo, Alicia G.

2014-01-01

ABSTRACT Cell–cell adhesions are important sites through which cells experience and resist forces. In endothelial cells, these forces regulate junction dynamics and determine endothelial barrier strength. We identify the Ig superfamily member EMMPRIN (also known as basigin) as a coordinator of forces at endothelial junctions. EMMPRIN localization at junctions correlates with endothelial junction strength in different mouse vascular beds. Accordingly, EMMPRIN-deficient mice show altered junctions and increased junction permeability. Lack of EMMPRIN alters the localization and function of VE-cadherin (also known as cadherin-5) by decreasing both actomyosin contractility and tugging forces at endothelial cell junctions. EMMPRIN ensures proper actomyosin-driven maturation of competent endothelial junctions by forming a molecular complex with γ-catenin (also known as junction plakoglobin) and Nm23 (also known as NME1), a nucleoside diphosphate kinase, thereby locally providing ATP to fuel the actomyosin machinery. These results provide a novel mechanism for the regulation of actomyosin contractility at endothelial junctions and might have broader implications in biological contexts such as angiogenesis, collective migration and tissue morphogenesis by coupling compartmentalized energy production to junction assembly. PMID:24994937

Abundance and ultrastructural diversity of neuronal gap junctions in the OFF and ON sublaminae of the inner plexiform layer of rat and mouse retina.

PubMed

Kamasawa, N; Furman, C S; Davidson, K G V; Sampson, J A; Magnie, A R; Gebhardt, B R; Kamasawa, M; Yasumura, T; Zumbrunnen, J R; Pickard, G E; Nagy, J I; Rash, J E

2006-11-03

Neuronal gap junctions are abundant in both outer and inner plexiform layers of the mammalian retina. In the inner plexiform layer (IPL), ultrastructurally-identified gap junctions were reported primarily in the functionally-defined and anatomically-distinct ON sublamina, with few reported in the OFF sublamina. We used freeze-fracture replica immunogold labeling and confocal microscopy to quantitatively analyze the morphologies and distributions of neuronal gap junctions in the IPL of adult rat and mouse retina. Under "baseline" conditions (photopic illumination/general anesthesia), 649 neuronal gap junctions immunogold-labeled for connexin36 were identified in rat IPL, of which 375 were photomapped to OFF vs. ON sublaminae. In contrast to previous reports, the volume-density of gap junctions was equally abundant in both sublaminae. Five distinctive morphologies of gap junctions were identified: conventional crystalline and non-crystalline "plaques" (71% and 3%), plus unusual "string" (14%), "ribbon" (7%) and "reticular" (2%) forms. Plaque and reticular gap junctions were distributed throughout the IPL. However, string and ribbon gap junctions were restricted to the OFF sublamina, where they represented 48% of gap junctions in that layer. In string and ribbon junctions, curvilinear strands of connexons were dispersed over 5 to 20 times the area of conventional plaques having equal numbers of connexons. To define morphologies of gap junctions under different light-adaptation conditions, we examined an additional 1150 gap junctions from rats and mice prepared after 30 min of photopic, mesopic and scotopic illumination, with and without general anesthesia. Under these conditions, string and ribbon gap junctions remained abundant in the OFF sublamina and absent in the ON sublamina. Abundant gap junctions in the OFF sublamina of these two rodents with rod-dominant retinas revealed previously-undescribed but extensive pathways for inter-neuronal communication; and the wide dispersion of connexons in string and ribbon gap junctions suggests unique structural features of gap junctional coupling in the OFF vs. ON sublamina.

1.00 MeV proton radiation resistance studies of single-junction and single gap dual-junction amorphous-silicon alloy solar cells

NASA Technical Reports Server (NTRS)

Abdulaziz, Salman; Payson, J. S.; Li, Yang; Woodyard, James R.

1990-01-01

A comparative study of the radiation resistance of a-Si:H and a-SiGe:H single-junction and a-Si:H dual-junction solar cells was conducted. The cells were irradiated with 1.00-MeV protons with fluences of 1.0 x 10 to the 14th, 5.0 x 10 to the 14th and 1.0 x 10 to the 15th/sq cm and characterized using I-V and quantum efficiency measurements. The radiation resistance of single-junction cells cannot be used to explain the behavior of dual-junction cells at a fluence of 1.0 x 10 to the 15th/sq cm. The a-Si H single-junction cells degraded the least of the three cells; a-SiGe:H single-junction cells showed the largest reduction in short-circuit current, while a-Si:H dual-junction cells exhibited the largest degradation in the open-circuit voltage. The quantum efficiency of the cells degraded more in the red part of the spectrum; the bottom junction degrades first in dual-junction cells.

Fabrication of magnetic tunnel junctions with epitaxial and textured ferromagnetic layers

DOEpatents

Chang, Y. Austin; Yang, Jianhua Joshua

2008-11-11

This invention relates to magnetic tunnel junctions and methods for making the magnetic tunnel junctions. The magnetic tunnel junctions include a tunnel barrier oxide layer sandwiched between two ferromagnetic layers both of which are epitaxial or textured with respect to the underlying substrate upon which the magnetic tunnel junctions are grown. The magnetic tunnel junctions provide improved magnetic properties, sharper interfaces and few defects.

Possible involvement of gap junctions in the barrier function of tight junctions of brain and lung endothelial cells.

PubMed

Nagasawa, Kunihiko; Chiba, Hideki; Fujita, Hiroki; Kojima, Takashi; Saito, Tsuyoshi; Endo, Toshiaki; Sawada, Norimasa

2006-07-01

Gap-junction plaques are often observed with tight-junction strands of vascular endothelial cells but the molecular interaction and functional relationships between these two junctions remain obscure. We herein show that gap-junction proteins connexin40 (Cx40) and Cx43 are colocalized and coprecipitated with tight-junction molecules occludin, claudin-5, and ZO-1 in porcine blood-brain barrier (BBB) endothelial cells. Gap junction blockers 18beta-glycyrrhetinic acid (18beta-GA) and oleamide (OA) did not influence expression of Cx40, Cx43, occludin, claudin-5, junctional adhesion molecule (JAM)-A, JAM-B, JAM-C, or ZO-1, or their subcellular localization in the porcine BBB endothelial cells. In contrast, these gap-junction blocking agents inhibited the barrier function of tight junctions in cells, determined by measurement of transendothelial electrical resistance and paracellular flux of mannitol and inulin. 18beta-GA also significantly reduced the barrier property in rat lung endothelial (RLE) cells expressing doxycycline-induced claudin-1, but did not change the interaction between Cx43 and either claudin-1 or ZO-1, nor their expression levels or subcellular distribution. These findings suggest that Cx40- and/or Cx43-based gap junctions might be required to maintain the endothelial barrier function without altering the expression and localization of the tight-junction components analyzed. Copyright 2006 Wiley-Liss, Inc.

Research and develop locking design for NJDOT junction boxes : final report, April 2009.

DOT National Transportation Integrated Search

2009-04-01

The report outlines the guidelines for securing electrical junction box covers to the junction box to prevent vandalism. The report provides details drawings that show various methods for securing the junction box cover to the junction box.

Framing Neuro-Glia Coupling in Antiepileptic Drug Design.

PubMed

Kardos, Julianna; Szabó, Zsolt; Héja, László

2016-02-11

We delineate perspectives for the design and discovery of antiepileptic drugs (AEDs) with fewer side effects by focusing on astroglial modulation of spatiotemporal seizure dynamics. It is now recognized that the major inhibitory neurotransmitter of the brain, γ-aminobutyric acid (GABA), can be released through the reversal of astroglial GABA transporters. Synaptic spillover and subsequent glutamate (Glu) uptake in neighboring astrocytes evoke replacement of extracellular Glu for GABA, driving neurons away from the seizure threshold. Attenuation of synaptic signaling by this negative feedback through the interplay of Glu and GABA transporters of adjacent astroglia can result in shortened seizures. By contrast, long-range activation of astroglia through gap junctions may promote recurrent seizures on the model of pharmacoresistant temporal lobe epilepsy. From their first detection to our current understanding, we identify various targets that shape both short- and long-range neuro-astroglia coupling, as these are manifest in epilepsy phenomena and in the associated research promotions of AED.

Metal oxides for optoelectronic applications.

PubMed

Yu, Xinge; Marks, Tobin J; Facchetti, Antonio

2016-04-01

Metal oxides (MOs) are the most abundant materials in the Earth's crust and are ingredients in traditional ceramics. MO semiconductors are strikingly different from conventional inorganic semiconductors such as silicon and III-V compounds with respect to materials design concepts, electronic structure, charge transport mechanisms, defect states, thin-film processing and optoelectronic properties, thereby enabling both conventional and completely new functions. Recently, remarkable advances in MO semiconductors for electronics have been achieved, including the discovery and characterization of new transparent conducting oxides, realization of p-type along with traditional n-type MO semiconductors for transistors, p-n junctions and complementary circuits, formulations for printing MO electronics and, most importantly, commercialization of amorphous oxide semiconductors for flat panel displays. This Review surveys the uniqueness and universality of MOs versus other unconventional electronic materials in terms of materials chemistry and physics, electronic characteristics, thin-film fabrication strategies and selected applications in thin-film transistors, solar cells, diodes and memories.

Metal oxides for optoelectronic applications

NASA Astrophysics Data System (ADS)

Yu, Xinge; Marks, Tobin J.; Facchetti, Antonio

2016-04-01

Metal oxides (MOs) are the most abundant materials in the Earth's crust and are ingredients in traditional ceramics. MO semiconductors are strikingly different from conventional inorganic semiconductors such as silicon and III-V compounds with respect to materials design concepts, electronic structure, charge transport mechanisms, defect states, thin-film processing and optoelectronic properties, thereby enabling both conventional and completely new functions. Recently, remarkable advances in MO semiconductors for electronics have been achieved, including the discovery and characterization of new transparent conducting oxides, realization of p-type along with traditional n-type MO semiconductors for transistors, p-n junctions and complementary circuits, formulations for printing MO electronics and, most importantly, commercialization of amorphous oxide semiconductors for flat panel displays. This Review surveys the uniqueness and universality of MOs versus other unconventional electronic materials in terms of materials chemistry and physics, electronic characteristics, thin-film fabrication strategies and selected applications in thin-film transistors, solar cells, diodes and memories.

The Molecular Interaction of CAR and JAML Recruits the Central Cell Signal Transducer PI3K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verdino, Petra; Witherden, Deborah A.; Havran, Wendy L.

Coxsackie and adenovirus receptor (CAR) is the primary cellular receptor for group B coxsackieviruses and most adenovirus serotypes and plays a crucial role in adenoviral gene therapy. Recent discovery of the interaction between junctional adhesion molecule-like protein (JAML) and CAR uncovered important functional roles in immunity, inflammation, and tissue homeostasis. Crystal structures of JAML ectodomain (2.2 angstroms) and its complex with CAR (2.8 angstroms) reveal an unusual immunoglobulin-domain assembly for JAML and a charged interface that confers high specificity. Biochemical and mutagenesis studies illustrate how CAR-mediated clustering of JAML recruits phosphoinositide 3-kinase (P13K) to a JAML intracellular sequence motif asmore » delineated for the {alpha}{beta} T cell costimulatory receptor CD28. Thus, CAR and JAML are cell signaling receptors of the immune system with implications for asthma, cancer, and chronic nonhealing wounds.« less

Fabrication of Circuit QED Quantum Processors, Part 2: Advanced Semiconductor Manufacturing Perspectives

NASA Astrophysics Data System (ADS)

Michalak, D. J.; Bruno, A.; Caudillo, R.; Elsherbini, A. A.; Falcon, J. A.; Nam, Y. S.; Poletto, S.; Roberts, J.; Thomas, N. K.; Yoscovits, Z. R.; Dicarlo, L.; Clarke, J. S.

Experimental quantum computing is rapidly approaching the integration of sufficient numbers of quantum bits for interesting applications, but many challenges still remain. These challenges include: realization of an extensible design for large array scale up, sufficient material process control, and discovery of integration schemes compatible with industrial 300 mm fabrication. We present recent developments in extensible circuits with vertical delivery. Toward the goal of developing a high-volume manufacturing process, we will present recent results on a new Josephson junction process that is compatible with current tooling. We will then present the improvements in NbTiN material uniformity that typical 300 mm fabrication tooling can provide. While initial results on few-qubit systems are encouraging, advanced processing control is expected to deliver the improvements in qubit uniformity, coherence time, and control required for larger systems. Research funded by Intel Corporation.

Discovery of stable skyrmionic state in ferroelectric nanocomposites

NASA Astrophysics Data System (ADS)

Nahas, Y.; Prokhorenko, S.; Louis, L.; Gui, Z.; Kornev, I.; Bellaiche, L.

2015-10-01

Non-coplanar swirling field textures, or skyrmions, are now widely recognized as objects of both fundamental interest and technological relevance. So far, skyrmions were amply investigated in magnets, where due to the presence of chiral interactions, these topological objects were found to be intrinsically stabilized. Ferroelectrics on the other hand, lacking such chiral interactions, were somewhat left aside in this quest. Here we demonstrate, via the use of a first-principles-based framework, that skyrmionic configuration of polarization can be extrinsically stabilized in ferroelectric nanocomposites. The interplay between the considered confined geometry and the dipolar interaction underlying the ferroelectric phase instability induces skyrmionic configurations. The topological structure of the obtained electrical skyrmion can be mapped onto the topology of domain-wall junctions. Furthermore, the stabilized electrical skyrmion can be as small as a few nanometers, thus revealing prospective skyrmion-based applications of ferroelectric nanocomposites.

Four-junction superconducting circuit

PubMed Central

Qiu, Yueyin; Xiong, Wei; He, Xiao-Ling; Li, Tie-Fu; You, J. Q.

2016-01-01

We develop a theory for the quantum circuit consisting of a superconducting loop interrupted by four Josephson junctions and pierced by a magnetic flux (either static or time-dependent). In addition to the similarity with the typical three-junction flux qubit in the double-well regime, we demonstrate the difference of the four-junction circuit from its three-junction analogue, including its advantages over the latter. Moreover, the four-junction circuit in the single-well regime is also investigated. Our theory provides a tool to explore the physical properties of this four-junction superconducting circuit. PMID:27356619

Injectable, cellular-scale optoelectronics with applications for wireless optogenetics.

PubMed

Kim, Tae-il; McCall, Jordan G; Jung, Yei Hwan; Huang, Xian; Siuda, Edward R; Li, Yuhang; Song, Jizhou; Song, Young Min; Pao, Hsuan An; Kim, Rak-Hwan; Lu, Chaofeng; Lee, Sung Dan; Song, Il-Sun; Shin, Gunchul; Al-Hasani, Ream; Kim, Stanley; Tan, Meng Peun; Huang, Yonggang; Omenetto, Fiorenzo G; Rogers, John A; Bruchas, Michael R

2013-04-12

Successful integration of advanced semiconductor devices with biological systems will accelerate basic scientific discoveries and their translation into clinical technologies. In neuroscience generally, and in optogenetics in particular, the ability to insert light sources, detectors, sensors, and other components into precise locations of the deep brain yields versatile and important capabilities. Here, we introduce an injectable class of cellular-scale optoelectronics that offers such features, with examples of unmatched operational modes in optogenetics, including completely wireless and programmed complex behavioral control over freely moving animals. The ability of these ultrathin, mechanically compliant, biocompatible devices to afford minimally invasive operation in the soft tissues of the mammalian brain foreshadow applications in other organ systems, with potential for broad utility in biomedical science and engineering.

Gravity Recovery and Interior Laboratory (GRAIL) Mission: Status at the Initiation of the Science Mapping Phase

NASA Technical Reports Server (NTRS)

Zuber, Maria T.; Smith, David E.; Asmar, Sami W.; Alomon; Konopliv, Alexander S.; Lemoine, Frank G.; Melosh, H. Jay; Neumann, Gregory A.; Phillips. Roger J.; Solomon, Sean C.;

Scalable human ES culture for therapeutic use: propagation, differentiation, genetic modification and regulatory issues.

PubMed

Rao, M

2008-01-01

Embryonic stem cells unlike most adult stem cell populations can replicate indefinitely while preserving genetic, epigenetic, mitochondrial and functional profiles. ESCs are therefore an excellent candidate cell type for providing a bank of cells for allogenic therapy and for introducing targeted genetic modifications for therapeutic intervention. This ability of prolonged self-renewal of stem cells and the unique advantages that this offers for gene therapy, discovery efforts, cell replacement, personalized medicine and other more direct applications requires the resolution of several important manufacturing, gene targeting and regulatory issues. In this review, we assess some of the advance made in developing scalable culture systems, improvement in vector design and gene insertion technology and the changing regulatory landscape.

TnpPred: A Web Service for the Robust Prediction of Prokaryotic Transposases

PubMed Central

Riadi, Gonzalo; Medina-Moenne, Cristobal; Holmes, David S.

2012-01-01

Transposases (Tnps) are enzymes that participate in the movement of insertion sequences (ISs) within and between genomes. Genes that encode Tnps are amongst the most abundant and widely distributed genes in nature. However, they are difficult to predict bioinformatically and given the increasing availability of prokaryotic genomes and metagenomes, it is incumbent to develop rapid, high quality automatic annotation of ISs. This need prompted us to develop a web service, termed TnpPred for Tnp discovery. It provides better sensitivity and specificity for Tnp predictions than given by currently available programs as determined by ROC analysis. TnpPred should be useful for improving genome annotation. The TnpPred web service is freely available for noncommercial use. PMID:23251097

Superstrate sub-cell voltage-matched multijunction solar cells

DOEpatents

Mascarenhas, Angelo; Alberi, Kirstin

2016-03-15

Voltage-matched thin film multijunction solar cell and methods of producing cells having upper CdTe pn junction layers formed on a transparent substrate which in the completed device is operatively positioned in a superstate configuration. The solar cell also includes a lower pn junction formed independently of the CdTe pn junction and an insulating layer between CdTe and lower pn junctions. The voltage-matched thin film multijunction solar cells further include a parallel connection between the CdTe pn junction and lower pn junctions to form a two-terminal photonic device. Methods of fabricating devices from independently produced upper CdTe junction layers and lower junction layers are also disclosed.

Effect of solar-cell junction geometry on open-circuit voltage

NASA Technical Reports Server (NTRS)

Weizer, V. G.; Godlewski, M. P.

1985-01-01

Simple analytical models have been found that adequately describe the voltage behavior of both the stripe junction and dot junction grating cells as a function of junction area. While the voltage in the former case is found to be insensitive to junction area reduction, significant voltage increases are shown to be possible for the dot junction cell. With regard to cells in which the junction area has been increased in a quest for better performance, it was found that (1) texturation does not affect the average saturation current density J0, indicating that the texturation process is equivalent to a simple extension of junction area by a factor of square root of 3 and (2) the vertical junction cell geometry produces a sizable decrease in J0 that, unfortunately, is more than offset by the effects of attendant areal increases.

Anisotropic-Scale Junction Detection and Matching for Indoor Images.

PubMed

Xue, Nan; Xia, Gui-Song; Bai, Xiang; Zhang, Liangpei; Shen, Weiming

Junctions play an important role in characterizing local geometrical structures of images, and the detection of which is a longstanding but challenging task. Existing junction detectors usually focus on identifying the location and orientations of junction branches while ignoring their scales, which, however, contain rich geometries of images. This paper presents a novel approach for junction detection and characterization, which especially exploits the locally anisotropic geometries of a junction and estimates its scales by relying on an a-contrario model. The output junctions are with anisotropic scales, saying that a scale parameter is associated with each branch of a junction and are thus named as anisotropic-scale junctions (ASJs). We then apply the new detected ASJs for matching indoor images, where there are dramatic changes of viewpoints and the detected local visual features, e.g., key-points, are usually insufficient and lack distinctive ability. We propose to use the anisotropic geometries of our junctions to improve the matching precision of indoor images. The matching results on sets of indoor images demonstrate that our approach achieves the state-of-the-art performance on indoor image matching.Junctions play an important role in characterizing local geometrical structures of images, and the detection of which is a longstanding but challenging task. Existing junction detectors usually focus on identifying the location and orientations of junction branches while ignoring their scales, which, however, contain rich geometries of images. This paper presents a novel approach for junction detection and characterization, which especially exploits the locally anisotropic geometries of a junction and estimates its scales by relying on an a-contrario model. The output junctions are with anisotropic scales, saying that a scale parameter is associated with each branch of a junction and are thus named as anisotropic-scale junctions (ASJs). We then apply the new detected ASJs for matching indoor images, where there are dramatic changes of viewpoints and the detected local visual features, e.g., key-points, are usually insufficient and lack distinctive ability. We propose to use the anisotropic geometries of our junctions to improve the matching precision of indoor images. The matching results on sets of indoor images demonstrate that our approach achieves the state-of-the-art performance on indoor image matching.

High affinity choline uptake (HACU) and choline acetyltransferase (ChAT) activity in neuronal cultures for mechanistic and drug discovery studies

PubMed Central

Ray, Balmiki; Bailey, Jason A.; Simon, Jay R.; Lahiri, Debomoy K.

2012-01-01

Acetylcholine (ACh) is the neurotransmitter used by cholinergic neurons at the neuromuscular junction and in parasympathetic nerve terminals in the periphery, as well as important memory-related circuits in the brain and also takes part in several critical functions. ACh is synthesized from choline and acetyl coenzyme-A by the enzyme choline acetyltransferase (ChAT). The formation of acetylcholine in cholinergic nerve terminals requires both the transport of choline into the cells from the extracellular space, and the activity of ChAT. High affinity choline uptake (HACU) represents the majority of choline uptake into the nerve terminal, and is the acutely regulated, rate-limiting step in ACh synthesis. The HACU component of choline uptake can be differentiated from non-specific choline uptake by inhibition of the choline transporter with hemicholinium. Several methods have been described previously to measure HACU and ChAT simultaneously in synaptosomes, but a well-documented protocol for cultured cells is lacking. We describe a procedure to simultaneously measure HACU and ChAT in cultured cells by simple radionuclide-based techniques. In this procedure we have quantitatively determined HACU and ChAT activity in cholinergically differentiated human neuroblastoma (SK-N-SH) cells. These simple methods can be used for neurochemical and drug discovery studies relevant to several disorders including Alzheimer’s disease, myasthenia gravis, and cardiovascular disease. PMID:22752895

High-efficiency solar cell and method for fabrication

DOEpatents

Hou, Hong Q.; Reinhardt, Kitt C.

1999-01-01

A high-efficiency 3- or 4-junction solar cell is disclosed with a theoretical AM0 energy conversion efficiency of about 40%. The solar cell includes p-n junctions formed from indium gallium arsenide nitride (InGaAsN), gallium arsenide (GaAs) and indium gallium aluminum phosphide (InGaAlP) separated by n-p tunnel junctions. An optional germanium (Ge) p-n junction can be formed in the substrate upon which the other p-n junctions are grown. The bandgap energies for each p-n junction are tailored to provide substantially equal short-circuit currents for each p-n junction, thereby eliminating current bottlenecks and improving the overall energy conversion efficiency of the solar cell. Additionally, the use of an InGaAsN p-n junction overcomes super-bandgap energy losses that are present in conventional multi-junction solar cells. A method is also disclosed for fabricating the high-efficiency 3- or 4-junction solar cell by metal-organic chemical vapor deposition (MOCVD).

High-efficiency solar cell and method for fabrication

DOEpatents

Hou, H.Q.; Reinhardt, K.C.

1999-08-31

A high-efficiency 3- or 4-junction solar cell is disclosed with a theoretical AM0 energy conversion efficiency of about 40%. The solar cell includes p-n junctions formed from indium gallium arsenide nitride (InGaAsN), gallium arsenide (GaAs) and indium gallium aluminum phosphide (InGaAlP) separated by n-p tunnel junctions. An optional germanium (Ge) p-n junction can be formed in the substrate upon which the other p-n junctions are grown. The bandgap energies for each p-n junction are tailored to provide substantially equal short-circuit currents for each p-n junction, thereby eliminating current bottlenecks and improving the overall energy conversion efficiency of the solar cell. Additionally, the use of an InGaAsN p-n junction overcomes super-bandgap energy losses that are present in conventional multi-junction solar cells. A method is also disclosed for fabricating the high-efficiency 3- or 4-junction solar cell by metal-organic chemical vapor deposition (MOCVD). 4 figs.

[Influence of Cx26/Cx32 gap junction channel on antineoplastic effect of etoposide in Hela cells].

PubMed

Tong, Xu-Hui; Dong, Shu-Ying; Jiang, Guo-Jun; Fan, Gao-Fu

2012-03-01

To observe the influence of Cx26/Cx32 gap junction channel on the antineoplastic effect of etoposide in Hela cervical cancer cells. Fluorescence trace was used to assay the gap junction intercellular communication mediated by Cx26/Cx32 in Hela cells and its functional modulation by the pharmacological agents (oleamide, retinoid acid). A standard colony-forming assay was applied to determine the cell growth-inhibiting effect of etoposide in Hela cells with functional modulation of the gap junction. Hoechst 33258 staining was used to assess the changes in etoposide-induced apoptosis of Hela cells with altered gap junction functions. Oleamide markedly decreased while retinoid acid obviously increased the gap junction function in Hela cells. Standard colony-forming assay showed that etoposide produced a lowered antiproliferative effect in Hela cells with reduced gap junction and an increased antiproliferative effect in cells with enhanced gap junction function. In cells with a reduced gap junction function, etoposide induced a lowered apoptosis rate, which increased obviously in cells with an enhanced gap junction function. The antineoplastic effect of etoposide is reduced in Hela cells with a decreased gap junction intercellular communication mediated by Cx26/Cx32 and is enhanced in cells with an increased gap junction intercellular communication.

Effects of 18beta-glycyrrhetinic acid on the junctional complex and steroidogenesis in rat adrenocortical cells.

PubMed

Huang, Shih-Horng; Wu, Jiahn-Chun; Hwang, Ra-Der; Yeo, Hui-Lin; Wang, Seu-Mei

2003-09-01

Cellular junctions play important roles in cell differentiation, signal transduction, and cell function. This study investigated their function in steroid secretion by adrenal cells. Immunofluorescence staining revealed the presence of gap junctions and adherens junctions between adrenal cells. The major gap junction protein, connexin43, was seen as a linear dotted pattern of the typical gap junction plaques, in contrast to alpha-, beta-, and gamma-catenin, which were seen as continuous, linear staining of cell-cell adherens junction. Treatment with 18beta-glycyrrhetinic acid, a gap junction inhibitor, reduced the immunoreactivity of these proteins in a time- and dose-dependent manner, and caused the gap junction and adherens junction to separate longitudinally from the cell-cell contact sites, indicating the structural interdependency of these two junctions. Interestingly, 18beta-glycyrrhetinic acid stimulated a two- to three-fold increase in steroid production in these adrenal cells lacking intact cell junctions. These data raise the question of the necessity for cell communication for the endocrine function of adrenal cells. Pharmacological analyses indicated that the steroidogenic effect of 18beta-glycyrrhetinic acid was partially mediated by extracellular signal-related kinase and calcium/calmodulin-dependent kinase, a pathway distinct from the protein kinase A signaling pathway already known to mediate steroidogenesis in adrenal cells. Copyright 2003 Wiley-Liss, Inc.

Gap junctions modulate glioma invasion by direct transfer of microRNA.

PubMed

Hong, Xiaoting; Sin, Wun Chey; Harris, Andrew L; Naus, Christian C

2015-06-20

The invasiveness of high-grade glioma is the primary reason for poor survival following treatment. Interaction between glioma cells and surrounding astrocytes are crucial to invasion. We investigated the role of gap junction mediated miRNA transfer in this context. By manipulating gap junctions with a gap junction inhibitor, siRNAs, and a dominant negative connexin mutant, we showed that functional glioma-glioma gap junctions suppress glioma invasion while glioma-astrocyte and astrocyte-astrocyte gap junctions promote it in an in vitro transwell invasion assay. After demonstrating that glioma-astrocyte gap junctions are permeable to microRNA, we compared the microRNA profiles of astrocytes before and after co-culture with glioma cells, identifying specific microRNAs as candidates for transfer through gap junctions from glioma cells to astrocytes. Further analysis showed that transfer of miR-5096 from glioma cells to astrocytes is through gap junctions; this transfer is responsible, in part, for the pro-invasive effect. Our results establish a role for glioma-astrocyte gap junction mediated microRNA signaling in modulation of glioma invasive behavior, and that gap junction coupling among astrocytes magnifies the pro-invasive signaling. Our findings reveal the potential for therapeutic interventions based on abolishing alteration of stromal cells by tumor cells via manipulation of microRNA and gap junction channel activity.

Gap junctions modulate glioma invasion by direct transfer of microRNA

PubMed Central

Hong, Xiaoting; Sin, Wun Chey; Harris, Andrew L.; Naus, Christian C.

2015-01-01

The invasiveness of high-grade glioma is the primary reason for poor survival following treatment. Interaction between glioma cells and surrounding astrocytes are crucial to invasion. We investigated the role of gap junction mediated miRNA transfer in this context. By manipulating gap junctions with a gap junction inhibitor, siRNAs, and a dominant negative connexin mutant, we showed that functional glioma-glioma gap junctions suppress glioma invasion while glioma-astrocyte and astrocyte-astrocyte gap junctions promote it in an in vitro transwell invasion assay. After demonstrating that glioma-astrocyte gap junctions are permeable to microRNA, we compared the microRNA profiles of astrocytes before and after co-culture with glioma cells, identifying specific microRNAs as candidates for transfer through gap junctions from glioma cells to astrocytes. Further analysis showed that transfer of miR-5096 from glioma cells to astrocytes is through gap junctions; this transfer is responsible, in part, for the pro-invasive effect. Our results establish a role for glioma-astrocyte gap junction mediated microRNA signaling in modulation of glioma invasive behavior, and that gap junction coupling among astrocytes magnifies the pro-invasive signaling. Our findings reveal the potential for therapeutic interventions based on abolishing alteration of stromal cells by tumor cells via manipulation of microRNA and gap junction channel activity. PMID:25978028

Regulation of gap junctional charge selectivity in cells coexpressing connexin 40 and connexin 43.

PubMed

Heyman, Nathanael S; Kurjiaka, David T; Ek Vitorin, Jose F; Burt, Janis M

2009-07-01

Expression of connexin 40 (Cx40) and Cx43 in cardiovascular tissues varies as a function of age, injury, and development with unknown consequences on the selectivity of junctional communication and its acute regulation. We investigated the PKC-dependent regulation of charge selectivity in junctions composed of Cx43, Cx40, or both by simultaneous assessment of junctional permeance rate constants (B(dye)) for dyes of similar size but opposite charge, N,N,N-trimethyl-2-[methyl-(7-nitro-2,1,3-benzoxadiol-4-yl)amino]ethanaminium (NBD-M-TMA; +1) and Alexa 350 (-1). The ratio of dye rate constants (B(NBD-M-TMA)/B(Alexa 350)) indicated that Cx40 junctions are cation selective (10.7 +/- 0.5), whereas Cx43 junction are nonselective (1.22 +/- 0.14). In coexpressing cells, a broad range of junctional selectivities was observed with mean cation selectivity increasing as the Cx40 to Cx43 expression ratio increased. PKC activation reduced or eliminated dye permeability of Cx43 junctions without altering their charge selectivity, had no effect on either permeability or charge selectivity of Cx40 junctions, and significantly increased the cation selectivity of junctions formed by coexpressing cells (approaching charge selectivity of Cx40 junctions). Junctions composed of Cx43 truncated at residue 257 (Cx43tr) were also not charge selective, but when Cx43tr was coexpressed with Cx40, a broad range of junctional selectivities that was unaffected by PKC activation was observed. Thus, whereas the charge selectivities of homomeric/homotypic Cx43 and Cx40 junctions appear invariant, the selectivities of junctions formed by cells coexpressing Cx40 and Cx43 vary considerably, reflecting both their relative expression levels and phosphorylation-dependent regulation. Such regulation could represent a mechanism by which coexpressing cells such as vascular endothelium and atrial cells regulate acutely the selective intercellular communication mediated by their gap junctions.

Cryotherapy of the nephrostomy tract: a novel technique to decrease the risk of hemorrhage after tubeless percutaneous renal surgery.

PubMed

Okeke, Zeph; Andonian, Sero; Srinivasan, Arun; Shapiro, Edan; Vanderbrink, Brian A; Kavoussi, Louis R; Smith, Arthur D

2009-03-01

Delayed hemorrhage and significant postoperative pain are associated with complex percutaneous renal surgery. Cryoablation of the percutaneous nephrostomy tract after endoscopic procedures is a potential means of preventing delayed renal hemorrhage. In this study, we investigated the efficacy of this technique by comparing a group of patients who underwent this approach with another group who had nephrostomy tube insertion after percutaneous renal surgery. Sixty patients with complex renal calculi or ureteropelvic junction (UPJ) obstruction underwent percutaneous endoscopic management of their disease. At the conclusion of the procedure, 30 consecutive patients underwent a single 10-minute freeze-thaw cycle, in which a cryoprobe traversed the nephrostomy tract. These 30 patients were compared with the preceding 30 patients who had a nephrostomy tube inserted after complex percutaneous renal surgery. The two groups were well matched in terms of age, body mass index, total stone burden, number of patients with full staghorn calculi, and number of patients with concomitant UPJ obstruction. The cryotherapy group had a significantly shorter hospital stay (2.1 v 3.6 days, P < 0.001); decreased rates of delayed bleeding episodes (3% v 13%, P < 0.001), and urinary leak (0% v 10%, P < 0.001). Cryotherapy of the nephrostomy is a novel means of decreasing the risk of delayed postoperative hemorrhage after complex percutaneous renal surgery. It is associated with significantly decreased length of hospitalization postoperatively, as well as decreased risk of urine leakage compared with nephrostomy tubes in these groups of patients.

Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

PubMed

Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

2017-06-01

Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

Method of making high breakdown voltage semiconductor device

DOEpatents

Arthur, Stephen D.; Temple, Victor A. K.

1990-01-01

A semiconductor device having at least one P-N junction and a multiple-zone junction termination extension (JTE) region which uniformly merges with the reverse blocking junction is disclosed. The blocking junction is graded into multiple zones of lower concentration dopant adjacent termination to facilitate merging of the JTE to the blocking junction and placing of the JTE at or near the high field point of the blocking junction. Preferably, the JTE region substantially overlaps the graded blocking junction region. A novel device fabrication method is also provided which eliminates the prior art step of separately diffusing the JTE region.

Methods for the fabrication of thermally stable magnetic tunnel junctions

DOEpatents

Chang, Y Austin [Middleton, WI; Yang, Jianhua J [Madison, WI; Ladwig, Peter F [Hutchinson, MN

2009-08-25

Magnetic tunnel junctions and method for making the magnetic tunnel junctions are provided. The magnetic tunnel junctions are characterized by a tunnel barrier oxide layer sandwiched between two ferromagnetic layers. The methods used to fabricate the magnetic tunnel junctions are capable of completely and selectively oxidizing a tunnel junction precursor material using an oxidizing gas containing a mixture of gases to provide a tunnel junction oxide without oxidizing the adjacent ferromagnetic materials. In some embodiments the gas mixture is a mixture of CO and CO.sub.2 or a mixture of H.sub.2 and H.sub.2O.

Possible Involvement of Tight Junctions, Extracellular Matrix and Nuclear Receptors in Epithelial Differentiation

PubMed Central

Ichikawa-Tomikawa, Naoki; Sugimoto, Kotaro; Satohisa, Seiro; Nishiura, Keisuke; Chiba, Hideki

2011-01-01

Tight junctions are intercellular junctions localized at the most apical end of the lateral plasma membrane. They consist of four kinds of transmembrane proteins (occludin, claudins, junctional adhesion molecules, and tricellulin) and huge numbers of scaffolding proteins and contribute to the paracellular barrier and fence function. The mutation and deletion of these proteins impair the functions of tight junctions and cause various human diseases. In this paper, we provide an overview of recent studies on transmembrane proteins of tight junctions and highlight the functional significance of tight junctions, extracellular matrix, and nuclear receptors in epithelial differentiation. PMID:22162632

Gap junction- and hemichannel-independent actions of connexins.

PubMed

Jiang, Jean X; Gu, Sumin

2005-06-10

Connexins have been known to be the protein building blocks of gap junctions and mediate cell-cell communication. In contrast to the conventional dogma, recent evidence suggests that in addition to forming gap junction channels, connexins possess gap junction-independent functions. One important gap junction-independent function for connexins is to serve as the major functional component for hemichannels, the un-apposed halves of gap junctions. Hemichannels, as independent functional units, play roles that are different from that of gap junctions in the cell. The other functions of connexins appear to be gap junction- and hemichannel-independent. Published studies implicate the latter functions of connexins in cell growth, differentiation, tumorigenicity, injury, and apoptosis, although the mechanistic aspects of these actions remain largely unknown. In this review, gap junction- and hemichannel-independent functions of connexins are summarized, and the molecular mechanisms underlying these connexin functions are speculated and discussed.

Atomic-scaled characterization of graphene PN junctions

NASA Astrophysics Data System (ADS)

Zhou, Xiaodong; Wang, Dennis; Dadgar, Ali; Agnihotri, Pratik; Lee, Ji Ung; Reuter, Mark C.; Ross, Frances M.; Pasupathy, Abhay N.

Graphene p-n junctions are essential devices for studying relativistic Klein tunneling and the Veselago lensing effect in graphene. We have successfully fabricated graphene p-n junctions using both lithographically pre-patterned substrates and the stacking of vertical heterostructures. We then use our 4-probe STM system to characterize the junctions. The ability to carry out scanning electron microscopy (SEM) in our STM instrument is essential for us to locate and measure the junction interface. We obtain both the topography and dI/dV spectra at the junction area, from which we track the shift of the graphene chemical potential with position across the junction interface. This allows us to directly measure the spatial width and roughness of the junction and its potential barrier height. We will compare the junction properties of devices fabricated by the aforementioned two methods and discuss their effects on the performance as a Veselago lens.

Molecular mechanisms regulating formation, trafficking and processing of annular gap junctions.

PubMed

Falk, Matthias M; Bell, Cheryl L; Kells Andrews, Rachael M; Murray, Sandra A

2016-05-24

Internalization of gap junction plaques results in the formation of annular gap junction vesicles. The factors that regulate the coordinated internalization of the gap junction plaques to form annular gap junction vesicles, and the subsequent events involved in annular gap junction processing have only relatively recently been investigated in detail. However it is becoming clear that while annular gap junction vesicles have been demonstrated to be degraded by autophagosomal and endo-lysosomal pathways, they undergo a number of additional processing events. Here, we characterize the morphology of the annular gap junction vesicle and review the current knowledge of the processes involved in their formation, fission, fusion, and degradation. In addition, we address the possibility for connexin protein recycling back to the plasma membrane to contribute to gap junction formation and intercellular communication. Information on gap junction plaque removal from the plasma membrane and the subsequent processing of annular gap junction vesicles is critical to our understanding of cell-cell communication as it relates to events regulating development, cell homeostasis, unstable proliferation of cancer cells, wound healing, changes in the ischemic heart, and many other physiological and pathological cellular phenomena.

ABUNDANCE AND ULTRASTRUCTURAL DIVERSITY OF NEURONAL GAP JUNCTIONS IN THE OFF AND ON SUBLAMINAE OF THE INNER PLEXIFORM LAYER OF RAT AND MOUSE RETINA

PubMed Central

KAMASAWA, N.; FURMAN, C. S.; DAVIDSON, K. G. V.; SAMPSON, J. A.; MAGNIE, A. R.; GEBHARDT, B. R.; KAMASAWA, M.; YASUMURA, T.; ZUMBRUNNEN, J. R.; PICKARD, G. E.; NAGY, J. I.; RASH, J. E.

2007-01-01

Neuronal gap junctions are abundant in both outer and inner plexiform layers of the mammalian retina. In the inner plexiform layer (IPL), ultrastructurally-identified gap junctions were reported primarily in the functionally-defined and anatomically-distinct ON sublamina, with few reported in the OFF sublamina. We used freeze-fracture replica immunogold labeling and confocal microscopy to quantitatively analyze the morphologies and distributions of neuronal gap junctions in the IPL of adult rat and mouse retina. Under “baseline” conditions (photopic illumination/general anesthesia), 649 neuronal gap junctions immunogold-labeled for connexin36 were identified in rat IPL, of which 375 were photomapped to OFF vs. ON sublaminae. In contrast to previous reports, the volume-density of gap junctions was equally abundant in both sublaminae. Five distinctive morphologies of gap junctions were identified: conventional crystalline and non-crystalline “plaques” (71% and 3%), plus unusual “string” (14%), “ribbon” (7%) and “reticular” (2%) forms. Plaque and reticular gap junctions were distributed throughout the IPL. However, string and ribbon gap junctions were restricted to the OFF sublamina, where they represented 48% of gap junctions in that layer. In string and ribbon junctions, curvilinear strands of connexons were dispersed over 5 to 20 times the area of conventional plaques having equal numbers of connexons. To define morphologies of gap junctions under different light-adaptation conditions, we examined an additional 1150 gap junctions from rats and mice prepared after 30 min of photopic, mesopic and scotopic illumination, with and without general anesthesia. Under these conditions, string and ribbon gap junctions remained abundant in the OFF sublamina and absent in the ON sublamina. Abundant gap junctions in the OFF sublamina of these two rodents with rod-dominant retinas revealed previously-undescribed but extensive pathways for inter-neuronal communication; and the wide dispersion of connexons in string and ribbon gap junctions suggests unique structural features of gap junctional coupling in the OFF vs. ON sublamina. PMID:17010526

Polymorphic integrations of an endogenous gammaretrovirus in the mule deer genome.

PubMed

Elleder, Daniel; Kim, Oekyung; Padhi, Abinash; Bankert, Jason G; Simeonov, Ivan; Schuster, Stephan C; Wittekindt, Nicola E; Motameny, Susanne; Poss, Mary

2012-03-01

Endogenous retroviruses constitute a significant genomic fraction in all mammalian species. Typically they are evolutionarily old and fixed in the host species population. Here we report on a novel endogenous gammaretrovirus (CrERVγ; for cervid endogenous gammaretrovirus) in the mule deer (Odocoileus hemionus) that is insertionally polymorphic among individuals from the same geographical location, suggesting that it has a more recent evolutionary origin. Using PCR-based methods, we identified seven CrERVγ proviruses and demonstrated that they show various levels of insertional polymorphism in mule deer individuals. One CrERVγ provirus was detected in all mule deer sampled but was absent from white-tailed deer, indicating that this virus originally integrated after the split of the two species, which occurred approximately one million years ago. There are, on average, 100 CrERVγ copies in the mule deer genome based on quantitative PCR analysis. A CrERVγ provirus was sequenced and contained intact open reading frames (ORFs) for three virus genes. Transcripts were identified covering the entire provirus. CrERVγ forms a distinct branch of the gammaretrovirus phylogeny, with the closest relatives of CrERVγ being endogenous gammaretroviruses from sheep and pig. We demonstrated that white-tailed deer (Odocoileus virginianus) and elk (Cervus canadensis) DNA contain proviruses that are closely related to mule deer CrERVγ in a conserved region of pol; more distantly related sequences can be identified in the genome of another member of the Cervidae, the muntjac (Muntiacus muntjak). The discovery of a novel transcriptionally active and insertionally polymorphic retrovirus in mammals could provide a useful model system to study the dynamic interaction between the host genome and an invading retrovirus.

Study of Gene Trafficking between Acanthamoeba and Giant Viruses Suggests an Undiscovered Family of Amoeba-Infecting Viruses.

PubMed

Maumus, Florian; Blanc, Guillaume

2016-12-14

The nucleocytoplasmic large DNA viruses (NCLDV) are a group of extremely complex double-stranded DNA viruses, which are major parasites of a variety of eukaryotes. Recent studies showed that certain unicellular eukaryotes contain fragments of NCLDV DNA integrated in their genome, when surprisingly many of these organisms were not previously shown to be infected by NCLDVs. These findings prompted us to search the genome of Acanthamoeba castellanii strain Neff (Neff), one of the most prolific hosts in the discovery of giant NCLDVs, for possible DNA inserts of viral origin. We report the identification of 267 markers of lateral gene transfer with viruses, approximately half of which are clustered in Neff genome regions of viral origins, transcriptionally inactive or exhibit nucleotide-composition signatures suggestive of a foreign origin. The integrated viral genes had diverse origin among relatives of viruses that infect Neff, including Mollivirus, Pandoravirus, Marseillevirus, Pithovirus, and Mimivirus However, phylogenetic analysis suggests the existence of a yet-undiscovered family of amoeba-infecting NCLDV in addition to the five already characterized. The active transcription of some apparently anciently integrated virus-like genes suggests that some viral genes might have been domesticated during the amoeba evolution. These insights confirm that genomic insertion of NCLDV DNA is a common theme in eukaryotes. This gene flow contributed fertilizing the eukaryotic gene repertoire and participated in the occurrence of orphan genes, a long standing issue in genomics. Search for viral inserts in eukaryotic genomes followed by environmental screening of the original viruses should be used to isolate radically new NCLDVs. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Ultrasound assessment of soft tissue augmentation around implants in the aesthetic zone using a connective tissue graft and xenogeneic collagen matrix - 1-year randomised follow-up.

PubMed

Puzio, Monika; Błaszczyszyn, Artur; Hadzik, Jakub; Dominiak, Marzena

2018-05-01

A comparative, ultrasound evaluation of the thickness of keratinized mucosa (TKT) around implants one year after gingival augmentation (GA) by means of a connective tissue graft (CTG) and the xenogeneic collagen matrix (CMX). A total of 75 bone level tapered implants (Conelog ® Camlog) were inserted in 57 patients in the aesthetic area of both jaws. The patients were divided into 3 groups: control group I- without GA; group II- GA 3 months before implantation, and group III- GA 3 months after implantation. Groups II and III were divided into two subgroups depends on type of material used for GA: (a) CMX (Mucograft ® , Geistlich Pharma AG) and (b) CTG. The patients underwent a clinical and ultrasound examination before, then after 3 and 12 months following GA respectively to evaluate TKT at two points using ultrasound equipment (Pirop ® , Echoson). Point 1 was considered to be in the middle of the line connecting the cemento-enamel junction (CEJ) to the adjacent teeth, and point 2 on the mucogingival junction (MGJ). Three months after GA, the highest increase in gingival thickness was noted in group IIIb (point 1 - 0.95mm, 2 - 1.01mm). However, 12 months after GA the highest gingival thickness was observed in group IIb (point 1 - 1.76mm, 2 - 1.36m) and next IIIb (point 1 - 1.52mm, 2 - 1.15mm). Both CTG and Geistlich Mucograft ® increased TKT, but higher values were noted using CTG augmentation before implantation. An ultrasonic device can be used as a non-invasive, reliable, and reproducible method for evaluating TKT. Copyright © 2017 Elsevier GmbH. All rights reserved.

Evolution of genome size and complexity in the rhabdoviridae.

PubMed

Walker, Peter J; Firth, Cadhla; Widen, Steven G; Blasdell, Kim R; Guzman, Hilda; Wood, Thomas G; Paradkar, Prasad N; Holmes, Edward C; Tesh, Robert B; Vasilakis, Nikos

2015-02-01

RNA viruses exhibit substantial structural, ecological and genomic diversity. However, genome size in RNA viruses is likely limited by a high mutation rate, resulting in the evolution of various mechanisms to increase complexity while minimising genome expansion. Here we conduct a large-scale analysis of the genome sequences of 99 animal rhabdoviruses, including 45 genomes which we determined de novo, to identify patterns of genome expansion and the evolution of genome complexity. All but seven of the rhabdoviruses clustered into 17 well-supported monophyletic groups, of which eight corresponded to established genera, seven were assigned as new genera, and two were taxonomically ambiguous. We show that the acquisition and loss of new genes appears to have been a central theme of rhabdovirus evolution, and has been associated with the appearance of alternative, overlapping and consecutive ORFs within the major structural protein genes, and the insertion and loss of additional ORFs in each gene junction in a clade-specific manner. Changes in the lengths of gene junctions accounted for as much as 48.5% of the variation in genome size from the smallest to the largest genome, and the frequency with which new ORFs were observed increased in the 3' to 5' direction along the genome. We also identify several new families of accessory genes encoded in these regions, and show that non-canonical expression strategies involving TURBS-like termination-reinitiation, ribosomal frame-shifts and leaky ribosomal scanning appear to be common. We conclude that rhabdoviruses have an unusual capacity for genomic plasticity that may be linked to their discontinuous transcription strategy from the negative-sense single-stranded RNA genome, and propose a model that accounts for the regular occurrence of genome expansion and contraction throughout the evolution of the Rhabdoviridae.

Cyclic nucleotide gated channels 7 and 8 are essential for male reproductive fertility.

PubMed

Tunc-Ozdemir, Meral; Rato, Claudia; Brown, Elizabeth; Rogers, Stephanie; Mooneyham, Amanda; Frietsch, Sabine; Myers, Candace T; Poulsen, Lisbeth Rosager; Malhó, Rui; Harper, Jeffrey F

2013-01-01

The Arabidopsis thaliana genome contains 20 CNGCs, which are proposed to encode cyclic nucleotide gated, non-selective, Ca²⁺-permeable ion channels. CNGC7 and CNGC8 are the two most similar with 74% protein sequence identity, and both genes are preferentially expressed in pollen. Two independent loss-of-function T-DNA insertions were identified for both genes and used to generate plant lines in which only one of the two alleles was segregating (e.g., cngc7-1+/-/cngc8-2-/- and cngc7-3-/-/cngc8-1+/-). While normal pollen transmission was observed for single gene mutations, pollen harboring mutations in both cngc7 and 8 were found to be male sterile (transmission efficiency reduced by more than 3000-fold). Pollen grains harboring T-DNA disruptions of both cngc7 and 8 displayed a high frequency of bursting when germinated in vitro. The male sterile defect could be rescued through pollen expression of a CNGC7 or 8 transgene including a CNGC7 with an N-terminal GFP-tag. However, rescue efficiencies were reduced ∼10-fold when the CNGC7 or 8 included an F to W substitution (F589W and F624W, respectively) at the junction between the putative cyclic nucleotide binding-site and the calmodulin binding-site, identifying this junction as important for proper functioning of a plant CNGC. Using confocal microscopy, GFP-CNGC7 was found to preferentially localize to the plasma membrane at the flanks of the growing tip. Together these results indicate that CNGC7 and 8 are at least partially redundant and provide an essential function at the initiation of pollen tube tip growth.

On-line wall-free cell for laser-induced fluorescence detection in capillary electrophoresis.

PubMed

Yu, Chang-Zhu; He, You-Zhao; Xie, Hai-Yang; Gao, Yong; Gan, Wu-Er; Li, Jun

2009-05-15

A wall-free detection method based on liquid junction in a capillary gap was proposed for laser-induced fluorescence (LIF) of capillary electrophoresis (CE). The capillary gap of the wall-free cell was fabricated by etching a 10-mm x 50-microm I.D. fused-silica capillary to obtain a polyimide coating sleeve, decoating about 6mm at one end of both 50 microm I.D. separation and liquid junction capillary, inserting the treated capillary ends into the coating sleeve oppositely, fixing the capillaries with a gap distance of 140 microm by epoxy glue and removing the coating sleeve by burning. The theoretical model, experimental results and wall-free cell images indicated that the gap distance and applied voltage were main influence factors on the wall-free detection. Since the wall-free cell increased the absorption light path and avoided the stray light from the capillary wall, it improved the ratio of signal to noise and limit of detection (LOD) of CE-LIF. Three flavin compounds of riboflavin (RF), flavin mononucleotide sodium (FMN) and flavin adenine dinucleotide disodium (FAD) were used to evaluate the wall-free detection method. Compared with on-column cell, the LODs of the wall-free cell were improved 15-, 6- and 9-fold for RF, FMN and FAD, respectively. The linear calibration concentrations of the flavins ranged from 0.005 to 5.0 micromol/L. The column efficiency was in the range from 1.0 x 10(5) to 2.5 x 10(5) plates. The wall-free detection of CE-LIF was applied to the analysis of the flavins in spinach and lettuce leaves.

Low resistance AL2O3 magnetic tunnel junctions optimized through in situ conductance measurements

NASA Astrophysics Data System (ADS)

Wolfman, J.; Mauri, D.; Lin, T.; Yang, J.; Chen, T.

2005-06-01

In situ electrical conductance is used to monitor the growth and natural oxidation of aluminum on top of a CoFe electrode. Light oxidation is found to enhance the electron specular scattering of the CoFe/vacuum interface. Aluminum deposited onto CoFe intermixes to a depth of a few atomic layers, however, subsequent natural oxidation tends to reverse this interdiffusion through oxygen-driven A1 segregation. At the right A1 thickness, natural oxidation creates a clean and specular CoFe /AlOx interface very similar to the best achievable CoFe/vacuum interface. For thicker A1, natural oxidation leaves behind underoxidized AlOx and most importantly an interdiffused CoFe /Al interface. Using 2Torr×150-s natural oxidation, we have fabricated magnetic tunnel junctions (MTJs) with a peak tunnel magnetoresistance (TMR) of 18% for a resistance area product of 7Ωμm2, at the A1 metal thickness of 6 Å. With the same oxidation process TMR drops to only 8% when A1 is increased to 9 Å. Contrary to the accepted view, we do not attribute this TMR drop to A1 underoxidation, but primarily to the interdiffusion at the CoFe /Al interface. This assertion is strongly supported by a second set of MTJs differing only by the insertion of a nano-oxide layer (NOL) on top of CoFe. In this case when Al is increased from 6 to 9 Å, the TMR does not drop but increases from 16% to 27%. This is significant because NOL is found to effectively prevent Al diffusion into CoFe. NOL is also found to act as a reservoir of oxygen, which is subsequently consumed by Al.

Thermoelectric needle probe for temperature measurements in biological materials.

PubMed

Korn, U; Rav-Noy, Z; Shtrikman, S; Zafrir, M

1980-04-01

In certain biological and medical applications it is important to measure and follow temperature changes inside a body or tissue. Any probe inserted into a tissue causes damage to tissue and distortion to the initial temperature distribution. To minimize this interference, a fine probe is needed. Thus, thin film technology is advantageous and was utilized by us to produce sensitive probes for these applications. The resulting probe is a small thermocouple at the tip of a thin needle (acupuncture stainless steel needle, approximately 0.26 mm in diameter and length in the range 5-10 cm was used). The junction was produced at the needle's tip by coating the needle with thin layers of insulating and thermoelectric materials. The first layer is an insulating one and is composed of polyacrylonitrile (PAN) and polymide produced by plasma polymerization and dip-coating respectively. This layer covers all the needle except the tip. The second layer is a vacuum deposited thermoelectric thin layer of Bi-5% Sb alloy coating also the tip. The third layer is for insulation and protection and is composed of PAN and polyimide. In this arrangement the junction is at the needle's tip, the needle is one conductor, the thermoelectric layer is the other and they are isolated by the plastic layer. The probe is handy and mechanically sturdy. The sensitivity is typically 77 microV/degrees C at room temperature and is constant to within 2% up to 90 degrees C. The response is fast (less than 1 sec) the noise is small, (less than 0.05 degrees C) and because of the small dimension, damage to tissue and disturbance to the measured temperature field are minimal.

Evolution of Genome Size and Complexity in the Rhabdoviridae

PubMed Central

Walker, Peter J.; Firth, Cadhla; Widen, Steven G.; Blasdell, Kim R.; Guzman, Hilda; Wood, Thomas G.; Paradkar, Prasad N.; Holmes, Edward C.; Tesh, Robert B.; Vasilakis, Nikos

2015-01-01

RNA viruses exhibit substantial structural, ecological and genomic diversity. However, genome size in RNA viruses is likely limited by a high mutation rate, resulting in the evolution of various mechanisms to increase complexity while minimising genome expansion. Here we conduct a large-scale analysis of the genome sequences of 99 animal rhabdoviruses, including 45 genomes which we determined de novo, to identify patterns of genome expansion and the evolution of genome complexity. All but seven of the rhabdoviruses clustered into 17 well-supported monophyletic groups, of which eight corresponded to established genera, seven were assigned as new genera, and two were taxonomically ambiguous. We show that the acquisition and loss of new genes appears to have been a central theme of rhabdovirus evolution, and has been associated with the appearance of alternative, overlapping and consecutive ORFs within the major structural protein genes, and the insertion and loss of additional ORFs in each gene junction in a clade-specific manner. Changes in the lengths of gene junctions accounted for as much as 48.5% of the variation in genome size from the smallest to the largest genome, and the frequency with which new ORFs were observed increased in the 3’ to 5’ direction along the genome. We also identify several new families of accessory genes encoded in these regions, and show that non-canonical expression strategies involving TURBS-like termination-reinitiation, ribosomal frame-shifts and leaky ribosomal scanning appear to be common. We conclude that rhabdoviruses have an unusual capacity for genomic plasticity that may be linked to their discontinuous transcription strategy from the negative-sense single-stranded RNA genome, and propose a model that accounts for the regular occurrence of genome expansion and contraction throughout the evolution of the Rhabdoviridae. PMID:25679389

Histomorphometrical analysis following augmentation of infected extraction sites exhibiting severe bone loss and primarily closed by intrasocket reactive soft tissue.

PubMed

Mardinger, Ofer; Vered, Marilena; Chaushu, Gavriel; Nissan, Joseph

2012-06-01

Intrasocket reactive soft tissue can be used for primary closure during augmentation of infected extraction sites exhibiting severe bone loss prior to implant placement. The present study evaluated the histological characteristics of the initially used intrasocket reactive soft tissue, the overlying soft tissue, and the histomorphometry of the newly formed bone during implant placement. Thirty-six consecutive patients (43 sites) were included in the study. Extraction sites demonstrating extensive bone loss on preoperative periapical and panoramic radiographs served as inclusion criteria. Forty-three implants were inserted after a healing period of 6 months. Porous bovine xenograft bone mineral was used as a single bone substitute. The intrasocket reactive soft tissue was sutured over the grafting material to seal the coronal portion of the socket. Biopsies of the intrasocket reactive soft tissue at augmentation, healed mucosa, and bone cores at implant placement were retrieved and evaluated. The intrasocket reactive soft tissue demonstrated features compatible with granulation tissue and long junctional epithelium. The mucosal samples at implant placement demonstrated histopathological characteristics of keratinized mucosa with no residual elements of granulation tissue. Histomorphometrically, the mean composition of the bone cores was - vital bone 40 ± 19% (13.7-74.8%); bone substitute 25.7 ± 13% (0.6-51%); connective tissue 34.3 ± 15% (13.8-71.9%). Intrasocket reactive soft tissue used for primary closure following ridge augmentation is composed of granulation tissue and long junctional epithelium. At implant placement, clinical and histological results demonstrate its replacement by keratinized gingiva. The histomorphometrical results reveal considerable bone formation. Fresh extraction sites of hopeless teeth demonstrating chronic infection and severe bone loss may be grafted simultaneously with their removal. © 2010 Wiley Periodicals, Inc.

Translocation and gross deletion breakpoints in human inherited disease and cancer II: Potential involvement of repetitive sequence elements in secondary structure formation between DNA ends.

PubMed

Chuzhanova, Nadia; Abeysinghe, Shaun S; Krawczak, Michael; Cooper, David N

2003-09-01

Translocations and gross deletions are responsible for a significant proportion of both cancer and inherited disease. Although such gene rearrangements are nonuniformly distributed in the human genome, the underlying mutational mechanisms remain unclear. We have studied the potential involvement of various types of repetitive sequence elements in the formation of secondary structure intermediates between the single-stranded DNA ends that recombine during rearrangements. Complexity analysis was used to assess the potential of these ends to form secondary structures, the maximum decrease in complexity consequent to a gross rearrangement being used as an indicator of the type of repeat and the specific DNA ends involved. A total of 175 pairs of deletion/translocation breakpoint junction sequences available from the Gross Rearrangement Breakpoint Database [GRaBD; www.uwcm.ac.uk/uwcm/mg/grabd/grabd.html] were analyzed. Potential secondary structure was noted between the 5' flanking sequence of the first breakpoint and the 3' flanking sequence of the second breakpoint in 49% of rearrangements and between the 5' flanking sequence of the second breakpoint and the 3' flanking sequence of the first breakpoint in 36% of rearrangements. Inverted repeats, inversions of inverted repeats, and symmetric elements were found in association with gross rearrangements at approximately the same frequency. However, inverted repeats and inversions of inverted repeats accounted for the vast majority (83%) of deletions plus small insertions, symmetric elements for one-half of all antigen receptor-mediated translocations, while direct repeats appear only to be involved in mediating simple deletions. These findings extend our understanding of illegitimate recombination by highlighting the importance of secondary structure formation between single-stranded DNA ends at breakpoint junctions. Copyright 2003 Wiley-Liss, Inc.

Compact Low-Loss Planar Magic-T

NASA Technical Reports Server (NTRS)

U-yen, Kongpop; Wollack, Edward J.; Doiron, Terence; Moseley, Sameul H.

2008-01-01

This design allows broadband power combining with high isolation between the H port and E port, and achieves a lower insertion loss than any other broadband planar magic-T. Passive micro wave/millimeter-wave signal power is combined both in-phase and out-of-phase at the ports, with the phase error being less than 1 , which is limited by port impedance. The in-phase signal combiner consists of two quarter-wavelength-long transmission lines combined at the microstrip line junction. The out-of-phase signal combiner consists of two half-wavelength-long transmission lines combined in series. Structural symmetry creates a virtual ground plane at the combining junction, and the combined signal is converted from microstrip line to slotline. Optimum realizable characteristic impedances are used so that the magic-T provides broadband response with low return loss. The magic-T is used in microwave and millimeter-wave frequencies, with the operating bandwidth being approximately 100 percent. The minimum isolation obtainable is 32 dB from port E to port H. The magic-T VSWR is less than 1.1 in the operating band. Operating temperature is mainly dependent on the variation in the dielectric constant of the substrate. Using crystallized substrate, the invention can operate in an extremely broad range of temperatures (from 0 to 400 K). It has a very high reliability because it has no moving parts and requires no maintenance, though it is desirable that the magic-T operate in a low-humidity environment. Fabrication of this design is very simple, using only two metallized layers. No bond wires, via holes, or air bridges are required. Additionally, this magic-T can operate as an individual component without auxiliary components.

Comparison of pitot traverses taken at varying distances downstream of obstructions.

PubMed

Guffey, S E; Booth, D W

1999-01-01

This study determined the deviations between pitot traverses taken under "ideal" conditions--at least seven duct diameter's lengths (i.e., distance = 7D) from obstructions, elbows, junction fittings, and other disturbances to flows--with those taken downstream from commonplace disturbances. Two perpendicular 10-point, log-linear velocity pressure traverses were taken at various distances downstream of tested upstream conditions. Upstream conditions included a plain duct opening, a junction fitting, a single 90 degrees elbow, and two elbows rotated 90 degrees from each other into two orthogonal planes. Airflows determined from those values were compared with the values measured more than 40D downstream of the same obstructions under ideal conditions. The ideal measurements were taken on three traverse diameters in the same plane separated by 120 degrees in honed drawn-over-mandrel tubing. In all cases the pitot tubes were held in place by devices that effectively eliminated alignment errors and insertion depth errors. Duct velocities ranged from 1500 to 4500 ft/min. Results were surprisingly good if one employed two perpendicular traverses. When the averages of two perpendicular traverses was taken, deviations from ideal value were 6% or less even for traverses taken as close as 2D distance from the upstream disturbances. At 3D distance, deviations seldom exceeded 5%. With single diameter traverses, errors seldom exceeded 5% at 6D or more downstream from the disturbance. Interestingly, percentage deviations were about the same at high and low velocities. This study demonstrated that two perpendicular pitot traverses can be taken as close as 3D from these disturbances with acceptable (< or = 5%) deviations from measurements taken under ideal conditions.

Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.

PubMed

Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M

2015-01-01

The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.

3D Topography of the Young Adult Anal Sphincter Complex Reconstructed from Undeformed Serial Anatomical Sections

PubMed Central

Wu, Yi; Dabhoiwala, Noshir F.; Hagoort, Jaco; Shan, Jin-Lu; Tan, Li-Wen; Fang, Bin-Ji; Zhang, Shao-Xiang; Lamers, Wouter H.

2015-01-01

Background Pelvic-floor anatomy is usually studied by artifact-prone dissection or imaging, which requires prior anatomical knowledge. We used the serial-section approach to settle contentious issues and an interactive 3D-pdf to make the results widely accessible. Method 3D reconstructions of undeformed thin serial anatomical sections of 4 females and 2 males (21–35y) of the Chinese Visible Human database. Findings Based on tendinous septa and muscle-fiber orientation as segmentation guides, the anal-sphincter complex (ASC) comprised the subcutaneous external anal sphincter (EAS) and the U-shaped puborectal muscle, a part of the levator ani muscle (LAM). The anococcygeal ligament fixed the EAS to the coccygeal bone. The puborectal-muscle loops, which define the levator hiatus, passed around the anorectal junction and inserted anteriorly on the perineal body and pubic bone. The LAM had a common anterior attachment to the pubic bone, but separated posteriorly into puborectal and “pubovisceral” muscles. This pubovisceral muscle was bilayered: its internal layer attached to the conjoint longitudinal muscle of the rectum and the rectococcygeal fascia, while its outer, patchy layer reinforced the inner layer. ASC contraction makes the ano-rectal bend more acute and lifts the pelvic floor. Extensions of the rectal longitudinal smooth muscle to the coccygeal bone (rectococcygeal muscle), perineal body (rectoperineal muscle), and endopelvic fascia (conjoint longitudinal and pubovisceral muscles) formed a “diaphragm” at the inferior boundary of the mesorectum that suspended the anorectal junction. Its contraction should straighten the anorectal bend. Conclusion The serial-section approach settled contentious topographic issues of the pelvic floor. We propose that the ASC is involved in continence and the rectal diaphragm in defecation. PMID:26305117

Signaling from the Podocyte Intercellular Junction to the Actin Cytoskeleton

PubMed Central

George, Britta; Holzman, Lawrence B.

2012-01-01

Observations of hereditary glomerular disease support the contention that podocyte intercellular junction proteins are essential for junction formation and maintenance. Genetic deletion of most of these podocyte intercellular junction proteins results in foot process effacement and proteinuria. This review focuses on the current understanding of molecular mechanisms by which podocyte intercellular junction proteins such as the Nephrin-Neph1-Podocin receptor complex coordinate cytoskeletal dynamics and thus intercellular junction formation, maintenance and injury-dependent remodeling. PMID:22958485

Visualizing the effect of dynamin inhibition on annular gap vesicle formation and fission

PubMed Central

Nickel, Beth; Boller, Marie; Schneider, Kimberly; Shakespeare, Teresa; Gay, Vernon; Murray, Sandra A.

2013-01-01

Summary Although gap junction plaque assembly has been extensively studied, mechanisms involved in plaque disassembly are not well understood. Disassembly involves an internalization process in which annular gap junction vesicles are formed. These vesicles undergo fission, but the molecular machinery needed for these fissions has not been described. The mechanoenzyme dynamin has been previously demonstrated to play a role in gap junction plaque internalization. To investigate the role of dynamin in annular gap junction vesicle fission, immunocytochemical, time-lapse and transmission electron microscopy were used to analyze SW-13 adrenocortical cells in culture. Dynamin was demonstrated to colocalize with gap junction plaques and vesicles. Dynamin inhibition, by siRNA knockdown or treatment with the dynamin GTPase inhibitor dynasore, increased the number and size of gap junction ‘buds’ suspended from the gap junction plaques. Buds, in control populations, were frequently released to form annular gap junction vesicles. In dynamin-inhibited populations, the buds were larger and infrequently released and thus fewer annular gap junction vesicles were formed. In addition, the number of annular gap junction vesicle fissions per hour was reduced in the dynamin-inhibited populations. We believe this to be the first report addressing the details of annular gap junction vesicle fissions and demonstrating a role of dynamin in this process. This information is crucial for elucidating the relationship between gap junctions, membrane regulation and cell behavior. PMID:23591819

Role of heteromeric gap junctions in the cytotoxicity of cisplatin.

PubMed

Tong, Xuhui; Dong, Shuying; Yu, Meiling; Wang, Qin; Tao, Liang

2013-08-09

In several systems, the presence of gap junctions made of a single connexin has been shown to enhance the cytotoxicity of cisplatin. However, most gap junction channels in vivo appear to be heteromeric (composed of more than one connexin isoform). Here we explore in HeLa cells the cytotoxicity to cisplatin that is enhanced by heteromeric gap junctions composed of Cx26 and Cx32, which have been shown to be more selective among biological permeants than the corresponding homomeric channels. We found that survival and subsequent proliferation of cells exposed to cisplatin were substantially reduced when gap junctions were present than when there were no gap junctions. Functional inhibition of gap junctions by oleamide enhanced survival/proliferation, and enhancement of gap junctions by retinoic acid decreased survival/proliferation. These effects occurred only in high density cultures, and the treatments were without effect when there was no opportunity for gap junction formation. The presence of functional gap junctions enhanced apoptosis as reflected in markers of both early-stage and late-stage apoptosis. Furthermore, analysis of caspases 3, 8 and 9 showed that functional gap junctions specifically induced apoptosis by the mitochondrial pathway. These results demonstrate that heteromeric Cx26/Cx32 gap junctions increase the cytotoxicity of cisplatin by induction of apoptosis via the mitochondrial pathway. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Visualizing the effect of dynamin inhibition on annular gap vesicle formation and fission.

PubMed

Nickel, Beth; Boller, Marie; Schneider, Kimberly; Shakespeare, Teresa; Gay, Vernon; Murray, Sandra A

2013-06-15

Although gap junction plaque assembly has been extensively studied, mechanisms involved in plaque disassembly are not well understood. Disassembly involves an internalization process in which annular gap junction vesicles are formed. These vesicles undergo fission, but the molecular machinery needed for these fissions has not been described. The mechanoenzyme dynamin has been previously demonstrated to play a role in gap junction plaque internalization. To investigate the role of dynamin in annular gap junction vesicle fission, immunocytochemical, time-lapse and transmission electron microscopy were used to analyze SW-13 adrenocortical cells in culture. Dynamin was demonstrated to colocalize with gap junction plaques and vesicles. Dynamin inhibition, by siRNA knockdown or treatment with the dynamin GTPase inhibitor dynasore, increased the number and size of gap junction 'buds' suspended from the gap junction plaques. Buds, in control populations, were frequently released to form annular gap junction vesicles. In dynamin-inhibited populations, the buds were larger and infrequently released and thus fewer annular gap junction vesicles were formed. In addition, the number of annular gap junction vesicle fissions per hour was reduced in the dynamin-inhibited populations. We believe this to be the first report addressing the details of annular gap junction vesicle fissions and demonstrating a role of dynamin in this process. This information is crucial for elucidating the relationship between gap junctions, membrane regulation and cell behavior.

A WAVE2–Arp2/3 actin nucleator apparatus supports junctional tension at the epithelial zonula adherens

PubMed Central

Verma, Suzie; Han, Siew Ping; Michael, Magdalene; Gomez, Guillermo A.; Yang, Zhe; Teasdale, Rohan D.; Ratheesh, Aparna; Kovacs, Eva M.; Ali, Radiya G.; Yap, Alpha S.

2012-01-01

The epithelial zonula adherens (ZA) is a specialized adhesive junction where actin dynamics and myosin-driven contractility coincide. The junctional cytoskeleton is enriched in myosin II, which generates contractile force to support junctional tension. It is also enriched in dynamic actin filaments, which are replenished by ongoing actin assembly. In this study we sought to pursue the relationship between actin assembly and junctional contractility. We demonstrate that WAVE2–Arp2/3 is a major nucleator of actin assembly at the ZA and likely acts in response to junctional Rac signaling. Furthermore, WAVE2–Arp2/3 is necessary for junctional integrity and contractile tension at the ZA. Maneuvers that disrupt the function of either WAVE2 or Arp2/3 reduced junctional tension and compromised the ability of cells to buffer side-to-side forces acting on the ZA. WAVE2–Arp2/3 disruption depleted junctions of both myosin IIA and IIB, suggesting that dynamic actin assembly may support junctional tension by facilitating the local recruitment of myosin. PMID:23051739

A WAVE2-Arp2/3 actin nucleator apparatus supports junctional tension at the epithelial zonula adherens.

PubMed

Verma, Suzie; Han, Siew Ping; Michael, Magdalene; Gomez, Guillermo A; Yang, Zhe; Teasdale, Rohan D; Ratheesh, Aparna; Kovacs, Eva M; Ali, Radiya G; Yap, Alpha S

2012-12-01

The epithelial zonula adherens (ZA) is a specialized adhesive junction where actin dynamics and myosin-driven contractility coincide. The junctional cytoskeleton is enriched in myosin II, which generates contractile force to support junctional tension. It is also enriched in dynamic actin filaments, which are replenished by ongoing actin assembly. In this study we sought to pursue the relationship between actin assembly and junctional contractility. We demonstrate that WAVE2-Arp2/3 is a major nucleator of actin assembly at the ZA and likely acts in response to junctional Rac signaling. Furthermore, WAVE2-Arp2/3 is necessary for junctional integrity and contractile tension at the ZA. Maneuvers that disrupt the function of either WAVE2 or Arp2/3 reduced junctional tension and compromised the ability of cells to buffer side-to-side forces acting on the ZA. WAVE2-Arp2/3 disruption depleted junctions of both myosin IIA and IIB, suggesting that dynamic actin assembly may support junctional tension by facilitating the local recruitment of myosin.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Genetic recombination pathways and their application for genome modification of human embryonic stem cells.

PubMed

Nieminen, Mikko; Tuuri, Timo; Savilahti, Harri

2010-10-01

Human embryonic stem cells are pluripotent cells derived from early human embryo and retain a potential to differentiate into all adult cell types. They provide vast opportunities in cell replacement therapies and are expected to become significant tools in drug discovery as well as in the studies of cellular and developmental functions of human genes. The progress in applying different types of DNA recombination reactions for genome modification in a variety of eukaryotic cell types has provided means to utilize recombination-based strategies also in human embryonic stem cells. Homologous recombination-based methods, particularly those utilizing extended homologous regions and those employing zinc finger nucleases to boost genomic integration, have shown their usefulness in efficient genome modification. Site-specific recombination systems are potent genome modifiers, and they can be used to integrate DNA into loci that contain an appropriate recombination signal sequence, either naturally occurring or suitably pre-engineered. Non-homologous recombination can be used to generate random integrations in genomes relatively effortlessly, albeit with a moderate efficiency and precision. DNA transposition-based strategies offer substantially more efficient random strategies and provide means to generate single-copy insertions, thus potentiating the generation of genome-wide insertion libraries applicable in genetic screens. 2010 Elsevier Inc. All rights reserved.

Disruption of gap junctions attenuates aminoglycoside-elicited renal tubular cell injury.

PubMed

Yao, Jian; Huang, Tao; Fang, Xin; Chi, Yuan; Zhu, Ying; Wan, Yigang; Matsue, Hiroyuki; Kitamura, Masanori

2010-08-01

Gap junctions play important roles in the regulation of cell phenotype and in determining cell survival after various insults. Here, we investigated the role of gap junctions in aminoglycoside-induced injury to renal tubular cells. Two tubular epithelial cell lines NRK-E52 and LLC-PK1 were compared for gap junction protein expression and function by immunofluorescent staining, Western blot and dye transfer assay. Cell viability after exposure to aminoglycosides was evaluated by WST assay. Gap junctions were modulated by transfection of the gap junction protein, connexin 43 (Cx43), use of Cx43 siRNA and gap junction inhibitors. NRK-E52 cells expressed abundant Cx43 and were functionally coupled by gap junctional intercellular communication (GJIC). Exposure of NRK-E52 cells to aminoglycosides, G418 and hygromycin, increased Cx43 phosphorylation and GJIC. The aminoglycosides also decreased cell viability that was prevented by gap junction inhibitors and Cx43 siRNA. LLC-PK1 cells were gap junction-deficient and resistant to aminoglycoside-induced cytotoxicity. Over-expression of a wild-type Cx43 converted LLC-PK1 cells to a drug-sensitive phenotype. The gap junction inhibitor alpha-glycyrrhetinic acid (alpha-GA) activated Akt in NRK-E52 cells. Inhibition of the Akt pathway enhanced cell toxicity to G418 and abolished the protective effects of alpha-GA. In addition, gentamycin-elicited cytotoxicity in NRK-E52 cells was also significantly attenuated by alpha-GA. Gap junctions contributed to the cytotoxic effects of aminoglycosides. Modulation of gap junctions could be a promising approach for prevention and treatment of aminoglycoside-induced renal tubular cell injury.

Coincidence of features of emitted THz electromagnetic wave power form a single Josephson junction and different current components

NASA Astrophysics Data System (ADS)

Hamdipour, Mohammad

2017-12-01

By applying a voltage to a Josephson junction, the charge in superconducting layers (S-layers) will oscillate. Wavelength of the charge oscillations in S-layers is related to external current in junction, by increasing the external current, the wavelength will decrease which cause in some currents the wavelength be incommensurate with width of junction, so the CVC shows Fiske like steps. External current throwing along junction has some components, resistive, capacitive and superconducting current, beside these currents there is a current in lateral direction of junction, (x direction). On the other hand, the emitted electromagnetic wave power in THz region is related to AC component of electric field in junction, which itself is related to charge density in S-layers, which is related to currents in the system. So we expect that features of variation of current components reflect the features of emitted THz power form junction. Here we study in detail the superconductive current in a long Josephson junction (JJ), the current voltage characteristics (CVC) of junction and emitted THz power from the system. Then we compare the results. Comparing the results we see that there is a good qualitative coincidence in features of emitted THz power and supercurrent in junction.

Tunnel junction multiple wavelength light-emitting diodes

DOEpatents

Olson, Jerry M.; Kurtz, Sarah R.

1992-01-01

A multiple wavelength LED having a monolithic cascade cell structure comprising at least two p-n junctions, wherein each of said at least two p-n junctions have substantially different band gaps, and electrical connector means by which said at least two p-n junctions may be collectively energized; and wherein said diode comprises a tunnel junction or interconnect.

Specific Cx43 phosphorylation events regulate gap junction turnover in vivo

PubMed Central

Solan, Joell L.; Lampe, Paul D.

2014-01-01

Gap junctions, composed of proteins from the connexin gene family, are highly dynamic structures that are regulated by kinase-mediated signaling pathways and interactions with other proteins. Phosphorylation of Connexin43 (Cx43) at different sites controls gap junction assembly, gap junction size and gap junction turnover. Here we present a model describing how Akt, mitogen activated protein kinase (MAPK) and src kinase coordinate to regulate rapid turnover of gap junctions. Specifically, Akt phosphorylates Cx43 at S373 eliminating interaction with zona occludens-1 (ZO-1) allowing gap junctions to enlarge. Then MAPK and src phosphorylate Cx43 to initiate turnover. We integrate published data with new data to test and refine this model. Finally, we propose that differential coordination of kinase activation and Cx43 phosphorylation controls the specific routes of disassembly, e.g., annular junction formation or gap junctions can potentially “unzip” and be internalized/endocytosed into the cell that produced each connexin. PMID:24508467

Nanotube junctions

DOEpatents

Crespi, Vincent Henry; Cohen, Marvin Lou; Louie, Steven Gwon; Zettl, Alexander Karlwalte

2004-12-28

The present invention comprises a new nanoscale metal-semiconductor, semiconductor-semiconductor, or metal-metal junction, designed by introducing topological or chemical defects in the atomic structure of the nanotube. Nanotubes comprising adjacent sections having differing electrical properties are described. These nanotubes can be constructed from combinations of carbon, boron, nitrogen and other elements. The nanotube can be designed having different indices on either side of a junction point in a continuous tube so that the electrical properties on either side of the junction vary in a useful fashion. For example, the inventive nanotube may be electrically conducting on one side of a junction and semiconducting on the other side. An example of a semiconductor-metal junction is a Schottky barrier. Alternatively, the nanotube may exhibit different semiconductor properties on either side of the junction. Nanotubes containing heterojunctions, Schottky barriers, and metal-metal junctions are useful for microcircuitry.

Nanotube junctions

DOEpatents

Crespi, Vincent Henry; Cohen, Marvin Lou; Louie, Steven Gwon Sheng; Zettl, Alexander Karlwalter

2003-01-01

The present invention comprises a new nanoscale metal-semiconductor, semiconductor-semiconductor, or metal-metal junction, designed by introducing topological or chemical defects in the atomic structure of the nanotube. Nanotubes comprising adjacent sections having differing electrical properties are described. These nanotubes can be constructed from combinations of carbon, boron, nitrogen and other elements. The nanotube can be designed having different indices on either side of a junction point in a continuous tube so that the electrical properties on either side of the junction vary in a useful fashion. For example, the inventive nanotube may be electrically conducting on one side of a junction and semiconducting on the other side. An example of a semiconductor-metal junction is a Schottky barrier. Alternatively, the nanotube may exhibit different semiconductor properties on either side of the junction. Nanotubes containing heterojunctions, Schottky barriers, and metal-metal junctions are useful for microcircuitry.

Short Ballistic Josephson Coupling in Planar Graphene Junctions with Inhomogeneous Carrier Doping

NASA Astrophysics Data System (ADS)

Park, Jinho; Lee, Jae Hyeong; Lee, Gil-Ho; Takane, Yositake; Imura, Ken-Ichiro; Taniguchi, Takashi; Watanabe, Kenji; Lee, Hu-Jong

2018-02-01

We report on short ballistic (SB) Josephson coupling in junctions embedded in a planar heterostructure of graphene. Ballistic Josephson coupling is confirmed by the Fabry-Perot-type interference of the junction critical current Ic . The product of Ic and the normal-state junction resistance RN , normalized by the zero-temperature gap energy Δ0 of the superconducting electrodes, turns out to be exceptionally large close to 2, an indication of strong Josephson coupling in the SB junction limit. However, Ic shows a temperature dependence that is inconsistent with the conventional short-junction-like behavior based on the standard Kulik-Omel'yanchuk prediction. We argue that this feature stems from the effects of inhomogeneous carrier doping in graphene near the superconducting contacts, although the junction is in fact in the short-junction limit.

Correlation between the graft-host junction of penetrating keratoplasty by anterior segment-optical coherence tomography and the magnitude of postoperative astigmatism.

PubMed

Nassar, Ghada Azab; Arfeen, Shaimaa Abd El Salam

2017-07-01

This study aimed to evaluate the alignment pattern of the graft-host junction after penetrating keratoplasty (PK) by anterior segment-optical coherence tomography (AS-OCT) and to correlate this pattern with the magnitude of postoperative astigmatism. This retrospective observational study was carried out on forty patients who underwent PK from February 2013 to August 2014. AS-OCT was performed, and the graft-host junctions were classified into well-apposed junction, malapposed junction, and equally apposed junction. Mal-apposition is subdivided into gap and protrusion. The correlations between clinical characteristics, wound profiles from the AS-OCT, and the magnitude of postoperative astigmatism by Sirius camera (Costruzione Strumenti Oftalmici [CSO], Florence, Italy (CSO, Sirius), were analyzed. Graft-host junctions from forty patients were analyzed; 18 eyes had well-apposed junctions, ten eyes had malapposed junctions, and 12 had equally apposed junctions. The mean cylinder was -9.44 ± -4.00D in well-apposed group, -13.40 ± -5.01D in malapposed group, and -4.67 ± -0.94D in equally apposed group. Alignment pattern of the graft-host junction correlated significantly with the magnitude of astigmatism (P = 0.034). Preoperative corneal diseases did not have an effect on the magnitude of astigmatism (P = 0.123). The alignment pattern of the graft-host junction by AS-OCT can explain the postoperative astigmatism after PK where it correlates significantly with the magnitude of astigmatism.

Membrane junctions in Xenopus eggs: their distribution suggests a role in calcium regulation.

PubMed

Gardiner, D M; Grey, R D

1983-04-01

We have observed the presence of membrane junctions formed between the plasma membrane and cortical endoplasmic reticulum of mature, unactivated eggs of xenopus laevis. The parallel, paired membranes of the junction are separated by a 10-mn gap within which electron-dense material is present. This material occurs in patches with an average center-to-center distance of approximately 30 nm. These junctions are rare in immature (but fully grown) oocytes (approximately 2 percent of the plasma membrane is associated with junctions) and increase dramatically during progesterone-induced maturation. Junctions in the mature, unactivated egg are two to three times more abundant in the animal hemisphere (25-30 percent of the plasma membrane associated with junction) as compared with the vegetal hemisphere (10-15 percent). Junction density decreases rapidly to values characteristic of immature oocytes in response to egg activation. The plasma membrane-ER junctions of xenopus eggs are strikingly similar in structure to membrane junctions in muscle cells thought to be essential in the triggering of intracellular calcium release from the sarcoplasmic reticulum. In addition, the junctions' distinctive, animal-vegetal polarity of distribution, their dramatic appearance during maturation, and their disapperance during activation are correlated with previously documented patterns of calcium-mediated events in anuran eggs. We discuss several lines of evidence supporting the hypothesis that these junctions in xenopus eggs are sites that transduce extracellular events into intracellular calcium release during fertilization and activation of development.

Type 1 fimbriae and extracellular polysaccharides are preeminent uropathogenic Escherichia coli virulence determinants in the murine urinary tract.

PubMed

Bahrani-Mougeot, Farah K; Buckles, Eric L; Lockatell, C V; Hebel, J R; Johnson, D E; Tang, C M; Donnenberg, M S

2002-08-01

Escherichia coli is the leading cause of urinary tract infections (UTIs). Despite the association of numerous bacterial factors with uropathogenic E. coli (UPEC), few such factors have been proved to be required for UTI in animal models. Previous investigations of urovirulence factors have relied on prior identification of phenotypic characteristics. We used signature-tagged mutagenesis (STM) in an unbiased effort to identify genes that are essential for UPEC survival within the murine urinary tract. A library of 2049 transposon mutants of the prototypic UPEC strain CFT073 was constructed using mini-Tn5km2 carrying 92 unique tags and screened in a murine model of ascending UTI. After initial screening followed by confirmation in co-infection experiments, 19 survival-defective mutants were identified. These mutants were recovered in numbers 101- to 106-fold less than the wild type in the bladder, kidneys or urine or at more than one site. The transposon junctions from each attenuated mutant were sequenced and analysed. Mutations were found in: (i) the type 1 fimbrial operon; (ii) genes involved in the biosyn-thesis of extracellular polysaccharides including group I capsule, group II capsule and enterobacterial common antigen; (iii) genes involved in metabolic pathways; and (iv) genes with unknown function. Five of the genes identified are absent from the genome of the E. coli K-12 strain. Mutations in type 1 fimbrial genes resulted in severely attenuated colonization, even in the case of a mutant with an insertion upstream of the fim operon that affected the rate of fimbrial switching from the 'off' to the 'on' phase. Three mutants had insertions in a new type II capsule biosynthesis locus on a pathogenicity island and were impaired in the production of capsule in vivo. An additional mutant with an insertion in wecE was unable to synthesize enterobacterial common antigen. These results confirm the pre-eminence of type 1 fimbriae, establish the importance of extracellular polysaccharides in the pathogenesis of UTI and identify new urovirulence determinants.

Effect of Implanting a Soft Tissue Autograft in a Central-Third Patellar Tendon Defect: Biomechanical and Histological Comparisons

PubMed Central

Kinneberg, Kirsten R. C.; Galloway, Marc T.; Butler, David L.; Shearn, Jason T.

2011-01-01

Previous studies by our laboratory have demonstrated that implanting a stiffer tissue engineered construct at surgery is positively correlated with repair tissue stiffness at 12 weeks. The objective of this study was to test this correlation by implanting a construct that matches normal tissue biomechanical properties. To do this, we utilized a soft tissue patellar tendon autograft to repair a central-third patellar tendon defect. Patellar tendon auto-graft repairs were contrasted against an unfilled defect repaired by natural healing (NH). We hypothesized that after 12 weeks, patellar tendon autograft repairs would have biomechanical properties superior to NH. Bilateral defects were established in the central-third patellar tendon of skeletally mature (one year old), female New Zealand White rabbits (n = 10). In one limb, the excised tissue, the patellar tendon autograft, was sutured into the defect site. In the contralateral limb, the defect was left empty (natural healing). After 12 weeks of recovery, the animals were euthanized and their limbs were dedicated to bio-mechanical (n = 7) or histological (n = 3) evaluations. Only stiffness was improved by treatment with patellar tendon autograft relative to natural healing (p = 0.009). Additionally, neither the patellar tendon autograft nor natural healing repairs regenerated a normal zonal insertion site between the tendon and bone. Immunohistochemical staining for collagen type II demonstrated that fibrocartilage-like tissue was regenerated at the tendon-bone interface for both repairs. However, the tissue was disorganized. Insufficient tissue integration at the tendon-to-bone junction led to repair tissue failure at the insertion site during testing. It is important to re-establish the tendon-to-bone insertion site because it provides joint stability and enables force transmission from muscle to tendon and subsequent loading of the tendon. Without loading, tendon mechanical properties deteriorate. Future studies by our laboratory will investigate potential strategies to improve patellar tendon autograft integration into bone using this model. [DOI: 10.1115/1.4004948] PMID:22010737

Ballistic Graphene Josephson Junctions from the Short to the Long Junction Regimes.

PubMed

Borzenets, I V; Amet, F; Ke, C T; Draelos, A W; Wei, M T; Seredinski, A; Watanabe, K; Taniguchi, T; Bomze, Y; Yamamoto, M; Tarucha, S; Finkelstein, G

2016-12-02

We investigate the critical current I_{C} of ballistic Josephson junctions made of encapsulated graphene-boron-nitride heterostructures. We observe a crossover from the short to the long junction regimes as the length of the device increases. In long ballistic junctions, I_{C} is found to scale as ∝exp(-k_{B}T/δE). The extracted energies δE are independent of the carrier density and proportional to the level spacing of the ballistic cavity. As T→0 the critical current of a long (or short) junction saturates at a level determined by the product of δE (or Δ) and the number of the junction's transversal modes.

Single P-N junction tandem photovoltaic device

DOEpatents

Walukiewicz, Wladyslaw [Kensington, CA; Ager, III, Joel W.; Yu, Kin Man [Lafayette, CA

2012-03-06

A single P-N junction solar cell is provided having two depletion regions for charge separation while allowing the electrons and holes to recombine such that the voltages associated with both depletion regions of the solar cell will add together. The single p-n junction solar cell includes an alloy of either InGaN or InAlN formed on one side of the P-N junction with Si formed on the other side in order to produce characteristics of a two junction (2J) tandem solar cell through only a single P-N junction. A single P-N junction solar cell having tandem solar cell characteristics will achieve power conversion efficiencies exceeding 30%.

Single P-N junction tandem photovoltaic device

DOEpatents

Walukiewicz, Wladyslaw [Kensington, CA; Ager, III, Joel W.; Yu, Kin Man [Lafayette, CA

2011-10-18

A single P-N junction solar cell is provided having two depletion regions for charge separation while allowing the electrons and holes to recombine such that the voltages associated with both depletion regions of the solar cell will add together. The single p-n junction solar cell includes an alloy of either InGaN or InAlN formed on one side of the P-N junction with Si formed on the other side in order to produce characteristics of a two junction (2J) tandem solar cell through only a single P-N junction. A single P-N junction solar cell having tandem solar cell characteristics will achieve power conversion efficiencies exceeding 30%.

Tunnel junction multiple wavelength light-emitting diodes

DOEpatents

Olson, J.M.; Kurtz, S.R.

1992-11-24

A multiple wavelength LED having a monolithic cascade cell structure comprising at least two p-n junctions, wherein each of said at least two p-n junctions have substantially different band gaps, and electrical connector means by which said at least two p-n junctions may be collectively energized; and wherein said diode comprises a tunnel junction or interconnect. 5 figs.

Supercurrent and multiple Andreev reflections in micrometer-long ballistic graphene Josephson junctions.

PubMed

Zhu, Mengjian; Ben Shalom, Moshe; Mishchsenko, Artem; Fal'ko, Vladimir; Novoselov, Kostya; Geim, Andre

2018-02-08

Ballistic Josephson junctions are predicted to support a number of exotic physics processess, providing an ideal system to inject the supercurrent in the quantum Hall regime. Herein, we demonstrate electrical transport measurements on ballistic superconductor-graphene-superconductor junctions by contacting graphene to niobium with a junction length up to 1.5 μm. Hexagonal boron nitride encapsulation and one-dimensional edge contacts guarantee high-quality graphene Josephson junctions with a mean free path of several micrometers and record-low contact resistance. Transports in normal states including the observation of Fabry-Pérot oscillations and Sharvin resistance conclusively witness the ballistic propagation in the junctions. The critical current density J C is over one order of magnitude larger than that of the previously reported junctions. Away from the charge neutrality point, the I C R N product (I C is the critical current and R N the normal state resistance of junction) is nearly a constant, independent of carrier density n, which agrees well with the theory for ballistic Josephson junctions. Multiple Andreev reflections up to the third order are observed for the first time by measuring the differential resistance in the micrometer-long ballistic graphene Josephson junctions.

Imaging snake orbits at graphene n -p junctions

NASA Astrophysics Data System (ADS)

Kolasiński, K.; Mreńca-Kolasińska, A.; Szafran, B.

2017-01-01

We consider conductance mapping of the snake orbits confined along the n -p junction defined in graphene by the electrostatic doping in the quantum Hall regime. We explain the periodicity of conductance oscillations at the magnetic field and the Fermi energy scales by the properties of the n -p junction as a conducting channel. We evaluate the conductance maps for a floating gate scanning the surface of the device. In the quantum Hall conditions the currents flow near the edges of the sample and along the n -p junction. The conductance mapping resolves only the n -p junction and not the edges. The conductance oscillations along the junction are found in the maps with periodicity related to the cyclotron orbits of the scattering current. Stronger probe potentials provide support to localized resonances at one of the sides of the junction with current loops that interfere with the n -p junction currents. The interference results in a series of narrow lines parallel to the junction with positions that strongly depend on the magnetic field through the Aharonov-Bohm effect. The consequences of a limited transparency of finite-width n -p junctions are also discussed.