Corti, Sabrina; Stephan, Roger
2002-01-01
Background Since Mycobacterium avium subspecies paratuberculosis (MAP) was isolated from intestinal tissue of a human patient suffering Crohn's disease, a controversial discussion exists whether MAP have a role in the etiology of Crohn's disease or not. Raw milk may be a potential vehicle for the transmission of MAP to human population. In a previous paper, we have demonstrated that MAP are found in raw milk samples obtained from a defined region in Switzerland. The aim of this work is to collect data about the prevalence of MAP specific IS900 insertion sequence in bulk-tank milk samples in different regions of Switzerland. Furthermore, we examined eventual correlation between the presence of MAP and the somatic cell counts, the total colony counts and the presence of Enterobacteriaceae. Results 273 (19.7%) of the 1384 examined bulk-tank milk samples tested IS900 PCR-positive. The prevalence, however, in the different regions of Switzerland shows significant differences and ranged from 1.7% to 49.2%. Furthermore, there were no statistically significant (p >> 0.05) differences between the somatic cell counts and the total colony counts of PCR-positive and PCR-negative milk samples. Enterobacteriaceae occur as often in IS900 PCR-positive as in PCR-negative milk samples. Conclusion This is the first study, which investigates the prevalence of MAP in bulk-tank milk samples all over Switzerland and infers the herd-level prevalence of MAP infection in dairy herds. The prevalence of 19.7% IS900 PCR-positive bulk-milk samples shows a wide distribution of subclinical MAP-infections in dairy stock in Switzerland. MAP can therefore often be transmitted to humans by raw milk consumption. PMID:12097144
The carnegie protein trap library: a versatile tool for Drosophila developmental studies.
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C
2007-03-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.
The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies
Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.
2007-01-01
Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782
Templated sequence insertion polymorphisms in the human genome
NASA Astrophysics Data System (ADS)
Onozawa, Masahiro; Aplan, Peter
2016-11-01
Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.
Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan
2016-01-01
Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.
Prediction of the translocon-mediated membrane insertion free energies of protein sequences.
Park, Yungki; Helms, Volkhard
2008-05-15
Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins
Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.
2013-01-01
The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011
Characterization of GM events by insert knowledge adapted re-sequencing approaches
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-01-01
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728
Characterization of GM events by insert knowledge adapted re-sequencing approaches.
Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing
2013-10-03
Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.
Otsuka, Sachio; Saiki, Jun
2016-02-01
Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.
Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio
2017-03-01
Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.
Landscape of Insertion Polymorphisms in the Human Genome
Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.
2015-01-01
Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018
Space-multiplexed optical scanner.
Riza, Nabeel A; Yaqoob, Zahid
2004-05-01
A low-loss two-dimensional optical beam scanner that is capable of delivering large (e.g., > 10 degrees) angular scans along the elevation as well as the azimuthal direction is presented. The proposed scanner is based on a space-switched parallel-serial architecture that employs a coarse-scanner module and a fine-scanner module that produce an ultrahigh scan space-fill factor, e.g., 900 x 900 distinguishable beams in a 10 degrees (elevation) x 10 degrees (azimuth) scan space. The experimentally demonstrated one-dimensional version of the proposed scanner has a supercontinuous scan, 100 distinguishable beam spots in a 2.29 degrees total scan range, and 1.5-dB optical insertion loss.
NASA Astrophysics Data System (ADS)
Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.
2017-05-01
MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.
Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario
2017-04-13
The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.
Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries
Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.
2015-01-01
PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706
Dunn, R. C.; Laurie, C. C.
1995-01-01
Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745
Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L
1994-01-01
A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933
A new molecular evolution model for limited insertion independent of substitution.
Lèbre, Sophie; Michel, Christian J
2013-10-01
We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.
GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.
Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd
2012-01-01
T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd
2017-01-01
SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction
Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt
2018-01-01
Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023
Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D
2014-05-27
We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.
Identifying transposon insertions and their effects from RNA-sequencing data.
de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos
2017-07-07
Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sorting genomes by reciprocal translocations, insertions, and deletions.
Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying
2010-01-01
The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.
High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.
Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca
2015-01-01
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.
Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji
2012-12-01
In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong
2010-12-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.
Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie
Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol
2010-01-01
P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104
Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.
2016-01-01
With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001
Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José; Lopez, Osvaldo Jorge
2013-03-01
Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time.
Mundo, Silvia Leonor; Gilardoni, Liliana Rosa; Hoffman, Federico José
2013-01-01
Paratuberculosis is an infectious, chronic, and incurable disease that affects ruminants, caused by Mycobacterium avium subsp. paratuberculosis. This bacterium is shed primarily through feces of infected cows but can be also excreted in colostrum and milk and might survive pasteurization. Since an association of genomic sequences of M. avium subsp. paratuberculosis in patients with Crohn's disease has been described; it is of interest to rapidly detect M. avium subsp. paratuberculosis in milk for human consumption. IS900 insertion is used as a target for PCR amplification to identify the presence of M. avium subsp. paratuberculosis in biological samples. Two target sequences were selected: IS1 (155 bp) and IS2 (94 bp). These fragments have a 100% identity among all M. avium subsp. paratuberculosis strains sequenced. M. avium subsp. paratuberculosis was specifically concentrated from milk samples by immunomagnetic separation prior to performing PCR. The amplicons were characterized using DNA methylase Genotyping, i.e., the amplicons were methylated with 6-methyl-adenine and digested with restriction enzymes to confirm their identity. The methylated amplicons from 100 CFU of M. avium subsp. paratuberculosis can be visualized in a Western blot format using an anti-6-methyl-adenine monoclonal antibody. The use of DNA methyltransferase genotyping coupled to a scintillation proximity assay allows for the detection of up to 10 CFU of M. avium subsp. paratuberculosis per ml of milk. This test is rapid and sensitive and allows for automation and thus multiple samples can be tested at the same time. PMID:23275511
Method for introducing unidirectional nested deletions
Dunn, John J.; Quesada, Mark A.; Randesi, Matthew
2001-01-01
Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Borot de Battisti, M; Maenhout, M; Lagendijk, J J W
Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less
Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young
2017-08-15
Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.
Bashir, Ali; Bansal, Vikas; Bafna, Vineet
2010-06-18
Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.
Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile
2007-07-01
A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.
High-throughput analysis of T-DNA location and structure using sequence capture
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
High-throughput analysis of T-DNA location and structure using sequence capture
Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...
2015-10-07
Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less
Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server
Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J
2006-01-01
Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563
Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J
2016-01-01
Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.
The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.
Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix
2014-01-01
The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.
Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S
2011-01-21
DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.
Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda
2012-01-01
Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.
Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda
2012-01-01
Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448
Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W
1994-12-01
DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.
Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing
Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand
2013-01-01
Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038
Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou
2018-04-01
While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health
Martin, William F.
2017-01-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372
Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae
Muñoz, Rosario; López, Rubens; García, Ernesto
1998-01-01
We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131
2012-01-01
Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909
Triple helix purification and sequencing
Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.
1995-01-01
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.
Triple helix purification and sequencing
Wang, R.; Smith, L.M.; Tong, X.E.
1995-03-28
Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.
Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.
2013-01-01
High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572
Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E
2018-02-27
Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.
Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar
2014-01-01
Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.
Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917
Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U
2012-01-01
We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Garrido, Joseba M.; Molina, Elena; Geijo, María V.; Elguezabal, Natalia; Vázquez, Patricia; Juste, Ramón A.
2014-01-01
The enteropathy called paratuberculosis (PTB), which mainly affects ruminants and has a worldwide distribution, is caused by Mycobacterium avium subsp. paratuberculosis. This disease significantly reduces the cost-effectiveness of ruminant farms, and therefore, reliable and rapid detection methods are needed to control the spread of the bacterium in livestock and in the environment. The aim of this study was to identify a specific and sensitive combination of DNA extraction and amplification to detect M. avium subsp. paratuberculosis in feces. Negative bovine fecal samples were inoculated with increasing concentrations of two different bacterial strains (field and reference) to compare the performance of four extraction and five amplification protocols. The best results were obtained using the JohnePrep and MagMax extraction kits combined with an in-house triplex real-time PCR designed to detect IS900, ISMap02 (an insertion sequence of M. avium subsp. paratuberculosis present in 6 copies per genome), and an internal amplification control DNA simultaneously. These combinations detected 10 M. avium subsp. paratuberculosis cells/g of spiked feces. The triplex PCR detected 1 fg of genomic DNA extracted from the reference strain K10. The performance of the robotized version of the MagMax extraction kit combined with the IS900 and ISMap02 PCR was further evaluated using 615 archival fecal samples from the first sampling of nine Friesian cattle herds included in a PTB control program and followed up for at least 4 years. The analysis of the results obtained in this survey demonstrated that the diagnostic method was highly specific and sensitive for the detection of M. avium subsp. paratuberculosis in fecal samples from cattle and a very valuable tool to be used in PTB control programs. PMID:24727272
Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide
2011-09-01
Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.
Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.
Hazkani-Covo, Einat; Martin, William F
2017-05-01
Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier
2016-05-01
Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.
NASA Astrophysics Data System (ADS)
Khosla, Deepak; Huber, David J.; Martin, Kevin
2017-05-01
This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).
Taheri, Mohammad Mohammad; Mosavari, Nader; Feizabadi, Mohammad Mehdi; Tadayon, Keyvan; Keshavarz, Rouholah; Pajoohi, Reza Aref; Soleimani, Kioomars; Pour, Shojaat Dashti
2016-12-01
Mycobacterium avium ssp paratuberculosis (MAP) causes paratuberculosis (Johne's disease) in ruminants. As a species, M. avium comprises M. avium subsp. hominissuis and a number of clones that are known to have evolved from this subspecies, namely M. avium subsp. avium (MAA), M. avium subsp. silvaticum, and MAP. Despite the very high genomic similarity of MAP and MAA, the insertion sequence IS900, which is 1,451-bp long, is now understood to be exclusively present in 10-20 copies in the genome of MAP. In the present study, a multidiscipline polymerase chain reaction (PCR)-based algorithm targeting16SrRNA, IS6110, IS901, IS1245, and IS900 markers has been employed to differentiate between six laboratory strains of M. avium complex (including MAP 316F, III&V, and 2e plus MAA D4), Mycobacterium tuberculosis DT, and Mycobacterium bovis AN5 strains used at the Razi Institute (Tehran, Iran) for the preparation of paratuberculin, avian, human, and bovine tuberculin, respectively. Three laboratory strains of III&V, 2e, and 316F were subcultured on Herrold's egg yolk medium, whereas the MAA strain of D4 along with M. bovis AN5 and M. tuberculosis DT were subcultured on Lowenstein-Jensen slopes. All the inoculated culture tubes were incubated for 8weeks at 37°C. Eventually, their genomic DNA was extracted according to the method of van Soolingen. Five individual PCRs were conducted on these templates to amplify 16SrRNA (genus-specific marker shared by all mycobacteria), IS900 (MAP-specific marker), IS901 (MAA-specific marker), IS1245 (M. avium complex (MAC)-specific marker), and IS6110 (M. tuberculosis complex (MTC)-specific marker) loci. Consequently, a 543-bp amplicon was amplified by all the six strains in PCR against 16SrRNA, an indication of their identity as members of Mycobacterium genus. A 245-bp fragment was detected in only IS6110-PCR with M. bovis AN5 as well as M. tuberculosis DT. In the IS1245 assessment, the MAA strain of D4 produced a 427-bp amplicon, whereas none of the other studied strains produced this amplicon. A 1,108-bp amplicon fragment of the IS901 marker was successfully produced by MAA strain, whereas no PCR product was achieved in amplification of all the three MAP strains. In IS900-nested PCR, the three MAP strains produced the expected 400-bp and 298-bp fragments CONCLUTION: However, no amplification was observed with other strains. Two main achievements of this work are the development of an efficient means of differentiation between the six Razi laboratory mycobacterial strains and characterization of the genomic profile of these strains, a capability that is vital when cross contamination is potentially an important concern. Copyright © 2016.
Müller, G; Zimmermann, R
1987-01-01
Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722
Hamilton, P T; Reeve, J N
1985-01-01
DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.
Utilization of next generation sequencing for analyzing transgenic insertions in plum
USDA-ARS?s Scientific Manuscript database
When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...
Characterization of (CA)n microsatellite repeats from large-insert clones.
Litt, M; Browne, D
2001-05-01
The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.
Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E
2001-08-01
Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.
Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae
Chatre, Laurent; Ricchetti, Miria
2011-01-01
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151
Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.
Chatre, Laurent; Ricchetti, Miria
2011-03-08
The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.
Active role of a human genomic insert in replication of a yeast artificial chromosome.
van Brabant, A J; Fangman, W L; Brewer, B J
1999-06-01
Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.
The tomato genome sequence provides insight into fleshy fruit evolution
USDA-ARS?s Scientific Manuscript database
The genome of the inbred tomato cultivar ‘Heinz 1706’ was sequenced and assembled using a combination of Sanger and “next generation” technologies. The predicted genome size is ~900 Mb, consistent with prior estimates, of which 760 Mb were assembled in 91 scaffolds aligned to the 12 tomato chromosom...
Amirhaeri, S; Wohlrab, F; Wells, R D
1995-02-17
The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.
Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.
2012-01-01
The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417
A High-Throughput Arabidopsis Reverse Genetics System
Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.
2002-01-01
A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722
Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I
2004-03-01
We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.
Florou, M; Leontides, L; Kostoulas, P; Billinis, C; Sofia, M; Kyriazakis, I; Lykotrafitis, F
2008-05-01
This study aimed to: (1) investigate whether non-ruminant wildlife interfacing with dairy sheep and goats of four Greek flocks endemically infected with Mycobacterium avium subspecies paratuberculosis (MAP) harboured MAP and (2) genetically compare the strains isolated from the wildlife to those isolated from the small ruminants of these flocks. We cultured and screened, by polymerase chain reaction (PCR), pooled-tissue samples from 327 wild animals of 11 species for the MAP-specific IS900 insertion sequence. We also cultured faecal samples from 100 sheep or goats from each of the four flocks. MAP was detected in samples from 11 sheep, 12 goats, two mice, two rats, a hare and a fox. Only one rat had histopathological findings. Genetic typing categorized 21 isolates as cattle-type strains and two, from a house mouse and a goat respectively, as sheep-type strains; this is the first report of a rodent harbouring a sheep-type strain. The MAP types that were most frequently isolated amongst the sheep and goats of each flock were also the ones isolated from sympatric rodents; those isolated from the fox and hare also belonged to the predominant ruminant strains.
Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca
2017-10-01
Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R
2017-08-01
There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.
2010-10-14
High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and
Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio
2014-03-14
Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.
Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe
2014-01-01
Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649
Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases
Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.
2013-01-01
There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777
Wild-Type Measles Viruses with Non-Standard Genome Lengths
Bankamp, Bettina; Liu, Chunyu; Rivailler, Pierre; Bera, Jayati; Shrivastava, Susmita; Kirkness, Ewen F.; Bellini, William J.; Rota, Paul A.
2014-01-01
The length of the single stranded, negative sense RNA genome of measles virus (MeV) is highly conserved at 15,894 nucleotides (nt). MeVs can be grouped into 24 genotypes based on the highly variable 450 nucleotides coding for the carboxyl-terminus of the nucleocapsid protein (N-450). Here, we report the genomic sequences of 2 wild-type viral isolates of genotype D4 with genome lengths of 15,900 nt. Both genomes had a 7 nt insertion in the 3′ untranslated region (UTR) of the matrix (M) gene and a 1 nt deletion in the 5′ UTR of the fusion (F) gene. The net gain of 6 nt complies with the rule-of-six required for replication competency of the genomes of morbilliviruses. The insertions and deletion (indels) were confirmed in a patient sample that was the source of one of the viral isolates. The positions of the indels were identical in both viral isolates, even though epidemiological data and the 3 nt differences in N-450 between the two genomes suggested that the viruses represented separate chains of transmission. Identical indels were found in the M-F intergenic regions of 14 additional genotype D4 viral isolates that were imported into the US during 2007–2010. Viral isolates with and without indels produced plaques of similar size and replicated efficiently in A549/hSLAM and Vero/hSLAM cells. This is the first report of wild-type MeVs with genome lengths other than 15,894 nt and demonstrates that the length of the M-F UTR of wild-type MeVs is flexible. PMID:24748123
Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations
Gumbart, James; Roux, Benoît
2012-01-01
The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850
Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara
2018-06-01
Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.
Mechanism for DNA transposons to generate introns on genomic scales
Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.
2017-01-01
Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113
Expression and Bioinformatics Analysis of Pectate Lyase Gene from Bacillus subtilis521
NASA Astrophysics Data System (ADS)
Xiao, Jing; Lu, Fu-Ping; Li, Yu; Li, Jin-Ting
In order to exploit new genetic resources, Pectate lyase(PEL) gene was amplified by PCR using the genome DNA from an alkaline Bacillus subtilis521. The PCR product was inserted into pET22b(+) vector. The recombinant plasmids were cloned in E.coli DH5α and then expressed in E.coli BL21. When cultured in the optimized medium, the positive clones E.coli BL21(pET22b(+)pel)showed intracellular pectate lyase activity of 90.0 U/mL. It was indicated that we had obtained the correct PEL gene. The pel has an open reading frame of 1263 nucleotides and codes for a product of 420 amino acids with a calculated molecular mass of 45.5 kD. Based on computer assisted analysis, a signal peptides and two conserved domains were revealed. The sequence analysis for PEL showed that it shares 26-82% homology with other strains in GenBank. In addition, the advanced structure of PEL were also predicted and analysed. This study will help to the experimental design of PEL fermentation and production purification and enzyme evolution.
Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W
2012-05-03
Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.
A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Stinear, Timothy; Davies, John K.; Jenkin, Grant A.; Portaels, Françoise; Ross, Bruce C.; OppEdIsano, Frances; Purcell, Maria; Hayman, John A.; Johnson, Paul D. R.
2000-01-01
Two high-copy-number insertion sequences, IS2404 and IS2606, were recently identified in Mycobacterium ulcerans and were shown by Southern hybridization to possess restriction fragment length polymorphism between strains from different geographic origins. We have designed a simple genotyping method that captures these differences by PCR amplification of the region between adjacent copies of IS2404 and IS2606. We have called this system 2426 PCR. The method is rapid, reproducible, sensitive, and specific for M. ulcerans, and it has confirmed previous studies suggesting a clonal population structure of M. ulcerans within a geographic region. M. ulcerans isolates from Australia, Papua New Guinea, Malaysia, Surinam, Mexico, Japan, China, and several countries in Africa were easily differentiated based on an array of 4 to 14 PCR products ranging in size from 200 to 900 bp. Numerical analysis of the banding patterns suggested a close evolutionary link between M. ulcerans isolates from Africa and southeast Asia. The application of 2426 PCR to total DNA, extracted directly from M. ulcerans-infected tissue specimens without culture, demonstrated the sensitivity and specificity of this method and confirmed for the first time that both animal and human isolates from areas of endemicity in southeast Australia have the same genotype. PMID:10747130
Thieme, Frank; Marillonnet, Sylvestre
2014-01-01
Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.
Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A
2018-03-01
Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.
Ehrmann, M A; Vogel, R E
2001-11-01
An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.
Ma, Zhengqiang
2013-01-01
Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966
Kuang, Jiayi; Li, Yuxuan; He, Yufeng; Gan, Lin; Wang, Aiming; Chen, Yanhua; Li, Xiaoting; Guo, Lin; Tang, Rongjun
2016-04-01
To compare the effects of oblique insertion at anatomical points and conventional acupuncture for sacroiliac joint injury. Eighty patients were randomly divided into an observation group and a control group, 40 cases in each one. In the observation group, oblique insertion therapy at anatomical points was used, and the 9 points of equal division (anatomical points) marked by palpating the anatomical symbol were treated as the insertion acupoints. In the control group, conventional acupuncture was applied, and perpendicular insertion was adopted at Huantiao (GB 30), Zhibian (BL 54) and Weizhong (BL 40), etc. In the two groups, the! treatment was given once a day and 5 times per week. Ten treatments were made into one course and two courses were required. The clinical effects, the changes of visual analogue scale (VAS) and Oswestry dysfunctional index. (ODI) before and after treatment were observed in the two groups. The total effective rate of the observation group was 90.0% (36/40), which was better than 72.5% (29/40) of the control group (P < 0.05). After treatment, the results of the VAS and ODI of the two groups were apparently declined (both P < 0.01), and those in the observation group were decreased more obviously (both P < 0.01). The effect of oblique inser-tion at anatomical points for sacroiliac joint injury is superior to that of conventional acupuncture, which can effectively relieve pain and improve the disfunction.
Szeverényi, I; Hodel, A; Arber, W; Olasz, F
1996-09-26
We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.
Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying
2011-03-01
To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.
Michalovova, M; Vyskot, B; Kejnovsky, E
2013-10-01
We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.
An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D
2014-07-01
Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp
2017-02-01
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).
Alu repeat discovery and characterization within human genomes
Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.
2011-01-01
Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385
Proels, Reinhard K; Roitsch, Thomas
2006-03-01
Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.
Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H
2006-11-21
Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.
Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates
2011-01-01
Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878
Zhang, Chun; Feng, Li; Tian, Xing-Shan
2018-04-26
The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.
Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.
2016-01-01
The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289
[Isolation and function of genes regulating aphB expression in Vibrio cholerae].
Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao
2012-02-04
We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.
The Design and Analysis of Transposon-Insertion Sequencing Experiments
Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.
2016-01-01
Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926
Word and frame synchronization with verification for PPM optical communications
NASA Technical Reports Server (NTRS)
Marshall, William K.
1986-01-01
A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.
Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.
Grindley, N D; Joyce, C M
1980-01-01
The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245
USDA-ARS?s Scientific Manuscript database
Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...
Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro
2017-05-01
Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.
Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy
NASA Astrophysics Data System (ADS)
Chen, Ellson Y.
1997-05-01
So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.
A Test for Characterizing Delamination Migration in Carbon/Epoxy Tape Laminates
NASA Technical Reports Server (NTRS)
Ratcliffe, James G.; Czabaj, Michael W.; O'Brien, Thomas K.
2013-01-01
A new test method is presented for the purpose of investigating migration of a delamination between neighboring ply interfaces in fiber-reinforced, polymer matrix tape laminates. The test is a single cantilever beam configuration consisting of a cross-ply laminate with a polytetrafluoroethylene insert implanted at the mid-plane and spanning part way along the length of the specimen. The insert is located between a 0- degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The specimen is clamped at both ends onto a rigid baseplate and is loaded on its upper surface via a piano hinge. Tests were conducted with the load-application point located on the intact portion of the specimen in order to initiate delamination growth onset followed by migration of the delamination to a neighboring 90/0 ply interface by kinking through the 90-degree ply stack. Varying this position was found to affect the distance relative to the load-application point at which migration initiated. In each specimen, migration initiated by a gradual transition of the delamination at the 0/90 interface into the 90-degree ply stack. In contrast, transition of the kinked crack into the 90/0 interface was sudden. Fractography of the specimens indicated that delamination prior to migration was generally mixed mode-I/II. Inspection of the kink surface revealed mode-I fracture. In general, use of this test allows for the observation of the growth of a delamination followed by migration of the delamination to another ply interface, and should thus provide a means for validating analyses aimed at simulating migration.
Characterizing Delamination Migration in Carbon/Epoxy Tape Laminates
NASA Technical Reports Server (NTRS)
Ratcliffe, James G.; Czabaj, Michael W.; Obrien, Thomas K.
2012-01-01
A new test method is presented for the purpose of investigating migration of a delamination between neighboring ply interfaces in fiber-reinforced, polymer matrix tape laminates. The test is a single cantilever beam configuration consisting of a cross-ply laminate with a polytetrafluoroethylene (PTFE) insert implanted at the mid-plane and spanning part way along the length of the specimen. The insert is located between a 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The specimen is clamped at both ends onto a rigid baseplate and is loaded on its upper surface via a piano hinge. Tests were conducted with the load-application point located on the intact portion of the specimen in order to initiate delamination growth onset followed by migration of the delamination to a neighboring 90/0 ply interface by kinking through the 90- degree ply stack. Varying this position was found to affect the distance relative to the load-application point at which migration initiated. In each specimen, migration initiated by a gradual transition of the delamination at the 0/90 interface into the 90- degree ply stack. In contrast, transition of the kinked crack into the 90/0 interface was sudden. Fractography of the specimens indicated that delamination prior to migration was generally mixed mode-I/II. Inspection of the kink surface revealed mode-I fracture. In general, use of this test allows for the observation of the growth of a delamination followed by migration of the delamination to another ply interface, and should thus provide a means for validating analyses aimed at simulating migration.
QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.
Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S
2009-07-01
Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers
2012-01-01
Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534
Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.
Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A
2012-04-30
Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.
Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús
2011-01-01
Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774
Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús
2011-01-01
Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.
Hsing, Michael; Cherkasov, Artem
2008-06-25
Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.
MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.
Park, Yungki; Helms, Volkhard
2008-08-15
To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.
Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.
2007-01-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094
Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J
2007-10-01
AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .
Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan
2014-02-25
This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.
Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster
Harden, N.; Ashburner, M.
1990-01-01
FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013
FLOROU, M.; LEONTIDES, L.; KOSTOULAS, P.; BILLINIS, C.; SOFIA, M.; KYRIAZAKIS, I.; LYKOTRAFITIS, F.
2008-01-01
SUMMARY This study aimed to: (1) investigate whether non-ruminant wildlife interfacing with dairy sheep and goats of four Greek flocks endemically infected with Mycobacterium avium subspecies paratuberculosis (MAP) harboured MAP and (2) genetically compare the strains isolated from the wildlife to those isolated from the small ruminants of these flocks. We cultured and screened, by polymerase chain reaction (PCR), pooled-tissue samples from 327 wild animals of 11 species for the MAP-specific IS900 insertion sequence. We also cultured faecal samples from 100 sheep or goats from each of the four flocks. MAP was detected in samples from 11 sheep, 12 goats, two mice, two rats, a hare and a fox. Only one rat had histopathological findings. Genetic typing categorized 21 isolates as cattle-type strains and two, from a house mouse and a goat respectively, as sheep-type strains; this is the first report of a rodent harbouring a sheep-type strain. The MAP types that were most frequently isolated amongst the sheep and goats of each flock were also the ones isolated from sympatric rodents; those isolated from the fox and hare also belonged to the predominant ruminant strains. PMID:17578601
Methods and compositions for controlling gene expression by RNA processing
Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.
2017-08-29
The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.
Stable zymomonas mobilis xylose and arabinose fermenting strains
Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW
2008-04-08
The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.
Jia, Xianbo; Lin, Xinjian; Chen, Jichen
2017-11-02
Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo
2016-10-15
Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L
2018-06-01
Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.
Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I
2018-05-01
Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.
Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique
2012-12-01
A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.
Compositions and methods for the expression of selenoproteins in eukaryotic cells
Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU
2012-09-25
Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.
Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R
2009-01-01
Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662
Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.
2017-01-01
Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011
Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A
2017-11-01
In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.
2012-01-01
Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201
Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A
2015-04-01
In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.
Xiong, Y; Eickbush, T H
1988-01-01
Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482
Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)
Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn
2009-01-01
Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547
TEs or not TEs? That is the evolutionary question.
Vaknin, Keren; Goren, Amir; Ast, Gil
2009-10-23
Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.
MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.
Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi
2018-03-05
Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.
Guidelines to use tomato in experiments with a controlled environment
Schwarz, Dietmar; Thompson, Andrew J.; Kläring, Hans-Peter
2014-01-01
Domesticated tomato (Solanum lycopersicum) is the most important horticultural crop worldwide. Low polymorphism at the DNA level conflicts with the wealth of morphological variation. Fruits vary widely in size, shape, and color. In contrast, genetic variation between the 16 wild relatives is tremendous. Several large seed banks provide tomato germplasm for both domesticated and wild accessions of tomato. Recently, the genomes of the inbred cultivar “Heinz 1706” (≈900 Mb), and S. pimpinellifolium (739 Mb) were sequenced. Genomic markers and genome re-sequencing data are available for >150 cultivars and accessions. Transformation of tomato is relatively easy and T-DNA insertion line collections are available. Tomato is widely used as a model crop for fruit development but also for diverse physiological, cellular, biochemical, molecular, and genetic studies. It can be easily grown in greenhouses or growth chambers. Plants grow, flower, and develop fruits well at daily light lengths between 8 and 16 h. The required daily light integral of an experiment depends on growth stage and temperature investigated. Temperature must be 10–35°C, relative humidity 30–90%, and, CO2 concentration 200–1500 μmol mol−1. Temperature determines the speed of the phenological development while daily light integral and CO2 concentration affect photosynthesis and biomass production. Seed to seed cultivation takes 100 days at 20°C and can be shortened or delayed by temperature. Tomato may be cultivated in soil, substrates, or aeroponically without any substrate. Root volume, and water uptake requirements are primarily determined by transpiration demands of the plants. Many nutrient supply recipes and strategies are available to ensure sufficient supply as well as specific nutrient deficits/surplus. Using appropriate cultivation techniques makes tomato a convenient model plant for researchers, even for beginners. PMID:25477888
Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.
Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami
2012-08-01
Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.
Wang, Lingfang; Kefalidis, Christos E; Sinbandhit, Sourisak; Dorcet, Vincent; Carpentier, Jean-François; Maron, Laurent; Sarazin, Yann
2013-09-27
The tin(II) complexes {LO(x)}Sn(X) ({LO(x)}(-) =aminophenolate ancillary) containing amido (1-4), chloro (5), or lactyl (6) coligands (X) promote the ring-opening polymerization (ROP) of cyclic esters. Complex 6, which models the first insertion of L-lactide, initiates the living ROP of L-LA on its own, but the amido derivatives 1-4 require the addition of alcohol to do so. Upon addition of one to ten equivalents of iPrOH, precatalysts 1-4 promote the ROP of trimethylene carbonate (TMC); yet, hardly any activity is observed if tert-butyl (R)-lactate is used instead of iPrOH. Strong inhibition of the reactivity of TMC is also detected for the simultaneous copolymerization of L-LA and TMC, or for the block copolymerization of TMC after that of L-LA. Experimental and computational data for the {LO(x)}Sn(OR)complexes (OR=lactyl or lactidyl) replicating the active species during the tin(II)-mediated ROP of L-LA demonstrate that the formation of a five-membered chelate is largely favored over that of an eight-membered one, and that it constitutes the resting state of the catalyst during this (co)polymerization. Comprehensive DFT calculations show that, out of the four possible monomer insertion sequences during simultaneous copolymerization of L-LA and TMC: 1) TMC then TMC, 2) TMC then L-LA, 3) L-LA then L-LA, and 4) L-LA then TMC, the first three are possible. By contrast, insertion of L-LA followed by that of TMC (i.e., insertion sequence 4) is endothermic by +1.1 kcal mol(-1), which compares unfavorably with consecutive insertions of two L-LA units (i.e., insertion sequence 3) (-10.2 kcal mol(-1)). The copolymerization of L-LA and TMC thus proceeds under thermodynamic control. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].
Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V
2012-04-01
Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.
Investigating Delamination Migration in Composite Tape Laminates
NASA Technical Reports Server (NTRS)
Ratcliffe, James G.; DeCarvalho, Nelson V.
2014-01-01
A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.
Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N
1978-11-16
Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.
Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph
2009-12-15
Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.
Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D
2011-09-01
Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.
Optimized scheduling technique of null subcarriers for peak power control in 3GPP LTE downlink.
Cho, Soobum; Park, Sang Kyu
2014-01-01
Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system.
Optimized Scheduling Technique of Null Subcarriers for Peak Power Control in 3GPP LTE Downlink
Park, Sang Kyu
2014-01-01
Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system. PMID:24883376
NASA Astrophysics Data System (ADS)
Khalighi, Mohammad Mehdi; Delso, Gaspar; Maramraju, Sri Harsha; Deller, Timothy W.; Levin, Craig S.; Glover, Gary H.
2016-10-01
A silicon photomultiplier (SiPM)-based time-of-flight capable PET detector has been integrated with a 70 cm wide-bore 3T MR scanner for simultaneous whole-body imaging (MR750w, GE Healthcare, Waukesha, WI). After insertion of the PET detector, the final PET/MR bore is 60 cm wide (SIGNA PET/MR, GE Healthcare, Waukesha, WI). The MR performance was compared before and after the PET ring insertion. B0 homogeneity, B1+ uniformity of the body coil along with peak B1+, coherent noise, and FBIRN (Function Biomedical Informatics Research Network) tests are used to compare the MR performance. It is shown that B0 homogeneity and coherent noise have not changed according to the system specifications. Peak B1+ is increased by 33% and B1+ inhomogeneity is increased by 4% after PET ring insertion due to a smaller diameter body coil design. The FBIRN test shows similar temporal stability before and after PET ring insertion. Due to a smaller body coil on the PET/MR system, the signal fluctuation to noise ratio (SFNR) and SNR for body receive coil, are improved by 40% and 160% for Echo Planar Imaging (EPI) and spiral sequences respectively. Comparison using RF- and gradient-intensive clinical sequences shows inserting the PET detectors into the wide-bore MRI has not compromised the MR image quality according to these tests.
The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.
Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J
2017-05-01
Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.
Birchler, James A; Presting, Gernot G
2012-04-01
The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.
Meyer, C; Pouteau, S; Rouzé, P; Caboche, M
1994-01-01
By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.
Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.
Ponce, M R; Quesada, V; Micol, J L
1998-05-01
An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.
Trinh, T. Q.; Sinden, R. R.
1993-01-01
We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478
Genome-wide analysis of Tol2 transposon reintegration in zebrafish.
Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir
2009-09-08
Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.
USDA-ARS?s Scientific Manuscript database
Phylogenetic studies have demonstrated the largest morning glory genus, Ipomoea, is not monophyletic, and nine other segregate genera are derived from within Ipomoea. Therefore, systematic research is focused on the monophyletic tribe Ipomoeeae (c. 650-900 species). We used whole plastid genomes to ...
2011-01-01
Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357
Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.
2014-01-01
Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068
NASA Astrophysics Data System (ADS)
Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.
2018-05-01
Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.
Selfish DNA in protein-coding genes of Rickettsia.
Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M
2000-10-13
Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.
Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...
In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome
2013-01-01
Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783
Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB
Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias
2012-01-01
The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441
Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB.
Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias
2012-01-01
The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB.
Fluorescence-based microendoscopes for breast cancer ductoscopy
NASA Astrophysics Data System (ADS)
Zeylikovich, Iosif; Tang, Guichen C.; Katz, A.; Budansky, Yury; Alfano, R. R.
2006-02-01
Recently microendoscopes are being developed as a tool to detection cancer or pre-cancerous lesions in the milk ducts of the human breast. The microendoscope can be inserted into the duct through the nipple. Integration of fluorescence spectroscopy into microendoscopy can provide an improved platform for real-time cancer detection followed by immediate intervention. Typically, the optical fibers employed by existing microendoscope systems transmit in the 450 to 900 nm range. A prototype system combining fluorescence spectroscopy with visible imaging by microendoscopy is described and preliminary measurements on ex vivo human breast tissues are presented. Image resolution and distortion are discussed.
Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao
2017-01-01
Abstract Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability. PMID:28180301
Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice
Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain
2013-01-01
Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695
Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C
2005-04-01
We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Rosa, Felice
2006-07-01
In the ambit of the Severe Accident Network of Excellence Project (SARNET), funded by the European Union, 6. FISA (Fission Safety) Programme, one of the main tasks is the development and validation of the European Accident Source Term Evaluation Code (ASTEC Code). One of the reference codes used to compare ASTEC results, coming from experimental and Reactor Plant applications, is MELCOR. ENEA is a SARNET member and also an ASTEC and MELCOR user. During the first 18 months of this project, we performed a series of MELCOR and ASTEC calculations referring to a French PWR 900 MWe and to themore » accident sequence of 'Loss of Steam Generator (SG) Feedwater' (known as H2 sequence in the French classification). H2 is an accident sequence substantially equivalent to a Station Blackout scenario, like a TMLB accident, with the only difference that in H2 sequence the scram is forced to occur with a delay of 28 seconds. The main events during the accident sequence are a loss of normal and auxiliary SG feedwater (0 s), followed by a scram when the water level in SG is equal or less than 0.7 m (after 28 seconds). There is also a main coolant pumps trip when {delta}Tsat < 10 deg. C, a total opening of the three relief valves when Tric (core maximal outlet temperature) is above 603 K (330 deg. C) and accumulators isolation when primary pressure goes below 1.5 MPa (15 bar). Among many other points, it is worth noting that this was the first time that a MELCOR 1.8.5 input deck was available for a French PWR 900. The main ENEA effort in this period was devoted to prepare the MELCOR input deck using the code version v.1.8.5 (build QZ Oct 2000 with the latest patch 185003 Oct 2001). The input deck, completely new, was prepared taking into account structure, data and same conditions as those found inside ASTEC input decks. The main goal of the work presented in this paper is to put in evidence where and when MELCOR provides good enough results and why, in some cases mainly referring to its specific models (candling, corium pool behaviour, etc.) they were less good. A future work will be the preparation of an input deck for the new MELCOR 1.8.6. and to perform a code-to-code comparison with ASTEC v1.2 rev. 1. (author)« less
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.
2011-01-01
We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007
Structural features of the rice chromosome 4 centromere.
Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin
2004-01-01
A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.
Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J
2000-11-01
Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.
Identification of genomic indels and structural variations using split reads
2011-01-01
Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches
Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael
2012-01-01
Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521
Continuous Influx of Genetic Material from Host to Virus Populations
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane
2016-01-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124
Continuous Influx of Genetic Material from Host to Virus Populations.
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A
2016-02-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, O.; Masters, C.; Lewis, M.B.
1994-09-01
In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less
Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K
2017-10-03
Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.
Insertion sequences enrichment in extreme Red sea brine pool vent.
Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania
2017-03-01
Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.
Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W
1996-02-15
Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).
Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W
1996-01-01
Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302
Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A
2015-01-01
We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.
Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.
2015-01-01
We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260
SvABA: genome-wide detection of structural variants and indels by local assembly.
Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen
2018-04-01
Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.
Traverse, Charles C; Ochman, Howard
2017-08-29
Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.
A Sequence of Sorting Strategies.
ERIC Educational Resources Information Center
Duncan, David R.; Litwiller, Bonnie H.
1984-01-01
Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)
Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.
He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin
2017-11-01
Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.
Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information
McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash
2018-01-01
ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869
Macé, Matthias; Crouau-Roy, Brigitte
2008-01-01
Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953
Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F
2015-07-08
Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.
Poliovirus serotype-specific VP1 sequencing primers.
Kilpatrick, David R; Iber, Jane C; Chen, Qi; Ching, Karen; Yang, Su-Ju; De, Lina; Mandelbaum, Mark D; Emery, Brian; Campagnoli, Ray; Burns, Cara C; Kew, Olen
2011-06-01
The Global Polio Laboratory Network routinely uses poliovirus-specific PCR primers and probes to determine the serotype and genotype of poliovirus isolates obtained as part of global poliovirus surveillance. To provide detailed molecular epidemiologic information, poliovirus isolates are further characterized by sequencing the ~900-nucleotide region encoding the major capsid protein, VP1. It is difficult to obtain quality sequence information when clinical or environmental samples contain poliovirus mixtures. As an alternative to conventional methods for resolving poliovirus mixtures, sets of serotype-specific primers were developed for amplifying and sequencing the VP1 regions of individual components of mixed populations of vaccine-vaccine, vaccine-wild, and wild-wild polioviruses. Published by Elsevier B.V.
Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.
Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S
2015-12-01
Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.
Zillmann, M; Limauro, S E; Goodchild, J
1997-01-01
By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657
A surprisingly large RNase P RNA in Candida glabrata
KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG
2005-01-01
We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816
Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter
2012-01-01
Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672
Martins, C; Galetti, P M
2001-10-01
To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.
Namouchi, Amine; Mardassi, Helmi
2006-11-01
Evidence suggests that insertion of the IS6110 element is not without consequence to the biology of Mycobacterium tuberculosis complex strains. Thus, mapping of multiple IS6110 insertion sites in the genome of biomedically relevant clinical isolates would result in a better understanding of the role of this mobile element, particularly with regard to transmission, adaptability and virulence. In the present paper, we describe a versatile strategy, referred to as GL-PCR, that amplifies IS6110-flanking sequences based on the construction of a genomic library. M. tuberculosis chromosomal DNA is fully digested with HincII and then ligated into a plasmid vector between T7 and T3 promoter sequences. The ligation reaction product is transformed into Escherichia coli and selective PCR amplification targeting both 5' and 3' IS6110-flanking sequences are performed on the plasmid library DNA. For this purpose, four separate PCR reactions are performed, each combining an outward primer specific for one IS6110 end with either T7 or T3 primer. Determination of the nucleotide sequence of the PCR products generated from a single ligation reaction allowed mapping of 21 out of the 24 IS6110 copies of two 12 banded M. tuberculosis strains, yielding an overall sensitivity of 87,5%. Furthermore, by simply comparing the migration pattern of GL-PCR-generated products, the strategy proved to be as valuable as IS6110 RFLP for molecular typing of M. tuberculosis complex strains. Importantly, GL-PCR was able to discriminate between strains differing by a single IS6110 band.
Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla
2015-01-01
Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370
Shahin-Jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-Mohammadi, Shahla
2016-05-01
Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence.
Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER
Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.
1986-01-01
Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893
De novo insertion of an intron into the mammalian sex determining gene, SRY
O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall
1998-01-01
Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071
vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S
2018-06-01
In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Langlois, S.; Kastelein, J.J.; Hayden, M.R.
1989-02-01
Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less
LoRTE: Detecting transposon-induced genomic variants using low coverage PacBio long read sequences.
Disdero, Eric; Filée, Jonathan
2017-01-01
Population genomic analysis of transposable elements has greatly benefited from recent advances of sequencing technologies. However, the short size of the reads and the propensity of transposable elements to nest in highly repeated regions of genomes limits the efficiency of bioinformatic tools when Illumina or 454 technologies are used. Fortunately, long read sequencing technologies generating read length that may span the entire length of full transposons are now available. However, existing TE population genomic softwares were not designed to handle long reads and the development of new dedicated tools is needed. LoRTE is the first tool able to use PacBio long read sequences to identify transposon deletions and insertions between a reference genome and genomes of different strains or populations. Tested against simulated and genuine Drosophila melanogaster PacBio datasets, LoRTE appears to be a reliable and broadly applicable tool to study the dynamic and evolutionary impact of transposable elements using low coverage, long read sequences. LoRTE is an efficient and accurate tool to identify structural genomic variants caused by TE insertion or deletion. LoRTE is available for download at http://www.egce.cnrs-gif.fr/?p=6422.
Lam, Kathy N; Charles, Trevor C
2015-01-01
Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J
2016-01-12
Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.
Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul
2005-01-01
Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361
Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko
2010-01-01
The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.
El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten
2014-07-17
Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
Mahillon, Jacques; Chandler, Michael
1998-01-01
Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608
Irenge, Léonid M; Walravens, Karl; Govaerts, Marc; Godfroid, Jacques; Rosseels, Valérie; Huygen, Kris; Gala, Jean-Luc
2009-04-14
A triplex real-time (TRT-PCR) assay was developed to ensure a rapid and reliable detection of Mycobacterium avium subsp. paratuberculosis (Map) in faecal samples and to allow routine detection of Map in farmed livestock and wildlife species. The TRT-PCR assay was designed using IS900, ISMAP02 and f57 molecular targets. Specificity of TRT-PCR was first confirmed on a panel of control mycobacterial Map and non-Map strains and on faecal samples from Map-negative cows (n=35) and from Map-positive cows (n=20). The TRT-PCR assay was compared to direct examination after Ziehl-Neelsen (ZN) staining and to culture on 197 faecal samples collected serially from five calves experimentally exposed to Map over a 3-year period during the sub-clinical phase of the disease. The data showed a good agreement between culture and TRT-PCR (kappa score=0.63), with the TRT-PCR limit of detection of 2.5 x 10(2)microorganisms/g of faeces spiked with Map. ZN agreement with TRT-PCR was not good (kappa=0.02). Sequence analysis of IS900 amplicons from three single IS900 positive samples confirmed the true Map positivity of the samples. Highly specific IS900 amplification suggests therefore that each single IS900 positive sample from experimentally exposed animals was a true Map-positive specimen. In this controlled experimental setting, the TRT-PCT was rapid, specific and displayed a very high sensitivity for Map detection in faecal samples compared to conventional methods.
Bull, Tim J.; McMinn, Elizabeth J.; Sidi-Boumedine, Karim; Skull, Angela; Durkin, Damien; Neild, Penny; Rhodes, Glenn; Pickup, Roger; Hermon-Taylor, John
2003-01-01
Mycobacterium avium subsp. paratuberculosis is a robust and phenotypically versatile pathogen which causes chronic inflammation of the intestine in many species, including primates. M. avium subsp. paratuberculosis infection is widespread in domestic livestock and is present in retail pasteurized cows' milk in the United Kingdom and, potentially, elsewhere. Water supplies are also at risk. The involvement of M. avium subsp. paratuberculosis in Crohn's disease (CD) in humans has been uncertain because of the substantial difficulties in detecting this pathogen. In its Ziehl-Neelsen staining-negative form, M. avium subsp. paratuberculosis is highly resistant to chemical and enzymatic lysis. The present study describes the development of optimized sample processing and DNA extraction procedures with fresh human intestinal mucosal biopsy specimens which ensure access to M. avium subsp. paratuberculosis DNA and maximize detection of these low-abundance pathogens. Also described are two nested PCR methodologies targeted at IS900, designated IS900[L/AV] and IS900[TJ1-4], which are uniquely specific for IS900. Detection of M. avium subsp. paratuberculosis in mucosal biopsy specimens was also evaluated by using mycobacterial growth indicator tube (MGIT) cultures (Becton Dickinson). IS900[L/AV] PCR detected M. avium subsp. paratuberculosis in 34 of 37 (92%) patients with CD and in 9 of 34 (26%) controls without CD (noninflammatory bowel disease [nIBD] controls) (P = 0.0002; odds ratio = 3.47). M. avium subsp. paratuberculosis was detected by IS900[L/AV] PCR in MGIT cultures after 14 to 88 weeks of incubation in 14 of 33 (42%) CD patients and 3 of 33 (9%) nIBD controls (P = 0.0019; odds ratio = 4.66). Nine of 15 (60%) MGIT cultures of specimens from CD patients incubated for more than 38 weeks were positive for M. avium subsp. paratuberculosis. In each case the identity of IS900 from M. avium subsp. paratuberculosis was verified by amplicon sequencing. The rate of detection of M. avium subsp. paratuberculosis in individuals with CD is highly significant and implicates this chronic enteric pathogen in disease causation. PMID:12843021
ERIC Educational Resources Information Center
Laming, Donald
2006-01-01
This article reports some calculations on free-recall data from B. Murdock and J. Metcalfe (1978), with vocal rehearsal during the presentation of a list. Given the sequence of vocalizations, with the stimuli inserted in their proper places, it is possible to predict the subsequent sequence of recalls--the predictions taking the form of a…
A single gene mutation that increases maize seed weight
DOE Office of Scientific and Technical Information (OSTI.GOV)
Giroux, M.J.; Shaw, J.; Hannah, L.C.
1996-06-11
The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less
An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.
Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S
2018-01-01
Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.
Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan
Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less
Engineering RNA phage MS2 virus-like particles for peptide display
NASA Astrophysics Data System (ADS)
Jordan, Sheldon Keith
Phage display is a powerful and versatile technology that enables the selection of novel binding functions from large populations of randomly generated peptide sequences. Random sequences are genetically fused to a viral structural protein to produce complex peptide libraries. From a sufficiently complex library, phage bearing peptides with practically any desired binding activity can be physically isolated by affinity selection, and, since each particle carries in its genome the genetic information for its own replication, the selectants can be amplified by infection of bacteria. For certain applications however, existing phage display platforms have limitations. One such area is in the field of vaccine development, where the goal is to identify relevant epitopes by affinity-selection against an antibody target, and then to utilize them as immunogens to elicit a desired antibody response. Today, affinity selection is usually conducted using display on filamentous phages like M13. This technology provides an efficient means for epitope identification, but, because filamentous phages do not display peptides in the high-density, multivalent arrays the immune system prefers to recognize, they generally make poor immunogens and are typically useless as vaccines. This makes it necessary to confer immunogenicity by conjugating synthetic versions of the peptides to more immunogenic carriers. Unfortunately, when introduced into these new structural environments, the epitopes often fail to elicit relevant antibody responses. Thus, it would be advantageous to combine the epitope selection and immunogen functions into a single platform where the structural constraints present during affinity selection can be preserved during immunization. This dissertation describes efforts to develop a peptide display system based on the virus-like particles (VLPs) of bacteriophage MS2. Phage display technologies rely on (1) the identification of a site in a viral structural protein that is present on the surface of the virus particle and can accept foreign sequence insertions without disruption of protein folding and viral particle assembly, and (2) on the encapsidation of nucleic acid sequences encoding both the VLP and the peptide it displays. The experiments described here are aimed at satisfying the first of these two requirements by engineering efficient peptide display at two different sites in MS2 coat protein. First, we evaluated the suitability of the N-terminus of MS2 coat for peptide insertions. It was observed that random N-terminal 10-mer fusions generally disrupted protein folding and VLP assembly, but by bracketing the foreign sequences with certain specific dipeptides, these defects could be suppressed. Next, the suitability of a coat protein surface loop for foreign sequence insertion was tested. Specifically, random sequence peptides were inserted into the N-terminal-most AB-loop of a coat protein single-chain dimer. Again we found that efficient display required the presence of appropriate dipeptides bracketing the peptide insertion. Finally, it was shown that an N-terminal fusion that tended to interfere specifically with capsid assembly could be efficiently incorporated into mosaic particles when co-expressed with wild-type coat protein.
van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T
2012-07-01
Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.
Characterization of ROP18 alleles in human toxoplasmosis.
Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique
2014-04-01
The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.
Contamination of sequence databases with adaptor sequences
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.
Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less
USDA-ARS?s Scientific Manuscript database
The genome sequence of Flavobacterium psychrophilum strain CSF259-93, isolated from rainbow trout (Oncorhynchus mykiss), consists of a single circular genome of 2,900,735 bp and 2,701 predicted open reading frames (ORFs). Strain CSF259-93 has been used to select a line of rainbow trout with increase...
Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1
Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming
2006-01-01
Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656
White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M
2018-03-28
A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.
Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.
Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio
2017-08-31
In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1995-04-01
This document is an Environmental Assessment (EA) for a proposed project to modify 14,900 square feet of an existing building (Building 64) at Lawrence Berkeley Laboratory (LBL) to operate as a Genome Sequencing Facility. This EA addresses the potential environmental impacts from the proposed modifications to Building 64 and operation of the Genome Sequencing Facility. The proposed action is to modify Building 64 to provide space and equipment allowing LBL to demonstrate that the Directed DNA Sequencing Strategy can be scaled up from the current level of 750,000 base pairs per year to a facility that produces over 6,000,000 basemore » pairs per year, while still retaining its efficiency.« less
Child Development and Structural Variation in the Human Genome
ERIC Educational Resources Information Center
Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.
2013-01-01
Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…
Macrophysical climate models and Holocene hunter-gatherer subsistence shifts in Central Texas, USA
NASA Astrophysics Data System (ADS)
Mauldin, R. P.; Munoz, C.
2013-12-01
We use stable carbon isotopic values from bone collagen, as well as carbon values from carbonate extracted from bone apatite from 69 prehistoric human skeletal samples to investigate past resource use and climate relationships over the Middle and Late Holocene in Central Texas. Bone samples come from seven archaeological sites and samples date from 6,900 BP to the close of the prehistoric sequence at about 350 BP. Carbon isotopes from these samples suggest four broad dietary trends. From 6,900 through about 3,800 BP, carbon isotopes suggest a gradual increase in the consumption of resources that ultimately use a C3 photosynthetic pathway. A decline in δ13C in both collagen and carbonate values follows, suggesting a decrease in C3 resource use through roughly 2,900 BP. A variable, but once again increasing pattern on C3 resource use by prehistoric hunter-gatherers is indicated in bone isotopes through about 1,000 BP. After that date, a decrease in C3 resource dependence, with hints at greater subsistence diversity, is suggested through the close of the sequence at 350 BP. To assess the impact of climate shifts on this isotopic pattern, we developed a series of macrophysical climate models (MCM) for several locations in Central Texas focusing on fall, winter, and early spring precipitation. This fall-spring rainfall should closely determine C3 production. If subsistence shifts are responding to climate-induced changes in resource availability, then the measured hunter-gatherer carbon isotope trends summarized above should pattern with C3 production as monitored by the modeled fall-spring precipitation values. For the Middle Holocene portion of the sequence, the precipitation models suggest increasing C3 production, consistent with increasing C3 dependence shown in the isotopic data. A decline in C3 production between 3,900 and 3,000 BP in the models is also consistent with the isotopic decline at that point. After 3,000 BP, however, the coupling between fall-spring rainfall pattern and the bone isotope patterns begin to break down. Precipitation models suggest an essentially flat or slightly increasing pattern of production, while the isotopic data show a rapid C3 increase, and then a decline. This divergence is especially the case late in the sequence, with isotopic patterns showing rapid decreases in C3 resource use that are not consistent with the macrophysical climate models. If the precipitation models are accurate, the Late Holocene pattern of resource use reflects additional elements (e.g., regional population density changes, mobility shifts, social alliances) that require investigation. Standardized values. Data point colors reflect distinct climate trends.
Oggioni, M R; Claverys, J P
1999-10-01
A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.
Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A
2015-08-29
The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang
2016-05-01
Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.
Copy number determination of genetically-modified hematopoietic stem cells.
Schuesler, Todd; Reeves, Lilith; Kalle, Christof von; Grassman, Elke
2009-01-01
Human gene transfer with gammaretroviral, murine leukemia virus (MLV) based vectors has been shown to effectively insert and express transgene sequences at a level of therapeutic benefit. However, there are numerous reports of disruption of the normal cellular processes caused by the viral insertion, even of replication deficient gammaretroviral vectors. Current gammaretroviral and lentiviral vectors do not control the site of insertion into the genome, hence, the possibility of disruption of the target cell genome. Risk related to viral insertions is linked to the number of insertions of the transgene into the cellular DNA, as has been demonstrated for replication competent and replication deficient retroviruses in experiments. At high number of insertions per cell, cell transformation due to vector induced activation of proto-oncogenes is more likely to occur, in particular since more than one transforming event is needed for oncogenesis. Thus, determination of the vector copy number in bulk transduced populations, individual colony forming units, and tissue from the recipient of the transduced cells is an increasingly important safety assay and has become a standard, though not straightforward assay, since the inception of quantitative PCR.
Tol2 transposon-mediated transgenesis in Xenopus tropicalis.
Hamlet, Michelle R Johnson; Yergeau, Donald A; Kuliyev, Emin; Takeda, Masatoshi; Taira, Masanori; Kawakami, Koichi; Mead, Paul E
2006-09-01
The diploid frog Xenopus tropicalis is becoming a powerful developmental genetic model system. Sequencing of the X. tropicalis genome is nearing completion and several labs are embarking on mutagenesis screens. We are interested in developing insertional mutagenesis strategies in X. tropicalis. Transposon-mediated insertional mutagenesis, once used exclusively in plants and invertebrate systems, is now more widely applicable to vertebrates. The first step in developing transposons as tools for mutagenesis is to demonstrate that these mobile elements function efficiently in the target organism. Here, we show that the Medaka fish transposon, Tol2, is able to stably integrate into the X. tropicalis genome and will serve as a powerful tool for insertional mutagenesis strategies in the frog.
Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L
2014-04-09
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.
Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.
2014-01-01
West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788
Haplotype estimation using sequencing reads.
Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan
2013-10-03
High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Guimond, A; Moss, T
1999-02-01
We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.
ERIC Educational Resources Information Center
Chen, Shuming
2018-01-01
An iridium(III)-mediated C-H functionalization sequence involving a concerted cyclometalation-deprotonation/migratory insertion pathway is reported for the undergraduate chemistry laboratory. The air- and water-stable iridacycle intermediates are readily isolated and characterized by NMR spectroscopy. Both steps of the experiment are performed at…
Young, Robert S
2016-07-01
Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.
Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.
Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia
2016-09-12
Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.
Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel
2008-10-01
Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.
Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R
2014-07-01
Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.
Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?
Rodić, Nemanja; Burns, Kathleen H
2013-03-01
LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.
Coiled-coil length: Size does matter.
Surkont, Jaroslaw; Diekmann, Yoan; Ryder, Pearl V; Pereira-Leal, Jose B
2015-12-01
Protein evolution is governed by processes that alter primary sequence but also the length of proteins. Protein length may change in different ways, but insertions, deletions and duplications are the most common. An optimal protein size is a trade-off between sequence extension, which may change protein stability or lead to acquisition of a new function, and shrinkage that decreases metabolic cost of protein synthesis. Despite the general tendency for length conservation across orthologous proteins, the propensity to accept insertions and deletions is heterogeneous along the sequence. For example, protein regions rich in repetitive peptide motifs are well known to extensively vary their length across species. Here, we analyze length conservation of coiled-coils, domains formed by an ubiquitous, repetitive peptide motif present in all domains of life, that frequently plays a structural role in the cell. We observed that, despite the repetitive nature, the length of coiled-coil domains is generally highly conserved throughout the tree of life, even when the remaining parts of the protein change, including globular domains. Length conservation is independent of primary amino acid sequence variation, and represents a conservation of domain physical size. This suggests that the conservation of domain size is due to functional constraints. © 2015 Wiley Periodicals, Inc.
HangOut: generating clean PSI-BLAST profiles for domains with long insertions.
Kim, Bong-Hyun; Cong, Qian; Grishin, Nick V
2010-06-15
Profile-based similarity search is an essential step in structure-function studies of proteins. However, inclusion of non-homologous sequence segments into a profile causes its corruption and results in false positives. Profile corruption is common in multidomain proteins, and single domains with long insertions are a significant source of errors. We developed a procedure (HangOut) that, for a single domain with specified insertion position, cleans erroneously extended PSI-BLAST alignments to generate better profiles. HangOut is implemented in Python 2.3 and runs on all Unix-compatible platforms. The source code is available under the GNU GPL license at http://prodata.swmed.edu/HangOut/. Supplementary data are available at Bioinformatics online.
Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel
2006-11-01
The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.
Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G
2011-04-01
Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.
Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.
Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P
2018-05-10
Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.
Nicholl, D; Windl, O; de Silva, R; Sawcer, S; Dempster, M; Ironside, J W; Estibeiro, J P; Yuill, G M; Lathe, R; Will, R G
1995-01-01
A case of familial Creutzfeldt-Jakob disease associated with a 144 base pair insertion in the open reading frame of the prion protein gene is described. Sequencing of the mutated allele showed an arrangement of six octapeptide repeats, distinct from that of a recently described British family with an insertion of similar size. Thirteen years previously the brother of the proband had died from "Huntington's disease", but re-examination of his neuropathology revealed spongiform encephalopathy and anti-prion protein immunocytochemistry gave a positive result. The independent evolution of at least two distinct pathological 144 base pair insertions in Britain is proposed. The importance of maintaining a high index of suspicion of inherited Creutzfeldt-Jakob disease in cases of familial neurodegenerative disease is stressed. Images PMID:7823070
Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H
2010-11-01
Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.
Unique transposon landscapes are pervasive across Drosophila melanogaster genomes
Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.
2015-01-01
To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579
Structure of yeast Argonaute with guide RNA
Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.
2012-01-01
The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195
Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji
1999-01-01
Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208
Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl
Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950
Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.
Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier
2013-01-01
Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.
Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong
2007-05-01
The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.
Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li
2015-01-01
Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154
Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li
2015-02-12
Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.
Molecular and bioinformatic analysis of the FB-NOF transposable element.
Badal, Martí; Portela, Anna; Xamena, Noel; Cabré, Oriol
2006-04-12
The Drosophila melanogaster transposable element FB-NOF is known to play a role in genome plasticity through the generation of all sort of genomic rearrangements. Moreover, several insertional mutants due to FB mobilizations have been reported. Its structure and sequence, however, have been poorly studied mainly as a consequence of the long, complex and repetitive sequence of FB inverted repeats. This repetitive region is composed of several 154 bp blocks, each with five almost identical repeats. In this paper, we report the sequencing process of 2 kb long FB inverted repeats of a complete FB-NOF element, with high precision and reliability. This achievement has been possible using a new map of the FB repetitive region, which identifies unambiguously each repeat with new features that can be used as landmarks. With this new vision of the element, a list of FB-NOF in the D. melanogaster genomic clones has been done, improving previous works that used only bioinformatic algorithms. The availability of many FB and FB-NOF sequences allowed an analysis of the FB insertion sequences that showed no sequence specificity, but a preference for A/T rich sequences. The position of NOF into FB is also studied, revealing that it is always located after a second repeat in a random block. With the results of this analysis, we propose a model of transposition in which NOF jumps from FB to FB, using an unidentified transposase enzyme that should specifically recognize the second repeat end of the FB blocks.
Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis
Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.
2000-01-01
Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956
Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.
Kietrys, Anna M; Velema, Willem A; Kool, Eric T
2017-11-29
Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.
Chemoresistance Evolution in Triple-Negative Breast Cancer Delineated by Single-Cell Sequencing.
Kim, Charissa; Gao, Ruli; Sei, Emi; Brandt, Rachel; Hartman, Johan; Hatschek, Thomas; Crosetto, Nicola; Foukakis, Theodoros; Navin, Nicholas E
2018-05-03
Triple-negative breast cancer (TNBC) is an aggressive subtype that frequently develops resistance to chemotherapy. An unresolved question is whether resistance is caused by the selection of rare pre-existing clones or alternatively through the acquisition of new genomic aberrations. To investigate this question, we applied single-cell DNA and RNA sequencing in addition to bulk exome sequencing to profile longitudinal samples from 20 TNBC patients during neoadjuvant chemotherapy (NAC). Deep-exome sequencing identified 10 patients in which NAC led to clonal extinction and 10 patients in which clones persisted after treatment. In 8 patients, we performed a more detailed study using single-cell DNA sequencing to analyze 900 cells and single-cell RNA sequencing to analyze 6,862 cells. Our data showed that resistant genotypes were pre-existing and adaptively selected by NAC, while transcriptional profiles were acquired by reprogramming in response to chemotherapy in TNBC patients. Copyright © 2018 Elsevier Inc. All rights reserved.
GASP: Gapped Ancestral Sequence Prediction for proteins
Edwards, Richard J; Shields, Denis C
2004-01-01
Background The prediction of ancestral protein sequences from multiple sequence alignments is useful for many bioinformatics analyses. Predicting ancestral sequences is not a simple procedure and relies on accurate alignments and phylogenies. Several algorithms exist based on Maximum Parsimony or Maximum Likelihood methods but many current implementations are unable to process residues with gaps, which may represent insertion/deletion (indel) events or sequence fragments. Results Here we present a new algorithm, GASP (Gapped Ancestral Sequence Prediction), for predicting ancestral sequences from phylogenetic trees and the corresponding multiple sequence alignments. Alignments may be of any size and contain gaps. GASP first assigns the positions of gaps in the phylogeny before using a likelihood-based approach centred on amino acid substitution matrices to assign ancestral amino acids. Important outgroup information is used by first working down from the tips of the tree to the root, using descendant data only to assign probabilities, and then working back up from the root to the tips using descendant and outgroup data to make predictions. GASP was tested on a number of simulated datasets based on real phylogenies. Prediction accuracy for ungapped data was similar to three alternative algorithms tested, with GASP performing better in some cases and worse in others. Adding simple insertions and deletions to the simulated data did not have a detrimental effect on GASP accuracy. Conclusions GASP (Gapped Ancestral Sequence Prediction) will predict ancestral sequences from multiple protein alignments of any size. Although not as accurate in all cases as some of the more sophisticated maximum likelihood approaches, it can process a wide range of input phylogenies and will predict ancestral sequences for gapped and ungapped residues alike. PMID:15350199
Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.
Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E
2003-11-01
We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.
Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis
2018-06-25
This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.
Final technical report for: Insertional Mutagenesis of Brachypodium distachyon DE-AI02-07ER64452
DOE Office of Scientific and Technical Information (OSTI.GOV)
John, Vogel P.
Several bioenergy grasses are poised to become a major source of energy in the United States. Despite their increasing importance, we know little about the basic biology underlying the traits that control the utility of grasses as energy crops. Better knowledge of grass biology (e.g. identification of the genes that control cell wall composition, plant architecture, cell size, cell division, reproduction, nutrient uptake, carbon flux, etc.) could be used to design rational strategies for crop improvement and shorten the time required to domesticate these species. The use of an appropriate model system is an efficient way to gain this knowledge.more » Brachypodium distachyon is a small annual grass with all the attributes needed to be a modern model organism including simple growth requirements, fast generation time, small stature, small genome size and self-fertility. These attributes led to the recommendation in the DOE’s “Breaking the Biological Barriers to Cellulosic Ethanol: A Joint Research Agenda” report to propose developing and using B. distachyon as a model for energy crops to accelerate their domestication. Strategic investments (e.g. genome sequencing) in B. distachyon by the DOE are now bearing fruit and B. distachyon is being used as a model grass by hundreds of laboratories worldwide. Sequence indexed insertional mutants are an extremely powerful tool for both forward and reverse genetics. They allow researchers to order mutants in any gene tagged in the collection by simply emailing a request. The goal of this project was to create a collection of sequence indexed insertional mutants (T-DNA lines) for the model grass Brachypodium distachyon in order to facilitate research by the scientific community. During the course of this grant we created a collection of 23,649 B. distachyon T-DNA lines and identified 26,112 unique insertion sites. The collection can be queried through the project website (http://jgi.doe.gov/our-science/science-programs/plant-genomics/brachypodium/brachypodium-t-dna-collection/) and through the Phytozome genome browser (http://phytozome.jgi.doe.gov/pz/portal.html). The collection has been heavily utilized by the research community and, as of October 23, 2015, 223 orders for 12,069 seeds packets have been filled. In addition to creating this resource, we also optimized methods for transformation and sequencing DNA flanking insertion sites.« less
USDA-ARS?s Scientific Manuscript database
We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...
Lineages of Streptococcus equi ssp. equi in the Irish equine industry.
Moloney, Emma; Kavanagh, Kerrie S; Buckley, Tom C; Cooney, Jakki C
2013-01-01
Streptococcus equi ssp. equi is the causative agent of 'Strangles' in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2-8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK.
Lineages of Streptococcus equi ssp. equi in the Irish equine industry
2013-01-01
Background Streptococcus equi ssp. equi is the causative agent of ‘Strangles’ in horses. This is a debilitating condition leading to economic loss, yard closures and cancellation of equestrian events. There are multiple genotypes of S. equi ssp. equi which can cause disease, but to date there has been no systematic study of strains which are prevalent in Ireland. This study identified and classified Streptococcus equi ssp. equi strains isolated from within the Irish equine industry. Results Two hundred veterinary isolates were subjected to SLST (single locus sequence typing) based on an internal sequence from the seM gene of Streptococcus equi ssp equi. Of the 171 samples which successfully gave an amplicon, 162 samples (137 Irish and 24 UK strains) gave robust DNA sequence information. Analysis of the sequences allowed division of the isolates into 19 groups, 13 of which contain at least 2 isolates and 6 groups containing single isolates. There were 19 positions where a DNA SNP (single nucleotide polymorphism) occurs, and one 3 bp insertion. All groups had multiple (2–8) SNPs. Of the SNPs 17 would result in an amino acid change in the encoded protein. Interestingly, the single isolate EI8, which has 6 SNPs, has the three base pair insertion which is not seen in any other isolate, this would result in the insertion of an Ile residue at position 62 in that protein sequence. Comparison of the relevant region in the determined sequences with the UK Streptococcus equi seM MLST database showed that Group B (15 isolates) and Group I (2 isolates), as well as the individual isolates EI3 and EI8, are unique to Ireland, and some groups are most likely of UK origin (Groups F and M), but many more probably passed back and forth between the two countries. Conclusions The strains occurring in Ireland are not clonal and there is a considerable degree of sequence variation seen in the seM gene. There are two major clades causing infection in Ireland and these strains are also common in the UK. PMID:23731628
Masking as an effective quality control method for next-generation sequencing data analysis.
Yun, Sajung; Yun, Sijung
2014-12-13
Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).
Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B
2009-01-01
Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.
Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh
2017-11-01
Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.
Dron, M; Hartmann, C; Rode, A; Sevignac, M
1985-01-01
We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548
Genomic deletions created upon LINE-1 retrotransposition.
Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V
2002-08-09
LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.
Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.
d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P
2003-04-01
The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.
Optimization of sequence alignment for simple sequence repeat regions.
Jighly, Abdulqader; Hamwieh, Aladdin; Ogbonnaya, Francis C
2011-07-20
Microsatellites, or simple sequence repeats (SSRs), are tandemly repeated DNA sequences, including tandem copies of specific sequences no longer than six bases, that are distributed in the genome. SSR has been used as a molecular marker because it is easy to detect and is used in a range of applications, including genetic diversity, genome mapping, and marker assisted selection. It is also very mutable because of slipping in the DNA polymerase during DNA replication. This unique mutation increases the insertion/deletion (INDELs) mutation frequency to a high ratio - more than other types of molecular markers such as single nucleotide polymorphism (SNPs).SNPs are more frequent than INDELs. Therefore, all designed algorithms for sequence alignment fit the vast majority of the genomic sequence without considering microsatellite regions, as unique sequences that require special consideration. The old algorithm is limited in its application because there are many overlaps between different repeat units which result in false evolutionary relationships. To overcome the limitation of the aligning algorithm when dealing with SSR loci, a new algorithm was developed using PERL script with a Tk graphical interface. This program is based on aligning sequences after determining the repeated units first, and the last SSR nucleotides positions. This results in a shifting process according to the inserted repeated unit type.When studying the phylogenic relations before and after applying the new algorithm, many differences in the trees were obtained by increasing the SSR length and complexity. However, less distance between different linage had been observed after applying the new algorithm. The new algorithm produces better estimates for aligning SSR loci because it reflects more reliable evolutionary relations between different linages. It reduces overlapping during SSR alignment, which results in a more realistic phylogenic relationship.
Emergence of a Novel Chimeric Gene Underlying Grain Number in Rice
Chen, Hao; Tang, Yanyan; Liu, Jianfeng; Tan, Lubin; Jiang, Jiahuan; Wang, Mumu; Zhu, Zuofeng; Sun, Xianyou; Sun, Chuanqing
2017-01-01
Grain number is an important factor in determining grain production of rice (Oryza sativa L.). The molecular genetic basis for grain number is complex. Discovering new genes involved in regulating rice grain number increases our knowledge regarding its molecular mechanisms and aids breeding programs. Here, we identified GRAINS NUMBER 2 (GN2), a novel gene that is responsible for rice grain number, from “Yuanjiang” common wild rice (O. rufipogon Griff.). Transgenic plants overexpressing GN2 showed less grain number, reduced plant height, and later heading date than control plants. Interestingly, GN2 arose through the insertion of a 1094-bp sequence from LOC_Os02g45150 into the third exon of LOC_Os02g56630, and the inserted sequence recruited its nearby sequence to generate the chimeric GN2. The gene structure and expression pattern of GN2 were distinct from those of LOC_Os02g45150 and LOC_Os02g56630. Sequence analysis showed that GN2 may be generated in the natural population of Yuanjiang common wild rice. In this study, we identified a novel functional chimeric gene and also provided information regarding the molecular mechanisms regulating rice grain number. PMID:27986805
Short interspersed elements (SINEs) are a major source of canine genomic diversity.
Wang, Wei; Kirkness, Ewen F
2005-12-01
SINEs are retrotransposons that have enjoyed remarkable reproductive success during the course of mammalian evolution, and have played a major role in shaping mammalian genomes. Previously, an analysis of survey-sequence data from an individual dog (a poodle) indicated that canine genomes harbor a high frequency of alleles that differ only by the absence or presence of a SINEC_Cf repeat. Comparison of this survey-sequence data with a draft genome sequence of a distinct dog (a boxer) has confirmed this prediction, and revealed the chromosomal coordinates for >10,000 loci that are bimorphic for SINEC_Cf insertions. Analysis of SINE insertion sites from the genomes of nine additional dogs indicates that 3%-5% are absent from either the poodle or boxer genome sequences--suggesting that an additional 10,000 bimorphic loci could be readily identified in the general dog population. We describe a methodology that can be used to identify these loci, and could be adapted to exploit these bimorphic loci for genotyping purposes. Approximately half of all annotated canine genes contain SINEC_Cf repeats, and these elements are occasionally transcribed. When transcribed in the antisense orientation, they provide splice acceptor sites that can result in incorporation of novel exons. The high frequency of bimorphic SINE insertions in the dog population is predicted to provide numerous examples of allele-specific transcription patterns that will be valuable for the study of differential gene expression among multiple dog breeds.
Gwynn, Babette; Lueders, Kira; Sands, Mark S.; Birkenmeier, Edward H.
1998-01-01
The severity of human mucopolysaccharidosis type VII (MPS VII), or Sly syndrome, depends on the relative activity of the enzyme β-glucuronidase. Loss of β-glucuronidase activity can cause hydrops fetalis, with in utero or postnatal death of the patient. In this report, we show that β-glucuronidase activity is not detectable by a standard fluorometric assay in C3H/HeOuJ (C3H) mice homozygous for a new mutation, gusmps2J. These gusmps2J/gusmps2J mice are born and survive much longer than the previously characterized β-glucuronidase-null B6.C-H-2bm1/ByBir-gusmps (gusmps/gusmps) mice. Northern blot analysis of liver from gusmps2J/gusmps2J mice demonstrates a 750-bp reduction in size of β-glucuronidase mRNA. A 5.4-kb insertion in the Gus-sh nucleotide sequence from these mice was localized by Southern blot analysis to intron 8. The ends of the inserted sequences were cloned by inverse PCR and revealed an intracisternal A-particle (IAP) element inserted near the 3′ end of the intron. The sequence of the long terminal repeat (LTR) regions of the IAP most closely matches that of a composite LTR found in transposed IAPs previously identified in the C3H strain. The inserted IAP may contribute to diminished β-glucuronidase activity either by interfering with transcription or by destabilizing the message. The resulting phenotype is much less severe than that previously described in the gusmps/gusmps mouse and provides an opportunity to study MPS VII on a genetic background that clearly modulates disease severity. PMID:9774663
Peyret, Hadrien; Gehin, Annick; Thuenemann, Eva C.; Blond, Donatienne; El Turabi, Aadil; Beales, Lucy; Clarke, Dean; Gilbert, Robert J. C.; Fry, Elizabeth E.; Stuart, David I.; Holmes, Kris; Stonehouse, Nicola J.; Whelan, Mike; Rosenberg, William; Lomonossoff, George P.; Rowlands, David J.
2015-01-01
The core protein of the hepatitis B virus, HBcAg, assembles into highly immunogenic virus-like particles (HBc VLPs) when expressed in a variety of heterologous systems. Specifically, the major insertion region (MIR) on the HBcAg protein allows the insertion of foreign sequences, which are then exposed on the tips of surface spike structures on the outside of the assembled particle. Here, we present a novel strategy which aids the display of whole proteins on the surface of HBc particles. This strategy, named tandem core, is based on the production of the HBcAg dimer as a single polypeptide chain by tandem fusion of two HBcAg open reading frames. This allows the insertion of large heterologous sequences in only one of the two MIRs in each spike, without compromising VLP formation. We present the use of tandem core technology in both plant and bacterial expression systems. The results show that tandem core particles can be produced with unmodified MIRs, or with one MIR in each tandem dimer modified to contain the entire sequence of GFP or of a camelid nanobody. Both inserted proteins are correctly folded and the nanobody fused to the surface of the tandem core particle (which we name tandibody) retains the ability to bind to its cognate antigen. This technology paves the way for the display of natively folded proteins on the surface of HBc particles either through direct fusion or through non-covalent attachment via a nanobody. PMID:25830365
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2008-06-24
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S; Cabantous, Stephanie
2013-02-12
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM
2011-06-14
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Circular permutant GFP insertion folding reporters
Waldo, Geoffrey S.; Cabantous, Stephanie
2013-04-16
Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.
Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.
Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia
2013-05-01
In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.
Hobbs, A A; Rosen, J M
1982-01-01
The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707
The Role(s) of Heparan Sulfate Proteoglycan(s) in the wnt-1 Signaling Pathway
1998-08-01
First , the sequence of the cDNA, when compared to the genomic site of insertion of the P-element, revealed that the P-element is inserted 686 bp...stages 8 to 13 (Yoffe et al. 1995). We first examined whether ectopic expression of Wgts effectively restores the naked cuticle as it does in wg and...by Kjell~n and Lindahl, 1991) . HS/heparin N-deacetylase/N-sulfotransferase catalyzes N-deacetylation and N-sulfation that is the first and key step
Robotic ICSI (intracytoplasmic sperm injection).
Lu, Zhe; Zhang, Xuping; Leung, Clement; Esfandiari, Navid; Casper, Robert F; Sun, Yu
2011-07-01
This paper is the first report of robotic intracytoplasmic sperm injection (ICSI). ICSI is a clinical procedure performed worldwide in fertility clinics, requiring pick-up of a single sperm and insertion of it into an oocyte (i.e., egg cell). Since its invention 20 years ago, ICSI has been conducted manually by a handful of highly skilled embryologists; however, success rates vary significantly among clinics due to poor reproducibility and inconsistency across operators. We leverage our work in robotic cell injection to realize robotic ICSI and aim ultimately, to standardize how clinical ICSI is performed. This paper presents some of the technical aspects of our robotic ICSI system, including a cell holding device, motion control, and computer vision algorithms. The system performs visual tracking of single sperm, robotic immobilization of sperm, aspiration of sperm with picoliter volume, and insertion of sperm into an oocyte with a high degree of reproducibility. The system requires minimal human involvement (requiring only a few computer mouse clicks), and is human operator skill independent. Using the hamster oocyte-human sperm model in preliminary trials, the robotic system demonstrated a high success rate of 90.0% and survival rate of 90.7% (n=120). © 2011 IEEE
Comparison of Insertional RNA Editing in Myxomycetes
Chen, Cai; Frankhouser, David; Bundschuh, Ralf
2012-01-01
RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871
Maurer-Stroh, Sebastian; Lee, Raphael T C; Gunalan, Vithiagaran; Eisenhaber, Frank
2013-05-01
A characteristic difference between highly and non-highly pathogenic avian influenza strains is the presence of an extended, often multibasic, cleavage motif insertion in the hemagglutinin protein. Such motif is found in H7N3 strains from chicken farm outbreaks in 2012 in Mexico. Through phylogenetic, sequence and structural analysis, we try to shed light on the role, prevalence, likelihood of appearance and origin of the inserted cleavage motifs in these H7N3 avian influenza strains. The H7N3 avian influenza strain which caused outbreaks in chicken farms in June/July 2012 in Mexico has a new extended cleavage site which is the likely reason for its high pathogenicity in these birds. This cleavage site appears to have been naturally acquired and was not present in the closest low pathogenic precursors. Structural modeling shows that insertion of a productive cleavage site is quite flexible to accept insertions of different length and with sequences from different possible origins. Different from recent cleavage site insertions, the origin of the insert here is not from the viral genome but from host 28S ribosomal RNA (rRNA) instead. This is a novelty for a natural acquisition as a similar insertion has so far only been observed in a laboratory strain before. Given the abundance of viral and host RNA in infected cells, the acquisition of a pathogenicity-enhancing extended cleavage site through a similar route by other low-pathogenic avian strains in future does not seem unlikely. Important for surveillance of these H7N3 strains, the structural sites known to enhance mammalian airborne transmission are dominated by the characteristic avian residues and the risk of human to human transmission should currently be low but should be monitored for future changes accordingly. This highly pathogenic H7N3 avian influenza strain acquired a novel extended cleavage site which likely originated from recombination with 28S rRNA from the avian host. Notably, this new virus can infect humans but currently lacks critical host receptor adaptations that would facilitate human to human transmission.
[cDNA library construction from panicle meristem of finger millet].
Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B
2014-01-01
The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.
Designing robust watermark barcodes for multiplex long-read sequencing.
Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth
2017-03-15
To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Identification and Characterization of Domesticated Bacterial Transposases
Gallie, Jenna; Rainey, Paul B.
2017-01-01
Abstract Selfish genetic elements, such as insertion sequences and transposons are found in most genomes. Transposons are usually identifiable by their high copy number within genomes. In contrast, REP-associated tyrosine transposases (RAYTs), a recently described class of bacterial transposase, are typically present at just one copy per genome. This suggests that RAYTs no longer copy themselves and thus they no longer function as a typical transposase. Motivated by this possibility we interrogated thousands of fully sequenced bacterial genomes in order to determine patterns of RAYT diversity, their distribution across chromosomes and accessory elements, and rate of duplication. RAYTs encompass exceptional diversity and are divisible into at least five distinct groups. They possess features more similar to housekeeping genes than insertion sequences, are predominantly vertically transmitted and have persisted through evolutionary time to the point where they are now found in 24% of all species for which at least one fully sequenced genome is available. Overall, the genomic distribution of RAYTs suggests that they have been coopted by host genomes to perform a function that benefits the host cell. PMID:28910967
Structure, Function, Self-Assembly and Origin of Simple Membrane Proteins
NASA Technical Reports Server (NTRS)
Pohorille, Andrew
2003-01-01
Integral membrane proteins perform such essential cellular functions as transport of ions, nutrients and waste products across cell walls, transduction of environmental signals, regulation of cell fusion, recognition of other cells, energy capture and its conversion into high-energy compounds. In fact, 30-40% of genes in modem organisms codes for membrane proteins. Although contemporary membrane proteins or their functional assemblies can be quite complex, their transmembrane fragments are usually remarkably simple. The most common structural motif for these fragments is a bundle of alpha-helices, but occasionally it could be a beta-barrel. In a series of molecular dynamics computer simulations we investigated self-organizing properties of simple membrane proteins based on these structural motifs. Specifically, we studied folding and insertion into membranes of short, nonpolar or amphiphatic peptides. We also investigated glycophorin A, a peptide that forms sequence-specific dimers, and a transmembrane aggregate of four identical alpha-helices that forms an efficient and selective voltage-gated proton channel was investigated. Many peptides are attracted to water-membrane interfaces. Once at the interface, nonpolar peptides spontaneously fold to a-helices. Whenever the sequence permits, peptides that contain both polar and nonpolar amino also adopt helical structures, in which polar and nonpolar amino acid side chains are immersed in water and membrane, respectively. Specific identity of side chains is less important. Helical peptides at the interface could insert into the membrane and adopt a transmembrane conformation. However, insertion of a single helix is unfavorable because polar groups in the peptide become completely dehydrated upon insertion. The unfavorable free energy of insertion can be regained by spontaneous association of peptides in the membrane. The first step in this process is the formation of dimers, although the most common are aggregates of 4-7 helices. The helices could arrange themselves such that they formed pores capable of transporting ions and small molecules across membranes. Stability of transmembrane aggregates of simple proteins is often only marginal and, therefore, it can be regulated by environmental signals or small sequence modifications in the region of interhelical interactions. A key step in the earliest evolution of membrane proteins was the emergence of selectivity for specific substrates. Many channels could become selective if one or only a few properly chosen amino acids are properly placed along the channel, acting as filters or gates. This is a convenient evolutionary solution because it does not require imposing conditions on the whole sequence.
Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.
Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.
2014-01-01
Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020
Optical mapping and its potential for large-scale sequencing projects.
Aston, C; Mishra, B; Schwartz, D C
1999-07-01
Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.
Iida, Takayuki; Itakura, Manabu; Anda, Mizue; Sugawara, Masayuki; Isawa, Tsuyoshi; Okubo, Takashi; Sato, Shusei; Chiba-Kakizaki, Kaori
2015-01-01
Extra-slow-growing bradyrhizobia from root nodules of field-grown soybeans harbor abundant insertion sequences (ISs) and are termed highly reiterated sequence-possessing (HRS) strains. We analyzed the genome organization of HRS strains with the focus on IS distribution and symbiosis island structure. Using pulsed-field gel electrophoresis, we consistently detected several plasmids (0.07 to 0.4 Mb) in the HRS strains (NK5, NK6, USDA135, 2281, USDA123, and T2), whereas no plasmids were detected in the non-HRS strain USDA110. The chromosomes of the six HRS strains (9.7 to 10.7 Mb) were larger than that of USDA110 (9.1 Mb). Using MiSeq sequences of 6 HRS and 17 non-HRS strains mapped to the USDA110 genome, we found that the copy numbers of ISRj1, ISRj2, ISFK1, IS1632, ISB27, ISBj8, and IS1631 were markedly higher in HRS strains. Whole-genome sequencing showed that the HRS strain NK6 had four small plasmids (136 to 212 kb) and a large chromosome (9,780 kb). Strong colinearity was found between 7.4-Mb core regions of the NK6 and USDA110 chromosomes. USDA110 symbiosis islands corresponded mainly to five small regions (S1 to S5) within two variable regions, V1 (0.8 Mb) and V2 (1.6 Mb), of the NK6 chromosome. The USDA110 nif gene cluster (nifDKENXSBZHQW-fixBCX) was split into two regions, S2 and S3, where ISRj1-mediated rearrangement occurred between nifS and nifB. ISs were also scattered in NK6 core regions, and ISRj1 insertion often disrupted some genes important for survival and environmental responses. These results suggest that HRS strains of soybean bradyrhizobia were subjected to IS-mediated symbiosis island shuffling and core genome degradation. PMID:25862225
Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong
2014-01-01
Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372
Using SINEs to probe ancient explosive speciation: "hidden" radiation of African cichlids?
Terai, Yohey; Takahashi, Kazuhiko; Nishida, Mutsumi; Sato, Tetsu; Okada, Norihiro
2003-06-01
Cichlid fishes of the east African Great Lakes represent a paradigm of adaptive radiation. We conducted a phylogenetic analysis of cichlids including pan-African and west African species by using insertion patterns of short interspersed elements (SINEs) at orthologous loci. The monophyly of the east African cichlids was consistently supported by seven independent insertions of SINE sequences that are uniquely shared by these species. In addition, data from four other loci indicated that the genera Tilapia (pan-African) and Steatocranus (west African) are the closest relatives to east African cichlids. However, relationships among Tilapia, Steatocranus, and the east African clade were ambiguous because of incongruencies among topologies suggested by insertion patterns of SINEs at six other loci. One plausible explanation for this phenomenon is incomplete lineage sorting of alleles containing or missing a SINE insertion at these loci during ancestral speciation. Such incomplete sorting may have taken place earlier than 14 MYA, followed by random and stochastic fixation of the alleles in subsequent lineages. These observations prompted us to consider the possibility that cichlid speciation occurred at an accelerated rate during this period when the African Great Lakes did not exist. The SINE method could be useful for detecting ancient exclusive speciation events that tend to remain hidden during conventional sequence analyses because of accumulated point mutations.
Ohno, S
1984-01-01
Three outstanding properties uniquely qualify repeats of base oligomers as the primordial coding sequences of all polypeptide chains. First, when compared with randomly generated base sequences in general, they are more likely to have long open reading frames. Second, periodical polypeptide chains specified by such repeats are more likely to assume either alpha-helical or beta-sheet secondary structures than are polypeptide chains of random sequence. Third, provided that the number of bases in the oligomeric unit is not a multiple of 3, these internally repetitious coding sequences are impervious to randomly sustained base substitutions, deletions, and insertions. This is because the recurring periodicity of their polypeptide chains is given by three consecutive copies of the oligomeric unit translated in three different reading frames. Accordingly, when one reading frame is open, the other two are automatically open as well, all three being capable of coding for polypeptide chains of identical periodicity. Under this circumstance, a frame shift due to the deletion or insertion of a number of bases that is not a multiple of 3 fails to alter the down-stream amino acid sequence, and even a base change causing premature chain-termination can silence only one of the three potential coding units. Newly arisen coding sequences in modern organisms are oligomeric repeats, and most of the older genes retain various vestiges of their original internal repetitions. Some of the genes (e.g., oncogenes) have even inherited the property of being impervious to randomly sustained base changes.
Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡
Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu
2009-01-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402
Genome-wide transposon mutagenesis in pathogenic Leptospira species.
Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu
2009-02-01
Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.
Bacterio-opsin mutants of Halobacterium halobium
Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.
1983-01-01
The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291
Muroid rodent phylogenetics: 900-species tree reveals increasing diversification rates
Schenk, John J.
2017-01-01
We combined new sequence data for more than 300 muroid rodent species with our previously published sequences for up to five nuclear and one mitochondrial genes to generate the most widely and densely sampled hypothesis of evolutionary relationships across Muroidea. An exhaustive screening procedure for publically available sequences was implemented to avoid the propagation of taxonomic errors that are common to supermatrix studies. The combined data set of carefully screened sequences derived from all available sequences on GenBank with our new data resulted in a robust maximum likelihood phylogeny for 900 of the approximately 1,620 muroids. Several regions that were equivocally resolved in previous studies are now more decisively resolved, and we estimated a chronogram using 28 fossil calibrations for the most integrated age and topological estimates to date. The results were used to update muroid classification and highlight questions needing additional data. We also compared the results of multigene supermatrix studies like this one with the principal published supertrees and concluded that the latter are unreliable for any comparative study in muroids. In addition, we explored diversification patterns as an explanation for why muroid rodents represent one of the most species-rich groups of mammals by detecting evidence for increasing net diversification rates through time across the muroid tree. We suggest the observation of increasing rates may be due to a combination of parallel increases in rate across clades and high average extinction rates. Five increased diversification-rate-shifts were inferred, suggesting that multiple, but perhaps not independent, events have led to the remarkable species diversity in the superfamily. Our results provide a phylogenetic framework for comparative studies that is not highly dependent upon the signal from any one gene. PMID:28813483
Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine
2014-12-12
Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.
Burke, W D; Calalang, C C; Eickbush, T H
1987-01-01
Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905
Huarte, Nerea; Lorizate, Maier; Maeso, Rubén; Kunert, Renate; Arranz, Rocio; Valpuesta, José M; Nieva, José L
2008-09-01
The broadly neutralizing 2F5 and 4E10 monoclonal antibodies (MAbs) recognize epitopes within the membrane-proximal external region (MPER) that connects the human immunodeficiency virus type 1 (HIV-1) envelope gp41 ectodomain with the transmembrane anchor. By adopting different conformations that stably insert into the virion external membrane interface, such as helical structures, a conserved aromatic-rich sequence within the MPER is thought to participate in HIV-1-cell fusion. Recent experimental evidence suggests that the neutralizing activity of 2F5 and 4E10 might correlate with the MAbs' capacity to recognize epitopes inserted into the viral membrane, thereby impairing MPER fusogenic activity. To gain new insights into the molecular mechanism underlying viral neutralization by these antibodies, we have compared the capacities of 2F5 and 4E10 to block the membrane-disorganizing activity of MPER peptides inserted into the surface bilayer of solution-diffusing unilamellar vesicles. Both MAbs inhibited leakage of vesicular aqueous contents (membrane permeabilization) and intervesicular lipid mixing (membrane fusion) promoted by MPER-derived peptides. Thus, our data support the idea that antibody binding to a membrane-inserted epitope may interfere with the function of the MPER during gp41-induced fusion. Antibody insertion into a cholesterol-containing, uncharged virion-like membrane is mediated by specific epitope recognition, and moreover, partitioning-coupled folding into a helix reduces the efficiency of 2F5 MAb binding to its epitope in the membrane. We conclude that the capacity to interfere with the membrane activity of conserved MPER sequences is best correlated with the broad neutralization of the 4E10 MAb.
Johnson, Jeremiah G.; Livny, Jonathan
2014-01-01
Campylobacter jejuni is a leading cause of gastrointestinal infections worldwide, due primarily to its ability to asymptomatically colonize the gastrointestinal tracts of agriculturally relevant animals, including chickens. Infection often occurs following consumption of meat that was contaminated by C. jejuni during harvest. Because of this, much interest lies in understanding the mechanisms that allow C. jejuni to colonize the chicken gastrointestinal tract. To address this, we generated a C. jejuni transposon mutant library that is amenable to insertion sequencing and introduced this mutant pool into day-of-hatch chicks. Following deep sequencing of C. jejuni mutants in the cecal outputs, several novel factors required for efficient colonization of the chicken gastrointestinal tract were identified, including the predicted outer membrane protein MapA. A mutant strain lacking mapA was constructed and found to be significantly reduced for chicken colonization in both competitive infections and monoinfections. Further, we found that mapA is required for in vitro competition with wild-type C. jejuni but is dispensable for growth in monoculture. PMID:24633877
Johnson, Jeremiah G; Livny, Jonathan; Dirita, Victor J
2014-06-01
Campylobacter jejuni is a leading cause of gastrointestinal infections worldwide, due primarily to its ability to asymptomatically colonize the gastrointestinal tracts of agriculturally relevant animals, including chickens. Infection often occurs following consumption of meat that was contaminated by C. jejuni during harvest. Because of this, much interest lies in understanding the mechanisms that allow C. jejuni to colonize the chicken gastrointestinal tract. To address this, we generated a C. jejuni transposon mutant library that is amenable to insertion sequencing and introduced this mutant pool into day-of-hatch chicks. Following deep sequencing of C. jejuni mutants in the cecal outputs, several novel factors required for efficient colonization of the chicken gastrointestinal tract were identified, including the predicted outer membrane protein MapA. A mutant strain lacking mapA was constructed and found to be significantly reduced for chicken colonization in both competitive infections and monoinfections. Further, we found that mapA is required for in vitro competition with wild-type C. jejuni but is dispensable for growth in monoculture.
Quantitation of normal CFTR mRNA in CF patients with splice-site mutations
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Z.; Olsen, J.C.; Silverman, L.M.
Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less
Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K
2016-12-07
Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.
Decarboxylative Hydroalkylation of Alkynes.
Till, Nicholas A; Smith, Russell T; MacMillan, David W C
2018-05-02
The merger of open- and closed-shell elementary organometallic steps has enabled the selective intermolecular addition of nucleophilic radicals to unactivated alkynes. A range of carboxylic acids can be subjected to a CO 2 extrusion, nickel capture, migratory insertion sequence with terminal and internal alkynes to generate stereodefined functionalized olefins. This platform has been further extended, via hydrogen atom transfer, to the direct vinylation of unactivated C-H bonds. Preliminary studies indicate that a Ni-alkyl migratory insertion is operative.
Clostridium perfringens type A–E toxin plasmids
Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.
2014-01-01
Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728
Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro
2015-11-18
RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.
Wolff, G; Burger, G; Lang, B F; Kück, U
1993-01-01
The mitochondrial DNA from the colourless alga Prototheca wickerhamii contains two mosaic genes as was revealed from complete sequencing of the circular extranuclear genome. The genes for the large subunit of the ribosomal RNA (LSUrRNA) as well as for subunit I of the cytochrome oxidase (coxI) carry two and three intronic sequences respectively. On the basis of their canonical nucleotide sequences they can be classified as group I introns. Phylogenetic comparisons of the coxI protein sequences allow us to conclude that the P.wickerhamii mtDNA is much closer related to higher plant mtDNAs than to those of the chlorophyte alga C.reinhardtii. The comparison of the intron sequences revealed several unusual features: (1) The P.wickerhamii introns are structurally related to mitochondrial introns from various ascomycetous fungi. (2) Phylogenetic analyses indicate a close relationship between fungal and algal intronic sequences. (3) The P. wickerhamii introns are located at positions within the structural genes which can be considered as preferred intron insertion sites in homologous mitochondrial genes from fungi or liverwort. In all cases, the sequences adjacent to the insertion sites are very well conserved over large evolutionary distances. Our finding of highly similar introns in fungi and algae is consistent with the idea that introns have already been present in the bacterial ancestors of present day mitochondria and evolved concomitantly with the organelles. PMID:7680126
USDA-ARS?s Scientific Manuscript database
Simple sequence repeats (SSR) markers were developed from a small insert genomic library for Bipolaris sorokiniana, a mitosporic fungal pathogen that causes spot blotch and root rot in switchgrass. About 59% of sequenced clones (n=384) harbored various SSR motifs. After eliminating the redundant seq...
Redox cofactors insertion in prokaryotic molybdoenzymes occurs via a conserved folding mechanism
Arias-Cartin, Rodrigo; Ceccaldi, Pierre; Schoepp-Cothenet, Barbara; Frick, Klaudia; Blanc, Jean-Michel; Guigliarelli, Bruno; Walburger, Anne; Grimaldi, Stéphane; Friedrich, Thorsten; Receveur-Brechot, Véronique; Magalon, Axel
2016-01-01
A major gap of knowledge in metalloproteins is the identity of the prefolded state of the protein before cofactor insertion. This holds for molybdoenzymes serving multiple purposes for life, especially in energy harvesting. This large group of prokaryotic enzymes allows for coordination of molybdenum or tungsten cofactors (Mo/W-bisPGD) and Fe/S clusters. Here we report the structural data on a cofactor-less enzyme, the nitrate reductase respiratory complex and characterize the conformational changes accompanying Mo/W-bisPGD and Fe/S cofactors insertion. Identified conformational changes are shown to be essential for recognition of the dedicated chaperone involved in cofactors insertion. A solvent-exposed salt bridge is shown to play a key role in enzyme folding after cofactors insertion. Furthermore, this salt bridge is shown to be strictly conserved within this prokaryotic molybdoenzyme family as deduced from a phylogenetic analysis issued from 3D structure-guided multiple sequence alignment. A biochemical analysis with a distantly-related member of the family, respiratory complex I, confirmed the critical importance of the salt bridge for folding. Overall, our results point to a conserved cofactors insertion mechanism within the Mo/W-bisPGD family. PMID:27886223
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Guilfoyle, Richard A.; Smith, Lloyd M.
1994-01-01
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.
Guilfoyle, R.A.; Smith, L.M.
1994-12-27
A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.
Improve homology search sensitivity of PacBio data by correcting frameshifts.
Du, Nan; Sun, Yanni
2016-09-01
Single-molecule, real-time sequencing (SMRT) developed by Pacific BioSciences produces longer reads than secondary generation sequencing technologies such as Illumina. The long read length enables PacBio sequencing to close gaps in genome assembly, reveal structural variations, and identify gene isoforms with higher accuracy in transcriptomic sequencing. However, PacBio data has high sequencing error rate and most of the errors are insertion or deletion errors. During alignment-based homology search, insertion or deletion errors in genes will cause frameshifts and may only lead to marginal alignment scores and short alignments. As a result, it is hard to distinguish true alignments from random alignments and the ambiguity will incur errors in structural and functional annotation. Existing frameshift correction tools are designed for data with much lower error rate and are not optimized for PacBio data. As an increasing number of groups are using SMRT, there is an urgent need for dedicated homology search tools for PacBio data. In this work, we introduce Frame-Pro, a profile homology search tool for PacBio reads. Our tool corrects sequencing errors and also outputs the profile alignments of the corrected sequences against characterized protein families. We applied our tool to both simulated and real PacBio data. The results showed that our method enables more sensitive homology search, especially for PacBio data sets of low sequencing coverage. In addition, we can correct more errors when comparing with a popular error correction tool that does not rely on hybrid sequencing. The source code is freely available at https://sourceforge.net/projects/frame-pro/ yannisun@msu.edu. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodi, D. J.; Soares, A. S.; Makowski, L.
Novel statistical methods have been developed and used to quantitate and annotate the sequence diversity within combinatorial peptide libraries on the basis of small numbers (1-200) of sequences selected at random from commercially available M13 p3-based phage display libraries. These libraries behave statistically as though they correspond to populations containing roughly 4.0{+-}1.6% of the random dodecapeptides and 7.9{+-}2.6% of the random constrained heptapeptides that are theoretically possible within the phage populations. Analysis of amino acid residue occurrence patterns shows no demonstrable influence on sequence censorship by Escherichia coli tRNA isoacceptor profiles or either overall codon or Class II codon usagemore » patterns, suggesting no metabolic constraints on recombinant p3 synthesis. There is an overall depression in the occurrence of cysteine, arginine and glycine residues and an overabundance of proline, threonine and histidine residues. The majority of position-dependent amino acid sequence bias is clustered at three positions within the inserted peptides of the dodecapeptide library, +1, +3 and +12 downstream from the signal peptidase cleavage site. Conformational tendency measures of the peptides indicate a significant preference for inserts favoring a {beta}-turn conformation. The observed protein sequence limitations can primarily be attributed to genetic codon degeneracy and signal peptidase cleavage preferences. These data suggest that for applications in which maximal sequence diversity is essential, such as epitope mapping or novel receptor identification, combinatorial peptide libraries should be constructed using codon-corrected trinucleotide cassettes within vector-host systems designed to minimize morphogenesis-related censorship.« less
O'Brien, Heath E; Gong, Yunchen; Fung, Pauline; Wang, Pauline W; Guttman, David S
2011-01-01
Next-generation genomic technology has both greatly accelerated the pace of genome research as well as increased our reliance on draft genome sequences. While groups such as the Genomics Standards Consortium have made strong efforts to promote genome standards there is a still a general lack of uniformity among published draft genomes, leading to challenges for downstream comparative analyses. This lack of uniformity is a particular problem when using standard draft genomes that frequently have large numbers of low-quality sequencing tracts. Here we present a proposal for an "enhanced-quality draft" genome that identifies at least 95% of the coding sequences, thereby effectively providing a full accounting of the genic component of the genome. Enhanced-quality draft genomes are easily attainable through a combination of small- and large-insert next-generation, paired-end sequencing. We illustrate the generation of an enhanced-quality draft genome by re-sequencing the plant pathogenic bacterium Pseudomonas syringae pv. phaseolicola 1448A (Pph 1448A), which has a published, closed genome sequence of 5.93 Mbp. We use a combination of Illumina paired-end and mate-pair sequencing, and surprisingly find that de novo assemblies with 100x paired-end coverage and mate-pair sequencing with as low as low as 2-5x coverage are substantially better than assemblies based on higher coverage. The rapid and low-cost generation of large numbers of enhanced-quality draft genome sequences will be of particular value for microbial diagnostics and biosecurity, which rely on precise discrimination of potentially dangerous clones from closely related benign strains.
Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O
2012-04-01
Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, S.B.
Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less
A short note on dynamic programming in a band.
Gibrat, Jean-François
2018-06-15
Third generation sequencing technologies generate long reads that exhibit high error rates, in particular for insertions and deletions which are usually the most difficult errors to cope with. The only exact algorithm capable of aligning sequences with insertions and deletions is a dynamic programming algorithm. In this note, for the sake of efficiency, we consider dynamic programming in a band. We show how to choose the band width in function of the long reads' error rates, thus obtaining an [Formula: see text] algorithm in space and time. We also propose a procedure to decide whether this algorithm, when applied to semi-global alignments, provides the optimal score. We suggest that dynamic programming in a band is well suited to the problem of aligning long reads between themselves and can be used as a core component of methods for obtaining a consensus sequence from the long reads alone. The function implementing the dynamic programming algorithm in a band is available, as a standalone program, at: https://forgemia.inra.fr/jean-francois.gibrat/BAND_DYN_PROG.git.
Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus
Youderian, Philip; Hartzell, Patricia L.
2006-01-01
Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386
DOE Office of Scientific and Technical Information (OSTI.GOV)
Solera, J.; Magallon, M.; Martin-Villar, J.
1992-02-01
DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less
Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T
2017-12-01
Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.
Schmidt, Nathan W.; Grigoryan, Gevorg
2017-01-01
Abstract Coiled‐coils are essential components of many protein complexes. First discovered in structural proteins such as keratins, they have since been found to figure largely in the assembly and dynamics required for diverse functions, including membrane fusion, signal transduction and motors. Coiled‐coils have a characteristic repeating seven‐residue geometric and sequence motif, which is sometimes interrupted by the insertion of one or more residues. Such insertions are often highly conserved and critical to interdomain communication in signaling proteins such as bacterial histidine kinases. Here we develop the “accommodation index” as a parameter that allows automatic detection and classification of insertions based on the three dimensional structure of a protein. This method allows precise identification of the type of insertion and the “accommodation length” over which the insertion is structurally accommodated. A simple theory is presented that predicts the structural perturbations of 1, 3, 4 residue insertions as a function of the length over which the insertion is accommodated. Analysis of experimental structures is in good agreement with theory, and shows that short accommodation lengths give rise to greater perturbation of helix packing angles, changes in local helical phase, and increased structural asymmetry relative to long accommodation lengths. Cytoplasmic domains of histidine kinases in different signaling states display large changes in their accommodation lengths, which can now be seen to underlie diverse structural transitions including symmetry/asymmetry and local variations in helical phase that accompany signal transduction. PMID:27977891
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-10-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-01-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624
The development of a cisgenic apple plant.
Vanblaere, Thalia; Szankowski, Iris; Schaart, Jan; Schouten, Henk; Flachowsky, Henryk; Broggini, Giovanni A L; Gessler, Cesare
2011-07-20
Cisgenesis represents a step toward a new generation of GM crops. The lack of selectable genes (e.g. antibiotic or herbicide resistance) in the final product and the fact that the inserted gene(s) derive from organisms sexually compatible with the target crop should rise less environmental concerns and increase consumer's acceptance. Here we report the generation of a cisgenic apple plant by inserting the endogenous apple scab resistance gene HcrVf2 under the control of its own regulatory sequences into the scab susceptible apple cultivar Gala. A previously developed method based on Agrobacterium-mediated transformation combined with a positive and negative selection system and a chemically inducible recombination machinery allowed the generation of apple cv. Gala carrying the scab resistance gene HcrVf2 under its native regulatory sequences and no foreign genes. Three cisgenic lines were chosen for detailed investigation and were shown to carry a single T-DNA insertion and express the target gene HcrVf2. This is the first report of the generation of a true cisgenic plant. Copyright © 2011 Elsevier B.V. All rights reserved.
Thermal stability of G-rich anti-parallel DNA triplexes upon insertion of LNA and α-L-LNA.
Kosbar, Tamer R; Sofan, Mamdouh A; Abou-Zeid, Laila; Pedersen, Erik B
2015-05-14
G-rich anti-parallel DNA triplexes were modified with LNA or α-L-LNA in their Watson-Crick and TFO strands. The triplexes were formed by targeting a pyrimidine strand to a putative hairpin formed by Hoogsteen base pairing in order to use the UV melting method to evaluate the stability of the triplexes. Their thermal stability was reduced when the TFO strand was modified with LNA or α-L-LNA. The same trend was observed when the TFO strand and the purine Watson-Crick strand both were modified with LNA. When all triad components were modified with α-L-LNA and LNA in the middle of the triplex, the thermal melting was increased. When the pyrimidine sequence was modified with a single insertion of LNA or α-L-LNA the ΔTm increased. Moreover, increasing the number of α-L-LNA in the pyrimidine target sequence to six insertions, leads to a high increase in the thermal stability. The conformational S-type structure of α-L-LNA in anti-parallel triplexes is preferable for triplex stability.
Ribosomes slide on lysine-encoding homopolymeric A stretches
Koutmou, Kristin S; Schuller, Anthony P; Brunelle, Julie L; Radhakrishnan, Aditya; Djuranovic, Sergej; Green, Rachel
2015-01-01
Protein output from synonymous codons is thought to be equivalent if appropriate tRNAs are sufficiently abundant. Here we show that mRNAs encoding iterated lysine codons, AAA or AAG, differentially impact protein synthesis: insertion of iterated AAA codons into an ORF diminishes protein expression more than insertion of synonymous AAG codons. Kinetic studies in E. coli reveal that differential protein production results from pausing on consecutive AAA-lysines followed by ribosome sliding on homopolymeric A sequence. Translation in a cell-free expression system demonstrates that diminished output from AAA-codon-containing reporters results from premature translation termination on out of frame stop codons following ribosome sliding. In eukaryotes, these premature termination events target the mRNAs for Nonsense-Mediated-Decay (NMD). The finding that ribosomes slide on homopolymeric A sequences explains bioinformatic analyses indicating that consecutive AAA codons are under-represented in gene-coding sequences. Ribosome ‘sliding’ represents an unexpected type of ribosome movement possible during translation. DOI: http://dx.doi.org/10.7554/eLife.05534.001 PMID:25695637
Retroviral DNA Integration Directed by HIV Integration Protein in Vitro
NASA Astrophysics Data System (ADS)
Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert
1990-09-01
Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.
Method of generating ploynucleotides encoding enhanced folding variants
Bradbury, Andrew M.; Kiss, Csaba; Waldo, Geoffrey S.
2017-05-02
The invention provides directed evolution methods for improving the folding, solubility and stability (including thermostability) characteristics of polypeptides. In one aspect, the invention provides a method for generating folding and stability-enhanced variants of proteins, including but not limited to fluorescent proteins, chromophoric proteins and enzymes. In another aspect, the invention provides methods for generating thermostable variants of a target protein or polypeptide via an internal destabilization baiting strategy. Internally destabilization a protein of interest is achieved by inserting a heterologous, folding-destabilizing sequence (folding interference domain) within DNA encoding the protein of interest, evolving the protein sequences adjacent to the heterologous insertion to overcome the destabilization (using any number of mutagenesis methods), thereby creating a library of variants. The variants in the library are expressed, and those with enhanced folding characteristics selected.
Family of pH-Low-Insertion-Peptides (pHLIPs)
NASA Astrophysics Data System (ADS)
Weerakkody, Dhammika; Moshnikova, Anna; Moshnikova, Valentina; Thakur, Mak; Rossi, Bethany; Engelman, Donald; Andreev, Oleg; Reshetnyak, Yana
2012-02-01
pHLIP (pH (Low) Insertion Peptide) is a novel delivery system for targeting of acidic diseased tissue such as solid tumors, sites of inflammation, arthritis and other pathological states. The molecular mechanism of pHLIP action is based on pH-dependent insertion and folding of pHLIP in membrane. We performed sequence variation and investigated 16 pHLIP variants with main goals of understanding the main principles of peptide-lipid interactions and tune delivery capability of pHLIP. The biophysical studies including thermodynamics and kinetics of the peptides interaction with a lipid bilayer of liposomes and cellular membranes were carried out. We found that peptides association to membrane at neutral and low pH could be modulated by 3-4 times. The apparent pK of transition from surface bound to membrane-inserted state could be tuned from 6.5 to 4.5. The rate of peptide's insertion across a bilayer could be enhanced 100 times compared to parent pHLIP. As a result, blood clearance and tumor targeting were modulated in a significant degree. The work is supported by NIH grants CA133890 to OAA, DME, YRK.
Membrane Topology and Insertion of Membrane Proteins: Search for Topogenic Signals
van Geest, Marleen; Lolkema, Juke S.
2000-01-01
Integral membrane proteins are found in all cellular membranes and carry out many of the functions that are essential to life. The membrane-embedded domains of integral membrane proteins are structurally quite simple, allowing the use of various prediction methods and biochemical methods to obtain structural information about membrane proteins. A critical step in the biosynthetic pathway leading to the folded protein in the membrane is its insertion into the lipid bilayer. Understanding of the fundamentals of the insertion and folding processes will significantly improve the methods used to predict the three-dimensional membrane protein structure from the amino acid sequence. In the first part of this review, biochemical approaches to elucidate membrane protein topology are reviewed and evaluated, and in the second part, the use of similar techniques to study membrane protein insertion is discussed. The latter studies search for signals in the polypeptide chain that direct the insertion process. Knowledge of the topogenic signals in the nascent chain of a membrane protein is essential for the evaluation of membrane topology studies. PMID:10704472
Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Jisen; Sharma, Anupma; Yu, Qingyi
Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less
Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum
Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...
2016-06-10
Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less
Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.
2011-01-01
Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787
Structural diversity of domain superfamilies in the CATH database.
Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A
2006-07-14
The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).
Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad
2015-01-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567
Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad
2014-11-01
While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.
Functional impact of the human mobilome.
Babatz, Timothy D; Burns, Kathleen H
2013-06-01
The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Bin, E-mail: huangbin@nwpu.edu.cn; Li, Maohua; Chen, Yanxia
The interfacial reactions of continuous SiC fiber reinforced Ti-6Al-4V matrix composite (SiC{sub f}/Ti-6Al-4V composite) and continuous SiC fiber coated by C reinforced Ti-6Al-4V matrix composite (SiC{sub f}/C/Ti-6Al-4V composite) were investigated by using micro-beam electron diffraction (MBED) and energy disperse spectroscopy (EDS) on transmission electron microscopy (TEM). The sequence of the interfacial reactions in the as-processed and exposed at 900°C for 50h SiC{sub f}/Ti-6Al-4V composites can be described as SiC||TiC||Ti{sub 5}Si{sub 3} + TiC||Ti-6Al-4V and SiC||TiC||Ti{sub 5}Si{sub 3}||TiC||Ti{sub 5}Si{sub 3}||TiC||Ti{sub 5}Si{sub 3}||Ti-6Al-4V, respectively. Additionally, both in as-processed and exposed composites, Ti{sub 3}SiC{sub 2} and Ti{sub 3}Si are absent at the interfaces.more » For the SiC{sub f}/C/Ti-6Al-4V composite exposed at 900 °C for 50 h, the sequence of the interfacial reaction can be described as SiC||C||TiC{sub F}||TiC{sub C}||Ti-6Al-4V before C coating is completely consumed by interfacial reaction. When interfacial reaction consumes C coating completely, the sequence of the interfacial reaction can be described as SiC||TiC||Ti{sub 5}Si{sub 3}||TiC||Ti-6Al-4V. Furthermore, in SiC{sub f}/C/Ti-6Al-4V composite, C coating can absolutely prevent Si diffusion from SiC fiber to matrix. Basing on these results, the model of formation process of the interfacial reaction products in the composites was proposed. - Highlights: • We obtained the sequence of the interfacial reactions in the as-processed and exposed at 900 °C for 50 h SiC{sub f}/Ti-6Al-4 V composites as well as in the SiC{sub f}/C/Ti-6Al-4 V composite exposed at 900 °C for 50 h. • We verified that both in as-processed and exposed SiC{sub f}/Ti-6Al-4 V composites, Ti{sub 3}SiC{sub 2} and Ti{sub 3}Si are absent at the interfaces. • Carbon coating can absolutely prevent silicon diffusion from SiC fiber to matrix. • Basing on these results, the model of formation process of the interfacial reaction products in the composites was proposed.« less
ISEScan: automated identification of insertion sequence elements in prokaryotic genomes.
Xie, Zhiqun; Tang, Haixu
2017-11-01
The insertion sequence (IS) elements are the smallest but most abundant autonomous transposable elements in prokaryotic genomes, which play a key role in prokaryotic genome organization and evolution. With the fast growing genomic data, it is becoming increasingly critical for biology researchers to be able to accurately and automatically annotate ISs in prokaryotic genome sequences. The available automatic IS annotation systems are either providing only incomplete IS annotation or relying on the availability of existing genome annotations. Here, we present a new IS elements annotation pipeline to address these issues. ISEScan is a highly sensitive software pipeline based on profile hidden Markov models constructed from manually curated IS elements. ISEScan performs better than existing IS annotation systems when tested on prokaryotic genomes with curated annotations of IS elements. Applying it to 2784 prokaryotic genomes, we report the global distribution of IS families across taxonomic clades in Archaea and Bacteria. ISEScan is implemented in Python and released as an open source software at https://github.com/xiezhq/ISEScan. hatang@indiana.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie
2015-01-01
Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955
Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun
2015-12-29
In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.
Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos
2008-01-01
Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739
Chen, Guiqian; Qiu, Yuan; Zhuang, Qingye; Wang, Suchun; Wang, Tong; Chen, Jiming; Wang, Kaicheng
2018-05-09
Next generation sequencing (NGS) is a powerful tool for the characterization, discovery, and molecular identification of RNA viruses. There were multiple NGS library preparation methods published for strand-specific RNA-seq, but some methods are not suitable for identifying and characterizing RNA viruses. In this study, we report a NGS library preparation method to identify RNA viruses using the Ion Torrent PGM platform. The NGS sequencing adapters were directly inserted into the sequencing library through reverse transcription and polymerase chain reaction, without fragmentation and ligation of nucleic acids. The results show that this method is simple to perform, able to identify multiple species of RNA viruses in clinical samples.
Ciardo, Diana E; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V; Böttger, Erik C
2010-08-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory.
Evaluating Documents: The Case of Patient Package Inserts. Technical Report No. 2.
ERIC Educational Resources Information Center
Krug, Robert E.
To illustrate the types of factors that must be considered in evaluating public documents, this paper analyzes a number of possible outcomes resulting from one type of document, the patient package insert (PPI) designed to provide consumers of prescription drugs with information about the drugs. It first outlines the intended sequence for a PPI:…
Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng
2013-01-01
Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982
Broadband notch filter design for millimeter-wave plasma diagnostics.
Furtula, V; Michelsen, P K; Leipold, F; Salewski, M; Korsholm, S B; Meo, F; Nielsen, S K; Stejner, M; Moseev, D; Johansen, T
2010-10-01
Notch filters are integrated in plasma diagnostic systems to protect millimeter-wave receivers from intensive stray radiation. Here we present a design of a notch filter with a center frequency of 140 GHz, a rejection bandwidth of ∼900 MHz, and a typical insertion loss below 2 dB in the passband of ±9 GHz. The design is based on a fundamental rectangular waveguide with eight cylindrical cavities coupled by T-junction apertures formed as thin slits. Parameters that affect the notch performance such as physical lengths and conductor materials are discussed. The excited resonance mode in the cylindrical cavities is the fundamental TE(11). The performance of the constructed filter is measured using a vector network analyzer monitoring a total bandwidth of 30 GHz. We compare the measurements with numerical simulations.
USDA-ARS?s Scientific Manuscript database
We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...
Unlocking Short Read Sequencing for Metagenomics
Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...
2010-07-28
We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.
Sage, Brian T; Csink, Amy K
2003-01-01
Chromosomes of higher eukaryotes contain blocks of heterochromatin that can associate with each other in the interphase nucleus. A well-studied example of heterochromatic interaction is the brown(Dominant) (bwD) chromosome of D. melanogaster, which contains an approximately 1.6-Mbp insertion of AAGAG repeats near the distal tip of chromosome 2. This insertion causes association of the tip with the centric heterochromatin of chromosome 2 (2h), which contains megabases of AAGAG repeats. Here we describe an example, other than bwD, in which distally translocated heterochromatin associates with centric heterochromatin. Additionally, we show that when a translocation places bwD on a different chromosome, bwD tends to associate with the centric heterochromatin of this chromosome, even when the chromosome contains a small fraction of the sequence homology present elsewhere. To further test the importance of sequence homology in these interactions, we used interspecific mating to introgress the bwD allele from D. melanogaster into D. simulans, which lacks the AAGAG on the autosomes. We find that D. simulans bwD associates with 2h, which lacks the AAGAG sequence, while it does not associate with the AAGAG containing X chromosome heterochromatin. Our results show that intranuclear association of separate heterochromatic blocks does not require that they contain the same sequence. PMID:14668374
Begin at the beginning: A BAC-end view of the passion fruit (Passiflora) genome.
Santos, Anselmo Azevedo; Penha, Helen Alves; Bellec, Arnaud; Munhoz, Carla de Freitas; Pedrosa-Harand, Andrea; Bergès, Hélène; Vieira, Maria Lucia Carneiro
2014-09-26
The passion fruit (Passiflora edulis) is a tropical crop of economic importance both for juice production and consumption as fresh fruit. The juice is also used in concentrate blends that are consumed worldwide. However, very little is known about the genome of the species. Therefore, improving our understanding of passion fruit genomics is essential and to some degree a pre-requisite if its genetic resources are to be used more efficiently. In this study, we have constructed a large-insert BAC library and provided the first view on the structure and content of the passion fruit genome, using BAC-end sequence (BES) data as a major resource. The library consisted of 82,944 clones and its levels of organellar DNA were very low. The library represents six haploid genome equivalents, and the average insert size was 108 kb. To check its utility for gene isolation, successful macroarray screening experiments were carried out with probes complementary to eight Passiflora gene sequences available in public databases. BACs harbouring those genes were used in fluorescent in situ hybridizations and unique signals were detected for four BACs in three chromosomes (n=9). Then, we explored 10,000 BES and we identified reads likely to contain repetitive mobile elements (19.6% of all BES), simple sequence repeats and putative proteins, and to estimate the GC content (~42%) of the reads. Around 9.6% of all BES were found to have high levels of similarity to plant genes and ontological terms were assigned to more than half of the sequences analysed (940). The vast majority of the top-hits made by our sequences were to Populus trichocarpa (24.8% of the total occurrences), Theobroma cacao (21.6%), Ricinus communis (14.3%), Vitis vinifera (6.5%) and Prunus persica (3.8%). We generated the first large-insert library for a member of Passifloraceae. This BAC library provides a new resource for genetic and genomic studies, as well as it represents a valuable tool for future whole genome study. Remarkably, a number of BAC-end pair sequences could be mapped to intervals of the sequenced Arabidopsis thaliana, V. vinifera and P. trichocarpa chromosomes, and putative collinear microsyntenic regions were identified.
Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun
2014-05-07
Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation 'Dj' corresponding to a DNA sequence but based on the five-letter base set; also, 'Dj's are expressed graphically. Insertions and deletions of a series of letters 'E' are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by 'Dj◦B(j→k) = Dk' (or 'Rj◦B(j→k) = Rk'). Based on the operations of this group, two types of groups-a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases-are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical "central dogma" via a category theory-like way is presented for future developments. Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing "central dogma" for future molecular/genetic biology remains to be explored.
GATA: A graphic alignment tool for comparative sequenceanalysis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nix, David A.; Eisen, Michael B.
2005-01-01
Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less
Simultaneous message framing and error detection
NASA Technical Reports Server (NTRS)
Frey, A. H., Jr.
1968-01-01
Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.
Potential Links between Hepadnavirus and Bornavirus Sequences in the Host Genome and Cancer.
Honda, Tomoyuki
2017-01-01
Various viruses leave their sequences in the host genomes during infection. Such events occur mainly in retrovirus infection but also sometimes in DNA and non-retroviral RNA virus infections. If viral sequences are integrated into the genomes of germ line cells, the sequences can become inherited as endogenous viral elements (EVEs). The integration events of viral sequences may have oncogenic potential. Because proviral integrations of some retroviruses and/or reactivation of endogenous retroviruses are closely linked to cancers, viral insertions related to non-retroviral viruses also possibly contribute to cancer development. This article focuses on genomic viral sequences derived from two non-retroviral viruses, whose endogenization is already reported, and discusses their possible contributions to cancer. Viral insertions of hepatitis B virus play roles in the development of hepatocellular carcinoma. Endogenous bornavirus-like elements, the only non-retroviral RNA virus-related EVEs found in the human genome, may also be involved in cancer formation. In addition, the possible contribution of the interactions between viruses and retrotransposons, which seem to be a major driving force for generating EVEs related to non-retroviral RNA viruses, to cancers will be discussed. Future studies regarding the possible links described here may open a new avenue for the development of novel therapeutics for tumor virus-related cancers and/or provide novel insights into EVE functions.
Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D
1994-01-01
For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267
DOE Office of Scientific and Technical Information (OSTI.GOV)
Warner, Jacob A.; Timmers, Heiko; Smith, Paul N.
2011-06-01
This study demonstrates a new method of radioisotope labeling of ultra-high molecular weight polyethylene inserts in prosthetic joints for wear studies. The radioisotopes {sup 97}Ru, {sup 100}Pd, {sup 100}Rh, and {sup 101m}Rh are produced in fusion evaporation reactions induced by {sup 12}C ions in a {sup 92}Zr target foil. The fusion products recoil-implant into ultra-high molecular weight polyethylene plugs, machined to fit into the surface of the inserts. During laboratory simulations of the joint motion, a wear rate of the labeled polyethylene may be measured and the pathways of wear debris particles can be traced by detecting characteristic gamma-rays. Themore » concentration profiles of the radioisotopes extend effectively uniformly from the polyethylene surface to a depth of about 4 {mu}m. The multiplicity of labeling and the use of several gamma-ray lines aids with avoiding systematic measurement uncertainties. Two polyethylene plugs were labeled and one was fitted into the surface of the tibial insert of a knee prosthesis, which had been worn in. Actuation over close to 100,000 cycles with a 900 N axial load and a 24 deg. flexion angle removed (14{+-}1)% of the gamma-ray activity from the plug. Most of this activity dispersed into the serum lubricant identifying this as the important debris pathway. Less than 1% activity was transferred to the femoral component of the prosthesis and the measured activity on the tibial tray was insignificant. Assuming uniform wear across the superior surface of the insert, a wear rate of (12{+-}3) mm{sup 3}/Megacycle was determined. This is consistent with wear rate measurements under similar conditions using other techniques.« less
Multiple mobile promoter regions for the rare carbapenem resistance gene of Bacteroides fragilis.
Podglajen, I; Breuil, J; Rohaut, A; Monsempes, C; Collatz, E
2001-06-01
Two novel insertion sequences (IS), IS1187 and IS1188, are described upstream from the carbapenem resistance gene cfiA in strains of Bacteroides fragilis. Mapping, with the RACE procedure, of transcription start sites of cfiA in these and two other previously reported IS showed that transcription of this rarely encountered gene is initiated close to a variety of B. fragilis consensus promoter sequences, as recently defined (D. P. Bayley, E. R. Rocha, and C. J. Smith, FEMS Microbiol. Lett. 193:149-154, 2000). In the cases of IS1186 and IS1188, these sequences overlap with putative Esigma(70) promoter sequences, while in IS942 and IS1187 such sequences can be observed either upstream or downstream of the B. fragilis promoters.
Comparison of Ultra-Conserved Elements in Drosophilids and Vertebrates
Makunin, Igor V.; Shloma, Viktor V.; Stephen, Stuart J.; Pheasant, Michael; Belyakin, Stepan N.
2013-01-01
Metazoan genomes contain many ultra-conserved elements (UCEs), long sequences identical between distant species. In this study we identified UCEs in drosophilid and vertebrate species with a similar level of phylogenetic divergence measured at protein-coding regions, and demonstrated that both the length and number of UCEs are larger in vertebrates. The proportion of non-exonic UCEs declines in distant drosophilids whilst an opposite trend was observed in vertebrates. We generated a set of 2,126 Sophophora UCEs by merging elements identified in several drosophila species and compared these to the eutherian UCEs identified in placental mammals. In contrast to vertebrates, the Sophophora UCEs are depleted around transcription start sites. Analysis of 52,954 P-element, piggyBac and Minos insertions in the D. melanogaster genome revealed depletion of the P-element and piggyBac insertions in and around the Sophophora UCEs. We examined eleven fly strains with transposon insertions into the intergenic UCEs and identified associated phenotypes in five strains. Four insertions behave as recessive lethals, and in one case we observed a suppression of the marker gene within the transgene, presumably by silenced chromatin around the integration site. To confirm the lethality is caused by integration of transposons we performed a phenotype rescue experiment for two stocks and demonstrated that the excision of the transposons from the intergenic UCEs restores viability. Sequencing of DNA after the transposon excision in one fly strain with the restored viability revealed a 47 bp insertion at the original transposon integration site suggesting that the nature of the mutation is important for the appearance of the phenotype. Our results suggest that the UCEs in flies and vertebrates have both common and distinct features, and demonstrate that a significant proportion of intergenic drosophila UCEs are sensitive to disruption. PMID:24349264
Mobile element biology – new possibilities with high-throughput sequencing
Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.
2014-01-01
Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846
Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang
2016-02-01
The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.
Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA
Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.
1995-01-01
The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581
Structure and expression of the attacin genes in Hyalophora cecropia.
Sun, S C; Lindström, I; Lee, J Y; Faye, I
1991-02-26
To study the regulation of the immune genes in insects, we have cloned and sequenced the attacin gene locus of the giant silk moth Hyalophora cecropia. The locus contains one acidic and one basic attacin gene as well as two pseudogenes, which are remnants of basic attacin genes. A small insertion element was found within the locus. The two functional attacin genes are transcribed in opposite directions and have two introns inserted at homologous positions. A common sequence, GGGGATTCCT, is found at nucleotide position -48 in the acidic gene and at nucleotide position -58 in the basic gene. Interestingly, this decanucleotide is similar to the consensus of the NF-k B-binding site. Expression studies revealed that both attacins are strongly induced by phorbol 12-myristate 13-acetate, lipopolysaccharide and bacteria. However, only the acidic attacin gene showed a clear response to injury.
A Forward Genetic Screening for Prostate Cancer Progression Genes
2012-10-01
sequence reads. For verifying the prevalence of insertions in tumors, PCR was performed on genomic DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science
NASA Astrophysics Data System (ADS)
Akim, E. L.; Zaslavsky, G. S.; Morskoy, I. M.; Ruzsky, E. G.; Stepaniants, V. A.; Tuchin, A. G.
2010-02-01
This paper is concerned with the problems of ballistics, navigation, and flight control of the space craft (SC) in the Phobos-Grunt mission. We consider an insertion into the Earth-Mars transfer trajectory, the Earth-Mars transfer, the strategy of corrections, and the accuracy of the insertion of the SC into Martian orbit. During the orbital maneuvering stage in the sphere of influence of Mars, we set up a scheme that allows for the insertion of the SC, with the prescribed accuracy, into a point 80-km above the Phobos surface over the theoretical landing area. We specify the sequence for a controlled landing and provide methods for solving the problems of navigation and control during a self-c ontained landing. We also consider the liftoff from Phobos, insertion into the parking orbit, and the Mars-Earth transfer.
Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA
Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary
2013-01-01
Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322
MOSAIK: a hash-based algorithm for accurate next-generation sequencing short-read mapping.
Lee, Wan-Ping; Stromberg, Michael P; Ward, Alistair; Stewart, Chip; Garrison, Erik P; Marth, Gabor T
2014-01-01
MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me).
MOSAIK: A Hash-Based Algorithm for Accurate Next-Generation Sequencing Short-Read Mapping
Lee, Wan-Ping; Stromberg, Michael P.; Ward, Alistair; Stewart, Chip; Garrison, Erik P.; Marth, Gabor T.
2014-01-01
MOSAIK is a stable, sensitive and open-source program for mapping second and third-generation sequencing reads to a reference genome. Uniquely among current mapping tools, MOSAIK can align reads generated by all the major sequencing technologies, including Illumina, Applied Biosystems SOLiD, Roche 454, Ion Torrent and Pacific BioSciences SMRT. Indeed, MOSAIK was the only aligner to provide consistent mappings for all the generated data (sequencing technologies, low-coverage and exome) in the 1000 Genomes Project. To provide highly accurate alignments, MOSAIK employs a hash clustering strategy coupled with the Smith-Waterman algorithm. This method is well-suited to capture mismatches as well as short insertions and deletions. To support the growing interest in larger structural variant (SV) discovery, MOSAIK provides explicit support for handling known-sequence SVs, e.g. mobile element insertions (MEIs) as well as generating outputs tailored to aid in SV discovery. All variant discovery benefits from an accurate description of the read placement confidence. To this end, MOSAIK uses a neural-network based training scheme to provide well-calibrated mapping quality scores, demonstrated by a correlation coefficient between MOSAIK assigned and actual mapping qualities greater than 0.98. In order to ensure that studies of any genome are supported, a training pipeline is provided to ensure optimal mapping quality scores for the genome under investigation. MOSAIK is multi-threaded, open source, and incorporated into our command and pipeline launcher system GKNO (http://gkno.me). PMID:24599324
Improved Protocols for Illumina Sequencing
Bronner, Iraad F.; Quail, Michael A.; Turner, Daniel J.; Swerdlow, Harold
2013-01-01
In this unit, we describe a set of improvements we have made to the standard Illumina protocols to make the sequencing process more reliable in a high-throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. PMID:19582764
ERIC Educational Resources Information Center
Galewsky, Samuel
2000-01-01
Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)
Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping
2018-01-01
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.
Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.
Danhorn, Thomas; Young, Curtis R; DeLong, Edward F
2012-11-01
The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.
Mobile elements reveal small population size in the ancient ancestors of Homo sapiens.
Huff, Chad D; Xing, Jinchuan; Rogers, Alan R; Witherspoon, David; Jorde, Lynn B
2010-02-02
The genealogies of different genetic loci vary in depth. The deeper the genealogy, the greater the chance that it will include a rare event, such as the insertion of a mobile element. Therefore, the genealogy of a region that contains a mobile element is on average older than that of the rest of the genome. In a simple demographic model, the expected time to most recent common ancestor (TMRCA) is doubled if a rare insertion is present. We test this expectation by examining single nucleotide polymorphisms around polymorphic Alu insertions from two completely sequenced human genomes. The estimated TMRCA for regions containing a polymorphic insertion is two times larger than the genomic average (P < <10(-30)), as predicted. Because genealogies that contain polymorphic mobile elements are old, they are shaped largely by the forces of ancient population history and are insensitive to recent demographic events, such as bottlenecks and expansions. Remarkably, the information in just two human DNA sequences provides substantial information about ancient human population size. By comparing the likelihood of various demographic models, we estimate that the effective population size of human ancestors living before 1.2 million years ago was 18,500, and we can reject all models where the ancient effective population size was larger than 26,000. This result implies an unusually small population for a species spread across the entire Old World, particularly in light of the effective population sizes of chimpanzees (21,000) and gorillas (25,000), which each inhabit only one part of a single continent.
Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar
2006-12-01
An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.
Molecular Cloning of Drebrin: Progress and Perspectives.
Kojima, Nobuhiko
2017-01-01
Chicken drebrin isoforms were first identified in the optic tectum of developing brain. Although the time course of protein expression was different in each drebrin isoform, the similarity between their protein structures was suggested by biochemical analysis of purified protein. To determine their protein structures, the cloning of drebrin cDNAs was conducted. Comparison between the cDNA sequences shows that all drebrin cDNAs are identical except that the internal insertion sequences are present or absent in their sequences. Chicken drebrin are now classified into three isoforms, namely, drebrins E1, E2, and A. Genomic cloning demonstrated that the three isoforms are generated by an alternative splicing of individual exons encoding the insertion sequences from single drebrin gene. The mechanism should be precisely regulated in cell-type-specific and developmental stage-specific fashion. Drebrin protein, which is well conserved in various vertebrate species, although mammalian drebrin has only two isoforms, namely, drebrin E and drebrin A, is different from chicken drebrin that has three isoforms. Drebrin belongs to an actin-depolymerizing factor homology (ADF-H) domain protein family. Besides the ADF-H domain, drebrin has other domains, including the actin-binding domain and Homer-binding motifs. Diversity of protein isoform and multiple domains of drebrin could interact differentially with the actin cytoskeleton and other intracellular proteins and regulate diverse cellular processes.
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Efficient pairwise RNA structure prediction using probabilistic alignment constraints in Dynalign
2007-01-01
Background Joint alignment and secondary structure prediction of two RNA sequences can significantly improve the accuracy of the structural predictions. Methods addressing this problem, however, are forced to employ constraints that reduce computation by restricting the alignments and/or structures (i.e. folds) that are permissible. In this paper, a new methodology is presented for the purpose of establishing alignment constraints based on nucleotide alignment and insertion posterior probabilities. Using a hidden Markov model, posterior probabilities of alignment and insertion are computed for all possible pairings of nucleotide positions from the two sequences. These alignment and insertion posterior probabilities are additively combined to obtain probabilities of co-incidence for nucleotide position pairs. A suitable alignment constraint is obtained by thresholding the co-incidence probabilities. The constraint is integrated with Dynalign, a free energy minimization algorithm for joint alignment and secondary structure prediction. The resulting method is benchmarked against the previous version of Dynalign and against other programs for pairwise RNA structure prediction. Results The proposed technique eliminates manual parameter selection in Dynalign and provides significant computational time savings in comparison to prior constraints in Dynalign while simultaneously providing a small improvement in the structural prediction accuracy. Savings are also realized in memory. In experiments over a 5S RNA dataset with average sequence length of approximately 120 nucleotides, the method reduces computation by a factor of 2. The method performs favorably in comparison to other programs for pairwise RNA structure prediction: yielding better accuracy, on average, and requiring significantly lesser computational resources. Conclusion Probabilistic analysis can be utilized in order to automate the determination of alignment constraints for pairwise RNA structure prediction methods in a principled fashion. These constraints can reduce the computational and memory requirements of these methods while maintaining or improving their accuracy of structural prediction. This extends the practical reach of these methods to longer length sequences. The revised Dynalign code is freely available for download. PMID:17445273
Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H.; Yu, Xue-jie
2014-01-01
Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine. PMID:25412248
Liu, Yan; Wu, Bin; Weinstock, George; Walker, David H; Yu, Xue-Jie
2014-01-01
Louse borne typhus (also called epidemic typhus) was one of man's major scourges, and epidemics of the disease can be reignited when social, economic, or political systems are disrupted. The fear of a bioterrorist attack using the etiologic agent of typhus, Rickettsia prowazekii, was a reality. An attenuated typhus vaccine, R. prowazekii Madrid E strain, was observed to revert to virulence as demonstrated by isolation of the virulent revertant Evir strain from animals which were inoculated with Madrid E strain. The mechanism of the mutation in R. prowazekii that affects the virulence of the vaccine was not known. We sequenced the genome of the virulent revertant Evir strain and compared its genome sequence with the genome sequences of its parental strain, Madrid E. We found that only a single nucleotide in the entire genome was different between the vaccine strain Madrid E and its virulent revertant strain Evir. The mutation is a single nucleotide insertion in the methyltransferase gene (also known as PR028) in the vaccine strain that inactivated the gene. We also confirmed that the vaccine strain E did not cause fever in guinea pigs and the virulent revertant strain Evir caused fever in guinea pigs. We concluded that a single nucleotide insertion in the methyltransferase gene of R. prowazekii attenuated the R. prowazekii vaccine strain E. This suggested that an irreversible insertion or deletion mutation in the methyl transferase gene of R. prowazekii is required for Madrid E to be considered a safe vaccine.
SNPServer: a real-time SNP discovery tool.
Savage, David; Batley, Jacqueline; Erwin, Tim; Logan, Erica; Love, Christopher G; Lim, Geraldine A C; Mongin, Emmanuel; Barker, Gary; Spangenberg, German C; Edwards, David
2005-07-01
SNPServer is a real-time flexible tool for the discovery of SNPs (single nucleotide polymorphisms) within DNA sequence data. The program uses BLAST, to identify related sequences, and CAP3, to cluster and align these sequences. The alignments are parsed to the SNP discovery software autoSNP, a program that detects SNPs and insertion/deletion polymorphisms (indels). Alternatively, lists of related sequences or pre-assembled sequences may be entered for SNP discovery. SNPServer and autoSNP use redundancy to differentiate between candidate SNPs and sequence errors. For each candidate SNP, two measures of confidence are calculated, the redundancy of the polymorphism at a SNP locus and the co-segregation of the candidate SNP with other SNPs in the alignment. SNPServer is available at http://hornbill.cspp.latrobe.edu.au/snpdiscovery.html.
Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel
2012-01-01
Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow. PMID:22802251
Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît
2012-10-01
Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow.
A low molecular weight artificial RNA of unique size with multiple probe target regions
NASA Technical Reports Server (NTRS)
Pitulle, C.; Dsouza, L.; Fox, G. E.
1997-01-01
Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dean, A.P.; Martin, Michael C.; Sigee, D.C.
2006-10-09
Synchrotron-based Fourier-transform infrared (FTIR)microspectroscopy was used to distinguish micropopulations of thecodominant algae Microcystis aeruginosa (Cyanophyceae) and Ceratiumhirundinella (Dinophyceae) in mixed phytoplankton samples taken from thewater column of a stratified eutrophic lake (Rostherne Mere, UK). FTIRspectra of the two algae showed a closely similar sequence of 10 bandsover the wave-number range 4000-900 cm-1. These were assigned to a rangeof vibrationally active chemical groups using published band assignmentsand on the basis of correlation and factor analysis. In both algae,intracellular concentrations of macromolecular components (determined asband intensity) varied considerably within the same population,indicating substantial intraspecific heterogeneity. Interspecificdifferences were separately analysed in relation tomore » discrete bands and bymultivariate analysis of the entire spectral region 1750-900 cm-1. Interms of discrete bands, comparison of individual intensities (normalisedto amide 1) demonstrated significant (99 percent probability level)differences in relation to six bands between the two algal species. Keyinterspecific differences were also noted in relation to the positions ofbands 2, 10 (carbohydrate) and 7 (protein) and in the 3-D plots derivedby principal component analysis (PCA) of the sequence of bandintensities. PCA of entire spectral regions showed clear resolutionofspecies in the PCA plot, with indication of separation on the basis ofprotein (region 1700-1500 cm1) and carbohydrate (region 1150-900 cm1)composition in the loading plot. Hierarchical cluster analysis (Wardalgorithm) of entire spectral regions also showed clear discrimination ofthe two species within the resulting dendrogram.« less
Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco
Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène
2007-01-01
The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058
Adrion, Jeffrey R.; Song, Michael J.; Schrider, Daniel R.; Hahn, Matthew W.
2017-01-01
Abstract Knowing the rate at which transposable elements (TEs) insert and delete is critical for understanding their role in genome evolution. We estimated spontaneous rates of insertion and deletion for all known, active TE superfamilies present in a set of Drosophila melanogaster mutation-accumulation (MA) lines using whole genome sequence data. Our results demonstrate that TE insertions far outpace TE deletions in D. melanogaster. We found a significant effect of background genotype on TE activity, with higher rates of insertions in one MA line. We also found significant rate heterogeneity between the chromosomes, with both insertion and deletion rates elevated on the X relative to the autosomes. Further, we identified significant associations between TE activity and chromatin state, and tested for associations between TE activity and other features of the local genomic environment such as TE content, exon content, GC content, and recombination rate. Our results provide the most detailed assessment of TE mobility in any organism to date, and provide a useful benchmark for both addressing theoretical predictions of TE dynamics and for exploring large-scale patterns of TE movement in D. melanogaster and other species. PMID:28338986
Differential evolution-simulated annealing for multiple sequence alignment
NASA Astrophysics Data System (ADS)
Addawe, R. C.; Addawe, J. M.; Sueño, M. R. K.; Magadia, J. C.
2017-10-01
Multiple sequence alignments (MSA) are used in the analysis of molecular evolution and sequence structure relationships. In this paper, a hybrid algorithm, Differential Evolution - Simulated Annealing (DESA) is applied in optimizing multiple sequence alignments (MSAs) based on structural information, non-gaps percentage and totally conserved columns. DESA is a robust algorithm characterized by self-organization, mutation, crossover, and SA-like selection scheme of the strategy parameters. Here, the MSA problem is treated as a multi-objective optimization problem of the hybrid evolutionary algorithm, DESA. Thus, we name the algorithm as DESA-MSA. Simulated sequences and alignments were generated to evaluate the accuracy and efficiency of DESA-MSA using different indel sizes, sequence lengths, deletion rates and insertion rates. The proposed hybrid algorithm obtained acceptable solutions particularly for the MSA problem evaluated based on the three objectives.
Wicker, Thomas; Yu, Yeisoo; Haberer, Georg; Mayer, Klaus F. X.; Marri, Pradeep Reddy; Rounsley, Steve; Chen, Mingsheng; Zuccolo, Andrea; Panaud, Olivier; Wing, Rod A.; Roffler, Stefan
2016-01-01
DNA (class 2) transposons are mobile genetic elements which move within their ‘host' genome through excising and re-inserting elsewhere. Although the rice genome contains tens of thousands of such elements, their actual role in evolution is still unclear. Analysing over 650 transposon polymorphisms in the rice species Oryza sativa and Oryza glaberrima, we find that DNA repair following transposon excisions is associated with an increased number of mutations in the sequences neighbouring the transposon. Indeed, the 3,000 bp flanking the excised transposons can contain over 10 times more mutations than the genome-wide average. Since DNA transposons preferably insert near genes, this is correlated with increases in mutation rates in coding sequences and regulatory regions. Most importantly, we find this phenomenon also in maize, wheat and barley. Thus, these findings suggest that DNA transposon activity is a major evolutionary force in grasses which provide the basis of most food consumed by humankind. PMID:27599761
[The principle and application of the single-molecule real-time sequencing technology].
Yanhu, Liu; Lu, Wang; Li, Yu
2015-03-01
Last decade witnessed the explosive development of the third-generation sequencing strategy, including single-molecule real-time sequencing (SMRT), true single-molecule sequencing (tSMSTM) and the single-molecule nanopore DNA sequencing. In this review, we summarize the principle, performance and application of the SMRT sequencing technology. Compared with the traditional Sanger method and the next-generation sequencing (NGS) technologies, the SMRT approach has several advantages, including long read length, high speed, PCR-free and the capability of direct detection of epigenetic modifications. However, the disadvantage of its low accuracy, most of which resulted from insertions and deletions, is also notable. So, the raw sequence data need to be corrected before assembly. Up to now, the SMRT is a good fit for applications in the de novo genomic sequencing and the high-quality assemblies of small genomes. In the future, it is expected to play an important role in epigenetics, transcriptomic sequencing, and assemblies of large genomes.
Brzeziński, K; Janowski, R; Podkowiński, J; Jaskólski, M
2001-01-01
The coding sequences of two S-adenosyl-L-homocysteine hydrolases (SAHases) were identified in yellow lupine by screenig of a cDNA library. One of them, corresponding to the complete protein, was sequenced and compared with 52 other SAHase sequences. Phylogenetic analysis of these proteins identified three groups of the enzymes. Group A comprises only bacterial sequences. Group B is subdivided into two subgroups, one of which (B1) is formed by animal sequences. Subgroup B2 consist of two distinct clusters, B2a and B2b. Cluster B2b comprises all known plant sequences, including the yellow lupine enzyme, which are distinguished by a 50-residue insert. Group C is heterogeneous and contains SAHases from Archaea as well as a new class of animal enzymes, distinctly different from those in group B1.
Construction of a scFv Library with Synthetic, Non-combinatorial CDR Diversity.
Bai, Xuelian; Shim, Hyunbo
2017-01-01
Many large synthetic antibody libraries have been designed, constructed, and successfully generated high-quality antibodies suitable for various demanding applications. While synthetic antibody libraries have many advantages such as optimized framework sequences and a broader sequence landscape than natural antibodies, their sequence diversities typically are generated by random combinatorial synthetic processes which cause the incorporation of many undesired CDR sequences. Here, we describe the construction of a synthetic scFv library using oligonucleotide mixtures that contain predefined, non-combinatorially synthesized CDR sequences. Each CDR is first inserted to a master scFv framework sequence and the resulting single-CDR libraries are subjected to a round of proofread panning. The proofread CDR sequences are assembled to produce the final scFv library with six diversified CDRs.
LookSeq: a browser-based viewer for deep sequencing data.
Manske, Heinrich Magnus; Kwiatkowski, Dominic P
2009-11-01
Sequencing a genome to great depth can be highly informative about heterogeneity within an individual or a population. Here we address the problem of how to visualize the multiple layers of information contained in deep sequencing data. We propose an interactive AJAX-based web viewer for browsing large data sets of aligned sequence reads. By enabling seamless browsing and fast zooming, the LookSeq program assists the user to assimilate information at different levels of resolution, from an overview of a genomic region to fine details such as heterogeneity within the sample. A specific problem, particularly if the sample is heterogeneous, is how to depict information about structural variation. LookSeq provides a simple graphical representation of paired sequence reads that is more revealing about potential insertions and deletions than are conventional methods.
Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.
Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A
2018-01-01
Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.
pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.
Gu, Jingsong; Ye, Chunjiang
2011-03-01
A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.
McTavish, Emily Jane; Steel, Mike; Holder, Mark T
2015-12-01
Statistically consistent estimation of phylogenetic trees or gene trees is possible if pairwise sequence dissimilarities can be converted to a set of distances that are proportional to the true evolutionary distances. Susko et al. (2004) reported some strikingly broad results about the forms of inconsistency in tree estimation that can arise if corrected distances are not proportional to the true distances. They showed that if the corrected distance is a concave function of the true distance, then inconsistency due to long branch attraction will occur. If these functions are convex, then two "long branch repulsion" trees will be preferred over the true tree - though these two incorrect trees are expected to be tied as the preferred true. Here we extend their results, and demonstrate the existence of a tree shape (which we refer to as a "twisted Farris-zone" tree) for which a single incorrect tree topology will be guaranteed to be preferred if the corrected distance function is convex. We also report that the standard practice of treating gaps in sequence alignments as missing data is sufficient to produce non-linear corrected distance functions if the substitution process is not independent of the insertion/deletion process. Taken together, these results imply inconsistent tree inference under mild conditions. For example, if some positions in a sequence are constrained to be free of substitutions and insertion/deletion events while the remaining sites evolve with independent substitutions and insertion/deletion events, then the distances obtained by treating gaps as missing data can support an incorrect tree topology even given an unlimited amount of data. Copyright © 2015 Elsevier Inc. All rights reserved.
Rodríguez-Herva, J J; Ramos-Gonzalez, M I; Ramos, J L
1996-01-01
Pseudomonas putida 14G-3, a derivative of the natural soil inhabitant P. putida KT2440, exhibited a chromosomal insertion of a mini-Tn5/'phoA transposon that resulted in reduced ability to colonize soil. In vitro characterization of P. putida 14G-3 revealed that it exhibited an altered cell morphology and envelope, as revealed by electron microscopy. The derived strain was sensitive to sodium dodecyl sulfate, deoxycholate, and EDTA, produced clumps when it reached high cell densities in the late logarithmic growth phase, and did not grow on low-osmolarity medium. The P. putida DNA surrounding the mini-Tn5/'phoA insertion was cloned and used as a probe to rescue the wild-type gene, which was sequenced. Comparison of the deduced peptide sequence with sequences in the Swiss-Prot database allowed the knocked-out gene to be identified as that encoding the peptidoglycan-associated lipoprotein (Pal or OprL) of P. putida. The protein was identified in coupled transcription and translation assays in vitro. PMID:8626299
Ancient DNA analysis reveals woolly rhino evolutionary relationships.
Orlando, Ludovic; Leonard, Jennifer A; Thenot, Aurélie; Laudet, Vincent; Guerin, Claude; Hänni, Catherine
2003-09-01
With ancient DNA technology, DNA sequences have been added to the list of characters available to infer the phyletic position of extinct species in evolutionary trees. We have sequenced the entire 12S rRNA and partial cytochrome b (cyt b) genes of one 60-70,000-year-old sample, and partial 12S rRNA and cyt b sequences of two 40-45,000-year-old samples of the extinct woolly rhinoceros (Coelodonta antiquitatis). Based on these two mitochondrial markers, phylogenetic analyses show that C. antiquitatis is most closely related to one of the three extant Asian rhinoceros species, Dicerorhinus sumatrensis. Calculations based on a molecular clock suggest that the lineage leading to C. antiquitatis and D. sumatrensis diverged in the Oligocene, 21-26 MYA. Both results agree with morphological models deduced from palaeontological data. Nuclear inserts of mitochondrial DNA were identified in the ancient specimens. These data should encourage the use of nuclear DNA in future ancient DNA studies. It also further establishes that the degraded nature of ancient DNA does not completely protect ancient DNA studies based on mitochondrial data from the problems associated with nuclear inserts.
CRISPR-based screening of genomic island excision events in bacteria.
Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe
2015-06-30
Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.
García Guerreiro, M P; Fontdevila, A
2007-01-01
A new transposable element, Isis, is identified as a LTR retrotransposon in Drosophila buzzatii. DNA sequence analysis shows that Isis contains three long ORFs similar to gag, pol and env genes of retroviruses. The ORF1 exhibits sequence homology to matrix, capsid and nucleocapsid gag proteins and ORF2 encodes a putative protease (PR), a reverse transcriptase (RT), an Rnase H (RH) and an integrase (IN) region. The analysis of a putative env product, encoded by the env ORF3, shows a degenerated protein containing several stop codons. The molecular study of the putative proteins coded by this new element shows striking similarities to both Ulysses and Osvaldo elements, two LTR retrotransposons, present in D. virilis and D. buzzatii, respectively. Comparisons of the predicted Isis RT to several known retrotransposons show strong phylogenetic relationships to gypsy-like elements, particulary to Ulysses retrotransposon. Studies of Isis chromosomal distribution show a strong hybridization signal in centromeric and pericentromeric regions, and a scattered distribution along all chromosomal arms. The existence of insertional polymorphisms between different strains and high molecular weight bands by Southern blot suggests the existence of full-sized copies that have been active recently. The presence of euchromatic insertion sites coincident between Isis and Osvaldo could indicate preferential insertion sites of Osvaldo element into Isis sequence or vice versa. Moreover, the presence of Isis in different species of the buzzatii complex indicates the ancient origin of this element.
Thermodynamics of membrane insertion and refolding of the diphtheria toxin T-domain
Vargas-Uribe, Mauricio; Rodnin, Mykola V.; Öjemalm, Karin; Holgado, Aurora; Kyrychenko, Alexander; Nilsson, IngMarie; Posokhov, Yevgen O.; Makhatadze, George; von Heijne, Gunnar; Ladokhin, Alexey S.
2014-01-01
The diphtheria toxin translocation (T) domain inserts into the endosomal membrane in response to the endosomal acidification and enables the delivery of the catalytic domain into the cell. The insertion pathway consists of a series of conformational changes that occur in solution and in the membrane and leads to the conversion of a water-soluble state into a transmembrane state. In this work, we utilize various biophysical techniques to characterize the insertion pathway from the thermodynamic perspective. Thermal and chemical unfolding measured by differential scanning calorimetry, circular dichroism and tryptophan fluorescence reveal that the free energy of unfolding of the T-domain at neutral and mildly acidic pH differ by 3–5 kcal/mol, depending on the experimental conditions. Fluorescence correlation spectroscopy measurements show that the free energy change from the membrane-competent state to the interfacial state is approximately −8 kcal/mol and is pH-independent, while that from the membrane-competent state to the transmembrane state ranges between −9.5 to −12 kcal/mol, depending on the membrane lipid composition and pH. Finally, the thermodynamics of transmembrane insertion of individual helices was tested using an in vitro assay that measures the translocon-assisted integration of test sequences into the microsomal membrane. These experiments suggest that even the most hydrophobic helix TH8 has only a small favorable free energy of insertion. The free energy for the insertion of the consensus insertion unit TH8-TH9 is slightly more favorable, yet less favorable than that measured for the entire protein, suggesting a cooperative effect for the membrane insertion of the helices of the T-domain. PMID:25281329
Eickbush, D. G.; Eickbush, T. H.
1995-01-01
R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424
Matsunaga, James; Haake, David A.
2016-01-01
Pathogenic species of Leptospira are the causative agents of leptospirosis, a zoonotic disease that causes mortality and morbidity worldwide. The understanding of the virulence mechanisms of Leptospira spp is still at an early stage due to the limited number of genetic tools available for this microorganism. The development of random transposon mutagenesis in pathogenic strains a decade ago has contributed to the identification of several virulence factors. In this study, we used the transposon sequencing (Tn-Seq) technique, which combines transposon mutagenesis with massive parallel sequencing, to study the in vivo fitness of a pool of Leptospira interrogans mutants. We infected hamsters with a pool of 42 mutants (input pool), which included control mutants with insertions in four genes previously analyzed by virulence testing (loa22, ligB, flaA1, and lic20111) and 23 mutants with disrupted signal transduction genes. We quantified the mutants in different tissues (blood, kidney and liver) at 4 days post-challenge by high-throughput sequencing and compared the frequencies of mutants recovered from tissues to their frequencies in the input pool. Control mutants that were less fit in the Tn-Seq experiment were attenuated for virulence when tested separately in the hamster model of lethal leptospirosis. Control mutants with unaltered fitness were as virulent as the wild-type strain. We identified two mutants with the transposon inserted in the same putative adenylate/guanylate cyclase gene (lic12327) that had reduced in vivo fitness in blood, kidney and liver. Both lic12327 mutants were attenuated for virulence when tested individually in hamsters. Growth of the control mutants and lic12327 mutants in culture medium were similar to that of the wild-type strain. These results demonstrate the feasibility of screening large pools of L. interrogans transposon mutants for those with altered fitness, and potentially attenuated virulence, by transposon sequencing. PMID:27824878
2013-12-01
University) "Effectors of the DNA damage and radiotherapy response in cancer" 9:20 pm - 9:30 pm Discussion TUESDAY 7:30 am - 8:30 am Breakfast 9:00...M. Morris , Hideki Onagi, Timothy M. Altamore, Allan B. Gamble, Christopher J. Easton Prohormone-substrate peptide sequence recognition by
Pestoides F, an atypical Yersinia pestis strain from the former Soviet Union.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia, Emilio; Worsham, Patricia; Bearden, S.
2007-01-01
Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lack of the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout amore » comprehensive genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla(-) strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains reveals differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single approximately 7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less
Pestoides F, and Atypical Yersinia pestis Strain from the Former Soviet Union
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garcia, E; Worsham, P; Bearden, S
2007-01-05
Unlike the classical Yersinia pestis strains, members of an atypical group of Y. pestis from Central Asia, denominated Y. pestis subspecies caucasica (also known as one of several pestoides types), are distinguished by a number of characteristics including their ability to ferment rhamnose and melibiose, their lacking the small plasmid encoding the plasminogen activator (pla) and pesticin, and their exceptionally large variants of the virulence plasmid pMT (encoding murine toxin and capsular antigen). We have obtained the entire genome sequence of Y. pestis Pestoides F, an isolate from the former Soviet Union that has enabled us to carryout a comprehensivemore » genome-wide comparison of this organism's genomic content against the six published sequences of Y. pestis and their Y. pseudotuberculosis ancestor. Based on classical glycerol fermentation (+ve) and nitrate reduction (+ve) Y. pestis Pestoides F is an isolate that belongs to the biovar antiqua. This strain is unusual in other characteristics such as the fact that it carries a non-consensus V antigen (lcrV) sequence, and that unlike other Pla{sup -} strains, Pestoides F retains virulence by the parenteral and aerosol routes. The chromosome of Pestoides F is 4,517,345 bp in size comprising some 3,936 predicted coding sequences, while its pCD and pMT plasmids are 71,507 bp and 137,010 bp in size respectively. Comparison of chromosome-associated genes in Pestoides F with those in the other sequenced Y. pestis strains, reveals a series of differences ranging from strain-specific rearrangements, insertions, deletions, single nucleotide polymorphisms, and a unique distribution of insertion sequences. There is a single {approx}7 kb unique region in the chromosome not found in any of the completed Y. pestis strains sequenced to date, but which is present in the Y. pseudotuberculosis ancestor. Taken together, these findings are consistent with Pestoides F being derived from the most ancient lineage of Y. pestis yet sequenced.« less
Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.
2012-01-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222
Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K
2012-08-01
A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.
Plasmid partition system of the P1par family from the pWR100 virulence plasmid of Shigella flexneri.
Sergueev, Kirill; Dabrazhynetskaya, Alena; Austin, Stuart
2005-05-01
P1par family members promote the active segregation of a variety of plasmids and plasmid prophages in gram-negative bacteria. Each has genes for ParA and ParB proteins, followed by a parS partition site. The large virulence plasmid pWR100 of Shigella flexneri contains a new P1par family member: pWR100par. Although typical parA and parB genes are present, the putative pWR100parS site is atypical in sequence and organization. However, pWR100parS promoted accurate plasmid partition in Escherichia coli when the pWR100 Par proteins were supplied. Unique BoxB hexamer motifs within parS define species specificities among previously described family members. Although substantially different from P1parS from the P1 plasmid prophage of E. coli, pWR100parS has the same BoxB sequence. As predicted, the species specificity of the two types proved identical. They also shared partition-mediated incompatibility, consistent with the proposed mechanistic link between incompatibility and species specificity. Among several informative sequence differences between pWR100parS and P1parS is the presence of a 21-bp insert at the center of the pWR100parS site. Deletion of this insert left much of the parS activity intact. Tolerance of central inserts with integral numbers of helical DNA turns reflects the critical topology of these sites, which are bent by binding the host IHF protein.
Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A.; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S.
2013-01-01
DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease. PMID:23695301
Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S
2013-08-01
DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease.
Zhu, Hongwen; Shang, Dandan; Sun, Miao; Choi, Sunju; Liu, Qing; Hao, Jiajie; Figuera, Luis E.; Zhang, Feng; Choy, Kwong Wai; Ao, Yang; Liu, Yang; Zhang, Xiao-Lin; Yue, Fengzhen; Wang, Ming-Rong; Jin, Li; Patel, Pragna I.; Jing, Tao; Zhang, Xue
2011-01-01
X-linked congenital generalized hypertrichosis (CGH), an extremely rare condition characterized by universal overgrowth of terminal hair, was first mapped to chromosome Xq24-q27.1 in a Mexican family. However, the underlying genetic defect remains unknown. We ascertained a large Chinese family with an X-linked congenital hypertrichosis syndrome combining CGH, scoliosis, and spina bifida and mapped the disease locus to a 5.6 Mb critical region within the interval defined by the previously reported Mexican family. Through the combination of a high-resolution copy-number variation (CNV) scan and targeted genomic sequencing, we identified an interchromosomal insertion at Xq27.1 of a 125,577 bp intragenic fragment of COL23A1 on 5q35.3, with one X breakpoint within and the other very close to a human-specific short palindromic sequence located 82 kb downstream of SOX3. In the Mexican family, we found an interchromosomal insertion at the same Xq27.1 site of a 300,036 bp genomic fragment on 4q31.2, encompassing PRMT10 and TMEM184C and involving parts of ARHGAP10 and EDNRA. Notably, both of the two X breakpoints were within the short palindrome. The two palindrome-mediated insertions fully segregate with the CGH phenotype in each of the families, and the CNV gains of the respective autosomal genomic segments are not present in the public database and were not found in 1274 control individuals. Analysis of control individuals revealed deletions ranging from 173 bp to 9104 bp at the site of the insertions with no phenotypic consequence. Taken together, our results strongly support the pathogenicity of the identified insertions and establish X-linked congenital hypertrichosis syndrome as a genomic disorder. PMID:21636067
Clément, Nathalie; Velu, Thierry; Brandenburger, Annick
2002-09-01
The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.
Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X
1995-01-01
Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153
SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.
Schwartz, Matthew L; Jorgensen, Erik M
2016-04-01
In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.
Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.
Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling
2015-06-19
Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
Integrity of Helix 2-Helix 3 Domain of the PrP Protein Is Not Mandatory for Prion Replication*
Salamat, Khalid; Moudjou, Mohammed; Chapuis, Jérôme; Herzog, Laetitia; Jaumain, Emilie; Béringue, Vincent; Rezaei, Human; Pastore, Annalisa; Laude, Hubert; Dron, Michel
2012-01-01
The process of prion conversion is not yet well understood at the molecular level. The regions critical for the conformational change of PrP remain mostly debated and the extent of sequence change acceptable for prion conversion is poorly documented. To achieve progress on these issues, we applied a reverse genetic approach using the Rov cell system. This allowed us to test the susceptibility of a number of insertion mutants to conversion into prion in the absence of wild-type PrP molecules. We were able to propagate several prions with 8 to 16 extra amino acids, including a polyglycine stretch and His or FLAG tags, inserted in the middle of the protease-resistant fragment. These results demonstrate the possibility to increase the length of the loop between helices H2 and H3 up to 4-fold, without preventing prion replication. They also indicate that this loop probably remains unstructured in PrPSc. We also showed that bona fide prions can be produced following insertion of octapeptides in the two C-terminal turns of H2. These insertions do not interfere with the overall fold of the H2-H3 domain indicating that the highly conserved sequence of the terminal part of H2 is not critical for the conversion. Altogether these data showed that the amplitude of modifications acceptable for prion conversion in the core of the globular domain of PrP is much greater than one might have assumed. These observations should help to refine structural models of PrPSc and elucidate the conformational changes underlying prions generation. PMID:22511770
Integrity of helix 2-helix 3 domain of the PrP protein is not mandatory for prion replication.
Salamat, Khalid; Moudjou, Mohammed; Chapuis, Jérôme; Herzog, Laetitia; Jaumain, Emilie; Béringue, Vincent; Rezaei, Human; Pastore, Annalisa; Laude, Hubert; Dron, Michel
2012-06-01
The process of prion conversion is not yet well understood at the molecular level. The regions critical for the conformational change of PrP remain mostly debated and the extent of sequence change acceptable for prion conversion is poorly documented. To achieve progress on these issues, we applied a reverse genetic approach using the Rov cell system. This allowed us to test the susceptibility of a number of insertion mutants to conversion into prion in the absence of wild-type PrP molecules. We were able to propagate several prions with 8 to 16 extra amino acids, including a polyglycine stretch and His or FLAG tags, inserted in the middle of the protease-resistant fragment. These results demonstrate the possibility to increase the length of the loop between helices H2 and H3 up to 4-fold, without preventing prion replication. They also indicate that this loop probably remains unstructured in PrP(Sc). We also showed that bona fide prions can be produced following insertion of octapeptides in the two C-terminal turns of H2. These insertions do not interfere with the overall fold of the H2-H3 domain indicating that the highly conserved sequence of the terminal part of H2 is not critical for the conversion. Altogether these data showed that the amplitude of modifications acceptable for prion conversion in the core of the globular domain of PrP is much greater than one might have assumed. These observations should help to refine structural models of PrP(Sc) and elucidate the conformational changes underlying prions generation.
Xu, Qifang; Dunbrack, Roland L
2012-11-01
Automating the assignment of existing domain and protein family classifications to new sets of sequences is an important task. Current methods often miss assignments because remote relationships fail to achieve statistical significance. Some assignments are not as long as the actual domain definitions because local alignment methods often cut alignments short. Long insertions in query sequences often erroneously result in two copies of the domain assigned to the query. Divergent repeat sequences in proteins are often missed. We have developed a multilevel procedure to produce nearly complete assignments of protein families of an existing classification system to a large set of sequences. We apply this to the task of assigning Pfam domains to sequences and structures in the Protein Data Bank (PDB). We found that HHsearch alignments frequently scored more remotely related Pfams in Pfam clans higher than closely related Pfams, thus, leading to erroneous assignment at the Pfam family level. A greedy algorithm allowing for partial overlaps was, thus, applied first to sequence/HMM alignments, then HMM-HMM alignments and then structure alignments, taking care to join partial alignments split by large insertions into single-domain assignments. Additional assignment of repeat Pfams with weaker E-values was allowed after stronger assignments of the repeat HMM. Our database of assignments, presented in a database called PDBfam, contains Pfams for 99.4% of chains >50 residues. The Pfam assignment data in PDBfam are available at http://dunbrack2.fccc.edu/ProtCid/PDBfam, which can be searched by PDB codes and Pfam identifiers. They will be updated regularly.
Conrad, Liza J; Brutnell, Thomas P
2005-12-01
We have identified and characterized a novel Activator (Ac) element that is incapable of excision yet contributes to the canonical negative dosage effect of Ac. Cloning and sequence analysis of this immobilized Ac (Ac-im) revealed that it is identical to Ac with the exception of a 10-bp deletion of sequences at the left end of the element. In screens of approximately 6800 seeds, no germinal transpositions of Ac-im were detected. Importantly, Ac-im catalyzes germinal excisions of a Ds element resident at the r1 locus resulting in the recovery of independent transposed Ds insertions in approximately 4.5% of progeny kernels. Many of these transposition events occur during gametophytic development. Furthermore, we demonstrate that Ac-im transactivates multiple Ds insertions in somatic tissues including those in reporter alleles at bronze1, anthocyaninless1, and anthocyaninless2. We propose a model for the generation of Ac-im as an aberrant transposition event that failed to generate an 8-bp target site duplication and resulted in the deletion of Ac end sequences. We also discuss the utility of Ac-im in two-component Ac/Ds gene-tagging programs in maize.
The Essential Genome of Escherichia coli K-12
2018-01-01
ABSTRACT Transposon-directed insertion site sequencing (TraDIS) is a high-throughput method coupling transposon mutagenesis with short-fragment DNA sequencing. It is commonly used to identify essential genes. Single gene deletion libraries are considered the gold standard for identifying essential genes. Currently, the TraDIS method has not been benchmarked against such libraries, and therefore, it remains unclear whether the two methodologies are comparable. To address this, a high-density transposon library was constructed in Escherichia coli K-12. Essential genes predicted from sequencing of this library were compared to existing essential gene databases. To decrease false-positive identification of essential genes, statistical data analysis included corrections for both gene length and genome length. Through this analysis, new essential genes and genes previously incorrectly designated essential were identified. We show that manual analysis of TraDIS data reveals novel features that would not have been detected by statistical analysis alone. Examples include short essential regions within genes, orientation-dependent effects, and fine-resolution identification of genome and protein features. Recognition of these insertion profiles in transposon mutagenesis data sets will assist genome annotation of less well characterized genomes and provides new insights into bacterial physiology and biochemistry. PMID:29463657
Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.
Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V
2015-03-28
Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.
Ciardo, Diana E.; Lucke, Katja; Imhof, Alex; Bloemberg, Guido V.; Böttger, Erik C.
2010-01-01
The implementation of internal transcribed spacer (ITS) sequencing for routine identification of molds in the diagnostic mycology laboratory was analyzed in a 5-year study. All mold isolates (n = 6,900) recovered in our laboratory from 2005 to 2009 were included in this study. According to a defined work flow, which in addition to troublesome phenotypic identification takes clinical relevance into account, 233 isolates were subjected to ITS sequence analysis. Sequencing resulted in successful identification for 78.6% of the analyzed isolates (57.1% at species level, 21.5% at genus level). In comparison, extended in-depth phenotypic characterization of the isolates subjected to sequencing achieved taxonomic assignment for 47.6% of these, with a mere 13.3% at species level. Optimization of DNA extraction further improved the efficacy of molecular identification. This study is the first of its kind to testify to the systematic implementation of sequence-based identification procedures in the routine workup of mold isolates in the diagnostic mycology laboratory. PMID:20573873
Dictyostelium mobile elements: strategies to amplify in a compact genome.
Winckler, T; Dingermann, T; Glöckner, G
2002-12-01
Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.
deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B
2017-01-01
Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.
Edlefsen, Paul T.; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A.; Fiore-Gartland, Andrew J.; Juraska, Michal; Carpp, Lindsay N.; Karuna, Shelly T.; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z.; Gottardo, Raphael; Koup, Richard A.; Bailer, Robert; Mascola, John R.; Graham, Barney S.; Roederer, Mario; O’Connell, Robert J.; Michael, Nelson L.; Robb, Merlin L.; Adams, Elizabeth; D’Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E.; Frahm, Nicole; Tomaras, Georgia D.; McElrath, M. Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E.; Hammer, Scott M.; Kim, Jerome H.; Mullins, James I.; Gilbert, Peter B.
2017-01-01
Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector. PMID:29149197
Bioactive Glass Scaffolds for Dental Pulp and Dentin Tissue Engineering
NASA Astrophysics Data System (ADS)
Shawli, Hassan Talat
Current and historical endodontic "root canal" treatments employ inert obturating materials inserted into the teeth's pulp chambers and root canals, often saving teeth but without adequate function. Furthermore, the occurrence of pulpal necrosis in the immature permanent tooth is considered to be a challenging situation, clinically, in treatment because the thin and often short roots increase the risk of fracture. The ideal treatment would be to promote continued root development. This work demonstrated that endodontically-shaped and durable scaffolds of slowly resorbable fibrous (HT) glass and faster-resorbing small-particle Bioglass can be sintered at 900 degrees C for such placement, and that cell growth of osteoblasts in these scaffolds shows good early results. Retained bioactivity in the sintered specimen was revealed by Multiple Attenuated Internal Reflection Infrared Spectroscopy.
Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.
He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y
2013-09-04
To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.
McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W
2018-04-01
Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.
McCarthy, Alex J.
2018-01-01
ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415
Fine tangled pili expressed by Haemophilus ducreyi are a novel class of pili.
Brentjens, R J; Ketterer, M; Apicella, M A; Spinola, S M
1996-01-01
Haemophilus ducreyi synthesizes fine, tangled pili composed predominantly of a protein whose apparent molecular weight is 24,000 (24K). A hybridoma, 2D8, produced a monoclonal antibody (MAb) that bound to a 24K protein in H. ducreyi strains isolated from diverse geographic locations. A lambda gt11 H. ducreyi library was screened with MAb 2D8. A 3.5-kb chromosomal insert from one reactive plaque was amplified and ligated into the pCRII vector. The recombinant plasmid, designated pHD24, expressed a 24K protein in Escherichia coli INV alpha F that bound MAb 2D8. The coding sequence of the 24K gene was localized by exonuclease III digestion. The insert contained a 570-bp open reading frame, designated ftpA (fine, tangled pili). Translation of ftpA predicted a polypeptide with a molecular weight of 21.1K. The predicted N-terminal amino acid sequence of the polypeptide encoded by ftpA was identical to the N-terminal amino acid sequence of purified pilin and lacked a cleavable signal sequence. Primer extension analysis of ftpA confirmed the lack of a leader peptide. The predicted amino acid sequence lacked homology to known pilin sequences but shared homology with the sequences of E. coli Dps and Treponema pallidum antigen TpF1 or 4D, proteins which associate to form ordered rings. An isogenic pilin mutant, H. ducreyi 35000ftpA::mTn3(Cm), was constructed by shuttle mutagenesis and did not contain pili when examined by electron microscopy. We conclude that H. ducreyi synthesizes fine, tangled pili that are composed of a unique major subunit, which may be exported by a signal sequence independent mechanism. PMID:8550517
Bouchami, Ons; de Lencastre, Herminia; Miragaia, Maria
2016-01-01
Staphylococcus haemolyticus is one of the most common pathogens associated with medical-device related infections, but its molecular epidemiology is poorly explored. In the current study, we aimed to better understand the genetic mechanisms contributing to S. haemolyticus diversity in the hospital environment and their impact on the population structure and clinical relevant phenotypic traits. The analysis of a representative S. haemolyticus collection by multilocus sequence typing (MLST) has identified a single highly prevalent and diverse genetic lineage of nosocomial S. haemolyticus clonal complex (CC) 29 accounting for 91% of the collection of isolates disseminated worldwide. The examination of the sequence changes at MLST loci during clonal diversification showed that recombination had a higher impact than mutation in shaping the S. haemolyticus population. Also, we ascertained that another mechanism contributing significantly to clonal diversification and adaptation was mediated by insertion sequence (IS) elements. We found that all nosocomial S. haemolyticus, belonging to different STs, were rich in IS1272 copies, as determined by Southern hybridization of macrorestriction patterns. In particular, we observed that the chromosome of a S. haemolyticus strain within CC29 was highly unstable during serial growth in vitro which paralleled with IS1272 transposition events and changes in clinically relevant phenotypic traits namely, mannitol fermentation, susceptibility to beta-lactams, biofilm formation and hemolysis. Our results suggest that recombination and IS transposition might be a strategy of adaptation, evolution and pathogenicity of the major S. haemolyticus prevalent lineage in the hospital environment.
Bouchami, Ons; de Lencastre, Herminia; Miragaia, Maria
2016-01-01
Staphylococcus haemolyticus is one of the most common pathogens associated with medical-device related infections, but its molecular epidemiology is poorly explored. In the current study, we aimed to better understand the genetic mechanisms contributing to S. haemolyticus diversity in the hospital environment and their impact on the population structure and clinical relevant phenotypic traits. The analysis of a representative S. haemolyticus collection by multilocus sequence typing (MLST) has identified a single highly prevalent and diverse genetic lineage of nosocomial S. haemolyticus clonal complex (CC) 29 accounting for 91% of the collection of isolates disseminated worldwide. The examination of the sequence changes at MLST loci during clonal diversification showed that recombination had a higher impact than mutation in shaping the S. haemolyticus population. Also, we ascertained that another mechanism contributing significantly to clonal diversification and adaptation was mediated by insertion sequence (IS) elements. We found that all nosocomial S. haemolyticus, belonging to different STs, were rich in IS1272 copies, as determined by Southern hybridization of macrorestriction patterns. In particular, we observed that the chromosome of a S. haemolyticus strain within CC29 was highly unstable during serial growth in vitro which paralleled with IS1272 transposition events and changes in clinically relevant phenotypic traits namely, mannitol fermentation, susceptibility to beta-lactams, biofilm formation and hemolysis. Our results suggest that recombination and IS transposition might be a strategy of adaptation, evolution and pathogenicity of the major S. haemolyticus prevalent lineage in the hospital environment. PMID:27249649
Using Phage Display to Create Recombinant Antibodies.
Dasch, James R; Dasch, Amy L
2017-09-01
A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.
Yang, Xu; You, Xue-Yi; Ji, Min; Nima, Ciren
2013-01-01
The effects of limiting factors such as rainfall intensity, rainfall duration, grass type and vegetation coverage on the stormwater runoff of urban green space was investigated in Tianjin. The prediction equation of stormwater runoff was established by the quantitative theory with the lab experimental data of soil columns. It was validated by three field experiments and the relative errors between predicted and measured stormwater runoff are 1.41, 1.52 and 7.35%, respectively. The results implied that the prediction equation could be used to forecast the stormwater runoff of urban green space. The results of range and variance analysis indicated the sequence order of limiting factors is rainfall intensity > grass type > rainfall duration > vegetation coverage. The least runoff of green land in the present study is the combination of rainfall intensity 60.0 mm/h, duration 60.0 min, grass Festuca arundinacea and vegetation coverage 90.0%. When the intensity and duration of rainfall are 60.0 mm/h and 90.0 min, the predicted volumetric runoff coefficient is 0.23 with Festuca arundinacea of 90.0% vegetation coverage. The present approach indicated that green space is an effective method to reduce stormwater runoff and the conclusions are mainly applicable to Tianjin and the semi-arid areas with main summer precipitation and long-time interval rainfalls.
2014-01-01
Background Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. Results We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation ‘Dj’ corresponding to a DNA sequence but based on the five-letter base set; also, ‘Dj’s are expressed graphically. Insertions and deletions of a series of letters ‘E’ are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by ‘Dj◦B(j→k) = Dk’ (or ‘Rj◦B(j→k) = Rk’). Based on the operations of this group, two types of groups—a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases—are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical “central dogma” via a category theory-like way is presented for future developments. Conclusions Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing “central dogma” for future molecular/genetic biology remains to be explored. PMID:24885369
Genomic stability of adipogenic human adenovirus 36.
Nam, J-H; Na, H-N; Atkinson, R L; Dhurandhar, N V
2014-02-01
Human adenovirus Ad36 increases adiposity in several animal models, including rodents and non-human primates. Importantly, Ad36 is associated with human obesity, which has prompted research to understand its epidemiology and to develop a vaccine to prevent a subgroup of obesity. For this purpose, understanding the genomic stability of Ad36 in vivo and in vitro infections is critical. Here, we examined whether in vitro cell passaging over a 14-year period introduced any genetic variation in Ad36. We sequenced the whole genome of Ad36-which was plaque purified in 1998 from the original strain obtained from American Type Culture Collection, and passaged approximately 12 times over the past 14 years (Ad36-2012). This DNA sequence was compared with a previously published sequence of Ad36 likely obtained from the same source (Ad36-1988). Compared with Ad36-1988, only two nucleotides were altered in Ad36-2012: a T insertion at nucleotide 1862, which may induce early termination of the E1B viral protein, and a T➝C transition at nucleotide 26 136. Virus with the T insertion (designated Ad36-2012-T6) was mixed with wild-type virus lacking the T insertion (designated Ad36-2012-T5) in the viral stock. The transition at nucleotide 26 136 does not change the encoded amino acid (aspartic acid) in the pVIII viral protein. The rate of genetic variation in Ad36 is ∼2.37 × 10(-6) mutations/nucleotide/passage. Of particular importance, there were no mutations in the E4orf1 gene, the critical gene for producing obesity. This very-low-variation rate should reduce concerns about genetic variability when developing Ad36 vaccines or developing assays for detecting Ad36 infection in populations.
Protective Socket For Integrated Circuits
NASA Technical Reports Server (NTRS)
Wilkinson, Chris; Henegar, Greg
1988-01-01
Socket for intergrated circuits (IC's) protects from excessive voltages and currents or from application of voltages and currents in wrong sequence during insertion or removal. Contains built-in switch that opens as IC removed, disconnecting leads from signals and power. Also protects other components on circuit board from transients produced by insertion and removal of IC. Makes unnecessary to turn off power to entire circuit board so other circuits on board continue to function.
Ong, Emily; Ho, Christopher; Miles, Peter
2011-03-01
To compare the efficiency of orthodontic archwire sequences produced by three manufacturers. Prospective, randomized clinical trial with three parallel groups. Private orthodontic practice in Caloundra, QLD, Australia. One hundred and thirty-two consecutive patients were randomized to one of three archwire sequence groups: (i) 3M Unitek, 0·014 inch Nitinol, 0·017 inch × 0·017 inch heat activated Ni-Ti; (ii) GAC international, 0·014 inch Sentalloy, 0·016 × 0·022 inch Bioforce; and (iii) Ormco corporation, 0·014 inch Damon Copper Ni-Ti, 0·014 × 0·025 inch Damon Copper Ni-Ti. All patients received 0·018 × 0·025 inch slot Victory Series™ brackets. Mandibular impressions were taken before the insertion of each archwire. Patients completed discomfort surveys according to a seven-point Likert Scale at 4 h, 24 h, 3 days and 7 days after the insertion of each archwire. Efficiency was measured by time required to reach the working archwire, mandibular anterior alignment and level of discomfort. No significant differences were found in the reduction of irregularity between the archwire sequences at any time-point (T1: P = 0·12; T2: P = 0·06; T3: P = 0·21) or in the time to reach the working archwire (P = 0·28). No significant differences were found in the overall discomfort scores between the archwire sequences (4 h: P = 0·30; 24 h: P = 0·18; 3 days: P = 0·53; 7 days: P = 0·47). When the time-points were analysed individually, the 3M Unitek archwire sequence induced significantly less discomfort than GAC and Ormco archwires 24 h after the insertion of the third archwire (P = 0·02). This could possibly be attributed to the progression in archwire material and archform. The archwire sequences were similar in alignment efficiency and overall discomfort. Progression in archwire dimension and archform may contribute to discomfort levels. This study provides clinical justification for three common archwire sequences in 0·018 × 0·025 inch slot brackets.
Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)
S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson
2006-01-01
We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chain, P; Garcia, E
2003-02-06
The goal of this proposed effort was to assess the difficulty in identifying and characterizing virulence candidate genes in an organism for which very limited data exists. This was accomplished by first addressing the finishing phase of draft-sequenced F. tularensis genomes and conducting comparative analyses to determine the coding potential of each genome; to discover the differences in genome structure and content, and to identify potential genes whose products may be involved in the F. tularensis virulence process. The project was divided into three parts: (1) Genome finishing: This part involves determining the order and orientation of the consensus sequencesmore » of contigs obtained from Phrap assemblies of random draft genomic sequences. This tedious process consists of linking contig ends using information embedded in each sequence file that relates the sequence to the original cloned insert. Since inserts are sequenced from both ends, we can establish a link between these paired-ends in different contigs and thus order and orient contigs. Since these genomes carry numerous copies of insertion sequences, these repeated elements ''confuse'' the Phrap assembly program. It is thus necessary to break these contigs apart at the repeated sequences and individually join the proper flanking regions using paired-end information, or using results of comparisons against a similar genome. Larger repeated elements such as the small subunit ribosomal RNA operon require verification with PCR. Tandem repeats require manual intervention and typically rely on single nucleotide polymorphisms to be resolved. Remaining gaps require PCR reactions and sequencing. Once the genomes have been ''closed'', low quality regions are addressed by resequencing reactions. (2) Genome analysis: The final consensus sequences are processed by combining the results of three gene modelers: Glimmer, Critica and Generation. The final gene models are submitted to a battery of homology searches and domain prediction programs in order to annotate them (e.g. BLAST, Pfam, TIGRfam, COG, KEGG, InterPro, TMhmm, SignalP). The genome structure is also assessed in terms of G+C content, GC bias (GC skew), and locations of repeated regions (e.g. IS elements) and phage-like genes. (3) Comparative genomics: The results of the various genome analyses are compared between the finished (or almost finished) genomes. Here, we have compared the F. tularensis genomes from the extremely lethal strain Schu4 (subsp. tularensis), the vaccine strain LVS (subsp. holartica), and strain UT01-4992 of the less virulent, opportunistic subsp. novicida. Regions present in the highly virulent strain that are absent from the other less virulent strains may provide insight into what factors are required for the high level of virulence.« less
Wachter, Shaun; Raghavan, Rahul; Wachter, Jenny; Minnick, Michael F
2018-04-11
Coxiella burnetii is a Gram-negative gammaproteobacterium and zoonotic agent of Q fever. C. burnetii's genome contains an abundance of pseudogenes and numerous selfish genetic elements. MITEs (miniature inverted-repeat transposable elements) are non-autonomous transposons that occur in all domains of life and are thought to be insertion sequences (ISs) that have lost their transposase function. Like most transposable elements (TEs), MITEs are thought to play an active role in evolution by altering gene function and expression through insertion and deletion activities. However, information regarding bacterial MITEs is limited. We describe two MITE families discovered during research on small non-coding RNAs (sRNAs) of C. burnetii. Two sRNAs, Cbsr3 and Cbsr13, were found to originate from a novel MITE family, termed QMITE1. Another sRNA, CbsR16, was found to originate from a separate and novel MITE family, termed QMITE2. Members of each family occur ~ 50 times within the strains evaluated. QMITE1 is a typical MITE of 300-400 bp with short (2-3 nt) direct repeats (DRs) of variable sequence and is often found overlapping annotated open reading frames (ORFs). Additionally, QMITE1 elements possess sigma-70 promoters and are transcriptionally active at several loci, potentially influencing expression of nearby genes. QMITE2 is smaller (150-190 bps), but has longer (7-11 nt) DRs of variable sequences and is mainly found in the 3' untranslated region of annotated ORFs and intergenic regions. QMITE2 contains a GTAG repetitive extragenic palindrome (REP) that serves as a target for IS1111 TE insertion. Both QMITE1 and QMITE2 display inter-strain linkage and sequence conservation, suggesting that they are adaptive and existed before divergence of C. burnetii strains. We have discovered two novel MITE families of C. burnetii. Our finding that MITEs serve as a source for sRNAs is novel. QMITE2 has a unique structure and occurs in large or small versions with unique DRs that display linkage and sequence conservation between strains, allowing for tracking of genomic rearrangements. QMITE1 and QMITE2 copies are hypothesized to influence expression of neighboring genes involved in DNA repair and virulence through transcriptional interference and ribonuclease processing.
Bentley, Stephen D.; Corton, Craig; Brown, Susan E.; Barron, Andrew; Clark, Louise; Doggett, Jon; Harris, Barbara; Ormond, Doug; Quail, Michael A.; May, Georgiana; Francis, David; Knudson, Dennis; Parkhill, Julian; Ishimaru, Carol A.
2008-01-01
Clavibacter michiganensis subsp. sepedonicus is a plant-pathogenic bacterium and the causative agent of bacterial ring rot, a devastating agricultural disease under strict quarantine control and zero tolerance in the seed potato industry. This organism appears to be largely restricted to an endophytic lifestyle, proliferating within plant tissues and unable to persist in the absence of plant material. Analysis of the genome sequence of C. michiganensis subsp. sepedonicus and comparison with the genome sequences of related plant pathogens revealed a dramatic recent evolutionary history. The genome contains 106 insertion sequence elements, which appear to have been active in extensive rearrangement of the chromosome compared to that of Clavibacter michiganensis subsp. michiganensis. There are 110 pseudogenes with overrepresentation in functions associated with carbohydrate metabolism, transcriptional regulation, and pathogenicity. Genome comparisons also indicated that there is substantial gene content diversity within the species, probably due to differential gene acquisition and loss. These genomic features and evolutionary dating suggest that there was recent adaptation for life in a restricted niche where nutrient diversity and perhaps competition are low, correlated with a reduced ability to exploit previously occupied complex niches outside the plant. Toleration of factors such as multiplication and integration of insertion sequence elements, genome rearrangements, and functional disruption of many genes and operons seems to indicate that there has been general relaxation of selective pressure on a large proportion of the genome. PMID:18192393
Folding and Stabilization of Native-Sequence-Reversed Proteins
Zhang, Yuanzhao; Weber, Jeffrey K; Zhou, Ruhong
2016-01-01
Though the problem of sequence-reversed protein folding is largely unexplored, one might speculate that reversed native protein sequences should be significantly more foldable than purely random heteropolymer sequences. In this article, we investigate how the reverse-sequences of native proteins might fold by examining a series of small proteins of increasing structural complexity (α-helix, β-hairpin, α-helix bundle, and α/β-protein). Employing a tandem protein structure prediction algorithmic and molecular dynamics simulation approach, we find that the ability of reverse sequences to adopt native-like folds is strongly influenced by protein size and the flexibility of the native hydrophobic core. For β-hairpins with reverse-sequences that fail to fold, we employ a simple mutational strategy for guiding stable hairpin formation that involves the insertion of amino acids into the β-turn region. This systematic look at reverse sequence duality sheds new light on the problem of protein sequence-structure mapping and may serve to inspire new protein design and protein structure prediction protocols. PMID:27113844
Folding and Stabilization of Native-Sequence-Reversed Proteins
NASA Astrophysics Data System (ADS)
Zhang, Yuanzhao; Weber, Jeffrey K.; Zhou, Ruhong
2016-04-01
Though the problem of sequence-reversed protein folding is largely unexplored, one might speculate that reversed native protein sequences should be significantly more foldable than purely random heteropolymer sequences. In this article, we investigate how the reverse-sequences of native proteins might fold by examining a series of small proteins of increasing structural complexity (α-helix, β-hairpin, α-helix bundle, and α/β-protein). Employing a tandem protein structure prediction algorithmic and molecular dynamics simulation approach, we find that the ability of reverse sequences to adopt native-like folds is strongly influenced by protein size and the flexibility of the native hydrophobic core. For β-hairpins with reverse-sequences that fail to fold, we employ a simple mutational strategy for guiding stable hairpin formation that involves the insertion of amino acids into the β-turn region. This systematic look at reverse sequence duality sheds new light on the problem of protein sequence-structure mapping and may serve to inspire new protein design and protein structure prediction protocols.
Bui, Huyen T.; Karren, Mary A.; Bhar, Debjani
2012-01-01
To initiate mitochondrial fission, dynamin-related proteins (DRPs) must bind specific adaptors on the outer mitochondrial membrane. The structural features underlying this interaction are poorly understood. Using yeast as a model, we show that the Insert B domain of the Dnm1 guanosine triphosphatase (a DRP) contains a novel motif required for association with the mitochondrial adaptor Mdv1. Mutation of this conserved motif specifically disrupted Dnm1–Mdv1 interactions, blocking Dnm1 recruitment and mitochondrial fission. Suppressor mutations in Mdv1 that restored Dnm1–Mdv1 interactions and fission identified potential protein-binding interfaces on the Mdv1 β-propeller domain. These results define the first known function for Insert B in DRP–adaptor interactions. Based on the variability of Insert B sequences and adaptor proteins, we propose that Insert B domains and mitochondrial adaptors have coevolved to meet the unique requirements for mitochondrial fission of different organisms. PMID:23148233
Gladyshev, Eugene A; Arkhipova, Irina R
2009-12-15
Ribosomal DNA genes in many eukaryotes contain insertions of non-LTR retrotransposable elements belonging to the R2 clade. These elements persist in the host genomes by inserting site-specifically into multicopy target sites, thereby avoiding random disruption of single-copy host genes. Here we describe R9 retrotransposons from the R2 clade in the 28S RNA genes of bdelloid rotifers, small freshwater invertebrate animals best known for their long-term asexuality and for their ability to survive repeated cycles of desiccation and rehydration. While the structural organization of R9 elements is highly similar to that of other members of the R2 clade, they are characterized by two distinct features: site-specific insertion into a previously unreported target sequence within the 28S gene, and an unusually long target site duplication of 126 bp. We discuss the implications of these findings in the context of bdelloid genome organization and the mechanisms of target-primed reverse transcription.
Lahm, H; Hoeflich, A; Andre, S; Sordat, B; Kaltner, H; Wolf, E; Gabius, H J
2000-09-01
The family of Ca2+-independent galactoside-binding lectins with the beta-strand topology of the jelly-roll, referred to as galectins, is known to mediate and modulate a variety of cellular activities. Their functional versatility explains the current interest in monitoring their expression in cancer research, so far primarily focused on galectin-1 and -3. Tandem-repeat-type galectin-9 and its (most probably) allelic variant ecalectin, a potent eosinophil chemoattractant, are known to be human leukocyte products. We show by RT-PCR with primers specific for both that their mRNA is expressed in 17 of 21 human colorectal cancer lines. As also indicated by restriction analysis, in addition to the expected transcript of 571 bp an otherwise identical isoform coding for a 32-amino acid extension of the link peptide was detected. Positive cell lines differentially expressed either one (7 lines) or both transcripts (10 lines). Sequence analysis of RT-PCR products, performed in four cases, allowed to assign the standard transcript to ecalectin in the case of SW480 cells and detected two point mutations in the insert of the link peptide-coding sequence in WiDr and Colo205. Furthermore, this analysis identified the insertion of a single nucleotide into the coding sequence generating a frame-shift mutation, an event which has so far not been reported for any galectin. This alteration encountered in both transcripts of the WiDr line and the isoform transcript of Colo205 cells will most likely truncate the protein part within the second (C-terminal) carbohydrate recognition domain. Our results thus reveal the presence of mRNA for a galectin-9-isoform or a potent eosinophil chemoattractant (ecalectin) or a truncated version thereof with preserved N-terminal carbohydrate recognition domain in established human colon cancer cell lines.
Alu Sb2 subfamily is present in all higher primates but was most succesfully amplified in humans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richer, C.; Zietkiewicz, E.; Labuda, D.
Alu repeats can be classified into subfamilies which amplified in primate genomes at different evolutionary time periods. A young Alu subfamily, Sb2, with a characteristic 7-nucleotide duplication at position 256, has been described in seven human loci. An Sb2 insertion found near the HD gene was unique to two HD families, indicating that Sb2 was still retropositionally active. Here, we have shown that the Sb2 insertion in the CHOL locus was similarly rare, being absent in 120 individuals of Caucasian, Oriental and Black origin. In contrast, Sb2 inserts in five other loci were found fixed (non-polymorphic), based on measurements inmore » the same population sample, but absent from orthologous positions in higher apes. This suggest that Sb2 repeats spread relatively early in the human lineage following divergence from other primates and that these elements may be human-specific. By quantitative PCR, we investigated the presence of Sb2 sequences in different primate DNA, using one PCR primer anchored at the 5{prime} Alu-end and the other complementary to the duplicated Sb2-specific segment. With an Sb2-containing plasmid as a standard, we estimated the number of Sb2 repeats at 1500-1800 copies per human haploid equivalent; corresponding numbers in chimpanzee and gorilla were almost two orders of magnitude lower, while the signal observed in orangutan and gibbon DNAs was consistent with the presence of a single copy. The analysis of 22 human, 11 chimpanzee and 10 gorilla sequences indicates that the Alu Sb2 dispersed independently in these three primate lineages; gorilla consensus differs from the human Sb2 sequence by one position, while all chimpanzee repeats have their linker expanded by up to eight A-residues. Should they be thus considered as separate subfamilies? It is possible that sequence modifications with respect to the human consensus are responsible for poor retroposition of Sb2 in apes.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2011-05-19
...: 900). If you have never attended a Connect Pro meeting before, test your connection at: https://collaboration.fda.gov/common/help/en/support/meeting_test.htm . To get a quick overview of the Connect Pro... technologies are currently extensively used in research and are entering clinical diagnostic use; they are...
Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur
2016-04-01
Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.
L1-Associated Genomic Regions are Deleted in Somatic Cells of the Healthy Human Brain
Erwin, Jennifer A.; Paquola, Apuã C.M.; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy; Ivanio, Francisco; Butcher, Cheyenne R.; Herdy, Joseph R.; Sarkar, Anindita; Lasken, Roger S.; Muotri, Alysson R.; Gage, Fred H.
2016-01-01
The healthy human brain is a mosaic of varied genomes. L1 retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that Somatic L1-Associated Variants (SLAVs) are actually composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs are, in fact, somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition- independent rearrangements within inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2/PSD93, and affect between 44–63% of cells of the cells in the healthy brain. PMID:27618310
Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.
1997-01-01
We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831
Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.
Suyama, Mikita; Lathe, Warren C; Bork, Peer
2005-10-10
We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.
NASA Astrophysics Data System (ADS)
Zhong, Wei; Cao, jiayuan; Xue, Jibin; Ouyang, Jun; Tang, Xiaohong; Yin, Huanling; Liao, Congyun; Long, Kun
2014-02-01
The study of a 300-cm-thick exposed lacustrine sediment section in the Hedong village in Zhaoqing area which is located in sub-tropical west Guangdong Province in South China, demonstrates that the lacustrine sedimentary sequence possibly contains evidence for exploring variation of Asian monsoon climate. Multi-proxy records, including the humification intensity, total organic carbon, and grain size fractions, reveal a general trend towards dry and cold conditions in the late Holocene that this is because of a decrease in solar insolation on an orbital scale. Three intensified Asian summer monsoon (ASM) intervals (˜3300-3000 cal yr BP, ˜2600-1600 cal yr BP, and ˜900-600 cal yr BP), and three weakened ASM intervals (˜4000-3300 cal yr BP, ˜3000-2600 cal yr BP, and ˜1600-900 cal yr BP) are identified. Our humification record (HDcal) shows a good correlation on multi-centennial scale with the tree ring Δ14C record, a proxy of solar activity. A spectral analysis of HDcal reveals four significant cycles, i.e., ˜1250 yr, 300 yr, 110 yr, and 70 yr, and most of these cycles are related to the solar activity. Our findings indicate that solar output and oceanic-atmospheric circulation probably have influenced the late Holocene climate variability in the study region.
Adrian-Kalchhauser, Irene; Svensson, Ola; Kutschera, Verena E; Alm Rosenblad, Magnus; Pippel, Martin; Winkler, Sylke; Schloissnig, Siegfried; Blomberg, Anders; Burkhardt-Holm, Patricia
2017-02-16
Vertebrate mitochondrial genomes are optimized for fast replication and low cost of RNA expression. Accordingly, they are devoid of introns, are transcribed as polycistrons and contain very little intergenic sequences. Usually, vertebrate mitochondrial genomes measure between 16.5 and 17 kilobases (kb). During genome sequencing projects for two novel vertebrate models, the invasive round goby and the sand goby, we found that the sand goby genome is exceptionally small (16.4 kb), while the mitochondrial genome of the round goby is much larger than expected for a vertebrate. It is 19 kb in size and is thus one of the largest fish and even vertebrate mitochondrial genomes known to date. The expansion is attributable to a sequence insertion downstream of the putative transcriptional start site. This insertion carries traces of repeats from the control region, but is mostly novel. To get more information about this phenomenon, we gathered all available mitochondrial genomes of Gobiidae and of nine gobioid species, performed phylogenetic analyses, analysed gene arrangements, and compared gobiid mitochondrial genome sizes, ecological information and other species characteristics with respect to the mitochondrial phylogeny. This allowed us amongst others to identify a unique arrangement of tRNAs among Ponto-Caspian gobies. Our results indicate that the round goby mitochondrial genome may contain novel features. Since mitochondrial genome organisation is tightly linked to energy metabolism, these features may be linked to its invasion success. Also, the unique tRNA arrangement among Ponto-Caspian gobies may be helpful in studying the evolution of this highly adaptive and invasive species group. Finally, we find that the phylogeny of gobiids can be further refined by the use of longer stretches of linked DNA sequence.
DNA transformations of Candida tropicalis with replicating and integrative vectors.
Sanglard, D; Fiechter, A
1992-12-01
The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Golden, Susan S
2008-10-16
The aim of this project was to inactivate each locus of the genome of the cyanobacterium Synechococcus elongatus PCC 7942 and screen resulting mutants for altered circadian phenotypes. The immediate goal was to identify all open reading frames (ORFs) that contribute to circadian timing. An additional result was to create a complete archived set of mutagenesis templates, of great utility for the wider research community, that will allow inactivation of any given locus in the genome of S. elongatus. Clones that carry segments of the S. elongatus genome were saturated with transposon insertions in vitro. We completed saturation mutagenesis ofmore » the chromosome (~2800 ORFs). The positions of insertions were sequenced for 17,767 mutagenized clones. Each individual insertion into the S. elongatus DNA in a cosmid or plasmid is a substrate for mutagenesis of the genome via homologous recombination. Because the complete insertion mutation clone set is 5-7 fold redundant, we produced a streamlined set of clones that contains one insertion mutation per locus in the genome, a unigene set. All clones are archived as Escherichia coli stocks frozen in glycerol in 96-well plates at -85ºC and as replicas of these plates on Whatman CloneSaver cards. Each of the mutagenesis substrates from the unigene set has been recombined into the chromosome of wild-type S. elongatus and these cyanobacterial mutants have been archived at -85ºC as well. S. elongatus insertion mutants defective for than 1400 independent genes have screened in luciferase reporter gene backgrounds to evaluate the effect of each mutation on circadian rhythms of gene expression. For the first 700 genes tested, mutagenesis of 71 different ORFs resulted in circadian phenotypes. The mutagenesis project also created insertion mutations in the endogenous large plasmid of S. elongatus, pANL. The sequence of pANL revealed two potential addiction cassettes that appear to account for selection for plasmid persistence. Genetic experiments confirmed that these regions are present on all sub-sets of the plasmid that can replace wild-type pANL. Analysis of mutants defective in each of the remaining ~1400 genes for defects in circadian rhythms will be completed with support from another agency as part of a larger project on circadian rhythms in this cyanobacterium.« less
Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize.
Lough, Ashley N; Roark, Leah M; Kato, Akio; Ream, Thomas S; Lamb, Jonathan C; Birchler, James A; Newton, Kathleen J
2008-01-01
Mitochondrial DNA (mtDNA) insertions into nuclear chromosomes have been documented in a number of eukaryotes. We used fluorescence in situ hybridization (FISH) to examine the variation of mtDNA insertions in maize. Twenty overlapping cosmids, representing the 570-kb maize mitochondrial genome, were individually labeled and hybridized to root tip metaphase chromosomes from the B73 inbred line. A minimum of 15 mtDNA insertion sites on nine chromosomes were detectable using this method. One site near the centromere on chromosome arm 9L was identified by a majority of the cosmids. To examine variation in nuclear mitochondrial DNA sequences (NUMTs), a mixture of labeled cosmids was applied to chromosome spreads of ten diverse inbred lines: A188, A632, B37, B73, BMS, KYS, Mo17, Oh43, W22, and W23. The number of detectable NUMTs varied dramatically among the lines. None of the tested inbred lines other than B73 showed the strong hybridization signal on 9L, suggesting that there is a recent mtDNA insertion at this site in B73. Different sources of B73 and W23 were examined for NUMT variation within inbred lines. Differences were detectable, suggesting either that mtDNA is being incorporated or lost from the maize nuclear genome continuously. The results indicate that mtDNA insertions represent a major source of nuclear chromosomal variation.
Palzkill, T G; Oliver, S G; Newlon, C S
1986-01-01
Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036
Lee, K L; Albee, K L; Bernasconi, R J; Edmunds, T
1997-01-01
The amino acid sequences of ananain (EC3.4.22.31) and stem bromelain (3.4.22.32), two cysteine proteases from pineapple stem, are similar yet ananain and stem bromelain possess distinct specificities towards synthetic peptide substrates and different reactivities towards the cysteine protease inhibitors E-64 and chicken egg white cystatin. We present here the complete amino acid sequence of ananain and compare it with the reported sequences of pineapple stem bromelain, papain and chymopapain from papaya and actinidin from kiwifruit. Ananain is comprised of 216 residues with a theoretical mass of 23464 Da. This primary structure includes a sequence insert between residues 170 and 174 not present in stem bromelain or papain and a hydrophobic series of amino acids adjacent to His-157. It is possible that these sequence differences contribute to the different substrate and inhibitor specificities exhibited by ananain and stem bromelain. PMID:9355753
Hayashi, J; Nishikawa, K; Hirano, R; Noguchi, T; Yoshimura, F
2000-01-01
Porphyromonas gingivalis, a periodontopathogen, is an oral anaerobic gram-negative bacterium with numerous fimbriae on the cell surface. Fimbriae have been considered to be an important virulence factor in this organism. We analyzed the genomic DNA of transposon-induced, fimbria-deficient mutants derived from ATCC 33277 and found that seven independent mutants had transposon insertions within the same restriction fragment. Cloning and sequencing of the disrupted region from one of the mutants revealed two adjacent open reading frames (ORFs) which seemed to encode a two-component signal transduction system. We also found that six of the mutants had insertions in a gene, fimS, a homologue of the genes encoding sensor kinase, and that the insertion in the remaining one disrupted the gene immediately downstream, fimR, a homologue of the response regulator genes in other bacteria. These findings suggest that this two-component regulatory system is involved in fimbriation of P. gingivalis.
He, Linling; Lin, Xiaohe; de Val, Natalia; Saye-Francisco, Karen L; Mann, Colin J; Augst, Ryan; Morris, Charles D; Azadnia, Parisa; Zhou, Bin; Sok, Devin; Ozorowski, Gabriel; Ward, Andrew B; Burton, Dennis R; Zhu, Jiang
2017-01-01
Germline precursors and intermediates of broadly neutralizing antibodies (bNAbs) are essential to the understanding of humoral response to HIV-1 infection and B-cell lineage vaccine design. Using a native-like gp140 trimer probe, we examined antibody libraries constructed from donor-17, the source of glycan-dependent PGT121-class bNAbs recognizing the N332 supersite on the HIV-1 envelope glycoprotein. To facilitate this analysis, a digital panning method was devised that combines biopanning of phage-displayed antibody libraries, 900 bp long-read next-generation sequencing, and heavy/light (H/L)-paired antibodyomics. In addition to single-chain variable fragments resembling the wild-type bNAbs, digital panning identified variants of PGT124 (a member of the PGT121 class) with a unique insertion in the heavy chain complementarity-determining region 1, as well as intermediates of PGT124 exhibiting notable affinity for the native-like trimer and broad HIV-1 neutralization. In a competition assay, these bNAb intermediates could effectively compete with mouse sera induced by a scaffolded BG505 gp140.681 trimer for the N332 supersite. Our study thus reveals previously unrecognized lineage complexity of the PGT121-class bNAbs and provides an array of library-derived bNAb intermediates for evaluation of immunogens containing the N332 supersite. Digital panning may prove to be a valuable tool in future studies of bNAb diversity and lineage development.
He, Linling; Lin, Xiaohe; de Val, Natalia; Saye-Francisco, Karen L.; Mann, Colin J.; Augst, Ryan; Morris, Charles D.; Azadnia, Parisa; Zhou, Bin; Sok, Devin; Ozorowski, Gabriel; Ward, Andrew B.; Burton, Dennis R.; Zhu, Jiang
2017-01-01
Germline precursors and intermediates of broadly neutralizing antibodies (bNAbs) are essential to the understanding of humoral response to HIV-1 infection and B-cell lineage vaccine design. Using a native-like gp140 trimer probe, we examined antibody libraries constructed from donor-17, the source of glycan-dependent PGT121-class bNAbs recognizing the N332 supersite on the HIV-1 envelope glycoprotein. To facilitate this analysis, a digital panning method was devised that combines biopanning of phage-displayed antibody libraries, 900 bp long-read next-generation sequencing, and heavy/light (H/L)-paired antibodyomics. In addition to single-chain variable fragments resembling the wild-type bNAbs, digital panning identified variants of PGT124 (a member of the PGT121 class) with a unique insertion in the heavy chain complementarity-determining region 1, as well as intermediates of PGT124 exhibiting notable affinity for the native-like trimer and broad HIV-1 neutralization. In a competition assay, these bNAb intermediates could effectively compete with mouse sera induced by a scaffolded BG505 gp140.681 trimer for the N332 supersite. Our study thus reveals previously unrecognized lineage complexity of the PGT121-class bNAbs and provides an array of library-derived bNAb intermediates for evaluation of immunogens containing the N332 supersite. Digital panning may prove to be a valuable tool in future studies of bNAb diversity and lineage development. PMID:28883821
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang, Shihui; Vera, Jessica M.; Grass, Jeff
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Yang, Shihui; Vera, Jessica M.; Grass, Jeff; ...
2018-05-02
Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4more » and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Furthermore, plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.« less
Intronic splicing mutations in PTCH1 cause Gorlin syndrome.
Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G
2014-09-01
Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.
LenVarDB: database of length-variant protein domains.
Mutt, Eshita; Mathew, Oommen K; Sowdhamini, Ramanathan
2014-01-01
Protein domains are functionally and structurally independent modules, which add to the functional variety of proteins. This array of functional diversity has been enabled by evolutionary changes, such as amino acid substitutions or insertions or deletions, occurring in these protein domains. Length variations (indels) can introduce changes at structural, functional and interaction levels. LenVarDB (freely available at http://caps.ncbs.res.in/lenvardb/) traces these length variations, starting from structure-based sequence alignments in our Protein Alignments organized as Structural Superfamilies (PASS2) database, across 731 structural classification of proteins (SCOP)-based protein domain superfamilies connected to 2 730 625 sequence homologues. Alignment of sequence homologues corresponding to a structural domain is available, starting from a structure-based sequence alignment of the superfamily. Orientation of the length-variant (indel) regions in protein domains can be visualized by mapping them on the structure and on the alignment. Knowledge about location of length variations within protein domains and their visual representation will be useful in predicting changes within structurally or functionally relevant sites, which may ultimately regulate protein function. Non-technical summary: Evolutionary changes bring about natural changes to proteins that may be found in many organisms. Such changes could be reflected as amino acid substitutions or insertions-deletions (indels) in protein sequences. LenVarDB is a database that provides an early overview of observed length variations that were set among 731 protein families and after examining >2 million sequences. Indels are followed up to observe if they are close to the active site such that they can affect the activity of proteins. Inclusion of such information can aid the design of bioengineering experiments.
Transposon integration enhances expression of stress response genes.
Feng, Gang; Leem, Young-Eun; Levin, Henry L
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.
Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.
Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G
2008-12-01
With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.
Transposon integration enhances expression of stress response genes
Feng, Gang; Leem, Young-Eun; Levin, Henry L.
2013-01-01
Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, C S; Xie, G; Challacombe, J F
The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B. cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including B anthracis. Comparative analysis of these two genomesmore » with other members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Cliff S.; Xie, Gary; Challacombe, Jean F.
The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B.cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including Banthracis. Comparative analysis of these two genomes with othermore » members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.« less