Molecular Characterization of Extended-Spectrum-β-Lactamase-Producing and Plasmid-Mediated AmpC β-Lactamase-Producing Escherichia coli Isolated from Stray Dogs in South Korea

PubMed Central

Tamang, Migma Dorji; Nam, Hyang-Mi; Jang, Geum-Chan; Kim, Su-Ran; Chae, Myung Hwa; Jung, Suk-Chan; Byun, Jae-Won; Park, Yong Ho

2012-01-01

A total of 47 extended-spectrum-cephalosporin-resistant Escherichia coli strains isolated from stray dogs in 2006 and 2007 in the Republic of Korea were investigated using molecular methods. Extended-spectrum β-lactamase (ESBL) and AmpC β-lactamase phenotypes were identified in 12 and 23 E. coli isolates, respectively. All 12 ESBL-producing isolates carried blaCTX-M genes. The most common CTX-M types were CTX-M-14 (n = 5) and CTX-M-24 (n = 3). Isolates producing CTX-M-3, CTX-M-55, CTX-M-27, and CTX-M-65 were also identified. Twenty-one of 23 AmpC β-lactamase-producing isolates were found to carry blaCMY-2 genes. TEM-1 was associated with CTX-M and CMY-2 β-lactamases in 4 and 15 isolates, respectively. In addition to blaTEM-1, two isolates carried blaDHA-1, and one of them cocarried blaCMY-2. Both CTX-M and CMY-2 genes were located on large (40 to 170 kb) conjugative plasmids that contained the insertion sequence ISEcp1 upstream of the bla genes. Only in the case of CTX-M genes was there an IS903 sequence downstream of the gene. The spread of ESBLs and AmpC β-lactamases occurred via both horizontal gene transfer, accounting for much of the CTX-M gene dissemination, and clonal spread, accounting for CMY-2 gene dissemination. The horizontal dissemination of blaCTX-M and blaCMY-2 genes was mediated by IncF and IncI1-Iγ plasmids, respectively. The clonal spread of blaCMY-2 was driven mainly by E. coli strains of virulent phylogroup D lineage ST648. To our knowledge, this is the first report of blaDHA-1 in E. coli strains isolated from companion animals. This study also represents the first report of CMY-2 β-lactamase-producing E. coli isolates from dogs in the Republic of Korea. PMID:22354297

Genetic Platforms of blaCTX-M in Carbapenemase-Producing Strains of K. pneumoniae Isolated in Chile

PubMed Central

Carrasco-Anabalón, Sergio; Vera-Leiva, Alejandra; Quezada-Aguiluz, Mario; Morales-Rivera, María F.; Lima, Celia A.; Fernández, Jorge; Ulloa, Soledad; Domínguez, Mariana; González-Rocha, Gerardo; Bello-Toledo, Helia

2018-01-01

Objective: To elucidate whether the genetic platforms of blaCTX-M contribute to the phenotypes of multi-drug-resistance (MDR) in the first carbapenemase-producing K. pneumoniae strains isolated in Chile. Method: Twenty-two carbapenemase-producing K. pneumoniae strains isolated from different Chilean patients and hospitals were studied. Their genetic relatedness was assessed by PFGE and MLST. The levels of antibiotic resistance were evaluated by determining the minimum inhibitory concentration of various antimicrobials. In addition, several antibiotic resistance genes of clinical relevance in Chile were investigated. The prevalence, allelic variants, and genetic platforms of blaCTX-M were determined by PCR and sequencing. Results: Out of the 22 strains studied, 20 carry KPC, one carries NDM-1, and one carries OXA-370. The PFGE analysis showed three clades with a genetic relatedness >85%, two formed by four strains and one by eight strains. The other strains are not genetically related, and a total of 17 different pulse types were detected. Ten different STs were identified, the main ones being ST258 (five strains) and ST1161 (seven strains). The isolates presented different percentages of resistance, and 82% were resistant to all the β-lactams tested, 91% to ciprofloxacin, 73% to colistin, 59% to gentamicin, 50% to amikacin, and only 9% to tigecycline. All isolates carried blaTEM and blaSHV, whereas 71% carried aac(6′)Ib-cr, and 57% one qnr gene (A, B, C, D, or S). The blaCTX-M gene was found in 10 of the isolates (4 blaCTX-M−15 and 6 blaCTX-M−2). The characterization of the platform, in seven selected strains, revealed that the gene is associated with unusual class 1 integrons and insertion sequences such as ISCR1, ISECp1, and IS26. Conclusion: In the first carbapenemase-producing K. pneumoniae strains isolated in Chile the genetic platform of blaCTX-M−2 corresponds to an unusual class 1 integron that can be responsible for the MDR phenotype, whereas the genetic platforms of blaCTX-M−15 are associated with different IS and do not contribute to multi-drug resistance. PMID:29593660

Characterization of GM events by insert knowledge adapted re-sequencing approaches

PubMed Central

Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

2013-01-01

Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728

Characterization of GM events by insert knowledge adapted re-sequencing approaches.

PubMed

Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

2013-10-03

Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.

Templated sequence insertion polymorphisms in the human genome

NASA Astrophysics Data System (ADS)

Onozawa, Masahiro; Aplan, Peter

2016-11-01

Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

Molecular characterization of multidrug-resistant extended-spectrum β-lactamase-producing Enterobacteriaceae isolated in Antananarivo, Madagascar

PubMed Central

2013-01-01

Background We investigated the molecular characteristics of multidrug-resistant, extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae isolated in community settings and in hospitals in Antananarivo, Madagascar. Results Forty-nine E. coli, K. pneumoniae, K. oxytoca and E. cloacae ESBL-producing isolates were studied. In antimicrobial susceptibility analyses, many of the isolates exhibited resistance to aminoglycosides, fluoroquinolones and trimethoprim-sulfamethoxazole. Gene amplification analysis and sequencing revealed that 75.5% (n=37) of the isolates harbored blaCTX-M-15 and 38.7% (n=19) harbored blaSHV-12. The non-ESBLs resistance genes detected were blaTEM-1, blaOXA-1, aac(6′)-Ib,aac(6′)-Ib-cr, tetA, sul-1, sul-2, qnrA, qnrB and catB-3. We found dfrA and aadA gene cassettes in the class 1 integron variable regions of the isolates, and the combination of dfrA17-aadA5 to be the most prevalent. All blaCTX-M-15 positive isolates also contained the ISEcp1 insertion element. Conjugation and transformation experiments indicated that 70.3% of the antibiotic resistance genes resided on plasmids. Through a PCR based replicon typing method, plasmids carrying the blaSHV-12 or blaCTX-M-15 genes were assigned to either the IncFII replicon type or, rarely, to the HI2 replicon type. All isolates were subtyped by the rep-PCR and ERIC-PCR methods. Phylogenetic grouping and virulence genotyping of the E. coli isolates revealed that most of them belonged to group A1. One isolate assigned to group B2 harbored blaCTX-M-15 and five virulence genes (traT, fyuA, iutA, iha and sfa) and was related to the O25b-ST131 clone. Conclusions Our results highlight the dissemination of multidrug resistant Enterobacteriaceae isolates in Antananarivo. These findings underline the need for a rational use of antibiotic and for appropriate methods of screening ESBL in routine laboratories in Antananarivo. PMID:23594374

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Regional Spread of CTX-M-2-Producing Proteus mirabilis with the Identical Genetic Structure in Japan.

PubMed

Kato, Karin; Matsumura, Yasufumi; Yamamoto, Masaki; Nagao, Miki; Takakura, Shunji; Ichiyama, Satoshi

2017-07-01

In this study, we analyzed the molecular epidemiology of extended-spectrum β-lactamase (ESBL)-producing Proteus mirabilis isolates collected from the central region of Japan. Between 2005 and 2012, 820 clinical P. mirabilis isolates were obtained from ten acute care hospitals in Japan. We characterized ESBL confirmatory test-positive isolates by sequencing the ESBL genes and their flanking regions, detecting plasmid replicons, and performing pulsed-field gel electrophoresis (PFGE). Ninety-six isolates (12%) were positive according to the ESBL confirmatory test; all these isolates possessed bla CTX-M-2 with the same flanking structure of upstream ΔISEcp1 and a downstream region identical to downstream bla KLUA-1 . IncT was the prevalent, and only, replicon found in 63 isolates. PFGE analysis detected eight clusters with more than one isolate, among which three included 56 isolates and six included isolates from multiple hospitals. CTX-M-2-producing P. mirabilis with an identical genetic structure flanking bla CTX-M-2 is dominant in this Japanese region, and there is evidence for the clonal spread of isolates.

“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

PubMed Central

Hansen, Geneviève; Chilton, Mary-Dell

1996-01-01

We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

Prevalence and characterization of extended-spectrum-β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat vegetables.

PubMed

Kim, Hong-Seok; Chon, Jung-Whan; Kim, Young-Ji; Kim, Dong-Hyeon; Kim, Mu-sang; Seo, Kun-Ho

2015-08-17

The objective of this investigation was to determine the prevalence and characteristics of extended-spectrum-β-lactamase (ESBL)-producing Escherichia coli and Klebsiella pneumoniae in ready-to-eat (RTE) vegetables. A total of 189 RTE vegetable samples (91 sprouts and 98 mixed salads) were collected in a retail market in South Korea from October 2012 to February 2013. The prevalence of ESBL-producing E. coli and K. pneumoniae was 10.1%. Of these, 94.7% were from the sprout samples. All isolates were resistant to cefotaxime, and many of the ESBL producers were also resistant to non-β-lactam antibiotics, including gentamicin, trimethoprim/sulfamethoxazole, and ciprofloxacin (73.7%, 63.2%, and 26.3% respectively). TEM-1, SHV-1, -2, -11, -12, -27, -28 and -61, and CTX-M-14, -15 and -55 β-lactamases were detected alone or in combination. The genetic platforms of all CTX-M producing isolates were ISEcp1-blaCTX-M-orf477 and ISEcp1-blaCTX-M-IS903 in CTX-M groups 1 and 9, respectively. To our knowledge, this is the first report of the prevalence and characterization of ESBL-producing E. coli and K. pneumoniae isolated from RTE vegetables. The results of this study indicate that RTE vegetables, sprouts, in particular, may play a role in spreading antimicrobial resistant bacteria and ESBL genes to humans. Copyright © 2015 Elsevier B.V. All rights reserved.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

PubMed

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

2010-12-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

PubMed Central

Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

2010-01-01

P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

PubMed

Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

2016-05-01

Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

PubMed

Otsuka, Sachio; Saiki, Jun

2016-02-01

Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

PubMed

Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

2018-02-27

Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

PubMed Central

Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

2013-01-01

High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

[Isolation and function of genes regulating aphB expression in Vibrio cholerae].

PubMed

Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

2012-02-04

We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

PubMed

Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

2014-01-01

Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

PubMed

Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

2016-01-01

Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

PubMed

Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

2007-07-01

A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

PubMed

Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

2001-08-01

Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

PubMed Central

Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

1994-01-01

A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

The Sudden Dominance of bla CTX–M Harbouring Plasmids in Shigella spp. Circulating in Southern Vietnam

PubMed Central

Nhu, Nguyen Thi Khanh; Vinh, Ha; Nga, Tran Vu Thieu; Stabler, Richard; Duy, Pham Thanh; Thi Minh Vien, Le; van Doorn, H. Rogier; Cerdeño-Tárraga, Ana; Thomson, Nicholas; Campbell, James; Van Minh Hoang, Nguyen; Thi Thu Nga, Tran; Minh, Pham Van; Thuy, Cao Thu; Wren, Brendan; Farrar, Jeremy; Baker, Stephen

2010-01-01

Background Plasmid mediated antimicrobial resistance in the Enterobacteriaceae is a global problem. The rise of CTX-M class extended spectrum beta lactamases (ESBLs) has been well documented in industrialized countries. Vietnam is representative of a typical transitional middle income country where the spectrum of infectious diseases combined with the spread of drug resistance is shifting and bringing new healthcare challenges. Methodology We collected hospital admission data from the pediatric population attending the hospital for tropical diseases in Ho Chi Minh City with Shigella infections. Organisms were cultured from all enrolled patients and subjected to antimicrobial susceptibility testing. Those that were ESBL positive were subjected to further investigation. These investigations included PCR amplification for common ESBL genes, plasmid investigation, conjugation, microarray hybridization and DNA sequencing of a bla CTX–M encoding plasmid. Principal Findings We show that two different bla CTX-M genes are circulating in this bacterial population in this location. Sequence of one of the ESBL plasmids shows that rather than the gene being integrated into a preexisting MDR plasmid, the bla CTX-M gene is located on relatively simple conjugative plasmid. The sequenced plasmid (pEG356) carried the bla CTX-M-24 gene on an ISEcp1 element and demonstrated considerable sequence homology with other IncFI plasmids. Significance The rapid dissemination, spread of antimicrobial resistance and changing population of Shigella spp. concurrent with economic growth are pertinent to many other countries undergoing similar development. Third generation cephalosporins are commonly used empiric antibiotics in Ho Chi Minh City. We recommend that these agents should not be considered for therapy of dysentery in this setting. PMID:20544028

Extended-spectrum β-lactamases and plasmid-mediated quinolone resistance in enterobacterial clinical isolates from neonates in Tunisia.

PubMed

Charfi, Karama; Grami, Raoudha; Ben Jeddou, Abir; Messaoudi, Aziza; Mani, Yosra; Bouallegue, Olfa; Boujaafar, Noureddine; Aouni, Mahjoub; Mammeri, Hedi; Mansour, Wejdène

2017-09-01

This study was conducted to investigate extended-spectrum-β-lactamase (ESBL) producing Enterobacteriaceae isolates from the Center of Maternity and Neonatology of Monastir, Tunisia. Fourty-six strains out of 283 were found to produce ESBL: Klebsiella pneumoniae (n = 37), Escherichia coli (n = 6), Enterobacter cloacae (n = 2), and Citrobacter freundi (n = 1). Genotyping analysis, using ERIC2 and RAPD, showed that strains were clonally unrelated. PCR amplification followed by sequencing revealed that all strains produced CTX-M-15. This enzyme was co-produced with TEM and SHV determinants in 34 and 36 strains respectively. The bla CTXM-15 gene was bracked by ISEcp1 and/or IS26 in 42 out of the 46 ESBL positive strains. The quinolone resistance determinants were associated to the ESBL producing isolates: we identified the qnrB1 gene in six isolates and the aac(6')-Ib-cr gene in five isolates. This epidemiological study shows the widespread of CTX-M-15 and qnr determinants among enterobacterial isolates from neonates hospitalized at the center of Maternity and Neonatology of Monastir suggesting either mother portage or horizontal transmission. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

PubMed Central

Ma, Zhengqiang

2013-01-01

Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system.

PubMed

Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I

2018-05-01

Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

USDA-ARS?s Scientific Manuscript database

Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

PubMed

Hamilton, P T; Reeve, J N

1985-01-01

DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

NASA Astrophysics Data System (ADS)

Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

2017-05-01

MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

PubMed

Rodić, Nemanja; Burns, Kathleen H

2013-03-01

LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

MRKAd5 HIV-1 Gag/Pol/Nef Vaccine-Induced T-Cell Responses Inadequately Predict Distance of Breakthrough HIV-1 Sequences to the Vaccine or Viral Load

PubMed Central

Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter

2012-01-01

Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672

Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae

PubMed Central

Muñoz, Rosario; López, Rubens; García, Ernesto

1998-01-01

We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131

Diagnostic use of computational retrotransposon detection: Successful definition of pathogenetic mechanism in a ciliopathy phenotype.

PubMed

Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro

2017-05-01

Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.

Whole Genome Sequencing Identifies a 78 kb Insertion from Chromosome 8 as the Cause of Charcot-Marie-Tooth Neuropathy CMTX3

PubMed Central

Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.

2016-01-01

With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001

Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

PubMed

Amirhaeri, S; Wohlrab, F; Wells, R D

1995-02-17

The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

PubMed

Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

2016-01-01

Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system

NASA Astrophysics Data System (ADS)

Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.

2018-05-01

Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

PubMed Central

Xiong, Y; Eickbush, T H

1988-01-01

Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

Extended-spectrum-β-lactamase-producing Escherichia coli as a cause of pediatric infections: report of a neonatal intensive care unit outbreak due to a CTX-M-14-producing strain.

PubMed

Oteo, Jesús; Cercenado, Emilia; Fernández-Romero, Sara; Saéz, David; Padilla, Belén; Zamora, Elena; Cuevas, Oscar; Bautista, Verónica; Campos, José

2012-01-01

Little information is available about pediatric infections caused by extended-spectrum-β-lactamase (ESBL)-producing Escherichia coli. We characterized an outbreak caused by a CTX-M-14-producing E. coli isolate in a neonatal intensive care unit (NICU) and studied other infections caused by ESBL-producing E. coli in non-NICU pediatric units. All children ≤4 years old who were infected or colonized by ESBL-producing E. coli isolates between January 2009 and September 2010 were included. Molecular epidemiology was studied by phylogroup analysis, pulsed-field gel electrophoresis (PFGE), and multilocus sequence typing. Antibiotic resistance genes were analyzed by PCR and sequencing. Plasmids were studied by PFGE with S1 nuclease digestion and by incompatibility group analysis using a PCR-based replicon-typing scheme. Of the ESBL-producing E. coli isolates colonizing or infecting the 30 newborns, identical PFGE results were observed for 21 (70%) isolates, which were classified as CTX-M-14-producing E. coli of ST23 phylogroup A. bla(CTX-M-14a) was linked to ISEcp1 and was carried on an ∼80-bp IncK plasmid. A smaller ongoing outbreak due to SHV-12-producing ST131 E. coli was also identified in the same NICU. Fifteen additional infections with ESBL-producing E. coli were identified in non-NICU pediatric units, but none was caused by the CTX-M-14-producing E. coli epidemic clone. Overall, CTX-M-14 (71.1%), CTX-M-15 (13.3%), and SHV-12 (13.3%) were the most important ESBLs causing pediatric infections in this study. Infections of newborns with CTX-M-14-producing E. coli were caused by both clonal and nonclonal isolates.

In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

PubMed Central

Zillmann, M; Limauro, S E; Goodchild, J

1997-01-01

By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

PubMed

Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

2018-04-01

While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of extended-spectrum β-lactamase (ESBL)-producing Klebsiella, Enterobacter, and Citrobacter obtained in environmental samples of a Tunisian hospital.

PubMed

Dziri, Raoudha; Klibi, Naouel; Alonso, Carla Andrea; Said, Leila Ben; Bellaaj, Ridha; Slama, Karim Ben; Boudabous, Abdellatif; Torres, Carmen

2016-10-01

The assessment of the hospital environment as a reservoir of ESBL-producing Enterobacteriaceae in Tunisian hospitals is scarcely analyzed, except for Escherichia coli. The aim of this study was to evaluate the presence of ESBL-producing non-E. coli Enterobacteriaceae (ESBL-EbNoEc) in 300 samples of abiotic surfaces and the hands of patients and staff of a Tunisian Hospital, and to characterize the ESBL genes of the recovered isolates. ESBL-EbNoEc were recovered in 28 of 300 (9.3%) analyzed samples and were identified as Klebsiella pneumoniae (n= 11), Enterobacter cloacae (n=11), Citrobacter freundii (n=4) and Klebsiella oxytoca (n=2). The bla genes identified by PCR and sequencing among the strains were as follows: 11 K.pneumoniae strains [blaCTX-M-15+ blaTEM-1+ blaSHV-11 (n=6); blaCTX-M-15+ blaTEM-1+ blaSHV-28 (n=3); blaCTX-M-15+ blaTEM-1+ blaSHV-1 (n=2)], 11 E. cloacae strains [blaCTX-M-15 (n=6); blaCTX-M-15+ blaTEM-1b (n=2); blaCTX-M-15+ blaTEM-1b+ blaOXA-1 (n=1);blaCTX-M-15+ blaOXA-1 (n=1);blaSHV-12 (n=1)], 4 C. freundii strains [blaCTX-M-15] and 2 K. oxytoca strains [blaCTX-M-15 (n=1); blaSHV-12 (n=1)]. The ISEcp1 and orf477 sequences were identified upstream and downstream of the blaCTX-M-15 gene, respectively, in 3 K. pneumoniae and 3 E. cloacae isolates. The PFGE analysis demonstrated three unrelated pulsotypes in K. pneumoniae strains and five pulsotypes in E. cloacae. The uncontrolled dissemination of ESBL-producing bacteria, even in the hospital environment, has become a real problem and new strategies and hygienic rules are needed to stop this bacterial dissemination. Copyright © 2016 Elsevier Inc. All rights reserved.

High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model–based analyses of transposon-insertion sequencing data

PubMed Central

Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.

2013-01-01

The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011

Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

PubMed Central

Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

2006-01-01

Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

EPA Science Inventory

Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

PubMed Central

Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

2014-01-01

Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

PubMed

Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

2000-11-01

Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.

PubMed

Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio

2017-08-31

In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.

Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

PubMed

Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

2014-05-27

We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

PubMed

Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

1994-01-01

By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

Heteroleptic tin(II) initiators for the ring-opening (co)polymerization of lactide and trimethylene carbonate: mechanistic insights from experiments and computations.

PubMed

Wang, Lingfang; Kefalidis, Christos E; Sinbandhit, Sourisak; Dorcet, Vincent; Carpentier, Jean-François; Maron, Laurent; Sarazin, Yann

2013-09-27

The tin(II) complexes {LO(x)}Sn(X) ({LO(x)}(-) =aminophenolate ancillary) containing amido (1-4), chloro (5), or lactyl (6) coligands (X) promote the ring-opening polymerization (ROP) of cyclic esters. Complex 6, which models the first insertion of L-lactide, initiates the living ROP of L-LA on its own, but the amido derivatives 1-4 require the addition of alcohol to do so. Upon addition of one to ten equivalents of iPrOH, precatalysts 1-4 promote the ROP of trimethylene carbonate (TMC); yet, hardly any activity is observed if tert-butyl (R)-lactate is used instead of iPrOH. Strong inhibition of the reactivity of TMC is also detected for the simultaneous copolymerization of L-LA and TMC, or for the block copolymerization of TMC after that of L-LA. Experimental and computational data for the {LO(x)}Sn(OR)complexes (OR=lactyl or lactidyl) replicating the active species during the tin(II)-mediated ROP of L-LA demonstrate that the formation of a five-membered chelate is largely favored over that of an eight-membered one, and that it constitutes the resting state of the catalyst during this (co)polymerization. Comprehensive DFT calculations show that, out of the four possible monomer insertion sequences during simultaneous copolymerization of L-LA and TMC: 1) TMC then TMC, 2) TMC then L-LA, 3) L-LA then L-LA, and 4) L-LA then TMC, the first three are possible. By contrast, insertion of L-LA followed by that of TMC (i.e., insertion sequence 4) is endothermic by +1.1 kcal mol(-1), which compares unfavorably with consecutive insertions of two L-LA units (i.e., insertion sequence 3) (-10.2 kcal mol(-1)). The copolymerization of L-LA and TMC thus proceeds under thermodynamic control. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

PubMed

Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

2016-12-07

Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

Prediction of the translocon-mediated membrane insertion free energies of protein sequences.

PubMed

Park, Yungki; Helms, Volkhard

2008-05-15

Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins

The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

PubMed Central

Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

1984-01-01

We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

PubMed

Hsing, Michael; Cherkasov, Artem

2008-06-25

Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

First report of extended-spectrum β-lactamases among clinical isolates of Escherichia coli in Gaza Strip, Palestine.

PubMed

Tayh, Ghassan; Ben Sallem, Rym; Ben Yahia, Houssem; Gharsa, Haythem; Klibi, Naouel; Boudabous, Abdellatif; Ben Slama, Karim

2016-09-01

This study aimed to assess the occurrence of extended-spectrum β-lactamases (ESBLs) in clinical Escherichia coli isolates from Palestine and to characterise their type, genetic environments and associated resistance genes. Twenty-seven broad-spectrum-cephalosporin-resistant E. coli isolates were recovered between April and June 2013 in Gaza Strip hospitals. Characterisation of ESBL genes and their genetic environments, detection of associated resistance genes, and the presence and characterisation of integrons were performed by PCR and sequencing. The clonal relationship among ESBL-positive E. coli strains was determined by pulsed-field gel electrophoresis (PFGE) using the restriction enzyme XbaI. Phylogroup typing and virulence factors were studied by PCR. The following ESBL genes were identified: blaCTX-M-15 (21 isolates); blaCTX-M-14a (2 isolates); blaCTX-M-1 (2 isolates); blaCTX-M-3 (1 isolate); and blaCTX-M-27 (1 isolate). The blaTEM-1 gene was also detected in eight CTX-M-producing strains. The ISEcp1 sequence was found upstream of blaCTX-M in 23 isolates, and orf477 was found downstream of this gene in 24 isolates. IS903 was also detected downstream in three isolates. Six isolates carried class 1 integrons with the gene cassette arrangement dfrA17-aadA5. High clonal diversity was observed among the studied isolates by PFGE (24 unrelated profiles). The virulence gene fimA was detected in 23 isolates, the aer gene in 8 isolates and the papC gene in 7 isolates. The studied isolates belonged to phylogroups B2 (12 isolates), D (12 isolates) and A (3 isolates). This is the first report of the detection of CTX-M class β-lactamases in E. coli of clinical origin in Gaza Strip hospitals. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence

PubMed Central

Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.

2014-01-01

Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068

The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

PubMed

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

PubMed Central

Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

2012-01-01

Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

PubMed Central

Chatre, Laurent; Ricchetti, Miria

2011-01-01

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

PubMed

Chatre, Laurent; Ricchetti, Miria

2011-03-08

The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

PubMed

Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

2015-12-01

Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

PubMed

Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

2017-02-01

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

Genetic variability in Melipona quinquefasciata (Hymenoptera, Apidae, Meliponini) from northeastern Brazil determined using the first internal transcribed spacer (ITS1).

PubMed

Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B

2009-01-01

Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.

Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

PubMed

Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

2011-01-21

DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.

PubMed

Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique

2012-12-01

A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.

Human MLH1 suppresses the insertion of telomeric sequences at intra-chromosomal sites in telomerase-expressing cells

PubMed Central

Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao

2017-01-01

Abstract Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability. PMID:28180301

Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

PubMed

Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

2017-03-01

Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

PubMed Central

Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

2015-01-01

PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

MR Performance Comparison of a PET/MR System Before and After SiPM-Based Time-of-Flight PET Detector Insertion

NASA Astrophysics Data System (ADS)

Khalighi, Mohammad Mehdi; Delso, Gaspar; Maramraju, Sri Harsha; Deller, Timothy W.; Levin, Craig S.; Glover, Gary H.

2016-10-01

A silicon photomultiplier (SiPM)-based time-of-flight capable PET detector has been integrated with a 70 cm wide-bore 3T MR scanner for simultaneous whole-body imaging (MR750w, GE Healthcare, Waukesha, WI). After insertion of the PET detector, the final PET/MR bore is 60 cm wide (SIGNA PET/MR, GE Healthcare, Waukesha, WI). The MR performance was compared before and after the PET ring insertion. B0 homogeneity, B1+ uniformity of the body coil along with peak B1+, coherent noise, and FBIRN (Function Biomedical Informatics Research Network) tests are used to compare the MR performance. It is shown that B0 homogeneity and coherent noise have not changed according to the system specifications. Peak B1+ is increased by 33% and B1+ inhomogeneity is increased by 4% after PET ring insertion due to a smaller diameter body coil design. The FBIRN test shows similar temporal stability before and after PET ring insertion. Due to a smaller body coil on the PET/MR system, the signal fluctuation to noise ratio (SFNR) and SNR for body receive coil, are improved by 40% and 160% for Echo Planar Imaging (EPI) and spiral sequences respectively. Comparison using RF- and gradient-intensive clinical sequences shows inserting the PET detectors into the wide-bore MRI has not compromised the MR image quality according to these tests.

Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

PubMed Central

Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

2015-01-01

To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

Novel insertion sequence- and transposon-mediated genetic rearrangements in genomic island SGI1 of Salmonella enterica serovar Kentucky.

PubMed

Doublet, Benoît; Praud, Karine; Bertrand, Sophie; Collard, Jean-Marc; Weill, François-Xavier; Cloeckaert, Axel

2008-10-01

Salmonella genomic island 1 (SGI1) is an integrative mobilizable element that harbors a multidrug resistance (MDR) gene cluster. Since its identification in epidemic Salmonella enterica serovar Typhimurium DT104 strains, variant SGI1 MDR gene clusters conferring different MDR phenotypes have been identified in several S. enterica serovars and classified as SGI1-A to -O. A study was undertaken to characterize SGI1 from serovar Kentucky strains isolated from travelers returning from Africa. Several strains tested were found to contain the partially characterized variant SGI1-K, recently described in a serovar Kentucky strain isolated in Australia. This variant contained only one cassette array, aac(3)-Id-aadA7, and an adjacent mercury resistance module. Here, the uncharacterized part of SGI1-K was sequenced. Downstream of the mer module similar to that found in Tn21, a mosaic genetic structure was found, comprising (i) part of Tn1721 containing the tetracycline resistance genes tetR and tet(A); (ii) part of Tn5393 containing the streptomycin resistance genes strAB, IS1133, and a truncated tnpR gene; and (iii) a Tn3-like region containing the tnpR gene and the beta-lactamase bla(TEM-1) gene flanked by two IS26 elements in opposite orientations. The rightmost IS26 element was shown to be inserted into the S044 open reading frame of the SGI1 backbone. This variant MDR region was named SGI1-K1 according to the previously described variant SGI1-K. Other SGI1-K MDR regions due to different IS26 locations, inversion, and partial deletions were characterized and named SGI1-K2 to -K5. Two new SGI1 variants named SGI1-P1 and -P2 contained only the Tn3-like region comprising the beta-lactamase bla(TEM-1) gene flanked by the two IS26 elements inserted into the SGI1 backbone. Three other new variants harbored only one IS26 element inserted in place of the MDR region of SGI1 and were named SGI1-Q1 to -Q3. Thus, in serovar Kentucky, the SGI1 MDR region undergoes recombinational and insertional events of transposon and insertion sequences, resulting in a higher diversity of MDR gene clusters than previously reported and consequently a higher diversity of MDR phenotypes.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Genomic deletions created upon LINE-1 retrotransposition.

PubMed

Gilbert, Nicolas; Lutz-Prigge, Sheila; Moran, John V

2002-08-09

LINE-1 (L1) retrotransposition continues to impact the human genome, yet little is known about how L1 integrates into DNA. Here, we developed a plasmid-based rescue system and have used it to recover 37 new L1 retrotransposition events from cultured human cells. Sequencing of the insertions revealed the usual L1 structural hallmarks; however, in four instances, retrotransposition generated large target site deletions. Remarkably, three of those resulted in the formation of chimeric L1s, containing the 5' end of an endogenous L1 fused precisely to our engineered L1. Thus, our data demonstrate multiple pathways for L1 integration in cultured cells, and show that L1 is not simply an insertional mutagen, but that its retrotransposition can result in significant deletions of genomic sequence.

Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

2017-01-01

SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

PubMed

Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2013-05-01

In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120.

PubMed

deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B

2017-01-01

Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.

Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120

PubMed Central

Edlefsen, Paul T.; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A.; Fiore-Gartland, Andrew J.; Juraska, Michal; Carpp, Lindsay N.; Karuna, Shelly T.; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z.; Gottardo, Raphael; Koup, Richard A.; Bailer, Robert; Mascola, John R.; Graham, Barney S.; Roederer, Mario; O’Connell, Robert J.; Michael, Nelson L.; Robb, Merlin L.; Adams, Elizabeth; D’Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E.; Frahm, Nicole; Tomaras, Georgia D.; McElrath, M. Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E.; Hammer, Scott M.; Kim, Jerome H.; Mullins, James I.; Gilbert, Peter B.

2017-01-01

Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector. PMID:29149197

Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

PubMed Central

Li, Bin; Pacey, Marissa P.

2017-01-01

We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

PubMed Central

Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

PubMed

Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

2011-01-01

Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

A Forward Genetic Screening for Prostate Cancer Progression Genes

DTIC Science & Technology

2012-10-01

sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

Genetic characterization of the mechanisms of resistance to amoxicillin/clavulanate and third-generation cephalosporins in Salmonella enterica from three Spanish hospitals.

PubMed

de Toro, María; Sáenz, Yolanda; Cercenado, Emilia; Rojo-Bezares, Beatriz; García-Campello, Marta; Undabeitia, Esther; Torres, Carmen

2011-09-01

The mechanisms of antimicrobial resistance were characterized in 90 Salmonella enterica isolates either resistant or with intermediate resistance to amoxicillin/clavulanate (AMC(R/I)) or resistant to third-generation cephalosporins (C3G(R)). These isolates were recovered in three Spanish hospitals during 2007-2009. The C3G(R) phenotype was expressed by three isolates that carried the following extended-spectrum β-lactamase genes: phage-associated bla(CTX M-10) in S. Virchow, bla(CTX-M-14a) surrounded by ISEcp1 and IS903 in S. Enteritidis, and bla(CTX-M-15) linked to ISEcp1 and orf477 in S. Gnesta (first description in this serotype). The AMC(R/I) phenotype was found in 87 isolates (79 S. Typhimurim, 7 S. Enteritidis, and one S. Thompson). The bla(PSE-1) gene, followed by bla(OXA-1) was mostly found among S. Typhimurim, and the bla(TEM-1) gene among S. Enteritidis. Three different gene combinations [bla(PSE-1) +floR+aadA2+sul+tet(G); bla(OXA-1) +catA+aadA1/strA-strB+sul+tet(B) and bla(TEM-1) + cmlA1+aadA/strA-strB+sul+tet(A)/tet(B) genes] were associated with the ampicillin-chloramphenicol-streptomycin-sulfonamides-tetracycline phenotype in 68 AMC(R/I) S. enterica isolates. Class 1 integrons were observed in 79% of the isolates and in most of them (45 isolates) two integrons including the aadA2 and bla(PSE-1) gene cassettes, respectively, were detected. The bla(OXA-1) +aadA1 arrangement was detected in 23 isolates, and the aac(6')-Ib-cr+bla(OXA-1) +catB3+arr3 in another one. Non-classic class 1 integrons were found in three isolates: dfrA12+orfF+aadA2+cmlA1+aadA1 (1 isolate), dfrA12+orfF+aadA2+ cmlA1+aadA1+qacH+IS440+sul3 (1 isolate) and dfrA12+orfF+aadA2+cmlA1+aadA1+qacH+IS440+ sul3+orf1+mef(B)Δ-IS26 (1 isolate). Taken together, these results underline the need for clinical concern regarding β-lactam resistance in Salmonella and thus for continuous monitoring.

PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

PubMed Central

Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

2016-01-01

The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

PubMed

Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

2017-11-01

Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

PubMed Central

Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

2017-01-01

Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

Mechanism for DNA transposons to generate introns on genomic scales

PubMed Central

Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

2017-01-01

Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

PubMed

Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

2014-12-12

Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

PubMed Central

Dunn, R. C.; Laurie, C. C.

1995-01-01

Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

Distinct Bacteriophages Encoding Panton-Valentine Leukocidin (PVL) among International Methicillin-Resistant Staphylococcus aureus Clones Harboring PVL▿

PubMed Central

Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.

2011-01-01

Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787

Identifying transposon insertions and their effects from RNA-sequencing data.

PubMed

de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

2017-07-07

Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

PubMed

Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

2012-12-01

In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

PubMed

Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

2017-04-13

The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

PubMed

Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

2017-10-03

Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

PubMed

Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

2015-01-01

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

Early Strains of Multidrug-Resistant Salmonella enterica Serovar Kentucky Sequence Type 198 from Southeast Asia Harbor Salmonella Genomic Island 1-J Variants with a Novel Insertion Sequence

PubMed Central

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel

2012-01-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow. PMID:22802251

Early strains of multidrug-resistant Salmonella enterica serovar Kentucky sequence type 198 from Southeast Asia harbor Salmonella genomic island 1-J variants with a novel insertion sequence.

PubMed

Le Hello, Simon; Weill, François-Xavier; Guibert, Véronique; Praud, Karine; Cloeckaert, Axel; Doublet, Benoît

2012-10-01

Salmonella genomic island 1 (SGI1) is a 43-kb integrative mobilizable element that harbors a great diversity of multidrug resistance gene clusters described in numerous Salmonella enterica serovars and also in Proteus mirabilis. The majority of SGI1 variants contain an In104-derivative complex class 1 integron inserted between resolvase gene res and open reading frame (ORF) S044 in SGI1. Recently, the international spread of ciprofloxacin-resistant S. enterica serovar Kentucky sequence type 198 (ST198) containing SGI1-K variants has been reported. A retrospective study was undertaken to characterize ST198 S. Kentucky strains isolated before the spread of the epidemic ST198-SGI1-K population in Africa and the Middle East. Here, we characterized 12 ST198 S. Kentucky strains isolated between 1969 and 1999, mainly from humans returning from Southeast Asia (n = 10 strains) or Israel (n = 1 strain) or from meat in Egypt (n = 1 strain). All these ST198 S. Kentucky strains did not belong to the XbaI pulsotype X1 associated with the African epidemic clone but to pulsotype X2. SGI1-J subgroup variants containing different complex integrons with a partial transposition module and inserted within ORF S023 of SGI1 were detected in six strains. The SGI1-J4 variant containing a partially deleted class 1 integron and thus showing a narrow resistance phenotype to sulfonamides was identified in two epidemiologically unrelated strains from Indonesia. The four remaining strains harbored a novel SGI1-J variant, named SGI1-J6, which contained aadA2, floR2, tetR(G)-tetA(G), and sul1 resistance genes within its complex integron. Moreover, in all these S. Kentucky isolates, a novel insertion sequence related to the IS630 family and named ISSen5 was found inserted upstream of the SGI1 complex integron in ORF S023. Thus, two subpopulations of S. Kentucky ST198 independently and exclusively acquired the SGI1 during the 1980s and 1990s. Unlike the ST198-X1 African epidemic subpopulation, the ST198-X2 subpopulation mainly from Asia harbors variants of the SGI1-J subgroup that are encountered mainly in the Far East, as previously described for S. enterica serovars Emek and Virchow.

Efficient transposition of the Tnt1 tobacco retrotransposon in the model legume Medicago truncatula.

PubMed

d'Erfurth, Isabelle; Cosson, Viviane; Eschstruth, Alexis; Lucas, Helene; Kondorosi, Adam; Ratet, P

2003-04-01

The tobacco element, Tnt1, is one of the few active retrotransposons in plants. Its transposition is activated during protoplast culture in tobacco and tissue culture in the heterologous host Arabidopsis thaliana. Here, we report its transposition in the R108 line of Medicago truncatula during the early steps of the in vitro transformation-regeneration process. Two hundred and twenty-five primary transformants containing Tnt1 were obtained. Among them, 11.2% contained only transposed copies of the element, indicating that Tnt1 transposed very early and efficiently during the in vitro transformation process, possibly even before the T-DNA integration. The average number of insertions per transgenic line was estimated to be about 15. These insertions were stable in the progeny and could be separated by segregation. Inspection of the sequences flanking the insertion sites revealed that Tnt1 had no insertion site specificity and often inserted in genes (one out of three insertions). Thus, our work demonstrates the functioning of an efficient transposable element in leguminous plants. These results indicate that Tnt1 can be used as a powerful tool for insertion mutagenesis in M. truncatula.

A new molecular evolution model for limited insertion independent of substitution.

PubMed

Lèbre, Sophie; Michel, Christian J

2013-10-01

We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

PubMed

vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

2018-06-01

In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

L1 Retrotransposon Heterogeneity in Ovarian Tumor Cell Evolution.

PubMed

Nguyen, Thu H M; Carreira, Patricia E; Sanchez-Luque, Francisco J; Schauer, Stephanie N; Fagg, Allister C; Richardson, Sandra R; Davies, Claire M; Jesuadian, J Samuel; Kempen, Marie-Jeanne H C; Troskie, Robin-Lee; James, Cini; Beaven, Elizabeth A; Wallis, Tristan P; Coward, Jermaine I G; Chetty, Naven P; Crandon, Alexander J; Venter, Deon J; Armes, Jane E; Perrin, Lewis C; Hooper, John D; Ewing, Adam D; Upton, Kyle R; Faulkner, Geoffrey J

2018-06-26

LINE-1 (L1) retrotransposons are a source of insertional mutagenesis in tumor cells. However, the clinical significance of L1 mobilization during tumorigenesis remains unclear. Here, we applied retrotransposon capture sequencing (RC-seq) to multiple single-cell clones isolated from five ovarian cancer cell lines and HeLa cells and detected endogenous L1 retrotransposition in vitro. We then applied RC-seq to ovarian tumor and matched blood samples from 19 patients and identified 88 tumor-specific L1 insertions. In one tumor, an intronic de novo L1 insertion supplied a novel cis-enhancer to the putative chemoresistance gene STC1. Notably, the tumor subclone carrying the STC1 L1 mutation increased in prevalence after chemotherapy, further increasing STC1 expression. We also identified hypomethylated donor L1s responsible for new L1 insertions in tumors and cultivated cancer cells. These congruent in vitro and in vivo results highlight L1 insertional mutagenesis as a common component of ovarian tumorigenesis and cancer genome heterogeneity. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

Visual attention distracter insertion for improved EEG rapid serial visual presentation (RSVP) target stimuli detection

NASA Astrophysics Data System (ADS)

Khosla, Deepak; Huber, David J.; Martin, Kevin

2017-05-01

This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).

Vertical Transmission of the Retrotransposable Elements R1 and R2 during the Evolution of the Drosophila Melanogaster Species Subgroup

PubMed Central

Eickbush, D. G.; Eickbush, T. H.

1995-01-01

R1 and R2 are non-long-terminal repeat retrotransposable elements that insert into specific sequences of insect 28S ribosomal RNA genes. These elements have been extensively described in Drosophila melanogaster. To determine whether these elements have been horizontally or vertically transmitted, we characterized R1 and R2 elements from the seven other members of the melanogaster species subgroup by genomic blotting and nucleotide sequencing. Each species was found to have homogeneous families of R1 and R2 elements with the exception of erecta and orena, which have no R2 elements. The DNA sequences of multiple R1 and R2 copies from each species indicated nucleotide divergence within each species averaged only 0.48% for R1 and 0.35% for R2, well below the level of divergence among the species. Most copies of R1 and R2 (40 of 47) sequenced from the seven species were potentially functional, as indicated by the absence of premature termination codons or translational frameshifts that would destroy the open reading frame of the element. The sequence relationships of both the R1 and R2 elements from the various members of the melanogaster subgroup closely followed that of the species phylogeny, suggesting that R1 and R2 have been stably maintained by vertical transmission since the origin of this species subgroup 17-20 million years ago. The remarkable stability of R1 and R2, compared to what has been suggested for transposable elements that insert at multiple locations in these same species, may be due to their unique specificity for sites in the rRNA gene locus. Under low copy number conditions, when it is essential for any mobile element to transpose, the insertion specificities of R1 and R2 ensure uniform developmentally regulated target sites that can be occupied with little or no detrimental effect on the host. PMID:7713424

Transposon variation by order during allopolyploidisation between Brassica oleracea and Brassica rapa.

PubMed

An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D

2014-07-01

Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

Structure of yeast Argonaute with guide RNA

PubMed Central

Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

2012-01-01

The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases

PubMed Central

Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.

2013-01-01

There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777

Analysis of BAC end sequences in oak, a keystone forest tree species, providing insight into the composition of its genome

PubMed Central

2011-01-01

Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357

High-throughput analysis of T-DNA location and structure using sequence capture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

High-throughput analysis of T-DNA location and structure using sequence capture

DOE PAGES

Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

2015-10-07

Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

PubMed Central

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

PubMed

Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

2017-08-15

Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

PubMed

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Influence of flanking sequences on presentation efficiency of a CD8+ cytotoxic T-cell epitope delivered by parvovirus-like particles.

PubMed

Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I

2004-03-01

We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.

Tnt1 Retrotransposon Mutagenesis: A Tool for Soybean Functional Genomics1[W][OA

PubMed Central

Cui, Yaya; Barampuram, Shyam; Stacey, Minviluz G.; Hancock, C. Nathan; Findley, Seth; Mathieu, Melanie; Zhang, Zhanyuan; Parrott, Wayne A.; Stacey, Gary

2013-01-01

Insertional mutagenesis is a powerful tool for determining gene function in both model and crop plant species. Tnt1, the transposable element of tobacco (Nicotiana tabacum) cell type 1, is a retrotransposon that replicates via an RNA copy that is reverse transcribed and integrated elsewhere in the plant genome. Based on studies in a variety of plants, Tnt1 appears to be inactive in normal plant tissue but can be reactivated by tissue culture. Our goal was to evaluate the utility of the Tnt1 retrotransposon as a mutagenesis strategy in soybean (Glycine max). Experiments showed that the Tnt1 element was stably transformed into soybean plants by Agrobacterium tumefaciens-mediated transformation. Twenty-seven independent transgenic lines carrying Tnt1 insertions were generated. Southern-blot analysis revealed that the copy number of transposed Tnt1 elements ranged from four to 19 insertions, with an average of approximately eight copies per line. These insertions showed Mendelian segregation and did not transpose under normal growth conditions. Analysis of 99 Tnt1 flanking sequences revealed insertions into 62 (62%) annotated genes, indicating that the element preferentially inserts into protein-coding regions. Tnt1 insertions were found in all 20 soybean chromosomes, indicating that Tnt1 transposed throughout the soybean genome. Furthermore, fluorescence in situ hybridization experiments validated that Tnt1 inserted into multiple chromosomes. Passage of transgenic lines through two different tissue culture treatments resulted in Tnt1 transposition, significantly increasing the number of insertions per line. Thus, our data demonstrate the Tnt1 retrotransposon to be a powerful system that can be used for effective large-scale insertional mutagenesis in soybean. PMID:23124322

Identification of the maize gravitropism gene lazy plant1 by a transposon-tagging genome resequencing strategy.

PubMed

Howard, Thomas P; Hayward, Andrew P; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A; Tohme, Joe; Kausch, Albert P; Mottinger, John P; Dellaporta, Stephen L

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform.

Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

PubMed Central

Howard, Thomas P.; Hayward, Andrew P.; Tordillos, Anthony; Fragoso, Christopher; Moreno, Maria A.; Tohme, Joe; Kausch, Albert P.; Mottinger, John P.; Dellaporta, Stephen L.

2014-01-01

Since their initial discovery, transposons have been widely used as mutagens for forward and reverse genetic screens in a range of organisms. The problems of high copy number and sequence divergence among related transposons have often limited the efficiency at which tagged genes can be identified. A method was developed to identity the locations of Mutator (Mu) transposons in the Zea mays genome using a simple enrichment method combined with genome resequencing to identify transposon junction fragments. The sequencing library was prepared from genomic DNA by digesting with a restriction enzyme that cuts within a perfectly conserved motif of the Mu terminal inverted repeats (TIR). Paired-end reads containing Mu TIR sequences were computationally identified and chromosomal sequences flanking the transposon were mapped to the maize reference genome. This method has been used to identify Mu insertions in a number of alleles and to isolate the previously unidentified lazy plant1 (la1) gene. The la1 gene is required for the negatively gravitropic response of shoots and mutant plants lack the ability to sense gravity. Using bioinformatic and fluorescence microscopy approaches, we show that the la1 gene encodes a cell membrane and nuclear localized protein. Our Mu-Taq method is readily adaptable to identify the genomic locations of any insertion of a known sequence in any organism using any sequencing platform. PMID:24498020

A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

PubMed

Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

2017-10-01

Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

PubMed

Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

2009-07-01

Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

PubMed

Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

2016-09-12

Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

Symbiosis Island Shuffling with Abundant Insertion Sequences in the Genomes of Extra-Slow-Growing Strains of Soybean Bradyrhizobia

PubMed Central

Iida, Takayuki; Itakura, Manabu; Anda, Mizue; Sugawara, Masayuki; Isawa, Tsuyoshi; Okubo, Takashi; Sato, Shusei; Chiba-Kakizaki, Kaori

2015-01-01

Extra-slow-growing bradyrhizobia from root nodules of field-grown soybeans harbor abundant insertion sequences (ISs) and are termed highly reiterated sequence-possessing (HRS) strains. We analyzed the genome organization of HRS strains with the focus on IS distribution and symbiosis island structure. Using pulsed-field gel electrophoresis, we consistently detected several plasmids (0.07 to 0.4 Mb) in the HRS strains (NK5, NK6, USDA135, 2281, USDA123, and T2), whereas no plasmids were detected in the non-HRS strain USDA110. The chromosomes of the six HRS strains (9.7 to 10.7 Mb) were larger than that of USDA110 (9.1 Mb). Using MiSeq sequences of 6 HRS and 17 non-HRS strains mapped to the USDA110 genome, we found that the copy numbers of ISRj1, ISRj2, ISFK1, IS1632, ISB27, ISBj8, and IS1631 were markedly higher in HRS strains. Whole-genome sequencing showed that the HRS strain NK6 had four small plasmids (136 to 212 kb) and a large chromosome (9,780 kb). Strong colinearity was found between 7.4-Mb core regions of the NK6 and USDA110 chromosomes. USDA110 symbiosis islands corresponded mainly to five small regions (S1 to S5) within two variable regions, V1 (0.8 Mb) and V2 (1.6 Mb), of the NK6 chromosome. The USDA110 nif gene cluster (nifDKENXSBZHQW-fixBCX) was split into two regions, S2 and S3, where ISRj1-mediated rearrangement occurred between nifS and nifB. ISs were also scattered in NK6 core regions, and ISRj1 insertion often disrupted some genes important for survival and environmental responses. These results suggest that HRS strains of soybean bradyrhizobia were subjected to IS-mediated symbiosis island shuffling and core genome degradation. PMID:25862225

Bacterio-opsin mutants of Halobacterium halobium

PubMed Central

Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

1983-01-01

The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

Extended-spectrum cephalosporin-resistant Escherichia coli in community, specialized outpatient clinic and hospital settings in Switzerland.

PubMed

Seiffert, Salome N; Hilty, Markus; Kronenberg, Andreas; Droz, Sara; Perreten, Vincent; Endimiani, Andrea

2013-10-01

Resistance to extended-spectrum cephalosporins (ESCs) in Escherichia coli can be due to the production of ESBLs, plasmid-mediated AmpCs (pAmpCs) or chromosomal AmpCs (cAmpCs). Information regarding type and prevalence of β-lactamases, clonal relations and plasmids associated with the bla genes for ESC-R E. coli (ESC-R-Ec) detected in Switzerland is lacking. Moreover, data focusing on patients referred to the specialized outpatient clinics (SOCs) are needed. We analysed 611 unique E. coli isolated during September-December 2011. ESC-R-Ec were studied with microarrays, PCR/DNA sequencing for blaESBLs, blapAmpCs, promoter region of blacAmpC, IS elements, plasmid incompatibility group, and also implementing transformation, aIEF, rep-PCR and MLST. The highest resistance rates were observed in the SOCs, whereas those in the hospital and community were lower (e.g. quinolone resistance of 22.6%, 17.2% and 9.0%, respectively; P = 0.003 for SOCs versus community). The prevalence of ESC-R-Ec in the three settings was 5.3% (n = 11), 7.8% (n = 22) and 5.7% (n = 7), respectively. Thirty isolates produced CTX-M ESBLs (14 were CTX-M-15), 5 produced CMY-2 pAmpC and 5 hyper-expressed cAmpCs due to promoter mutations. Fourteen isolates were of sequence type 131 (ST131; 10 with CTX-M-15). blaCTX-M and blaCMY-2 were associated with an intact or truncated ISEcp1 and were mainly carried by IncF, IncFII and IncI1plasmids. ST131 producing CTX-M-15 is the predominant clone. The prevalence of ESC-R-Ec (overall 6.5%) is low, but an unusual relatively high frequency of AmpC producers (25%) was noted. The presence of ESC-R-Ec in the SOCs and their potential ability to be exchanged between hospital and community should be taken into serious consideration.

Regional outbreak of CTX-M-2 β-lactamase-producing Proteus mirabilis in Japan.

PubMed

Nakano, Ryuichi; Nakano, Akiyo; Abe, Michiko; Inoue, Matsuhisa; Okamoto, Ryoichi

2012-12-01

Proteus mirabilis is a common cause of urinary tract infection. Wild-type P. mirabilis strains are usually susceptible to penicillins and cephalosporins, but occurrences of P. mirabilis producing extended-spectrum β-lactamases (ESBLs) have been recently reported. Here, we surveyed the prevalence of cefotaxime resistance among P. mirabilis strains at seven different hospitals in Kanagawa Prefecture, Japan, and investigated their molecular epidemiology to explain the mechanism of their spread. The prevalence of cefotaxime resistance among P. mirabilis increased annually, from 10.1 % in 1998 to 23.1 % in 2003, and increased drastically in 2004, exceeding 40 %. We collected 105 consecutive and non-duplicate cefotaxime-resistant P. mirabilis isolates (MIC 16 to >256 µg ml(-1)) from these hospitals from June 2004 to May 2005 and characterized their profile. PCR and sequence analysis revealed that all resistant strains produced exclusively CTX-M-2 β-lactamase. PFGE analysis identified 47 banding patterns with 83 % or greater similarity. These results indicated that a regional outbreak of P. mirabilis producing CTX-M-2 β-lactamase has occurred in Japan and suggest that the epidemic spread occurred within and across hospitals and communities by extended clonal strains. Plasmid analysis revealed that 44.8 % of plasmids harboured by bla(CTX-M-2) isolates had common profiles, encoding ISEcp1, IS26 and Int1, and belonged to incompatibility group T. Spread of the resistant isolates in Japan resulted from dissemination of narrow-host-range plasmids of the IncT group encoding bla(CTX-M-2). These findings indicate the rapidly developing problem of treating the species to prevent dissemination of ESBL producers.

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements

PubMed Central

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-01-01

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading. PMID:25686154

pTC Plasmids from Sulfolobus Species in the Geothermal Area of Tengchong, China: Genomic Conservation and Naturally-Occurring Variations as a Result of Transposition by Mobile Genetic Elements.

PubMed

Xiang, Xiaoyu; Huang, Xiaoxing; Wang, Haina; Huang, Li

2015-02-12

Plasmids occur frequently in Archaea. A novel plasmid (denoted pTC1) containing typical conjugation functions has been isolated from Sulfolobus tengchongensis RT8-4, a strain obtained from a hot spring in Tengchong, China, and characterized. The plasmid is a circular double-stranded DNA molecule of 20,417 bp. Among a total of 26 predicted pTC1 ORFs, 23 have homologues in other known Sulfolobus conjugative plasmids (CPs). pTC1 resembles other Sulfolobus CPs in genome architecture, and is most highly conserved in the genomic region encoding conjugation functions. However, attempts to demonstrate experimentally the capacity of the plasmid for conjugational transfer were unsuccessful. A survey revealed that pTC1 and its closely related plasmid variants were widespread in the geothermal area of Tengchong. Variations of the plasmids at the target sites for transposition by an insertion sequence (IS) and a miniature inverted-repeat transposable element (MITE) were readily detected. The IS was efficiently inserted into the pTC1 genome, and the inserted sequence was inactivated and degraded more frequently in an imprecise manner than in a precise manner. These results suggest that the host organism has evolved a strategy to maintain a balance between the insertion and elimination of mobile genetic elements to permit genomic plasticity while inhibiting their fast spreading.

Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

PubMed

Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

2006-12-01

An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing

DTIC Science & Technology

2010-10-14

High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and

GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

PubMed

Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

2012-01-01

T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

Assessment of sequence dependent geometric distortion in contrast-enhanced MR images employed in stereotactic radiosurgery treatment planning.

PubMed

Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis

2018-06-25

This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.

Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

PubMed Central

Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

PubMed

Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

2013-01-01

Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

PubMed Central

Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

2012-01-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

A novel motif in the yeast mitochondrial dynamin Dnm1 is essential for adaptor binding and membrane recruitment

PubMed Central

Bui, Huyen T.; Karren, Mary A.; Bhar, Debjani

2012-01-01

To initiate mitochondrial fission, dynamin-related proteins (DRPs) must bind specific adaptors on the outer mitochondrial membrane. The structural features underlying this interaction are poorly understood. Using yeast as a model, we show that the Insert B domain of the Dnm1 guanosine triphosphatase (a DRP) contains a novel motif required for association with the mitochondrial adaptor Mdv1. Mutation of this conserved motif specifically disrupted Dnm1–Mdv1 interactions, blocking Dnm1 recruitment and mitochondrial fission. Suppressor mutations in Mdv1 that restored Dnm1–Mdv1 interactions and fission identified potential protein-binding interfaces on the Mdv1 β-propeller domain. These results define the first known function for Insert B in DRP–adaptor interactions. Based on the variability of Insert B sequences and adaptor proteins, we propose that Insert B domains and mitochondrial adaptors have coevolved to meet the unique requirements for mitochondrial fission of different organisms. PMID:23148233

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Langlois, S.; Kastelein, J.J.; Hayden, M.R.

1989-02-01

Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum.

PubMed

McCarthy, Alex J; Stabler, Richard A; Taylor, Peter W

2018-04-01

Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn 5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. Copyright © 2018 McCarthy et al.

Genome-Wide Identification by Transposon Insertion Sequencing of Escherichia coli K1 Genes Essential for In Vitro Growth, Gastrointestinal Colonizing Capacity, and Survival in Serum

PubMed Central

McCarthy, Alex J.

2018-01-01

ABSTRACT Escherichia coli K1 strains are major causative agents of invasive disease of newborn infants. The age dependency of infection can be reproduced in neonatal rats. Colonization of the small intestine following oral administration of K1 bacteria leads rapidly to invasion of the blood circulation; bacteria that avoid capture by the mesenteric lymphatic system and evade antibacterial mechanisms in the blood may disseminate to cause organ-specific infections such as meningitis. Some E. coli K1 surface constituents, in particular the polysialic acid capsule, are known to contribute to invasive potential, but a comprehensive picture of the factors that determine the fully virulent phenotype has not emerged so far. We constructed a library and constituent sublibraries of ∼775,000 Tn5 transposon mutants of E. coli K1 strain A192PP and employed transposon-directed insertion site sequencing (TraDIS) to identify genes required for fitness for infection of 2-day-old rats. Transposon insertions were lacking in 357 genes following recovery on selective agar; these genes were considered essential for growth in nutrient-replete medium. Colonization of the midsection of the small intestine was facilitated by 167 E. coli K1 gene products. Restricted bacterial translocation across epithelial barriers precluded TraDIS analysis of gut-to-blood and blood-to-brain transits; 97 genes were required for survival in human serum. This study revealed that a large number of bacterial genes, many of which were not previously associated with systemic E. coli K1 infection, are required to realize full invasive potential. IMPORTANCE Escherichia coli K1 strains cause life-threatening infections in newborn infants. They are acquired from the mother at birth and colonize the small intestine, from where they invade the blood and central nervous system. It is difficult to obtain information from acutely ill patients that sheds light on physiological and bacterial factors determining invasive disease. Key aspects of naturally occurring age-dependent human infection can be reproduced in neonatal rats. Here, we employ transposon-directed insertion site sequencing to identify genes essential for the in vitro growth of E. coli K1 and genes that contribute to the colonization of susceptible rats. The presence of bottlenecks to invasion of the blood and cerebrospinal compartments precluded insertion site sequencing analysis, but we identified genes for survival in serum. PMID:29339415

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

PubMed Central

Martin, William F.

2017-01-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

[Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

PubMed

Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

2012-04-01

Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

Transposon integration enhances expression of stress response genes.

PubMed

Feng, Gang; Leem, Young-Eun; Levin, Henry L

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress.

Transposon integration enhances expression of stress response genes

PubMed Central

Feng, Gang; Leem, Young-Eun; Levin, Henry L.

2013-01-01

Transposable elements possess specific patterns of integration. The biological impact of these integration profiles is not well understood. Tf1, a long-terminal repeat retrotransposon in Schizosaccharomyces pombe, integrates into promoters with a preference for the promoters of stress response genes. To determine the biological significance of Tf1 integration, we took advantage of saturated maps of insertion activity and studied how integration at hot spots affected the expression of the adjacent genes. Our study revealed that Tf1 integration did not reduce gene expression. Importantly, the insertions activated the expression of 6 of 32 genes tested. We found that Tf1 increased gene expression by inserting enhancer activity. Interestingly, the enhancer activity of Tf1 could be limited by Abp1, a host surveillance factor that sequesters transposon sequences into structures containing histone deacetylases. We found the Tf1 promoter was activated by heat treatment and, remarkably, only genes that themselves were induced by heat could be activated by Tf1 integration, suggesting a synergy of Tf1 enhancer sequence with the stress response elements of target promoters. We propose that the integration preference of Tf1 for the promoters of stress response genes and the ability of Tf1 to enhance the expression of these genes co-evolved to promote the survival of cells under stress. PMID:23193295

Molecular characterization of antibiotic resistance in cultivable multidrug-resistant bacteria from livestock manure.

PubMed

Yang, Qingxiang; Tian, Tiantian; Niu, Tianqi; Wang, Panliang

2017-10-01

Diverse antibiotic-resistance genes (ARGs) are frequently reported to have high prevalence in veterinary manure samples due to extensive use of antibiotics in farm animals. However, the characteristics of the distribution and transmission of ARGs among bacteria, especially among different species of multiple antibiotic-resistant bacteria (MARB), have not been well explored. By applying high-throughput sequencing methods, our study uncovered a vast MARB reservoir in livestock manure. The genera Escherichia, Myroides, Acinetobacter, Proteus, Ignatzschineria, Alcaligenes, Providencia and Enterococcus were the predominant cultivable MARB, with compositions of 40.6%-85.7%. From chicken manure isolates, 33 MARB were selected for investigation of the molecular characteristics of antibiotic resistance. A total of 61 ARGs and 18 mobile genetic elements (MGEs) were investigated. We found that 47 ARGs were widely distributed among the 33 MARB isolates. Each isolate carried 27-36 genes responsible for resistance to eight classes of antibiotics frequently used in clinic or veterinary settings. ARGs to the six classes of antibiotics other than streptogramins and vancomycin were present in all 33 MARB isolates with a prevalence of 80%-100%. A total of 12 MGEs were widely distributed among the 33 MARB, with intI1, IS26, ISaba1, and ISEcp1 simultaneously present in 100% of isolates. In addition, 9 gene cassettes within integrons and ISCR1 were detected among MARB isolates encoding resistance to different antibiotic classes. This is the first report revealing the general co-presence of multiple ARGs, various MGEs and ARG cassettes in different species of individual MARB isolates in chicken manure. The results highlight a much higher risk of ARGs spreading through livestock manure to humans than we expected. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

PubMed

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

TU-H-CAMPUS-JeP3-05: Adaptive Determination of Needle Sequence HDR Prostate Brachytherapy with Divergent Needle-By-Needle Delivery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Borot de Battisti, M; Maenhout, M; Lagendijk, J J W

Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less

In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

PubMed Central

Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

2018-01-01

Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

PubMed

Ehrmann, M A; Vogel, R E

2001-11-01

An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

PubMed Central

Grindley, N D; Joyce, C M

1980-01-01

The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

Successful Gene Tagging in Lettuce Using the Tnt1 Retrotransposon from Tobacco

PubMed Central

Mazier, Marianne; Botton, Emmanuel; Flamain, Fabrice; Bouchet, Jean-Paul; Courtial, Béatrice; Chupeau, Marie-Christine; Chupeau, Yves; Maisonneuve, Brigitte; Lucas, Hélène

2007-01-01

The tobacco (Nicotiana tabacum) element Tnt1 is one of the few identified active retrotransposons in plants. These elements possess unique properties that make them ideal genetic tools for gene tagging. Here, we demonstrate the feasibility of gene tagging using the retrotransposon Tnt1 in lettuce (Lactuca sativa), which is the largest genome tested for retrotransposon mutagenesis so far. Of 10 different transgenic bushes carrying a complete Tnt1 containing T-DNA, eight contained multiple transposed copies of Tnt1. The number of transposed copies of the element per plant was particularly high, the smallest number being 28. Tnt1 transposition in lettuce can be induced by a very simple in vitro culture protocol. Tnt1 insertions were stable in the progeny of the primary transformants and could be segregated genetically. Characterization of the sequences flanking some insertion sites revealed that Tnt1 often inserted into genes. The progeny of some primary transformants showed phenotypic alterations due to recessive mutations. One of these mutations was due to Tnt1 insertion in the gibberellin 3β-hydroxylase gene. Taken together, these results indicate that Tnt1 is a powerful tool for insertion mutagenesis especially in plants with a large genome. PMID:17351058

Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

PubMed Central

Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

2013-01-01

Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

Sorting genomes by reciprocal translocations, insertions, and deletions.

PubMed

Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

2010-01-01

The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

PubMed Central

Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

2014-01-01

Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

The Nucleotide Excision Repair Pathway Limits L1 Retrotransposition

PubMed Central

Servant, Geraldine; Streva, Vincent A.; Derbes, Rebecca S.; Wijetunge, Madushani I.; Neeland, Marc; White, Travis B.; Belancio, Victoria P.; Roy-Engel, Astrid M.; Deininger, Prescott L.

2017-01-01

Long interspersed elements 1 (L1) are active mobile elements that constitute almost 17% of the human genome. They amplify through a “copy-and-paste” mechanism termed retrotransposition, and de novo insertions related to these elements have been reported to cause 0.2% of genetic diseases. Our previous data demonstrated that the endonuclease complex ERCC1-XPF, which cleaves a 3′ DNA flap structure, limits L1 retrotransposition. Although the ERCC1-XPF endonuclease participates in several different DNA repair pathways, such as single-strand annealing, or in telomere maintenance, its recruitment to DNA lesions is best characterized in the nucleotide excision repair (NER) pathway. To determine if the NER pathway prevents the insertion of retroelements in the genome, we monitored the retrotransposition efficiencies of engineered L1 elements in NER-deficient cells and in their complemented versions. Core proteins of the NER pathway, XPD and XPA, and the lesion binding protein, XPC, are involved in limiting L1 retrotransposition. In addition, sequence analysis of recovered de novo L1 inserts and their genomic locations in NER-deficient cells demonstrated the presence of abnormally large duplications at the site of insertion, suggesting that NER proteins may also play a role in the normal L1 insertion process. Here, we propose new functions for the NER pathway in the maintenance of genome integrity: limitation of insertional mutations caused by retrotransposons and the prevention of potentially mutagenic large genomic duplications at the site of retrotransposon insertion events. PMID:28049704

Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

PubMed

Hazkani-Covo, Einat; Martin, William F

2017-05-01

Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

PubMed

Michalovova, M; Vyskot, B; Kejnovsky, E

2013-10-01

We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

PubMed

Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

2015-08-29

The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Identification of genomic indels and structural variations using split reads

PubMed Central

2011-01-01

Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Alu repeat discovery and characterization within human genomes

PubMed Central

Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

2011-01-01

Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

PubMed

Proels, Reinhard K; Roitsch, Thomas

2006-03-01

Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

L1-Associated Genomic Regions are Deleted in Somatic Cells of the Healthy Human Brain

PubMed Central

Erwin, Jennifer A.; Paquola, Apuã C.M.; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy; Ivanio, Francisco; Butcher, Cheyenne R.; Herdy, Joseph R.; Sarkar, Anindita; Lasken, Roger S.; Muotri, Alysson R.; Gage, Fred H.

2016-01-01

The healthy human brain is a mosaic of varied genomes. L1 retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that Somatic L1-Associated Variants (SLAVs) are actually composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs are, in fact, somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition- independent rearrangements within inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2/PSD93, and affect between 44–63% of cells of the cells in the healthy brain. PMID:27618310

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

Plasmid partition system of the P1par family from the pWR100 virulence plasmid of Shigella flexneri.

PubMed

Sergueev, Kirill; Dabrazhynetskaya, Alena; Austin, Stuart

2005-05-01

P1par family members promote the active segregation of a variety of plasmids and plasmid prophages in gram-negative bacteria. Each has genes for ParA and ParB proteins, followed by a parS partition site. The large virulence plasmid pWR100 of Shigella flexneri contains a new P1par family member: pWR100par. Although typical parA and parB genes are present, the putative pWR100parS site is atypical in sequence and organization. However, pWR100parS promoted accurate plasmid partition in Escherichia coli when the pWR100 Par proteins were supplied. Unique BoxB hexamer motifs within parS define species specificities among previously described family members. Although substantially different from P1parS from the P1 plasmid prophage of E. coli, pWR100parS has the same BoxB sequence. As predicted, the species specificity of the two types proved identical. They also shared partition-mediated incompatibility, consistent with the proposed mechanistic link between incompatibility and species specificity. Among several informative sequence differences between pWR100parS and P1parS is the presence of a 21-bp insert at the center of the pWR100parS site. Deletion of this insert left much of the parS activity intact. Tolerance of central inserts with integral numbers of helical DNA turns reflects the critical topology of these sites, which are bent by binding the host IHF protein.

The broadly neutralizing anti-human immunodeficiency virus type 1 4E10 monoclonal antibody is better adapted to membrane-bound epitope recognition and blocking than 2F5.

PubMed

Huarte, Nerea; Lorizate, Maier; Maeso, Rubén; Kunert, Renate; Arranz, Rocio; Valpuesta, José M; Nieva, José L

2008-09-01

The broadly neutralizing 2F5 and 4E10 monoclonal antibodies (MAbs) recognize epitopes within the membrane-proximal external region (MPER) that connects the human immunodeficiency virus type 1 (HIV-1) envelope gp41 ectodomain with the transmembrane anchor. By adopting different conformations that stably insert into the virion external membrane interface, such as helical structures, a conserved aromatic-rich sequence within the MPER is thought to participate in HIV-1-cell fusion. Recent experimental evidence suggests that the neutralizing activity of 2F5 and 4E10 might correlate with the MAbs' capacity to recognize epitopes inserted into the viral membrane, thereby impairing MPER fusogenic activity. To gain new insights into the molecular mechanism underlying viral neutralization by these antibodies, we have compared the capacities of 2F5 and 4E10 to block the membrane-disorganizing activity of MPER peptides inserted into the surface bilayer of solution-diffusing unilamellar vesicles. Both MAbs inhibited leakage of vesicular aqueous contents (membrane permeabilization) and intervesicular lipid mixing (membrane fusion) promoted by MPER-derived peptides. Thus, our data support the idea that antibody binding to a membrane-inserted epitope may interfere with the function of the MPER during gp41-induced fusion. Antibody insertion into a cholesterol-containing, uncharged virion-like membrane is mediated by specific epitope recognition, and moreover, partitioning-coupled folding into a helix reduces the efficiency of 2F5 MAb binding to its epitope in the membrane. We conclude that the capacity to interfere with the membrane activity of conserved MPER sequences is best correlated with the broad neutralization of the 4E10 MAb.

Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

PubMed Central

Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

1995-01-01

Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

Child Development and Structural Variation in the Human Genome

ERIC Educational Resources Information Center

Zhang, Ying; Haraksingh, Rajini; Grubert, Fabian; Abyzov, Alexej; Gerstein, Mark; Weissman, Sherman; Urban, Alexander E.

2013-01-01

Structural variation of the human genome sequence is the insertion, deletion, or rearrangement of stretches of DNA sequence sized from around 1,000 to millions of base pairs. Over the past few years, structural variation has been shown to be far more common in human genomes than previously thought. Very little is currently known about the effects…

A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

DTIC Science & Technology

2013-11-01

the genome using the same parental fly line, minimizing the effect of surrounding sequences and genetic variations on the ...locomotion and GTPC cyclrohydolase protein levels; (3) supplementation of dopamine can partially rescue the locomotion defects of Drosophila larvae...8217- GCGAACAACCAAAAAATCATTGAGATAATAAACTCCTCCATTAG-3’) to make dtorsin cDNA that lacks GAC (D307) (Fig. 1) respectively. After confirming mutated sequences , the insert was again

X-Linked Congenital Hypertrichosis Syndrome Is Associated with Interchromosomal Insertions Mediated by a Human-Specific Palindrome near SOX3

PubMed Central

Zhu, Hongwen; Shang, Dandan; Sun, Miao; Choi, Sunju; Liu, Qing; Hao, Jiajie; Figuera, Luis E.; Zhang, Feng; Choy, Kwong Wai; Ao, Yang; Liu, Yang; Zhang, Xiao-Lin; Yue, Fengzhen; Wang, Ming-Rong; Jin, Li; Patel, Pragna I.; Jing, Tao; Zhang, Xue

2011-01-01

X-linked congenital generalized hypertrichosis (CGH), an extremely rare condition characterized by universal overgrowth of terminal hair, was first mapped to chromosome Xq24-q27.1 in a Mexican family. However, the underlying genetic defect remains unknown. We ascertained a large Chinese family with an X-linked congenital hypertrichosis syndrome combining CGH, scoliosis, and spina bifida and mapped the disease locus to a 5.6 Mb critical region within the interval defined by the previously reported Mexican family. Through the combination of a high-resolution copy-number variation (CNV) scan and targeted genomic sequencing, we identified an interchromosomal insertion at Xq27.1 of a 125,577 bp intragenic fragment of COL23A1 on 5q35.3, with one X breakpoint within and the other very close to a human-specific short palindromic sequence located 82 kb downstream of SOX3. In the Mexican family, we found an interchromosomal insertion at the same Xq27.1 site of a 300,036 bp genomic fragment on 4q31.2, encompassing PRMT10 and TMEM184C and involving parts of ARHGAP10 and EDNRA. Notably, both of the two X breakpoints were within the short palindrome. The two palindrome-mediated insertions fully segregate with the CGH phenotype in each of the families, and the CNV gains of the respective autosomal genomic segments are not present in the public database and were not found in 1274 control individuals. Analysis of control individuals revealed deletions ranging from 173 bp to 9104 bp at the site of the insertions with no phenotypic consequence. Taken together, our results strongly support the pathogenicity of the identified insertions and establish X-linked congenital hypertrichosis syndrome as a genomic disorder. PMID:21636067

Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

PubMed

Oggioni, M R; Claverys, J P

1999-10-01

A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.

PubMed

Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J

2017-05-01

Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.

Membrane-bound human orphan cytochrome P450 2U1: Sequence singularities, construction of a full 3D model, and substrate docking.

PubMed

Ducassou, Lionel; Dhers, Laura; Jonasson, Gabriella; Pietrancosta, Nicolas; Boucher, Jean-Luc; Mansuy, Daniel; André, François

2017-09-01

Human cytochrome P450 2U1 (CYP2U1) is an orphan CYP that exhibits several distinctive characteristics among the 57 human CYPs with a highly conserved sequence in almost all living organisms. We compared its protein sequence with those of the 57 human CYPs and constructed a 3D structure of a full-length CYP2U1 model bound to a POPC membrane. We also performed docking experiments of arachidonic acid (AA) and N-arachidonoylserotonin (AS) in this model. The protein sequence of CYP2U1 displayed two unique characteristics when compared to those of the human CYPs, the presence of a longer N-terminal region upstream of the putative trans-membrane helix (TMH) containing 8 proline residues, and of an insert of about 20 amino acids containing 5 arginine residues between helices A' and A. Its N-terminal part upstream of TMH involved an additional short terminal helix, in a manner similar to what was reported in the crystal structure of Saccharomyces cerevisiae CYP51. Our model also showed a specific interaction between the charged residues of insert AA' and phosphate groups of lipid polar heads, suggesting a possible role of this insert in substrate recruitment. Docking of AA and AS in this model showed these substrates in channel 2ac, with the terminal alkyl chain of AA or the indole ring of AS close to the heme, in agreement with the reported CYP2U1-catalyzed AA and AS hydroxylation regioselectivities. This model should be useful to find new endogenous or exogenous CYP2U1 substrates and to interpret the regioselectivity of their hydroxylation. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

PubMed

Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

2018-01-01

Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

PubMed Central

Macé, Matthias; Crouau-Roy, Brigitte

2008-01-01

Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953

Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells.

PubMed

Chang, Chia-Wei; Lai, Yi-Shin; Pawlik, Kevin M; Liu, Kaimao; Sun, Chiao-Wang; Li, Chao; Schoeb, Trenton R; Townes, Tim M

2009-05-01

We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3' long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic "hit and run" vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells.

Methods and compositions for controlling gene expression by RNA processing

DOEpatents

Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

2017-08-29

The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

PubMed

Jia, Xianbo; Lin, Xinjian; Chen, Jichen

2017-11-02

Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

Comparison of the isolation rates and characteristics of Salmonella isolated from antibiotic-free and conventional chicken meat samples.

PubMed

Park, J-H; Kim, H-S; Yim, J-H; Kim, Y-J; Kim, D-H; Chon, J-W; Kim, H; Om, A-S; Seo, K-H

2017-08-01

Salmonella contamination in chicken samples can cause major health problems in humans. However, not only the effects of antibiotic treatment during growth but also the impacts of the poultry slaughter line on the prevalence of Salmonellae in final chicken meat sold to consumers are unknown. In this study, we compared the isolation rates and antimicrobial resistance of Salmonellae among antibiotic-free, conventional, conventional Korean native retail chicken meat samples, and clonal divergence of Salmonella isolates by multilocus sequence typing. In addition, the distribution of extended-spectrum β-lactamase (ESBL) genes in ESBL-producing Salmonella isolates was analyzed. A total of 72 retail chicken meat samples (n = 24 antibiotic-free broiler [AFB] chickens, n = 24 conventional broiler [CB] chickens, and n = 24 conventional Korean native [CK] chickens) was collected from local retail markets in Seoul, South Korea. The isolation rates of Salmonellae were 66.6% in AFB chickens, 45.8% in CB chickens, and 25% in CK chickens. By analyzing the minimum inhibitory concentrations of β-lactam antibiotics with the disc-diffusion test, we found that 81.2% of Salmonella isolates from AFB chickens, 63.6% of isolates from CB chickens, and 50% of isolates from CK chickens were ESBL producers; all ESBL-positive isolates had the CTX-M-15 genotype. Interestingly, all ESBL-producing Salmonellae were revealed as ST16 by multilocus sequence typing and had the genetic platform of blaCTX-M gene (IS26-ISEcp1-blaCTX-M-15-IS903), which was first reported in Salmonellae around the world. The Salmonella ST33 strain (S. Hadar) isolated in this study has never been reported in South Korea. In conclusion, our findings showed that antibiotic-free retail chicken meat products were also largely contaminated with ESBL-producing Salmonellae and that their ESBL genes and genetic platforms were the same as those isolated from conventional retail chicken meat products. © 2017 Poultry Science Association Inc.

Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

PubMed

Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

2014-04-09

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

PubMed Central

Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

2014-01-01

West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

High-throughput sequencing of retrotransposon integration provides a saturated profile of target activity in Schizosaccharomyces pombe.

PubMed

Guo, Yabin; Levin, Henry L

2010-02-01

The biological impact of transposons on the physiology of the host depends greatly on the frequency and position of integration. Previous studies of Tf1, a long terminal repeat retrotransposon in Schizosaccharomyces pombe, showed that integration occurs at the promoters of RNA polymerase II (Pol II) transcribed genes. To determine whether specific promoters are preferred targets of integration, we sequenced large numbers of insertions using high-throughput pyrosequencing. In four independent experiments we identified a total of 73,125 independent integration events. These data provided strong support for the conclusion that Pol II promoters are the targets of Tf1 integration. The size and number of the integration experiments resulted in reproducible measures of integration for each intergenic region and ORF in the S. pombe genome. The reproducibility of the integration activity from experiment to experiment demonstrates that we have saturated the full set of insertion sites that are actively targeted by Tf1. We found Tf1 integration was highly biased in favor of a specific set of Pol II promoters. The overwhelming majority (76%) of the insertions were distributed in intergenic sequences that contained 31% of the promoters of S. pombe. Interestingly, there was no correlation between the amount of integration at these promoters and their level of transcription. Instead, we found Tf1 had a strong preference for promoters that are induced by conditions of stress. This targeting of stress response genes coupled with the ability of Tf1 to regulate the expression of adjacent genes suggests Tf1 may improve the survival of S. pombe when cells are exposed to environmental stress.

High-throughput sequencing of retrotransposon integration provides a saturated profile of target activity in Schizosaccharomyces pombe

PubMed Central

Guo, Yabin; Levin, Henry L.

2010-01-01

The biological impact of transposons on the physiology of the host depends greatly on the frequency and position of integration. Previous studies of Tf1, a long terminal repeat retrotransposon in Schizosaccharomyces pombe, showed that integration occurs at the promoters of RNA polymerase II (Pol II) transcribed genes. To determine whether specific promoters are preferred targets of integration, we sequenced large numbers of insertions using high-throughput pyrosequencing. In four independent experiments we identified a total of 73,125 independent integration events. These data provided strong support for the conclusion that Pol II promoters are the targets of Tf1 integration. The size and number of the integration experiments resulted in reproducible measures of integration for each intergenic region and ORF in the S. pombe genome. The reproducibility of the integration activity from experiment to experiment demonstrates that we have saturated the full set of insertion sites that are actively targeted by Tf1. We found Tf1 integration was highly biased in favor of a specific set of Pol II promoters. The overwhelming majority (76%) of the insertions were distributed in intergenic sequences that contained 31% of the promoters of S. pombe. Interestingly, there was no correlation between the amount of integration at these promoters and their level of transcription. Instead, we found Tf1 had a strong preference for promoters that are induced by conditions of stress. This targeting of stress response genes coupled with the ability of Tf1 to regulate the expression of adjacent genes suggests Tf1 may improve the survival of S. pombe when cells are exposed to environmental stress. PMID:20040583

Compositions and methods for the expression of selenoproteins in eukaryotic cells

DOEpatents

Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

2012-09-25

Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

Genomic characterization of two large Alu-mediated rearrangements of the BRCA1 gene.

PubMed

Peixoto, Ana; Pinheiro, Manuela; Massena, Lígia; Santos, Catarina; Pinto, Pedro; Rocha, Patrícia; Pinto, Carla; Teixeira, Manuel R

2013-02-01

To determine whether a large genomic rearrangement is actually novel and to gain insight about the mutational mechanism responsible for its occurrence, molecular characterization with breakpoint identification is mandatory. We here report the characterization of two large deletions involving the BRCA1 gene. The first rearrangement harbored a 89,664-bp deletion comprising exon 7 of the BRCA1 gene to exon 11 of the NBR1 gene (c.441+1724_oNBR1:c.1073+480del). Two highly homologous Alu elements were found in the genomic sequences flanking the deletion breakpoints. Furthermore, a 20-bp overlapping sequence at the breakpoint junction was observed, suggesting that the most likely mechanism for the occurrence of this rearrangement was nonallelic homologous recombination. The second rearrangement fully characterized at the nucleotide level was a BRCA1 exons 11-15 deletion (c.671-319_4677-578delinsAlu). The case harbored a 23,363-bp deletion with an Alu element inserted at the breakpoints of the deleted region. As the Alu element inserted belongs to a still active AluY family, the observed rearrangement could be due to an insertion-mediated deletion mechanism caused by Alu retrotransposition. To conclude, we describe the breakpoints of two novel large deletions involving the BRCA1 gene and analysis of their genomic context allowed us to gain insight about the respective mutational mechanism.

Viral morphogenesis is the dominant source of sequence censorship in M13 combinatorial peptide phage display.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodi, D. J.; Soares, A. S.; Makowski, L.

Novel statistical methods have been developed and used to quantitate and annotate the sequence diversity within combinatorial peptide libraries on the basis of small numbers (1-200) of sequences selected at random from commercially available M13 p3-based phage display libraries. These libraries behave statistically as though they correspond to populations containing roughly 4.0{+-}1.6% of the random dodecapeptides and 7.9{+-}2.6% of the random constrained heptapeptides that are theoretically possible within the phage populations. Analysis of amino acid residue occurrence patterns shows no demonstrable influence on sequence censorship by Escherichia coli tRNA isoacceptor profiles or either overall codon or Class II codon usagemore » patterns, suggesting no metabolic constraints on recombinant p3 synthesis. There is an overall depression in the occurrence of cysteine, arginine and glycine residues and an overabundance of proline, threonine and histidine residues. The majority of position-dependent amino acid sequence bias is clustered at three positions within the inserted peptides of the dodecapeptide library, +1, +3 and +12 downstream from the signal peptidase cleavage site. Conformational tendency measures of the peptides indicate a significant preference for inserts favoring a {beta}-turn conformation. The observed protein sequence limitations can primarily be attributed to genetic codon degeneracy and signal peptidase cleavage preferences. These data suggest that for applications in which maximal sequence diversity is essential, such as epitope mapping or novel receptor identification, combinatorial peptide libraries should be constructed using codon-corrected trinucleotide cassettes within vector-host systems designed to minimize morphogenesis-related censorship.« less

Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

PubMed Central

Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

2015-01-01

Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

PubMed

Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

2014-01-01

The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

A High-Throughput Arabidopsis Reverse Genetics System

PubMed Central

Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

2002-01-01

A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

PubMed

van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

2012-07-01

Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

PubMed

Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

2014-03-14

Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

Facial asymmetry and clinical manifestations in patients with novel insertion of the TCOF1 gene.

PubMed

Su, P-H; Liu, Y-F; Yu, J-S; Chen, J-Y; Chen, S-J; Lai, Y-J

2012-11-01

This study explored the role of TCOF1 insertion mutations in Taiwanese patients with craniofacial anomalies. Twelve patients with single or multiple, asymmetrical congenital craniofacial anomalies were enrolled. Genomic DNA was prepared from leukocytes; the coding regions of TCOF1 were analyzed by polymerase chain reaction and direct sequencing. Clinical manifestations were correlated to the TCOF1 mutation. Six of 12 patients diagnosed with hemifacial microsomia exhibited a novel insertion mutation 4127 ins G (frameshift) in exon 24 in the TCOF1 gene. All six patients were diagnosed with anomalies on the left side. In addition, four of these six patients had hearing impairment; three had other major anomalies; and two had developmental delay. The insertion caused a frameshift, an early truncation, the loss of two putative nuclear localization signals (residues 1404-1420 and 1424-1440), and the loss of coiled coil domain (1406-1426) in treacle protein. These findings support the existence of two regulators of growth of the mandibular condyles. © 2011 John Wiley & Sons A/S.

L1-associated genomic regions are deleted in somatic cells of the healthy human brain.

PubMed

Erwin, Jennifer A; Paquola, Apuã C M; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy A; Alves, Francisco I A; Butcher, Cheyenne R; Herdy, Joseph R; Sarkar, Anindita; Lasken, Roger S; Muotri, Alysson R; Gage, Fred H

2016-12-01

The healthy human brain is a mosaic of varied genomes. Long interspersed element-1 (LINE-1 or L1) retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that somatic L1-associated variants (SLAVs) are composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs comprises somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition-independent rearrangements in inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2 (also called PSD93), and affect 44-63% of cells of the cells in the healthy brain.

Insertion sequence typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.

PubMed

Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W

1994-12-01

DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

Comparative structural analysis of Bru1 region homeologs in Saccharum spontaneum and S. officinarum

DOE PAGES

Zhang, Jisen; Sharma, Anupma; Yu, Qingyi; ...

2016-06-10

Here, sugarcane is a major sugar and biofuel crop, but genomic research and molecular breeding have lagged behind other major crops due to the complexity of auto-allopolyploid genomes. Sugarcane cultivars are frequently aneuploid with chromosome number ranging from 100 to 130, consisting of 70-80 % S. officinarum, 10-20 % S. spontaneum, and 10 % recombinants between these two species. Analysis of a genomic region in the progenitor autoploid genomes of sugarcane hybrid cultivars will reveal the nature and divergence of homologous chromosomes. As a result, to investigate the origin and evolution of haplotypes in the Bru1 genomic regions in sugarcanemore » cultivars, we identified two BAC clones from S. spontaneum and four from S. officinarum and compared to seven haplotype sequences from sugarcane hybrid R570. The results clarified the origin of seven homologous haplotypes in R570, four haplotypes originated from S. officinarum, two from S. spontaneum and one recombinant.. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence ranged from 18.2 % to 60.5 % with an average of 33. 7 %. Gene content and gene structure were relatively well conserved among the homologous haplotypes. Exon splitting occurred in haplotypes of the hybrid genome but not in its progenitor genomes. Tajima's D analysis revealed that S. spontaneum hapotypes in the Bru1 genomic regions were under strong directional selection. Numerous inversions, deletions, insertions and translocations were found between haplotypes within each genome. In conclusion, this is the first comparison among haplotypes of a modern sugarcane hybrid and its two progenitors. Tajima's D results emphasized the crucial role of this fungal disease resistance gene for enhancing the fitness of this species and indicating that the brown rust resistance gene in R570 is from S. spontaneum. Species-specific InDel, sequences similarity and phylogenetic analysis of homologous genes can be used for identifying the origin of S. spontaneum and S. officinarum haplotype in Saccharum hybrids. Comparison of exon splitting among the homologous haplotypes suggested that the genome rearrangements in Saccharum hybrids S. officinarum would be sufficient for proper genome assembly of this autopolyploid genome. Retrotransposon insertions and sequences variations among the homologous haplotypes sequence divergence may allow sequencing and assembling the autopolyploid Saccharum genomes and the auto-allopolyploid hybrid genomes using whole genome shotgun sequencing.« less

Characterization of the exogenous insert and development of event-specific PCR detection methods for genetically modified Huanong No. 1 papaya.

PubMed

Guo, Jinchao; Yang, Litao; Liu, Xin; Guan, Xiaoyan; Jiang, Lingxi; Zhang, Dabing

2009-08-26

Genetically modified (GM) papaya (Carica papaya L.), Huanong No. 1, was approved for commercialization in Guangdong province, China in 2006, and the development of the Huanong No. 1 papaya detection method is necessary for implementing genetically modified organism (GMO) labeling regulations. In this study, we reported the characterization of the exogenous integration of GM Huanong No. 1 papaya by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. The results suggested that one intact copy of the initial construction was integrated in the papaya genome and which probably resulted in one deletion (38 bp in size) of the host genomic DNA. Also, one unintended insertion of a 92 bp truncated NptII fragment was observed at the 5' end of the exogenous insert. Furthermore, we revealed its 5' and 3' flanking sequences between the insert DNA and the papaya genomic DNA, and developed the event-specific qualitative and quantitative PCR assays for GM Huanong No. 1 papaya based on the 5' integration flanking sequence. The relative limit of detection (LOD) of the qualitative PCR assay was about 0.01% in 100 ng of total papaya genomic DNA, corresponding to about 25 copies of papaya haploid genome. In the quantitative PCR, the limits of detection and quantification (LOD and LOQ) were as low as 12.5 and 25 copies of papaya haploid genome, respectively. In practical sample quantification, the quantified biases between the test and true values of three samples ranged from 0.44% to 4.41%. Collectively, we proposed that all of these results are useful for the identification and quantification of Huanong No. 1 papaya and its derivates.

Dissemination of the highly expressed Bx7 glutenin subunit (Glu-B1al allele) in wheat as revealed by novel PCR markers and RP-HPLC.

PubMed

Butow, B J; Gale, K R; Ikea, J; Juhász, A; Bedö, Z; Tamás, L; Gianibelli, M C

2004-11-01

Increased expression of the high molecular weight glutenin subunit (HMW-GS) Bx7 is associated with improved dough strength of wheat (Triticum aestivum L.) flour. Several cultivars and landraces of widely different genetic backgrounds from around the world have now been found to contain this so-called 'over-expressing' allelic form of the Bx7 subunit encoded by Glu-B1al. Using three methods of identification, SDS-PAGE, RP-HPLC and PCR marker analysis, as well as pedigree information, we have traced the distribution and source of this allele from a Uruguayan landrace, Americano 44D, in the mid-nineteenth century. Results are supported by knowledge of the movement of wheat lines with migrants. All cultivars possessing the Glu-B1al allele can be identified by the following attributes: (1) the elution of the By sub-unit peak before the Dx sub-unit peak by RP-HPLC, (2) high expression levels of Bx7 (>39% Mol% Bx), (3) a 43 bp insertion in the matrix-attachment region (MAR) upstream of the gene promoter relative to Bx7 and an 18 bp nucleotide duplication in the coding region of the gene. Evidence is presented indicating that these 18 and 43 bp sequence insertions are not causal for the high expression levels of Bx7 as they were also found to be present in a small number of hexaploid species, including Chinese Spring, and species expressing Glu-B1ak and Glu-B1a alleles. In addition, these sequence inserts were found in different isolates of the tetraploid wheat, T. turgidum, indicating that these insertion/deletion events occurred prior to hexaploidization.

MERE1, a low-copy-number copia-type retroelement in Medicago truncatula active during tissue culture.

PubMed

Rakocevic, Alexandra; Mondy, Samuel; Tirichine, Leïla; Cosson, Viviane; Brocard, Lysiane; Iantcheva, Anelia; Cayrel, Anne; Devier, Benjamin; Abu El-Heba, Ghada Ahmed; Ratet, Pascal

2009-11-01

We have identified an active Medicago truncatula copia-like retroelement called Medicago RetroElement1-1 (MERE1-1) as an insertion in the symbiotic NSP2 gene. MERE1-1 belongs to a low-copy-number family in the sequenced Medicago genome. These copies are highly related, but only three of them have a complete coding region and polymorphism exists between the long terminal repeats of these different copies. This retroelement family is present in all M. truncatula ecotypes tested but also in other legume species like Lotus japonicus. It is active only during tissue culture in both R108 and Jemalong Medicago accessions and inserts preferentially in genes.

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

PubMed

Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

2014-09-01

Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

PubMed

Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

2011-01-01

In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

Utilization of next generation sequencing for analyzing transgenic insertions in plum

USDA-ARS?s Scientific Manuscript database

When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

The Role(s) of Heparan Sulfate Proteoglycan(s) in the wnt-1 Signaling Pathway

DTIC Science & Technology

1998-08-01

First , the sequence of the cDNA, when compared to the genomic site of insertion of the P-element, revealed that the P-element is inserted 686 bp...stages 8 to 13 (Yoffe et al. 1995). We first examined whether ectopic expression of Wgts effectively restores the naked cuticle as it does in wg and...by Kjell~n and Lindahl, 1991) . HS/heparin N-deacetylase/N-sulfotransferase catalyzes N-deacetylation and N-sulfation that is the first and key step

A Truncated AdeS Kinase Protein Generated by ISAba1 Insertion Correlates with Tigecycline Resistance in Acinetobacter baumannii

PubMed Central

Sun, Jun-Ren; Perng, Cherng-Lih; Chan, Ming-Chin; Morita, Yuji; Lin, Jung-Chung; Su, Chih-Mao; Wang, Wei-Yao; Chang, Tein-Yao; Chiueh, Tzong-Shi

2012-01-01

Over-expression of AdeABC efflux pump stimulated continuously by the mutated AdeRS two component system has been found to result in antimicrobial resistance, even tigecycline (TGC) resistance, in multidrug-resistant Acinetobacter baumannii (MRAB). Although the insertion sequence, ISAba1, contributes to one of the AdeRS mutations, the detail mechanism remains unclear. In the present study we collected 130 TGC-resistant isolates from 317 carbapenem resistant MRAB (MRAB-C) isolates, and 38 of them were characterized with ISAba1 insertion in the adeS gene. The relationship between the expression of AdeABC efflux pump and TGC resistant was verified indirectly by successfully reducing TGC resistance with NMP, an efflux pump inhibitor. Further analysis showed that the remaining gene following the ISAba1 insertion was still transcribed to generate a truncated AdeS protein by the Pout promoter on ISAba1 instead of frame shift or pre-termination. Through introducing a series of recombinant adeRS constructs into a adeRS knockout strain, we demonstrated the truncated AdeS protein was constitutively produced and stimulating the expression of AdeABC efflux pump via interaction with AdeR. Our findings suggest a mechanism of antimicrobial resistance induced by an aberrant cytoplasmic sensor derived from an insertion element. PMID:23166700

A surprisingly large RNase P RNA in Candida glabrata

PubMed Central

KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG

2005-01-01

We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816

Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

PubMed Central

Hobbs, A A; Rosen, J M

1982-01-01

The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

PubMed

Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

2003-11-01

We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

PubMed

Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

2018-06-01

Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

PubMed

Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

2012-05-03

Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

Ac-immobilized, a stable source of Activator transposase that mediates sporophytic and gametophytic excision of Dissociation elements in maize.

PubMed

Conrad, Liza J; Brutnell, Thomas P

2005-12-01

We have identified and characterized a novel Activator (Ac) element that is incapable of excision yet contributes to the canonical negative dosage effect of Ac. Cloning and sequence analysis of this immobilized Ac (Ac-im) revealed that it is identical to Ac with the exception of a 10-bp deletion of sequences at the left end of the element. In screens of approximately 6800 seeds, no germinal transpositions of Ac-im were detected. Importantly, Ac-im catalyzes germinal excisions of a Ds element resident at the r1 locus resulting in the recovery of independent transposed Ds insertions in approximately 4.5% of progeny kernels. Many of these transposition events occur during gametophytic development. Furthermore, we demonstrate that Ac-im transactivates multiple Ds insertions in somatic tissues including those in reporter alleles at bronze1, anthocyaninless1, and anthocyaninless2. We propose a model for the generation of Ac-im as an aberrant transposition event that failed to generate an 8-bp target site duplication and resulted in the deletion of Ac end sequences. We also discuss the utility of Ac-im in two-component Ac/Ds gene-tagging programs in maize.

Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

PubMed

Birchler, James A; Presting, Gernot G

2012-04-01

The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

The Tc1/mariner transposable element family shapes genetic variation and gene expression in the protist Trichomonas vaginalis

PubMed Central

2014-01-01

Background Trichomonas vaginalis is the most prevalent non-viral sexually transmitted parasite. Although the protist is presumed to reproduce asexually, 60% of its haploid genome contains transposable elements (TEs), known contributors to genome variability. The availability of a draft genome sequence and our collection of >200 global isolates of T. vaginalis facilitate the study and analysis of TE population dynamics and their contribution to genomic variability in this protist. Results We present here a pilot study of a subset of class II Tc1/mariner TEs that belong to the T. vaginalis Tvmar1 family. We report the genetic structure of 19 Tvmar1 loci, their ability to encode a full-length transposase protein, and their insertion frequencies in 94 global isolates from seven regions of the world. While most of the Tvmar1 elements studied exhibited low insertion frequencies, two of the 19 loci (locus 1 and locus 9) show high insertion frequencies of 1.00 and 0.96, respectively. The genetic structuring of the global populations identified by principal component analysis (PCA) of the Tvmar1 loci is in general agreement with published data based on genotyping, showing that Tvmar1 polymorphisms are a robust indicator of T. vaginalis genetic history. Analysis of expression of 22 genes flanking 13 Tvmar1 loci indicated significantly altered expression of six of the genes next to five Tvmar1 insertions, suggesting that the insertions have functional implications for T. vaginalis gene expression. Conclusions Our study is the first in T. vaginalis to describe Tvmar1 population dynamics and its contribution to genetic variability of the parasite. We show that a majority of our studied Tvmar1 insertion loci exist at very low frequencies in the global population, and insertions are variable between geographical isolates. In addition, we observe that low frequency insertion is related to reduced or abolished expression of flanking genes. While low insertion frequencies might be expected, we identified two Tvmar1 insertion loci that are fixed across global populations. This observation indicates that Tvmar1 insertion may have differing impacts and fitness costs in the host genome and may play varying roles in the adaptive evolution of T. vaginalis. PMID:24834134

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

PubMed Central

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

2011-01-01

Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

Processing of intervening sequences: a new yeast mutant which fails to excise intervening sequences from precursor tRNAs.

PubMed

Hopper, A K; Schultz, L D; Shapiro, R A

1980-03-01

By using conditional loss of suppression an an assay, we have been successful in screening for a yeast mutant which is defective in tRNA processing. The los1-1 mutation causes an accumulation of a subset of precursor tRNAs at the nonpermissive temperature. These pre-tRNAs are like those which accumulate in the yeast mutant ts 136 (rna1) in that they have transcribed intervening sequences. The mutations at los1-1 and rna1 complement and segregate independently of each other. The los1-1 mutation affects the expression of all 8 tyrosine-inserting suppressor loci, but does not seem to affect rRNA or mRNA synthesis.

Characterization of Four Multidrug Resistance Plasmids Captured from the Sediments of an Urban Coastal Wetland

PubMed Central

Botts, Ryan T.; Apffel, Brooke A.; Walters, C. J.; Davidson, Kelly E.; Echols, Ryan S.; Geiger, Michael R.; Guzman, Victoria L.; Haase, Victoria S.; Montana, Michal A.; La Chat, Chip A.; Mielke, Jenna A.; Mullen, Kelly L.; Virtue, Cierra C.; Brown, Celeste J.; Top, Eva M.; Cummings, David E.

2017-01-01

Self-transmissible and mobilizable plasmids contribute to the emergence and spread of multidrug-resistant bacteria by enabling the horizontal transfer of acquired antibiotic resistance. The objective of this study was to capture and characterize self-transmissible and mobilizable resistance plasmids from a coastal wetland impacted by urban stormwater runoff and human wastewater during the rainy season. Four plasmids were captured, two self-transmissible and two mobilizable, using both mating and enrichment approaches. Plasmid genomes, sequenced with either Illumina or PacBio platforms, revealed representatives of incompatibility groups IncP-6, IncR, IncN3, and IncF. The plasmids ranged in size from 36 to 144 kb and encoded known resistance genes for most of the major classes of antibiotics used to treat Gram-negative infections (tetracyclines, sulfonamides, β-lactams, fluoroquinolones, aminoglycosides, and amphenicols). The mobilizable IncP-6 plasmid pLNU-11 was discovered in a strain of Citrobacter freundii enriched from the wetland sediments with tetracycline and nalidixic acid, and encodes a novel AmpC-like β-lactamase (blaWDC-1), which shares less than 62% amino acid sequence identity with the PDC class of β-lactamases found in Pseudomonas aeruginosa. Although the IncR plasmid pTRE-1611 was captured by mating wetland bacteria with P. putida KT2440 as recipient, it was found to be mobilizable rather than self-transmissible. Two self-transmissible multidrug-resistance plasmids were also captured: the small (48 kb) IncN3 plasmid pTRE-131 was captured by mating wetland bacteria with Escherichia coli HY842 where it is seemed to be maintained at nearly 240 copies per cell, while the large (144 kb) IncF plasmid pTRE-2011, which was isolated from a cefotaxime-resistant environmental strain of E. coli ST744, exists at just a single copy per cell. Furthermore, pTRE-2011 bears the globally epidemic blaCTX-M-55 extended-spectrum β-lactamase downstream of ISEcp1. Our results indicate that urban coastal wetlands are reservoirs of diverse self-transmissible and mobilizable plasmids of relevance to human health. PMID:29067005

In vivo field-cycling relaxometry using an insert coil for magnetic field offset.

PubMed

Pine, Kerrin J; Goldie, Fred; Lurie, David J

2014-11-01

The T(1) of tissue has a strong dependence on the measurement magnetic field strength. T(1) -dispersion could be a useful contrast parameter, but is unavailable to clinical MR systems which operate at fixed magnetic field strength. The purpose of this work was to implement a removable insert magnet coil for field-cycling T(1) -dispersion measurements on a vertical-field MRI scanner, by offsetting the static field over a volume of interest. An insert magnet coil was constructed for use with a whole-body sized 59 milli-Tesla (mT) vertical-field, permanent-magnet based imager. The coil has diameter 38 cm and thickness 6.1 cm and a homogeneous region (± 5%) of 5 cm DSV, offset by 5 cm from the coil surface. Surface radiofrequency (RF) coils were also constructed. The insert coil was used in conjunction with a surface RF coil and a volume-localized inversion-recovery pulse sequence to plot T(1) -dispersion in a human volunteer's forearm over a range of field strengths from 1 mT to 70 mT. T(1) -dispersion measurements were demonstrated on a fixed-field MRI scanner, using an insert coil. This demonstrates the feasibility of relaxation dispersion measurements on an otherwise conventional MR imager, facilitating the exploitation of T(1) -dispersion contrast for enhanced diagnosis. Copyright © 2013 Wiley Periodicals, Inc.

The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

PubMed Central

Trinh, T. Q.; Sinden, R. R.

1993-01-01

We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Functional impact of the human mobilome.

PubMed

Babatz, Timothy D; Burns, Kathleen H

2013-06-01

The human genome is replete with interspersed repetitive sequences derived from the propagation of mobile DNA elements. Three families of human retrotransposons remain active today: LINE1, Alu, and SVA elements. Since 1988, de novo insertions at previously recognized disease loci have been shown to generate highly penetrant alleles in Mendelian disorders. Only recently has the extent of germline-transmitted retrotransposon insertion polymorphism (RIP) in human populations been fully realized. Also exciting are recent studies of somatic retrotransposition in human tissues and reports of tumor-specific insertions, suggesting roles in tissue heterogeneity and tumorigenesis. Here we discuss mobile elements in human disease with an emphasis on exciting developments from the last several years. Copyright © 2013 Elsevier Ltd. All rights reserved.

Gene conversion as a mechanism for divergence of a chloroplast tRNA gene inserted in the mitochondrial genome of Brassica oleracea.

PubMed Central

Dron, M; Hartmann, C; Rode, A; Sevignac, M

1985-01-01

We have characterized a 1.7 kb sequence, containing a tRNA Leu2 gene shared by the ct and mt genomes of Brassica oleracea. The two sequences are completely homologous except in two short regions where two distinct gene conversion events have occurred between two sets of direct repeats leading to the insertion of 5 bp in the T loop of the mt copy of the ct gene. This is the first evidence that gene conversion represents the initial evolutionary step in inactivation of transferred ct genes in the mt genome. We also indicate that organelle DNA transfer by organelle fusion is an ongoing process which could be useful in genetic engineering. PMID:4080548

The Wnt-1 (int-1) oncogene promoter and its mechanism of activation by insertion of proviral DNA of the mouse mammary tumor virus.

PubMed Central

Nusse, R; Theunissen, H; Wagenaar, E; Rijsewijk, F; Gennissen, A; Otte, A; Schuuring, E; van Ooyen, A

1990-01-01

Wnt-1 (int-1) is a cellular oncogene often activated by insertion of proviral DNA of the mouse mammary tumor virus. We have mapped the 5' end and the promoter area of the Wnt-1 gene by nuclease protection and primer extension assays. In differentiating P19 embryonal carcinoma cells, in which Wnt-1 is naturally expressed, two start sites of transcription were found, one preceded by two TATA boxes and one preceded by several GC boxes. In P19 cells, a 1-kilobase upstream sequence of Wnt-1 was able to confer differentiation-specific expression on a heterologous gene. We have investigated how Wnt-1 transcription was affected by mouse mammary tumor virus proviral integrations in various configurations near the promoters of the gene. One provirus has been inserted in the 5' nontranslated part of Wnt-1, in the same transcriptional orientation, and has functionally replaced the Wnt-1 promoters. Wnt-1 transcription in this tumor starts in the right long terminal repeat of the provirus, with considerable readthrough transcription from the left long terminal repeat. Another provirus has been inserted in the orientation opposite that of Wnt-1 into a GC box, disrupting the first Wnt-1 transcription start site but not the downstream start site. Most insertions have not structurally altered the Wnt-1 transcripts and have enhanced the activity of the normal two promoters. Images PMID:1695322

Cloning and Expression of the Erwinia carotovora subsp. carotovora Gene Encoding the Low-Molecular-Weight Bacteriocin Carocin S1▿

PubMed Central

Chuang, Duen-yau; Chien, Yung-chei; Wu, Huang-Pin

2007-01-01

The purpose of this study was to clone the carocin S1 gene and express it in a non-carocin-producing strain of Erwinia carotovora. A mutant, TH22-10, which produced a high-molecular-weight bacteriocin but not a low-molecular-weight bacteriocin, was obtained by Tn5 insertional mutagenesis using H-rif-8-2 (a spontaneous rifampin-resistant mutant of Erwinia carotovora subsp. carotovora 89-H-4). Using thermal asymmetric interlaced PCR, the DNA sequence from the Tn5 insertion site and the DNA sequence of the contiguous 2,280-bp region were determined. Two complete open reading frames (ORF), designated ORF2 and ORF3, were identified within the sequence fragment. ORF2 and ORF3 were identified with the carocin S1 genes, caroS1K (ORF2) and caroS1I (ORF3), which, respectively, encode a killing protein (CaroS1K) and an immunity protein (CaroS1I). These genes were homologous to the pyocin S3 gene and the pyocin AP41 gene. Carocin S1 was expressed in E. carotovora subsp. carotovora Ea1068 and replicated in TH22-10 but could not be expressed in Escherichia coli (JM101) because a consensus sequence resembling an SOS box was absent. A putative sequence similar to the consensus sequence for the E. coli cyclic AMP receptor protein binding site (−312 bp) was found upstream of the start codon. Production of this bacteriocin was also induced by glucose and lactose. The homology search results indicated that the carocin S1 gene (between bp 1078 and bp 1704) was homologous to the pyocin S3 and pyocin AP41 genes in Pseudomonas aeruginosa. These genes encode proteins with nuclease activity (domain 4). This study found that carocin S1 also has nuclease activity. PMID:17071754

Identification of Novel Virulence Determinants in Mycobacterium paratuberculosis by Screening a Library of Insertional Mutants†

PubMed Central

Shin, Sung Jae; Wu, Chia-wei; Steinberg, Howard; Talaat, Adel M.

2006-01-01

Johne's disease, caused by Mycobacterium paratuberculosis infection, is a worldwide problem for the dairy industry and has a possible involvement in Crohn's disease in humans. To identify virulence determinants of this economically important pathogen, a library of 5,060 transposon mutants was constructed using Tn5367 insertion mutagenesis, followed by large-scale sequencing to identify disrupted genes. In this report, 1,150 mutants were analyzed and 970 unique insertion sites were identified. Sequence analysis of the disrupted genes indicated that the insertion of Tn5367 was more prevalent in genomic regions with G+C content (50.5 to 60.5%) lower than the average G+C content (69.3%) of the rest of the genome. Phenotypic screening of the library identified disruptions of genes involved in iron, tryptophan, or mycolic acid metabolic pathways that displayed unique growth characteristics. Bioinformatic analysis of disrupted genes identified a list of potential virulence determinants for further testing with animals. Mouse infection studies showed a significant decrease in tissue colonization by mutants with a disruption in the gcpE, pstA, kdpC, papA2, impA, umaA1, or fabG2_2 gene. Attenuation phenotypes were tissue specific (e.g., for the umaA1 mutant) as well as time specific (e.g., for the impA mutant), suggesting that those genes may be involved in different virulence mechanisms. The identified potential virulence determinants represent novel functional classes that could be necessary for mycobacterial survival during infection and could provide suitable targets for vaccine and drug development against Johne's and Crohn's diseases. PMID:16790754

A functional 12T-insertion polymorphism in the ATP1A1 promoter confers decreased susceptibility to hypertension in a male Sardinian population.

PubMed

Herrera, Victoria L; Pasion, Khristine A; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5'-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28-0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/- male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/- mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population.

A Functional 12T-Insertion Polymorphism in the ATP1A1 Promoter Confers Decreased Susceptibility to Hypertension in a Male Sardinian Population

PubMed Central

Herrera, Victoria L.; Pasion, Khristine A.; Moran, Ann Marie; Zaninello, Roberta; Ortu, Maria Francesca; Fresu, Giovanni; Piras, Daniela Antonella; Argiolas, Giuseppe; Troffa, Chiara; Glorioso, Valeria; Masala, Wanda; Glorioso, Nicola; Ruiz-Opazo, Nelson

2015-01-01

Identification of susceptibility genes for essential hypertension in humans has been a challenge due to its multifactorial pathogenesis complicated by gene-gene and gene-environment interactions, developmental programing and sex specific differences. These concurrent features make identification of causal hypertension susceptibility genes with a single approach difficult, thus requiring multiple lines of evidence involving genetic, biochemical and biological experimentation to establish causal functional mutations. Here we report experimental evidence encompassing genetic, biochemical and in vivo modeling that altogether support ATP1A1 as a hypertension susceptibility gene in males in Sardinia, Italy. ATP1A1 encodes the α1Na,K-ATPase isoform, the sole sodium pump in vascular endothelial and renal tubular epithelial cells. DNA-sequencing detected a 12-nucleotide long thymidine (12T) insertion(ins)/deletion(del) polymorphism within a poly-T sequence (38T vs 26T) in the ATP1A1 5’-regulatory region associated with hypertension in a male Sardinian population. The 12T-insertion allele confers decreased susceptibility to hypertension (P = 0.035; OR = 0.50 [0.28–0.93]) accounting for 12.1 mmHg decrease in systolic BP (P = 0.02) and 6.6 mmHg in diastolic BP (P = 0.046). The ATP1A1 promoter containing the 12T-insertion exhibited decreased transcriptional activity in in vitro reporter-assay systems, indicating decreased α1Na,K-ATPase expression with the 12T-insertion, compared with the 12T-deletion ATP1A1 promoter. To test the effects of decreased α1Na,K-ATPase expression on blood pressure, we measured blood pressure by radiotelemetry in three month-old, highly inbred heterozygous knockout ATP1A1+/− male mice with resultant 58% reduction in ATP1A1 protein levels. Male ATP1A1+/− mice showed significantly lower blood pressure (P < 0.03) than age-matched male wild-type littermate controls. Concordantly, lower ATP1A1 expression is expected to lower Na-reabsorption in the kidney thereby decreasing sodium-associated risk for hypertension and sodium-induced endothelial stiffness and dysfunction. Altogether, data support ATP1A1 as a hypertension susceptibility gene in a male Sardinian population, and mandate further investigation of its involvement in hypertension in the general population. PMID:25615575

Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

PubMed

Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

2017-08-01

There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

Import of honeybee prepromelittin into the endoplasmic reticulum: structural basis for independence of SRP and docking protein.

PubMed Central

Müller, G; Zimmermann, R

1987-01-01

Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722

The molecular biology of environmental aromatic hydrocarbons: Progress report for the period September 1, 1986 through July 31, 1987

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weiss, S.B.

Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less

Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

PubMed Central

Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

2009-01-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

Genome-wide transposon mutagenesis in pathogenic Leptospira species.

PubMed

Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

2009-02-01

Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

Persistence and Epidemic Propagation of a Pseudomonas aeruginosa Sequence Type 235 Clone Harboring an IS26 Composite Transposon Carrying the blaIMP-1 Integron in Hiroshima, Japan, 2005 to 2012

PubMed Central

Shimizu, Wataru; Kayama, Shizuo; Kouda, Shuntaro; Ogura, Yoshitoshi; Kobayashi, Kanao; Shigemoto, Norifumi; Shimada, Norimitsu; Yano, Raita; Hisatsune, Junzo; Kato, Fuminori; Hayashi, Tetsuya; Sueda, Taijiro; Ohge, Hiroki

2015-01-01

A 9-year surveillance for multidrug-resistant (MDR) Pseudomonas aeruginosa in the Hiroshima region showed that the number of isolates harboring the metallo-β-lactamase gene blaIMP-1 abruptly increased after 2004, recorded the highest peak in 2006, and showed a tendency to decline afterwards, indicating a history of an epidemic. PCR mapping of the variable regions of the integrons showed that this epidemic was caused by the clonal persistence and propagation of an MDR P. aeruginosa strain harboring the blaIMP-1 gene and an aminoglycoside 6′-N-acetyltransferase gene, aac(6′)-Iae in a class I integron (In113), whose integrase gene intl1 was disrupted by an IS26 insertion. Sequence analysis of the representative strain PA058447 resistance element containing the In113-derived gene cassette array showed that the element forms an IS26 transposon embedded in the chromosome. It has a Tn21 backbone and is composed of two segments sandwiched by three IS26s. In Japan, clonal nationwide expansion of an MDR P. aeruginosa NCGM2.S1 harboring chromosomally encoded In113 with intact intl1 is reported. Multilocus sequence typing and genomic comparison strongly suggest that PA058447 and NCGM2.S1 belong to the same clonal lineage. Moreover, the structures of the resistance element in the two strains are very similar, but the sites of insertion into the chromosome are different. Based on tagging information of the IS26 present in both resistance elements, we suggest that the MDR P. aeruginosa clone causing the epidemic in Hiroshima for the past 9 years originated from a common ancestor genome of PA058447 and NCGM2.S1 through an IS26 insertion into intl1 of In113 and through IS26-mediated genomic rearrangements. PMID:25712351

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Nucleotide sequences of bovine alpha S1- and kappa-casein cDNAs.

PubMed Central

Stewart, A F; Willis, I M; Mackinlay, A G

1984-01-01

The nucleotide sequences corresponding to bovine alpha S1- and kappa-casein mRNAs are presented. An unusual alpha S1-casein cDNA has been characterised whose 5' end commences upstream from its putative TATA box. The alpha S1-casein mRNA is compared to rat alpha-casein mRNA and two components of divergence are identified. Firstly, the two sequences have diverged at a high point mutation rate and the rate of amino acid replacement by this mechanism is at least as great as the rate of divergence of any other part of the mRNAs. Secondly, the protein coding sequence has been subjected to several insertion/deletion events, one of which may be an example of exon shuffling . The kappa-casein mRNA sequence verifies the proposition that it has arisen from a different ancestral gene to the other caseins. Images PMID:6328443

MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

PubMed Central

Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

2011-01-01

We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

Active role of a human genomic insert in replication of a yeast artificial chromosome.

PubMed

van Brabant, A J; Fangman, W L; Brewer, B J

1999-06-01

Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

PubMed

Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

2018-03-01

Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

Rates and patterns of great ape retrotransposition.

PubMed

Hormozdiari, Fereydoun; Konkel, Miriam K; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H; Huddleston, John; Catacchio, Claudia R; Ko, Arthur; Malig, Maika; Baker, Carl; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A; Eichler, Evan E

2013-08-13

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r(2) = 0.65) in contrast to Alu repeats, which show little correlation (r(2) = 0.07). We estimate that the "rate" of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation--the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human-great ape evolution, with increases and decreases occurring over very short periods of evolutionary time.

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

PubMed

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

PubMed Central

Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

2012-01-01

Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

Turnover of R1 (Type I) and R2 (Type Ii) Retrotransposable Elements in the Ribosomal DNA of Drosophila Melanogaster

PubMed Central

Jakubczak, J. L.; Zenni, M. K.; Woodruff, R. C.; Eickbush, T. H.

1992-01-01

R1 and R2 are distantly related non-long terminal repeat retrotransposable elements each of which inserts into a specific site in the 28S rRNA genes of most insects. We have analyzed aspects of R1 and R2 abundance and sequence variation in 27 geographical isolates of Drosophila melanogaster. The fraction of 28S rRNA genes containing these elements varied greatly between strains, 17-67% for R1 elements and 2-28% for R2 elements. The total percentage of the rDNA repeats inserted ranged from 32 to 77%. The fraction of the rDNA repeats that contained both of these elements suggested that R1 and R2 exhibit neither an inhibition of nor preference for insertion into a 28S gene already containing the other type of element. Based on the conservation of restriction sites in the elements of all strains, and sequence analysis of individual elements from three strains, nucleotide divergence is very low for R1 and R2 elements within or between strains (<0.6%). This sequence uniformity is the expected result of the forces of concerted evolution (unequal crossovers and gene conversion) which act on the rRNA genes themselves. Evidence for the role of retrotransposition in the turnover of R1 and R2 was obtained by using naturally occurring 5' length polymorphisms of the elements as markers for independent transposition events. The pattern of these different length 5' truncations of R1 and R2 was found to be diverse and unique to most strains analyzed. Because recombination can only, with time, amplify or eliminate those length variants already present, the diversity found in each strain suggests that retrotransposition has played a critical role in maintaining these elements in the rDNA repeats of D. melanogaster. PMID:1317313

Fine tangled pili expressed by Haemophilus ducreyi are a novel class of pili.

PubMed Central

Brentjens, R J; Ketterer, M; Apicella, M A; Spinola, S M

1996-01-01

Haemophilus ducreyi synthesizes fine, tangled pili composed predominantly of a protein whose apparent molecular weight is 24,000 (24K). A hybridoma, 2D8, produced a monoclonal antibody (MAb) that bound to a 24K protein in H. ducreyi strains isolated from diverse geographic locations. A lambda gt11 H. ducreyi library was screened with MAb 2D8. A 3.5-kb chromosomal insert from one reactive plaque was amplified and ligated into the pCRII vector. The recombinant plasmid, designated pHD24, expressed a 24K protein in Escherichia coli INV alpha F that bound MAb 2D8. The coding sequence of the 24K gene was localized by exonuclease III digestion. The insert contained a 570-bp open reading frame, designated ftpA (fine, tangled pili). Translation of ftpA predicted a polypeptide with a molecular weight of 21.1K. The predicted N-terminal amino acid sequence of the polypeptide encoded by ftpA was identical to the N-terminal amino acid sequence of purified pilin and lacked a cleavable signal sequence. Primer extension analysis of ftpA confirmed the lack of a leader peptide. The predicted amino acid sequence lacked homology to known pilin sequences but shared homology with the sequences of E. coli Dps and Treponema pallidum antigen TpF1 or 4D, proteins which associate to form ordered rings. An isogenic pilin mutant, H. ducreyi 35000ftpA::mTn3(Cm), was constructed by shuttle mutagenesis and did not contain pili when examined by electron microscopy. We conclude that H. ducreyi synthesizes fine, tangled pili that are composed of a unique major subunit, which may be exported by a signal sequence independent mechanism. PMID:8550517

Sequence determination and analysis of S-adenosyl-L-homocysteine hydrolase from yellow lupine (Lupinus luteus).

PubMed

Brzeziński, K; Janowski, R; Podkowiński, J; Jaskólski, M

2001-01-01

The coding sequences of two S-adenosyl-L-homocysteine hydrolases (SAHases) were identified in yellow lupine by screenig of a cDNA library. One of them, corresponding to the complete protein, was sequenced and compared with 52 other SAHase sequences. Phylogenetic analysis of these proteins identified three groups of the enzymes. Group A comprises only bacterial sequences. Group B is subdivided into two subgroups, one of which (B1) is formed by animal sequences. Subgroup B2 consist of two distinct clusters, B2a and B2b. Cluster B2b comprises all known plant sequences, including the yellow lupine enzyme, which are distinguished by a 50-residue insert. Group C is heterogeneous and contains SAHases from Archaea as well as a new class of animal enzymes, distinctly different from those in group B1.

Insertion sequences enrichment in extreme Red sea brine pool vent.

PubMed

Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

2017-03-01

Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

PubMed Central

Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

2012-01-01

The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

DYZ1 arrays show sequence variation between the monozygotic males

PubMed Central

2014-01-01

Background Monozygotic twins (MZT) are an important resource for genetical studies in the context of normal and diseased genomes. In the present study we used DYZ1, a satellite fraction present in the form of tandem arrays on the long arm of the human Y chromosome, as a tool to uncover sequence variations between the monozygotic males. Results We detected copy number variation, frequent insertions and deletions within the sequences of DYZ1 arrays amongst all the three sets of twins used in the present study. MZT1b showed loss of 35 bp compared to that in 1a, whereas 2a showed loss of 31 bp compared to that in 2b. Similarly, 3b showed 10 bp insertion compared to that in 3a. MZT1a germline DNA showed loss of 5 bp and 1b blood DNA showed loss of 26 bp compared to that of 1a blood and 1b germline DNA, respectively. Of the 69 restriction sites detected in DYZ1 arrays, MboII, BsrI, TspEI and TaqI enzymes showed frequent loss and or gain amongst all the 3 pairs studied. MZT1 pair showed loss/gain of VspI, BsrDI, AgsI, PleI, TspDTI, TspEI, TfiI and TaqI restriction sites in both blood and germline DNA. All the three sets of MZT showed differences in the number of DYZ1 copies. FISH signals reflected somatic mosaicism of the DYZ1 copies across the cells. Conclusions DYZ1 showed both sequence and copy number variation between the MZT males. Sequence variation was also noticed between germline and blood DNA samples of the same individual as we observed at least in one set of sample. The result suggests that DYZ1 faithfully records all the genetical changes occurring after the twining which may be ascribed to the environmental factors. PMID:24495361

A Sequence of Sorting Strategies.

ERIC Educational Resources Information Center

Duncan, David R.; Litwiller, Bonnie H.

1984-01-01

Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

Targeting the Atypical Chemokine Receptor ACKR3/CXCR7: Phase 1 - Phage Display Peptide Identification and Characterization.

PubMed

Vestal, R D; LaJeunesse, D R; Taylor, E W

2016-01-01

One of the greatest challenges in fighting cancer is cell targeting and biomarker selection. The Atypical Chemokine Receptor ACKR3/CXCR7 is expressed on many cancer cell types, including breast cancer and glioblastoma, and binds the endogenous ligands SDF1/CXCL12 and ITAC/CXCL11. A 20 amino acid region of the ACKR3/CXCR7 N-terminus was synthesized and targeted with the NEB PhD-7 Phage Display Peptide Library. Twenty-nine phages were isolated and heptapeptide inserts sequenced; of these, 23 sequences were unique. A 3D molecular model was created for the ACKR3/CXCR7 N-terminus by mutating the corresponding region of the crystal structure of CXCR4 with bound SDF1/CXCL12. A ClustalW alignment was performed on each peptide sequence using the entire SDF1/CXCL12 sequence as the template. The 23-peptide sequences showed similarity to three distinct regions of the SDF1/CXCL12 molecule. A 3D molecular model was made for each of the phage peptide inserts to visually identify potential areas of steric interference of peptides that simulated CXCL12 regions not in contact with the receptor's Nterminus. An ELISA analysis of the relative binding affinity between the peptides identified 9 peptides with statistically significant results. The candidate pool of 9 peptides was further reduced to 3 peptides based on their affinity for the targeted N-terminus region peptide versus no target peptide present or a scrambled negative control peptide. The results clearly show the Phage Display protocol can be used to target a synthesized region of the ACKR3/CXCR7 N-terminus. The 3 peptides chosen, P20, P3, and P9, will be the basis for further targeting studies.

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

PubMed Central

Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

2007-01-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

PubMed

Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

2007-10-01

AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

A Novel Locomotion-based Validation Assay for Candidate Drugs Using Drosophila DYT1 Disease Model

DTIC Science & Technology

2014-06-01

rescue the locomotion defects of Drosophila larvae caused by the expression of human torsinAΔE. These results demonstrated that human torsinA can... Drosophila dtorsin∆D transgenic lines dtorsin∆E and dtorsin∆D cDNA constructs were made from the wild type dtorsin cDNA using QuikChange II XL Site...After confirming mutated sequences , the insert was again cut out with EcoRI and NotI and inserted between EcoRI and NotI sites of pUAST [2] to produce

Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information

PubMed Central

McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash

2018-01-01

ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869

Fission yeast retrotransposon Tf1 integration is targeted to 5' ends of open reading frames.

PubMed

Behrens, R; Hayles, J; Nurse, P

2000-12-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100-420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed.

Fission yeast retrotransposon Tf1 integration is targeted to 5′ ends of open reading frames

PubMed Central

Behrens, Ralf; Hayles, Jacky; Nurse, Paul

2000-01-01

Target site selection of transposable elements is usually not random but involves some specificity for a DNA sequence or a DNA binding host factor. We have investigated the target site selection of the long terminal repeat-containing retrotransposon Tf1 from the fission yeast Schizosaccharomyces pombe. By monitoring induced transposition events we found that Tf1 integration sites were distributed throughout the genome. Mapping these insertions revealed that Tf1 did not integrate into open reading frames, but occurred preferentially in longer intergenic regions with integration biased towards a region 100–420 bp upstream of the translation start site. Northern blot analysis showed that transcription of genes adjacent to Tf1 insertions was not significantly changed. PMID:11095681

The distribution of a phage-related insertion sequence element in the cyanobacterium, Microcystis aeruginosa.

PubMed

Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko

2010-01-01

The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.

Recognition of the CDEI motif GTCACATG by mouse nuclear proteins and interference with the early development of the mouse embryo.

PubMed Central

Blangy, A; Léopold, P; Vidal, F; Rassoulzadegan, M; Cuzin, F

1991-01-01

We have reported previously (1) two unexpected consequences of the microinjection into fertilized mouse eggs of a recombinant plasmid designated p12B1, carrying a 343 bp insert of non-repetitive mouse DNA. Injected at very low concentrations, this plasmid could be established as an extrachromosomal genetic element. When injected in greater concentration, an early arrest of embryonic development resulted. In the present work, we have studied this toxic effect in more detail by microinjecting short synthetic oligonucleotides with sequences from the mouse insert. Lethality was associated with the nucleotide sequence GTCACATG, identical with the CDEl element of yeast centromeres. Development of injected embryos was arrested between the one-cell and the early morula stages, with abnormal structures and DNA contents. Electrophoretic mobility shift and DNAse foot-printing assays demonstrated the binding of mouse nuclear protein(s) to the CDEl-like box. Base changes within the CDEl sequence prevented both the toxic effects in embryos and the formation of protein complex in vitro, suggesting that protein binding at such sites in chromosomal DNA plays an important role in early development. Images PMID:1766880

Short Communication: Analysis of Minor Populations of Human Immunodeficiency Virus by Primer Identification and Insertion-Deletion and Carry Forward Correction Pipelines.

PubMed

Hughes, Paul; Deng, Wenjie; Olson, Scott C; Coombs, Robert W; Chung, Michael H; Frenkel, Lisa M

2016-03-01

Accurate analysis of minor populations of drug-resistant HIV requires analysis of a sufficient number of viral templates. We assessed the effect of experimental conditions on the analysis of HIV pol 454 pyrosequences generated from plasma using (1) the "Insertion-deletion (indel) and Carry Forward Correction" (ICC) pipeline, which clusters sequence reads using a nonsubstitution approach and can correct for indels and carry forward errors, and (2) the "Primer Identification (ID)" method, which facilitates construction of a consensus sequence to correct for sequencing errors and allelic skewing. The Primer ID and ICC methods produced similar estimates of viral diversity, but differed in the number of sequence variants generated. Sequence preparation for ICC was comparably simple, but was limited by an inability to assess the number of templates analyzed and allelic skewing. The more costly Primer ID method corrected for allelic skewing and provided the number of viral templates analyzed, which revealed that amplifiable HIV templates varied across specimens and did not correlate with clinical viral load. This latter observation highlights the value of the Primer ID method, which by determining the number of templates amplified, enables more accurate assessment of minority species in the virus population, which may be relevant to prescribing effective antiretroviral therapy.

Heterochromatic self-association, a determinant of nuclear organization, does not require sequence homology in Drosophila.

PubMed Central

Sage, Brian T; Csink, Amy K

2003-01-01

Chromosomes of higher eukaryotes contain blocks of heterochromatin that can associate with each other in the interphase nucleus. A well-studied example of heterochromatic interaction is the brown(Dominant) (bwD) chromosome of D. melanogaster, which contains an approximately 1.6-Mbp insertion of AAGAG repeats near the distal tip of chromosome 2. This insertion causes association of the tip with the centric heterochromatin of chromosome 2 (2h), which contains megabases of AAGAG repeats. Here we describe an example, other than bwD, in which distally translocated heterochromatin associates with centric heterochromatin. Additionally, we show that when a translocation places bwD on a different chromosome, bwD tends to associate with the centric heterochromatin of this chromosome, even when the chromosome contains a small fraction of the sequence homology present elsewhere. To further test the importance of sequence homology in these interactions, we used interspecific mating to introgress the bwD allele from D. melanogaster into D. simulans, which lacks the AAGAG on the autosomes. We find that D. simulans bwD associates with 2h, which lacks the AAGAG sequence, while it does not associate with the AAGAG containing X chromosome heterochromatin. Our results show that intranuclear association of separate heterochromatic blocks does not require that they contain the same sequence. PMID:14668374

Few mitochondrial DNA sequences are inserted into the turkey (Meleagris gallopavo) nuclear genome: evolutionary analyses and informativity in the domestic lineage.

PubMed

Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L

2018-06-01

Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.

Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

PubMed Central

Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

2009-01-01

Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

Sequence of pNL194, a 79.3-Kilobase IncN Plasmid Carrying the blaVIM-1 Metallo-β-Lactamase Gene in Klebsiella pneumoniae▿

PubMed Central

Miriagou, V.; Papagiannitsis, C. C.; Kotsakis, S. D.; Loli, A.; Tzelepi, E.; Legakis, N. J.; Tzouvelekis, L. S.

2010-01-01

The nucleotide sequence of pNL194, a VIM-1-encoding plasmid, is described in this study. pNL194 (79,307 bp) comprised an IncN-characteristic segment (38,940 bp) and a mosaic structure (40,367 bp) including blaVIM-1, aacA7, aadA1, aadA2, dfrA1, dfrA12, aphA1, strA, strB, and sul1. Tn1000 or Tn5501 insertion within fipA probably facilitated recruitment of additional mobile elements carrying resistance genes. PMID:20660690

Gene relocations within chloroplast genomes of Jasminum and Menodora (Oleaceae) are due to multiple, overlapping inversions.

PubMed

Lee, Hae-Lim; Jansen, Robert K; Chumley, Timothy W; Kim, Ki-Joong

2007-05-01

The chloroplast (cp) DNA sequence of Jasminum nudiflorum (Oleaceae-Jasmineae) is completed and compared with the large single-copy region sequences from 6 related species. The cp genomes of the tribe Jasmineae (Jasminum and Menodora) show several distinctive rearrangements, including inversions, gene duplications, insertions, inverted repeat expansions, and gene and intron losses. The ycf4-psaI region in Jasminum section Primulina was relocated as a result of 2 overlapping inversions of 21,169 and 18,414 bp. The 1st, larger inversion is shared by all members of the Jasmineae indicating that it occurred in the common ancestor of the tribe. Similar rearrangements were also identified in the cp genome of Menodora. In this case, 2 fragments including ycf4 and rps4-trnS-ycf3 genes were moved by 2 additional inversions of 14 and 59 kb that are unique to Menodora. Other rearrangements in the Oleaceae are confined to certain regions of the Jasminum and Menodora cp genomes, including the presence of highly repeated sequences and duplications of coding and noncoding sequences that are inserted into clpP and between rbcL and psaI. These insertions are correlated with the loss of 2 introns in clpP and a serial loss of segments of accD. The loss of the accD gene and clpP introns in both the monocot family Poaceae and the eudicot family Oleaceae are clearly independent evolutionary events. However, their genome organization is surprisingly similar despite the distant relationship of these 2 angiosperm families.

The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

PubMed

Toyoda, N; Kleinhaus, N; Larsen, P R

1996-06-01

We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

Interchromosomal recombination in Zea mays.

PubMed Central

Hu, W; Timmermans, M C; Messing, J

1998-01-01

A new allele of the 27-kD zein locus in maize has been generated by interchromosomal recombination between chromosomes of two different inbred lines. A continuous patch of at least 11,817 bp of inbred W64A, containing the previously characterized Ra allele of the 27-kD zein gene, has been inserted into the genome of A188 by a single crossover. While both junction sequences are conserved, sequences of the two homologs between these junctions differ considerably. W64A contains the 7313-bp-long retrotransposon, Zeon-1. A188 contains a second copy of the 27-kD zein gene and a 2-kb repetitive element. Therefore, recombination results in a 7.3-kb insertion and a 14-kb deletion compared to the original S+A188 allele. If nonpairing sequences are looped out, 206 single base changes, frequently clustered, are present. The structure of this allele may explain how a recently discovered example of somatic recombination occurred in an A188/W64A hybrid. This would indicate that despite these sequence differences, pairing between these alleles could occur early during plant development. Therefore, such a somatically derived chimeric chromosome can also be heritable and give rise to new alleles. PMID:9799274

Identification of novel MITEs (miniature inverted-repeat transposable elements) in Coxiella burnetii: implications for protein and small RNA evolution.

PubMed

Wachter, Shaun; Raghavan, Rahul; Wachter, Jenny; Minnick, Michael F

2018-04-11

Coxiella burnetii is a Gram-negative gammaproteobacterium and zoonotic agent of Q fever. C. burnetii's genome contains an abundance of pseudogenes and numerous selfish genetic elements. MITEs (miniature inverted-repeat transposable elements) are non-autonomous transposons that occur in all domains of life and are thought to be insertion sequences (ISs) that have lost their transposase function. Like most transposable elements (TEs), MITEs are thought to play an active role in evolution by altering gene function and expression through insertion and deletion activities. However, information regarding bacterial MITEs is limited. We describe two MITE families discovered during research on small non-coding RNAs (sRNAs) of C. burnetii. Two sRNAs, Cbsr3 and Cbsr13, were found to originate from a novel MITE family, termed QMITE1. Another sRNA, CbsR16, was found to originate from a separate and novel MITE family, termed QMITE2. Members of each family occur ~ 50 times within the strains evaluated. QMITE1 is a typical MITE of 300-400 bp with short (2-3 nt) direct repeats (DRs) of variable sequence and is often found overlapping annotated open reading frames (ORFs). Additionally, QMITE1 elements possess sigma-70 promoters and are transcriptionally active at several loci, potentially influencing expression of nearby genes. QMITE2 is smaller (150-190 bps), but has longer (7-11 nt) DRs of variable sequences and is mainly found in the 3' untranslated region of annotated ORFs and intergenic regions. QMITE2 contains a GTAG repetitive extragenic palindrome (REP) that serves as a target for IS1111 TE insertion. Both QMITE1 and QMITE2 display inter-strain linkage and sequence conservation, suggesting that they are adaptive and existed before divergence of C. burnetii strains. We have discovered two novel MITE families of C. burnetii. Our finding that MITEs serve as a source for sRNAs is novel. QMITE2 has a unique structure and occurs in large or small versions with unique DRs that display linkage and sequence conservation between strains, allowing for tracking of genomic rearrangements. QMITE1 and QMITE2 copies are hypothesized to influence expression of neighboring genes involved in DNA repair and virulence through transcriptional interference and ribonuclease processing.

Intracisternal A-Particle Element Transposition into the Murine β-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for β-Glucuronidase Deficiency in the C3H Mouse†

PubMed Central

Gwynn, Babette; Lueders, Kira; Sands, Mark S.; Birkenmeier, Edward H.

1998-01-01

The severity of human mucopolysaccharidosis type VII (MPS VII), or Sly syndrome, depends on the relative activity of the enzyme β-glucuronidase. Loss of β-glucuronidase activity can cause hydrops fetalis, with in utero or postnatal death of the patient. In this report, we show that β-glucuronidase activity is not detectable by a standard fluorometric assay in C3H/HeOuJ (C3H) mice homozygous for a new mutation, gusmps2J. These gusmps2J/gusmps2J mice are born and survive much longer than the previously characterized β-glucuronidase-null B6.C-H-2bm1/ByBir-gusmps (gusmps/gusmps) mice. Northern blot analysis of liver from gusmps2J/gusmps2J mice demonstrates a 750-bp reduction in size of β-glucuronidase mRNA. A 5.4-kb insertion in the Gus-sh nucleotide sequence from these mice was localized by Southern blot analysis to intron 8. The ends of the inserted sequences were cloned by inverse PCR and revealed an intracisternal A-particle (IAP) element inserted near the 3′ end of the intron. The sequence of the long terminal repeat (LTR) regions of the IAP most closely matches that of a composite LTR found in transposed IAPs previously identified in the C3H strain. The inserted IAP may contribute to diminished β-glucuronidase activity either by interfering with transcription or by destabilizing the message. The resulting phenotype is much less severe than that previously described in the gusmps/gusmps mouse and provides an opportunity to study MPS VII on a genetic background that clearly modulates disease severity. PMID:9774663

Immunizations with chimeric hepatitis B virus-like particles to induce potential anti-hepatitis C virus neutralizing antibodies.

PubMed

Vietheer, Patricia T K; Boo, Irene; Drummer, Heidi E; Netter, Hans-Jürgen

2007-01-01

Virus-like particles (VLPs) are highly immunogenic and proven to induce protective immunity. The small surface antigen (HBsAg-S) of hepatitis B virus (HBV) self-assembles into VLPs and its use as a vaccine results in protective antiviral immunity against HBV infections. Chimeric HBsAg-S proteins carrying foreign epitopes allow particle formation and have the ability to induce anti-foreign humoral and cellular immune responses. The insertion of the hypervariable region 1 (HVR1) sequence derived from the envelope protein 2 (E2) of hepatitis C virus (HCV) into the major antigenic site of HBsAg-S ('a'-determinant) resulted in the formation of highly immunogenic VLPs that retained the antigenicity of the inserted HVR1 sequence. BALB/c mice were immunized with chimeric VLPs, which resulted in antisera with anti-HCV activity. The antisera were able to immunoprecipitate native HCV envelope complexes (E1E2) containing homologous or heterologous HVR1 sequences. HCV E1E2 pseudotyped HIV-1 particles (HCVpp) were used to measure entry into HuH-7 target cells in the presence or absence of antisera that were raised against chimeric VLPs. Anti-HVR1 VLP sera interfered with entry of entry-competent HCVpps containing either homologous or heterologous HVR1 sequences. Also, immunizations with chimeric VLPs induced antisurface antigen (HBsAg) antibodies, indicating that HBV-specific antigenicity and immunogenicity of the 'a'-determinant region is retained. A multivalent vaccine against different pathogens based on the HBsAg delivery platform should be possible. We hypothesize that custom design of VLPs with an appropriate set of HCV-neutralizing epitopes will induce antibodies that would serve to decrease the viral load at the initial infecting inoculum.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing

PubMed Central

Rosconi, Federico; de Vries, Stefan P. W.; Baig, Abiyad; Fabiano, Elena

2016-01-01

ABSTRACT The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. IMPORTANCE A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. PMID:27590816

Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

PubMed Central

2012-01-01

Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

PubMed Central

Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

1997-01-01

We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

Alignment efficiency and discomfort of three orthodontic archwire sequences: a randomized clinical trial.

PubMed

Ong, Emily; Ho, Christopher; Miles, Peter

2011-03-01

To compare the efficiency of orthodontic archwire sequences produced by three manufacturers. Prospective, randomized clinical trial with three parallel groups. Private orthodontic practice in Caloundra, QLD, Australia. One hundred and thirty-two consecutive patients were randomized to one of three archwire sequence groups: (i) 3M Unitek, 0·014 inch Nitinol, 0·017 inch × 0·017 inch heat activated Ni-Ti; (ii) GAC international, 0·014 inch Sentalloy, 0·016 × 0·022 inch Bioforce; and (iii) Ormco corporation, 0·014 inch Damon Copper Ni-Ti, 0·014 × 0·025 inch Damon Copper Ni-Ti. All patients received 0·018 × 0·025 inch slot Victory Series™ brackets. Mandibular impressions were taken before the insertion of each archwire. Patients completed discomfort surveys according to a seven-point Likert Scale at 4 h, 24 h, 3 days and 7 days after the insertion of each archwire. Efficiency was measured by time required to reach the working archwire, mandibular anterior alignment and level of discomfort. No significant differences were found in the reduction of irregularity between the archwire sequences at any time-point (T1: P = 0·12; T2: P = 0·06; T3: P = 0·21) or in the time to reach the working archwire (P = 0·28). No significant differences were found in the overall discomfort scores between the archwire sequences (4 h: P = 0·30; 24 h: P = 0·18; 3 days: P = 0·53; 7 days: P = 0·47). When the time-points were analysed individually, the 3M Unitek archwire sequence induced significantly less discomfort than GAC and Ormco archwires 24 h after the insertion of the third archwire (P = 0·02). This could possibly be attributed to the progression in archwire material and archform. The archwire sequences were similar in alignment efficiency and overall discomfort. Progression in archwire dimension and archform may contribute to discomfort levels. This study provides clinical justification for three common archwire sequences in 0·018 × 0·025 inch slot brackets.

Dynamics and Differential Proliferation of Transposable Elements During the Evolution of the B and A Genomes of Wheat

PubMed Central

Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

2008-01-01

Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739

Stable zymomonas mobilis xylose and arabinose fermenting strains

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

2008-04-08

The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

PubMed Central

Traverse, Charles C.

2017-01-01

ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

CRISPR regulation of intraspecies diversification by limiting IS transposition and intercellular recombination.

PubMed

Watanabe, Takayasu; Nozawa, Takashi; Aikawa, Chihiro; Amano, Atsuo; Maruyama, Fumito; Nakagawa, Ichiro

2013-01-01

Mobile genetic elements (MGEs) and genetic rearrangement are considered as major driving forces of bacterial diversification. Previous comparative genome analysis of Porphyromonas gingivalis, a pathogen related to periodontitis, implied such an important relationship. As a counterpart system to MGEs, clustered regularly interspaced short palindromic repeats (CRISPRs) in bacteria may be useful for genetic typing. We found that CRISPR typing could be a reasonable alternative to conventional methods for characterizing phylogenetic relationships among 60 highly diverse P. gingivalis isolates. Examination of genetic recombination along with multilocus sequence typing suggests the importance of such events between different isolates. MGEs appear to be strategically located at the breakpoint gaps of complicated genome rearrangements. Of these MGEs, insertion sequences (ISs) were found most frequently. CRISPR analysis identified 2,150 spacers that were clustered into 1,187 unique ones. Most of these spacers exhibited no significant nucleotide similarity to known sequences (97.6%: 1,158/1,187). Surprisingly, CRISPR spacers exhibiting high nucleotide similarity to regions of P. gingivalis genomes including ISs were predominant. The proportion of such spacers to all the unique spacers (1.6%: 19/1,187) was the highest among previous studies, suggesting novel functions for these CRISPRs. These results indicate that P. gingivalis is a bacterium with high intraspecies diversity caused by frequent insertion sequence (IS) transposition, whereas both the introduction of foreign DNA, primarily from other P. gingivalis cells, and IS transposition are limited by CRISPR interference. It is suggested that P. gingivalis CRISPRs could be an important source for understanding the role of CRISPRs in the development of bacterial diversity.

[Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

PubMed

Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

2011-03-01

To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

PubMed

Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

2017-11-01

In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

Mitochondrial genes in the colourless alga Prototheca wickerhamii resemble plant genes in their exons but fungal genes in their introns.

PubMed Central

Wolff, G; Burger, G; Lang, B F; Kück, U

1993-01-01

The mitochondrial DNA from the colourless alga Prototheca wickerhamii contains two mosaic genes as was revealed from complete sequencing of the circular extranuclear genome. The genes for the large subunit of the ribosomal RNA (LSUrRNA) as well as for subunit I of the cytochrome oxidase (coxI) carry two and three intronic sequences respectively. On the basis of their canonical nucleotide sequences they can be classified as group I introns. Phylogenetic comparisons of the coxI protein sequences allow us to conclude that the P.wickerhamii mtDNA is much closer related to higher plant mtDNAs than to those of the chlorophyte alga C.reinhardtii. The comparison of the intron sequences revealed several unusual features: (1) The P.wickerhamii introns are structurally related to mitochondrial introns from various ascomycetous fungi. (2) Phylogenetic analyses indicate a close relationship between fungal and algal intronic sequences. (3) The P. wickerhamii introns are located at positions within the structural genes which can be considered as preferred intron insertion sites in homologous mitochondrial genes from fungi or liverwort. In all cases, the sequences adjacent to the insertion sites are very well conserved over large evolutionary distances. Our finding of highly similar introns in fungi and algae is consistent with the idea that introns have already been present in the bacterial ancestors of present day mitochondria and evolved concomitantly with the organelles. PMID:7680126

Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations

PubMed Central

Gumbart, James; Roux, Benoît

2012-01-01

The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850

The Design and Analysis of Transposon-Insertion Sequencing Experiments

PubMed Central

Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.

2016-01-01

Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926

Word and frame synchronization with verification for PPM optical communications

NASA Technical Reports Server (NTRS)

Marshall, William K.

1986-01-01

A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.

Characterization of a new high copy Stowaway family MITE, BRAMI-1 in Brassica genome

PubMed Central

2013-01-01

Background Miniature inverted-repeat transposable elements (MITEs) are expected to play important roles in evolution of genes and genome in plants, especially in the highly duplicated plant genomes. Various MITE families and their roles in plants have been characterized. However, there have been fewer studies of MITE families and their potential roles in evolution of the recently triplicated Brassica genome. Results We identified a new MITE family, BRAMI-1, belonging to the Stowaway super-family in the Brassica genome. In silico mapping revealed that 697 members are dispersed throughout the euchromatic regions of the B. rapa pseudo-chromosomes. Among them, 548 members (78.6%) are located in gene-rich regions, less than 3 kb from genes. In addition, we identified 516 and 15 members in the 470 Mb and 15 Mb genomic shotgun sequences currently available for B. oleracea and B. napus, respectively. The resulting estimated copy numbers for the entire genomes were 1440, 1464 and 2490 in B. rapa, B. oleracea and B. napus, respectively. Concurrently, only 70 members of the related Arabidopsis ATTIRTA-1 MITE family were identified in the Arabidopsis genome. Phylogenetic analysis revealed that BRAMI-1 elements proliferated in the Brassica genus after divergence from the Arabidopsis lineage. MITE insertion polymorphism (MIP) was inspected for 50 BRAMI-1 members, revealing high levels of insertion polymorphism between and within species of Brassica that clarify BRAMI-1 activation periods up to the present. Comparative analysis of the 71 genes harbouring the BRAMI-1 elements with their non-insertion paralogs (NIPs) showed that the BRAMI-1 insertions mainly reside in non-coding sequences and that the expression levels of genes with the elements differ from those of their NIPs. Conclusion A Stowaway family MITE, named as BRAMI-1, was gradually amplified and remained present in over than 1400 copies in each of three Brassica species. Overall, 78% of the members were identified in gene-rich regions, and it is assumed that they may contribute to the evolution of duplicated genes in the highly duplicated Brassica genome. The resulting MIPs can serve as a good source of DNA markers for Brassica crops because the insertions are highly dispersed in the gene-rich euchromatin region and are polymorphic between or within species. PMID:23547712

Spectra of spontaneous frameshift mutations at the hisD3052 allele of Salmonella typhimurium in four DNA repair backgrounds.

PubMed Central

DeMarini, D M; Shelton, M L; Abu-Shakra, A; Szakmary, A; Levine, J G

1998-01-01

To characterize the hisD3052 -1 frameshift allele of Salmonella typhimurium, we analyzed approximately 6000 spontaneous revertants (rev) for a 2-base deletion hotspot within the sequence (CG)4, and we sequenced approximately 500 nonhotspot rev. The reversion target is a minimum of 76 bases (nucleotides 843-918) that code for amino acids within a nonconserved region of the histidinol dehydrogenase protein. Only 0.4-3.9% were true rev. Of the following classes, 182 unique second-site mutations were identified: hotspot, complex frameshifts requiring DeltauvrB + pKM101 (TA98-specific) or not (concerted), 1-base insertions, duplications, and nonhotspot deletions. The percentages of hotspot mutations were 13.8% in TA1978 (wild type), 24.5% in UTH8413 (pKM101), 31.6% in TA1538 (DeltauvrB), and 41.0% in TA98 (DeltauvrB, pKM101). The DeltauvrB allele decreased by three times the mutant frequency (MF, rev/10(8) survivors) of duplications and increased by about two times the MF of deletions. Separately, the DeltauvrB allele or pKM101 plasmid increased by two to three times the MF of hotspot mutations; combined, they increased this MF by five times. The percentage of 1-base insertions was not influenced by either DeltauvrB or pKM101. Hotspot deletions and TA98-specific complex frameshifts are inducible by some mutagens; concerted complex frameshifts and 1-base insertions are not; and there is little evidence for mutagen-induced duplications and nonhotspot deletions. Except for the base substitutions in TA98-specific complex frameshifts, all spontaneous mutations of the hisD3052 allele are likely templated. The mechanisms may involve (1) the potential of direct and inverted repeats to undergo slippage and misalignment and to form quasi-palindromes and (2) the interaction of these sequences with DNA replication and repair proteins. PMID:9584083

Target sites for the transposition of rat long interspersed repeated DNA elements (LINEs) are not random.

PubMed Central

Furano, A V; Somerville, C C; Tsichlis, P N; D'Ambrosio, E

1986-01-01

The long interspersed repeated DNA family of rats (LINE or L1Rn family) contains about 40,000 6.7-kilobase (kb) long members (1). LINE members may be currently mobile since their presence or absence causes allelic variation at three single copy loci (2, 3): insulin 1, Moloney leukemia virus integration 2 (Mlvi-2) (4), and immunoglobulin heavy chain (Igh). To characterize target sites for LINE insertion, we compared the DNA sequences of the unoccupied Mlvi-2 target site, its LINE-containing allele, and several other LINE-containing sites. Although not homologous overall, the target sites share three characteristics: First, depending on the site, they are from 68% to 86% (A+T) compared to 58% (A+T) for total rat DNA (5). Depending on the site, a 7- to 15-bp target site sequence becomes duplicated and flanks the inserted LINE member. The second is a version (0 or 1 mismatch) of the hexanucleotide, TACTCA, which is also present in the LINE member, in a highly conserved region located just before the A-rich right end of the LINE member. The third is a stretch of alternating purine/pyrimidine (PQ). The A-rich right ends of different LINE members vary in length and composition, and the sequence of a particularly long one suggests that it contains the A-rich target site from a previous transposition. PMID:3012480

(New hosts and vectors for genome cloning)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

[New hosts and vectors for genome cloning]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Nucleotide Sequence and Genetic Structure of a Novel Carbaryl Hydrolase Gene (cehA) from Rhizobium sp. Strain AC100

PubMed Central

Hashimoto, Masayuki; Fukui, Mitsuru; Hayano, Kouichi; Hayatsu, Masahito

2002-01-01

Rhizobium sp. strain AC100, which is capable of degrading carbaryl (1-naphthyl-N-methylcarbamate), was isolated from soil treated with carbaryl. This bacterium hydrolyzed carbaryl to 1-naphthol and methylamine. Carbaryl hydrolase from the strain was purified to homogeneity, and its N-terminal sequence, molecular mass (82 kDa), and enzymatic properties were determined. The purified enzyme hydrolyzed 1-naphthyl acetate and 4-nitrophenyl acetate indicating that the enzyme is an esterase. We then cloned the carbaryl hydrolase gene (cehA) from the plasmid DNA of the strain and determined the nucleotide sequence of the 10-kb region containing cehA. No homologous sequences were found by a database homology search using the nucleotide and deduced amino acid sequences of the cehA gene. Six open reading frames including the cehA gene were found in the 10-kb region, and sequencing analysis shows that the cehA gene is flanked by two copies of insertion sequence-like sequence, suggesting that it makes part of a composite transposon. PMID:11872471

Rates and patterns of great ape retrotransposition

PubMed Central

Hormozdiari, Fereydoun; Konkel, Miriam K.; Prado-Martinez, Javier; Chiatante, Giorgia; Herraez, Irene Hernando; Walker, Jerilyn A.; Nelson, Benjamin; Alkan, Can; Sudmant, Peter H.; Huddleston, John; Catacchio, Claudia R.; Ko, Arthur; Malig, Maika; Baker, Carl; Genome Project, Great Ape; Marques-Bonet, Tomas; Ventura, Mario; Batzer, Mark A.; Eichler, Evan E.

2013-01-01

We analyzed 83 fully sequenced great ape genomes for mobile element insertions, predicting a total of 49,452 fixed and polymorphic Alu and long interspersed element 1 (L1) insertions not present in the human reference assembly and assigning each retrotransposition event to a different time point during great ape evolution. We used these homoplasy-free markers to construct a mobile element insertions-based phylogeny of humans and great apes and demonstrate their differential power to discern ape subspecies and populations. Within this context, we find a good correlation between L1 diversity and single-nucleotide polymorphism heterozygosity (r2 = 0.65) in contrast to Alu repeats, which show little correlation (r2 = 0.07). We estimate that the “rate” of Alu retrotransposition has differed by a factor of 15-fold in these lineages. Humans, chimpanzees, and bonobos show the highest rates of Alu accumulation—the latter two since divergence 1.5 Mya. The L1 insertion rate, in contrast, has remained relatively constant, with rates differing by less than a factor of three. We conclude that Alu retrotransposition has been the most variable form of genetic variation during recent human–great ape evolution, with increases and decreases occurring over very short periods of evolutionary time. PMID:23884656

Cloning, sequencing, and expression of the Pseudomonas testosteroni gene encoding 3-oxosteroid delta 1-dehydrogenase.

PubMed Central

Plesiat, P; Grandguillot, M; Harayama, S; Vragar, S; Michel-Briand, Y

1991-01-01

Pseudomonas testosteroni ATCC 17410 is able to grow on testosterone. This strain was mutagenized by Tn5, and 41 mutants defective in the utilization of testosterone were isolated. One of them, called mutant 06, expressed 3-oxosteroid delta 1- and 3-oxosteroid delta 4-5 alpha-dehydrogenases only at low levels. The DNA region around the Tn5 insertion in mutant 06 was cloned into pUC19, and the 1-kbp EcoRI-BamHI segment neighbor to the Tn5 insertion was used to probe DNA from the wild-type strain. The probe hybridized to a 7.8-kbp SalI fragment. Plasmid pTES5, which is a pUC19 derivative containing this 7.8-kbp SalI fragment, was isolated after the screening by the 1-kbp EcoRI-BamHI probe. This plasmid expressed delta 1-dehydrogenase in Escherichia coli cells. The 2.2-kbp KpnI-KpnI segment of pTES5 was subcloned into pUC18, and pTEK21 was constructed. In E. coli containing the lacIq plasmid pRG1 and pTEK21, the expression of delta 1-dehydrogenase was induced by isopropyl-beta-D-thiogalactopyranoside (IPTG). The induced level was about 40 times higher than the induced level in P. testosteroni. Delta 1-Dehydrogenase synthesized in E. coli was localized in the inner membrane fraction. The minicell experiments showed that a 59-kDa polypeptide was synthesized from pTEK21, and this polypeptide was located in the inner membrane fraction. The complete nucleotide sequence of the 2.2-kbp KpnI-KpnI segment of pTEK21 was determined. An open reading frame which encodes a 62.4-kDa polypeptide and which is preceded by a Shine-Dalgarno-like sequence was identified. The first 44 amino acids of the putative product exhibited significant sequence similarity to the N-terminal sequences of lipoamide dehydrogenases. Images FIG. 4 PMID:1657885

Engineering RNA phage MS2 virus-like particles for peptide display

NASA Astrophysics Data System (ADS)

Jordan, Sheldon Keith

Phage display is a powerful and versatile technology that enables the selection of novel binding functions from large populations of randomly generated peptide sequences. Random sequences are genetically fused to a viral structural protein to produce complex peptide libraries. From a sufficiently complex library, phage bearing peptides with practically any desired binding activity can be physically isolated by affinity selection, and, since each particle carries in its genome the genetic information for its own replication, the selectants can be amplified by infection of bacteria. For certain applications however, existing phage display platforms have limitations. One such area is in the field of vaccine development, where the goal is to identify relevant epitopes by affinity-selection against an antibody target, and then to utilize them as immunogens to elicit a desired antibody response. Today, affinity selection is usually conducted using display on filamentous phages like M13. This technology provides an efficient means for epitope identification, but, because filamentous phages do not display peptides in the high-density, multivalent arrays the immune system prefers to recognize, they generally make poor immunogens and are typically useless as vaccines. This makes it necessary to confer immunogenicity by conjugating synthetic versions of the peptides to more immunogenic carriers. Unfortunately, when introduced into these new structural environments, the epitopes often fail to elicit relevant antibody responses. Thus, it would be advantageous to combine the epitope selection and immunogen functions into a single platform where the structural constraints present during affinity selection can be preserved during immunization. This dissertation describes efforts to develop a peptide display system based on the virus-like particles (VLPs) of bacteriophage MS2. Phage display technologies rely on (1) the identification of a site in a viral structural protein that is present on the surface of the virus particle and can accept foreign sequence insertions without disruption of protein folding and viral particle assembly, and (2) on the encapsidation of nucleic acid sequences encoding both the VLP and the peptide it displays. The experiments described here are aimed at satisfying the first of these two requirements by engineering efficient peptide display at two different sites in MS2 coat protein. First, we evaluated the suitability of the N-terminus of MS2 coat for peptide insertions. It was observed that random N-terminal 10-mer fusions generally disrupted protein folding and VLP assembly, but by bracketing the foreign sequences with certain specific dipeptides, these defects could be suppressed. Next, the suitability of a coat protein surface loop for foreign sequence insertion was tested. Specifically, random sequence peptides were inserted into the N-terminal-most AB-loop of a coat protein single-chain dimer. Again we found that efficient display required the presence of appropriate dipeptides bracketing the peptide insertion. Finally, it was shown that an N-terminal fusion that tended to interfere specifically with capsid assembly could be efficiently incorporated into mosaic particles when co-expressed with wild-type coat protein.

Detection of extended-spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae in vegetables, soil and water of the farm environment in Tunisia.

PubMed

Ben Said, Leila; Jouini, Ahlem; Klibi, Naouel; Dziri, Raoudha; Alonso, Carla Andrea; Boudabous, Abdellatif; Ben Slama, Karim; Torres, Carmen

2015-06-16

One-hundred-nine samples of 18 different farms (49 of food-vegetables, 41 of soil and 19 of irrigation water) and 45 vegetable food samples of 13 markets were collected in Tunisia. These samples were inoculated in MacConkey agar plates supplemented with cefotaxime (2 μg/ml). ESBL-producing Enterobacteriaceae (ESBL-Eb) were detected in 10 of the 109 farm samples (vegetables, 8.2%; soil, 7.3%; water, 15.8%), and in 4 of 45 vegetables of markets (8.9%), recovering 15 ESBL-Eb. Isolates and ESBL genes detected were: Escherichia coli (n=8: 5 blaCTX-M-1, 2 blaCTX-M-15 and one blaCTX-M-14), Citrobacter freundii (n=4: 3 blaCTX-M-15 and one blaSHV-12), Enterobacter hormaechei (n=2: 2 blaCTX-M-15) and Klebsiella pneumoniae (n=1, blaCTX-M-15). The ISEcp1 sequence was found upstream of blaCTX-M genes in 13 of 14 strains (in three cases truncated by IS5), and orf477 or IS903 downstream. Class 1 integrons were detected in five strains and contained two gene cassette arrangements (dfrA17-aadA5 and aadA1). Most isolates tested showed a multiresistant phenotype. All blaCTX-M-15-positive strains carried the aac(6')-1b-cr gene, that affects to amikacin-tobramycin-kanamycin-ciprofloxacin. Five ESBL-Eb strains carried genes of the qnr family. The 8 ESBL-positive E. coli isolates were typed as: ST58/B1 (n=3) and ST117/D, ST131/B2, ST10/A, ST23/A, and the new ST3496/D (one strain, each). From 1-2 plasmids were detected in all ESBL-positive E. coli isolates (63-179 kb). The ESBL genes were transferred by conjugation in 4 blaCTX-M-1-positive E. coli strains, and transconjugants acquired a 97 kb IncI1 plasmid. ESBL-Eb isolates are frequently disseminated in vegetable farms and potentially could be transmitted to humans through the food chain. Copyright © 2015 Elsevier B.V. All rights reserved.

Transposable elements in cancer.

PubMed

Burns, Kathleen H

2017-07-01

Transposable elements give rise to interspersed repeats, sequences that comprise most of our genomes. These mobile DNAs have been historically underappreciated - both because they have been presumed to be unimportant, and because their high copy number and variability pose unique technical challenges. Neither impediment now seems steadfast. Interest in the human mobilome has never been greater, and methods enabling its study are maturing at a fast pace. This Review describes the activity of transposable elements in human cancers, particularly long interspersed element-1 (LINE-1). LINE-1 sequences are self-propagating, protein-coding retrotransposons, and their activity results in somatically acquired insertions in cancer genomes. Altered expression of transposable elements and animation of genomic LINE-1 sequences appear to be hallmarks of cancer, and can be responsible for driving mutations in tumorigenesis.

Construction and sequence sampling of deep-coverage, large-insert BAC libraries for three model lepidopteran species

PubMed Central

Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R

2009-01-01

Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662

ISC, a Novel Group of Bacterial and Archaeal DNA Transposons That Encode Cas9 Homologs

PubMed Central

Kapitonov, Vladimir V.; Makarova, Kira S.

2015-01-01

ABSTRACT Bacterial genomes encode numerous homologs of Cas9, the effector protein of the type II CRISPR-Cas systems. The homology region includes the arginine-rich helix and the HNH nuclease domain that is inserted into the RuvC-like nuclease domain. These genes, however, are not linked to cas genes or CRISPR. Here, we show that Cas9 homologs represent a distinct group of nonautonomous transposons, which we denote ISC (insertion sequences Cas9-like). We identify many diverse families of full-length ISC transposons and demonstrate that their terminal sequences (particularly 3′ termini) are similar to those of IS605 superfamily transposons that are mobilized by the Y1 tyrosine transposase encoded by the TnpA gene and often also encode the TnpB protein containing the RuvC-like endonuclease domain. The terminal regions of the ISC and IS605 transposons contain palindromic structures that are likely recognized by the Y1 transposase. The transposons from these two groups are inserted either exactly in the middle or upstream of specific 4-bp target sites, without target site duplication. We also identify autonomous ISC transposons that encode TnpA-like Y1 transposases. Thus, the nonautonomous ISC transposons could be mobilized in trans either by Y1 transposases of other, autonomous ISC transposons or by Y1 transposases of the more abundant IS605 transposons. These findings imply an evolutionary scenario in which the ISC transposons evolved from IS605 family transposons, possibly via insertion of a mobile group II intron encoding the HNH domain, and Cas9 subsequently evolved via immobilization of an ISC transposon. IMPORTANCE Cas9 endonucleases, the effectors of type II CRISPR-Cas systems, represent the new generation of genome-engineering tools. Here, we describe in detail a novel family of transposable elements that encode the likely ancestors of Cas9 and outline the evolutionary scenario connecting different varieties of these transposons and Cas9. PMID:26712934

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

PubMed Central

2012-01-01

Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

PubMed

Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

2012-04-30

Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

PubMed

White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

2018-03-28

A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

PubMed Central

Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

2011-01-01

Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

PubMed

Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

2015-04-01

In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Insertion sequence ISRP10 inactivation of the oprD gene in imipenem-resistant Pseudomonas aeruginosa clinical isolates.

PubMed

Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang

2016-05-01

Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

PubMed

Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

2009-12-15

Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

PubMed

Zhang, Chun; Feng, Li; Tian, Xing-Shan

2018-04-26

The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

Sequence variability of Campylobacter temperate bacteriophages

PubMed Central

Clark, Clifford G; Ng, Lai-King

2008-01-01

Background Prophages integrated within the chromosomes of Campylobacter jejuni isolates have been demonstrated very recently. Prior work with Campylobacter temperate bacteriophages, as well as evidence from prophages in other enteric bacteria, suggests these prophages might have a role in the biology and virulence of the organism. However, very little is known about the genetic variability of Campylobacter prophages which, if present, could lead to differential phenotypes in isolates carrying the phages versus those that do not. As a first step in the characterization of C. jejuni prophages, we investigated the distribution of prophage DNA within a C. jejuni population assessed the DNA and protein sequence variability within a subset of the putative prophages found. Results Southern blotting of C. jejuni DNA using probes from genes within the three putative prophages of the C. jejuni sequenced strain RM 1221 demonstrated the presence of at least one prophage gene in a large proportion (27/35) of isolates tested. Of these, 15 were positive for 5 or more of the 7 Campylobacter Mu-like phage 1 (CMLP 1, also designated Campylobacter jejuni integrated element 1, or CJIE 1) genes tested. Twelve of these putative prophages were chosen for further analysis. DNA sequencing of a 9,000 to 11,000 nucleotide region of each prophage demonstrated a close homology with CMLP 1 in both gene order and nucleotide sequence. Structural and sequence variability, including short insertions, deletions, and allele replacements, were found within the prophage genomes, some of which would alter the protein products of the ORFs involved. No insertions of novel genes were detected within the sequenced regions. The 12 prophages and RM 1221 had a % G+C very similar to C. jejuni sequenced strains, as well as promoter regions characteristic of C. jejuni. None of the putative prophages were successfully induced and propagated, so it is not known if they were functional or if they represented remnant prophage DNA in the bacterial chromosomes. Conclusion These putative prophages form a family of phages with conserved sequences, and appear to be adapted to Campylobacter. There was evidence for recombination among groups of prophages, suggesting that the prophages had a mosaic structure. In many of these properties, the Mu-like CMLP 1 homologs characterized in this study resemble temperate bacteriophages of enteric bacteria that are responsible for contributions to virulence and host adaptation. PMID:18366706

Arginine insertion and loss of N-linked glycosylation site in HIV-1 envelope V3 region confer CXCR4-tropism

PubMed Central

Tsuchiya, Kiyoto; Ode, Hirotaka; Hayashida, Tsunefusa; Kakizawa, Junko; Sato, Hironori; Oka, Shinichi; Gatanaga, Hiroyuki

2013-01-01

The third variable region (V3) of HIV-1 envelope glycoprotein gp120 plays a key role in determination of viral coreceptor usage (tropism). However, which combinations of mutations in V3 confer a tropism shift is still unclear. A unique pattern of mutations in antiretroviral therapy-naive HIV-1 patient was observed associated with the HIV-1 tropism shift CCR5 to CXCR4. The insertion of arginine at position 11 and the loss of the N-linked glycosylation site were indispensable for acquiring pure CXCR4-tropism, which were confirmed by cell-cell fusion assay and phenotype analysis of recombinant HIV-1 variants. The same pattern of mutations in V3 and the associated tropism shift were identified in two of 53 other patients (3.8%) with CD4+ cell count <200/mm3. The combination of arginine insertion and loss of N-linked glycosylation site usually confers CXCR4-tropism. Awareness of this rule will help to confirm the tropism prediction from V3 sequences by conventional rules. PMID:23925152

Genomic sequencing of Pleistocene cave bears

DOE Office of Scientific and Technical Information (OSTI.GOV)

Noonan, James P.; Hofreiter, Michael; Smith, Doug

2005-04-01

Despite the information content of genomic DNA, ancient DNA studies to date have largely been limited to amplification of mitochondrial DNA due to technical hurdles such as contamination and degradation of ancient DNAs. In this study, we describe two metagenomic libraries constructed using unamplified DNA extracted from the bones of two 40,000-year-old extinct cave bears. Analysis of {approx}1 Mb of sequence from each library showed that, despite significant microbial contamination, 5.8 percent and 1.1 percent of clones in the libraries contain cave bear inserts, yielding 26,861 bp of cave bear genome sequence. Alignment of this sequence to the dog genome,more » the closest sequenced genome to cave bear in terms of evolutionary distance, revealed roughly the expected ratio of cave bear exons, repeats and conserved noncoding sequences. Only 0.04 percent of all clones sequenced were derived from contamination with modern human DNA. Comparison of cave bear with orthologous sequences from several modern bear species revealed the evolutionary relationship of these lineages. Using the metagenomic approach described here, we have recovered substantial quantities of mammalian genomic sequence more than twice as old as any previously reported, establishing the feasibility of ancient DNA genomic sequencing programs.« less

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

PubMed

Guimond, A; Moss, T

1999-02-01

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Parkin dosage mutations have greater pathogenicity in familial PD than simple sequence mutations

PubMed Central

Pankratz, N; Kissell, D K.; Pauciulo, M W.; Halter, C A.; Rudolph, A; Pfeiffer, R F.; Marder, K S.; Foroud, T; Nichols, W C.

2009-01-01

Objective: Mutations in both alleles of parkin have been shown to result in Parkinson disease (PD). However, it is unclear whether haploinsufficiency (presence of a mutation in only 1 of the 2 parkin alleles) increases the risk for PD. Methods: We performed comprehensive dosage and sequence analysis of all 12 exons of parkin in a sample of 520 independent patients with familial PD and 263 controls. We evaluated whether presence of a single parkin mutation, either a sequence (point mutation or small insertion/deletion) or dosage (whole exon deletion or duplication) mutation, was found at increased frequency in cases as compared with controls. We then compared the clinical characteristics of cases with 0, 1, or 2 parkin mutations. Results: We identified 55 independent patients with PD with at least 1 parkin mutation and 9 controls with a single sequence mutation. Cases and controls had a similar frequency of single sequence mutations (3.1% vs 3.4%, p = 0.83); however, the cases had a significantly higher rate of dosage mutations (2.6% vs 0%, p = 0.009). Cases with a single dosage mutation were more likely to have an earlier age at onset (50% with onset at ≤45 years) compared with those with no parkin mutations (10%, p = 0.00002); this was not true for cases with only a single sequence mutation (25% with onset at ≤45 years, p = 0.06). Conclusions: Parkin haploinsufficiency, specifically for a dosage mutation rather than a point mutation or small insertion/deletion, is a risk factor for familial PD and may be associated with earlier age at onset. GLOSSARY ADL = Activities of Daily Living; GDS = Geriatric Depression Scale; MLPA = multiplex ligation-dependent probe amplification; MMSE = Mini-Mental State Examination; PD = Parkinson disease; UPDRS = Unified Parkinson’s Disease Rating Scale. PMID:19636047

Reference quality assembly of the 3.5-Gb genome of Capsicum annuum from a single linked-read library.

PubMed

Hulse-Kemp, Amanda M; Maheshwari, Shamoni; Stoffel, Kevin; Hill, Theresa A; Jaffe, David; Williams, Stephen R; Weisenfeld, Neil; Ramakrishnan, Srividya; Kumar, Vijay; Shah, Preyas; Schatz, Michael C; Church, Deanna M; Van Deynze, Allen

2018-01-01

Linked-Read sequencing technology has recently been employed successfully for de novo assembly of human genomes, however, the utility of this technology for complex plant genomes is unproven. We evaluated the technology for this purpose by sequencing the 3.5-gigabase (Gb) diploid pepper ( Capsicum annuum ) genome with a single Linked-Read library. Plant genomes, including pepper, are characterized by long, highly similar repetitive sequences. Accordingly, significant effort is used to ensure that the sequenced plant is highly homozygous and the resulting assembly is a haploid consensus. With a phased assembly approach, we targeted a heterozygous F 1 derived from a wide cross to assess the ability to derive both haplotypes and characterize a pungency gene with a large insertion/deletion. The Supernova software generated a highly ordered, more contiguous sequence assembly than all currently available C. annuum reference genomes. Over 83% of the final assembly was anchored and oriented using four publicly available  de novo linkage maps. A comparison of the annotation of conserved eukaryotic genes indicated the completeness of assembly. The validity of the phased assembly is further demonstrated with the complete recovery of both 2.5-Kb insertion/deletion haplotypes of the PUN1 locus in the F 1 sample that represents pungent and nonpungent peppers, as well as nearly full recovery of the BUSCO2 gene set within each of the two haplotypes. The most contiguous pepper genome assembly to date has been generated which demonstrates that Linked-Read library technology provides a tool to de novo assemble complex highly repetitive heterozygous plant genomes. This technology can provide an opportunity to cost-effectively develop high-quality genome assemblies for other complex plants and compare structural and gene differences through accurate haplotype reconstruction.

Molecular characterization and genomic distribution of Isis: a new retrotransposon of Drosophila buzzatii.

PubMed

García Guerreiro, M P; Fontdevila, A

2007-01-01

A new transposable element, Isis, is identified as a LTR retrotransposon in Drosophila buzzatii. DNA sequence analysis shows that Isis contains three long ORFs similar to gag, pol and env genes of retroviruses. The ORF1 exhibits sequence homology to matrix, capsid and nucleocapsid gag proteins and ORF2 encodes a putative protease (PR), a reverse transcriptase (RT), an Rnase H (RH) and an integrase (IN) region. The analysis of a putative env product, encoded by the env ORF3, shows a degenerated protein containing several stop codons. The molecular study of the putative proteins coded by this new element shows striking similarities to both Ulysses and Osvaldo elements, two LTR retrotransposons, present in D. virilis and D. buzzatii, respectively. Comparisons of the predicted Isis RT to several known retrotransposons show strong phylogenetic relationships to gypsy-like elements, particulary to Ulysses retrotransposon. Studies of Isis chromosomal distribution show a strong hybridization signal in centromeric and pericentromeric regions, and a scattered distribution along all chromosomal arms. The existence of insertional polymorphisms between different strains and high molecular weight bands by Southern blot suggests the existence of full-sized copies that have been active recently. The presence of euchromatic insertion sites coincident between Isis and Osvaldo could indicate preferential insertion sites of Osvaldo element into Isis sequence or vice versa. Moreover, the presence of Isis in different species of the buzzatii complex indicates the ancient origin of this element.

Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

PubMed

Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

2014-07-01

Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA-Sec and SECIS) insertion machinery in land plants.

PubMed

Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan

2014-02-25

This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.

Genomic stability of adipogenic human adenovirus 36.

PubMed

Nam, J-H; Na, H-N; Atkinson, R L; Dhurandhar, N V

2014-02-01

Human adenovirus Ad36 increases adiposity in several animal models, including rodents and non-human primates. Importantly, Ad36 is associated with human obesity, which has prompted research to understand its epidemiology and to develop a vaccine to prevent a subgroup of obesity. For this purpose, understanding the genomic stability of Ad36 in vivo and in vitro infections is critical. Here, we examined whether in vitro cell passaging over a 14-year period introduced any genetic variation in Ad36. We sequenced the whole genome of Ad36-which was plaque purified in 1998 from the original strain obtained from American Type Culture Collection, and passaged approximately 12 times over the past 14 years (Ad36-2012). This DNA sequence was compared with a previously published sequence of Ad36 likely obtained from the same source (Ad36-1988). Compared with Ad36-1988, only two nucleotides were altered in Ad36-2012: a T insertion at nucleotide 1862, which may induce early termination of the E1B viral protein, and a T➝C transition at nucleotide 26 136. Virus with the T insertion (designated Ad36-2012-T6) was mixed with wild-type virus lacking the T insertion (designated Ad36-2012-T5) in the viral stock. The transition at nucleotide 26 136 does not change the encoded amino acid (aspartic acid) in the pVIII viral protein. The rate of genetic variation in Ad36 is ∼2.37 × 10(-6) mutations/nucleotide/passage. Of particular importance, there were no mutations in the E4orf1 gene, the critical gene for producing obesity. This very-low-variation rate should reduce concerns about genetic variability when developing Ad36 vaccines or developing assays for detecting Ad36 infection in populations.

Structure and Evolution of Chlorate Reduction Composite Transposons

PubMed Central

Clark, Iain C.; Melnyk, Ryan A.; Engelbrektson, Anna; Coates, John D.

2013-01-01

ABSTRACT The genes for chlorate reduction in six bacterial strains were analyzed in order to gain insight into the metabolism. A newly isolated chlorate-reducing bacterium (Shewanella algae ACDC) and three previously isolated strains (Ideonella dechloratans, Pseudomonas sp. strain PK, and Dechloromarinus chlorophilus NSS) were genome sequenced and compared to published sequences (Alicycliphilus denitrificans BC plasmid pALIDE01 and Pseudomonas chloritidismutans AW-1). De novo assembly of genomes failed to join regions adjacent to genes involved in chlorate reduction, suggesting the presence of repeat regions. Using a bioinformatics approach and finishing PCRs to connect fragmented contigs, we discovered that chlorate reduction genes are flanked by insertion sequences, forming composite transposons in all four newly sequenced strains. These insertion sequences delineate regions with the potential to move horizontally and define a set of genes that may be important for chlorate reduction. In addition to core metabolic components, we have highlighted several such genes through comparative analysis and visualization. Phylogenetic analysis places chlorate reductase within a functionally diverse clade of type II dimethyl sulfoxide (DMSO) reductases, part of a larger family of enzymes with reactivity toward chlorate. Nucleotide-level forensics of regions surrounding chlorite dismutase (cld), as well as its phylogenetic clustering in a betaproteobacterial Cld clade, indicate that cld has been mobilized at least once from a perchlorate reducer to build chlorate respiration. PMID:23919996

Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

PubMed

Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

2002-09-01

The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

Retrotransposons of the Tnt1B family are mobile in Nicotiana plumbaginifolia and can induce alternative splicing of the host gene upon insertion.

PubMed

Leprinc, A S; Grandbastien, M A; Christian, M

2001-11-01

Active retrotransposons have been identified in Nicotiana plumbaginifolia by their ability to disrupt the nitrate reductase gene in chlorate-resistant mutants selected from protoplast-derived cultures. In mutants E23 and F97, two independent insertions of Tnp2, a new retrotransposon closely related to the tobacco Tnt1 elements, were detected in the nitrate reductase gene. These two Tnp2 elements are members of the Tnt1B subfamily which shows that Tnt1B elements can be active and mutagenic in the N. plumbaginifolia genome. Furthermore, these results suggest that Tnt1B is the most active family of Tntl elements in N. plumbaginifolia, whereas in tobacco only members of the Tnt1A subfamily were found inserted in the nitrate reductase gene. The transcriptional regulations of Tnp2 and Tnt1A elements are most probably different due to non-conserved U3 regions. Our results thus support the hypothesis that different Nicotiana species contain different active Tntl subfamilies and that only one active Tntl subfamily might be maintained in each of these species. The Tnp2 insertion found in the F97 mutant was found to be spliced out of the nitrate reductase mRNA by activation of cryptic donor and acceptor sites in the nitrate reductase and the Tnp2 sequences respectively.

The 14alpha-Demethylasse(CYP51A1) Gene is Overexpressed in Venturia inaequalis Strains Resistant to Myclobutanil.

PubMed

Schnabel, G; Jones, A L

2001-01-01

ABSTRACT We identified the cytochrome P450 sterol 14alpha-demethylase (CYP51A1) gene from Venturia inaequalis and optional insertions located upstream from CYP51A1 and evaluated their potential role in conferring resistance to the sterol demethylation-inhibitor (DMI) fungicide my-clobutanil. The CYP51A1 gene was completely sequenced from one my-clobutanil sensitive (S) and two myclobutanil-resistant (R) strains. No nucleotide variation was found when the three sequences were aligned. Allele-specific polymerase chain reaction (PCR) analysis indicated that a previously described single base pair mutation that correlated with resistance to DMI fungicides in strains of other filamentous fungi was absent in 19 S and 32 R strains of V. inaequalis from Michigan and elsewhere. The sequencing results and PCR analyses suggest that resistance in these strains was not due to a mutation in the sterol demethylase target site for DMI fungicides. Expression of CYP51A1 was determined for strains from an orchard that had never been sprayed with DMI fungicides (baseline orchard), and the data provided a reference for evaluating the expression of strains collected from a research orchard and from three commercial Michigan apple orchards with a long history of DMI use and a high frequency of R strains. Overexpression of CYP51A1 was significantly higher in 9 of 11 R strains from the research orchard than in S strains from the baseline orchard. The high expression was correlated with the presence of a 553-bp insertion located upstream of CYP51A1. Overexpression of the CYP51A1 gene was also detected in eight of eight, five of nine, and nine of nine R strains from three commercial orchards, but the insertion was not detected in the majority of these strains. The results suggest that overexpression of the target-site CYP51A1 gene is an important mechanism of resistance in some field resistant strains of V. inaequalis, but other mechanisms of resistance also appear to exist.

Insertion of a specific fungal 3'-phosphoadenosine-5'-phosphatase motif into a plant homologue improves halotolerance and drought tolerance of plants.

PubMed

Gašparič, Meti Buh; Lenassi, Metka; Gostinčar, Cene; Rotter, Ana; Plemenitaš, Ana; Gunde-Cimerman, Nina; Gruden, Kristina; Zel, Jana

2013-01-01

Soil salinity and drought are among the most serious agricultural and environmental problems of today. Therefore, investigations of plant resistance to abiotic stress have received a lot of attention in recent years. In this study, we identified the complete coding sequence of a 3'-phosphoadenosine-5'-phosphatase protein, ApHal2, from the halotolerant yeast Aureobasidium pullulans. Expression of the ApHAL2 gene in a Saccharomyces cerevisiae hal2 mutant complemented the mutant auxotrophy for methionine, and rescued the growth of the hal2 mutant in media with high NaCl concentrations. A 21-amino-acids-long region of the ApHal2 enzyme was inserted into the Arabidopsis thaliana homologue of Hal2, the SAL1 phosphatase. The inserted sequence included the META motif, which has previously been implicated in increased sodium tolerance of the Hal2 homologue from a related fungal species. Transgenic Arabidopsis plants overexpressing this modified SAL1 (mSAL1) showed improved halotolerance and drought tolerance. In a medium with an elevated salt concentration, mSAL1-expressing plants were twice as likely to have roots in a higher length category in comparison with the wild-type Arabidopsis and with plants overexpressing the native SAL1, and had 5% to 10% larger leaf surface area under moderate and severe salt stress, respectively. Similarly, after moderate drought exposure, the mSAL1-expressing plants showed 14% increased dry weight after revitalisation, with no increase in dry weight of the wild-type plants. With severe drought, plants overexpressing native SAL1 had the worst rehydration success, consistent with the recently proposed role of SAL1 in severe drought. This was not observed for plants expressing mSAL1. Therefore, the presence of this fungal META motif sequence is beneficial under conditions of increased salinity and moderate drought, and shows no drawbacks for plant survival under severe drought. This demonstrates that adaptations of extremotolerant fungi should be considered as a valuable resource for improving stress-tolerance in plant breeding in the future.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Whole-Genome Sequences of DA and F344 Rats with Different Susceptibilities to Arthritis, Autoimmunity, Inflammation and Cancer

PubMed Central

Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A.; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S.

2013-01-01

DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease. PMID:23695301

Whole-genome sequences of DA and F344 rats with different susceptibilities to arthritis, autoimmunity, inflammation and cancer.

PubMed

Guo, Xiaosen; Brenner, Max; Zhang, Xuemei; Laragione, Teresina; Tai, Shuaishuai; Li, Yanhong; Bu, Junjie; Yin, Ye; Shah, Anish A; Kwan, Kevin; Li, Yingrui; Jun, Wang; Gulko, Pércio S

2013-08-01

DA (D-blood group of Palm and Agouti, also known as Dark Agouti) and F344 (Fischer) are two inbred rat strains with differences in several phenotypes, including susceptibility to autoimmune disease models and inflammatory responses. While these strains have been extensively studied, little information is available about the DA and F344 genomes, as only the Brown Norway (BN) and spontaneously hypertensive rat strains have been sequenced to date. Here we report the sequencing of the DA and F344 genomes using next-generation Illumina paired-end read technology and the first de novo assembly of a rat genome. DA and F344 were sequenced with an average depth of 32-fold, covered 98.9% of the BN reference genome, and included 97.97% of known rat ESTs. New sequences could be assigned to 59 million positions with previously unknown data in the BN reference genome. Differences between DA, F344, and BN included 19 million positions in novel scaffolds, 4.09 million single nucleotide polymorphisms (SNPs) (including 1.37 million new SNPs), 458,224 short insertions and deletions, and 58,174 structural variants. Genetic differences between DA, F344, and BN, including high-impact SNPs and short insertions and deletions affecting >2500 genes, are likely to account for most of the phenotypic variation between these strains. The new DA and F344 genome sequencing data should facilitate gene discovery efforts in rat models of human disease.

MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.

PubMed

Park, Yungki; Helms, Volkhard

2008-08-15

To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.

Emergence and subsequent functional specialization of kindlins during evolution of cell adhesiveness

PubMed Central

Meller, Julia; Rogozin, Igor B.; Poliakov, Eugenia; Meller, Nahum; Bedanov-Pack, Mark; Plow, Edward F.; Qin, Jun; Podrez, Eugene A.; Byzova, Tatiana V.

2015-01-01

Kindlins are integrin-interacting proteins essential for integrin-mediated cell adhesiveness. In this study, we focused on the evolutionary origin and functional specialization of kindlins as a part of the evolutionary adaptation of cell adhesive machinery. Database searches revealed that many members of the integrin machinery (including talin and integrins) existed before kindlin emergence in evolution. Among the analyzed species, all metazoan lineages—but none of the premetazoans—had at least one kindlin-encoding gene, whereas talin was present in several premetazoan lineages. Kindlin appears to originate from a duplication of the sequence encoding the N-terminal fragment of talin (the talin head domain) with a subsequent insertion of the PH domain of separate origin. Sequence analysis identified a member of the actin filament–associated protein 1 (AFAP1) superfamily as the most likely origin of the kindlin PH domain. The functional divergence between kindlin paralogues was assessed using the sequence swap (chimera) approach. Comparison of kindlin 2 (K2)/kindlin 3 (K3) chimeras revealed that the F2 subdomain, in particular its C-terminal part, is crucial for the differential functional properties of K2 and K3. The presence of this segment enables K2 but not K3 to localize to focal adhesions. Sequence analysis of the C-terminal part of the F2 subdomain of K3 suggests that insertion of a variable glycine-rich sequence in vertebrates contributed to the loss of constitutive K3 targeting to focal adhesions. Thus emergence and subsequent functional specialization of kindlins allowed multicellular organisms to develop additional tissue-specific adaptations of cell adhesiveness. PMID:25540429

Transposon Invasion of the Paramecium Germline Genome Countered by a Domesticated PiggyBac Transposase and the NHEJ Pathway

PubMed Central

Dubois, Emeline; Bischerour, Julien; Marmignon, Antoine; Mathy, Nathalie; Régnier, Vinciane; Bétermier, Mireille

2012-01-01

Sequences related to transposons constitute a large fraction of extant genomes, but insertions within coding sequences have generally not been tolerated during evolution. Thanks to their unique nuclear dimorphism and to their original mechanism of programmed DNA elimination from their somatic nucleus (macronucleus), ciliates are emerging model organisms for the study of the impact of transposable elements on genomes. The germline genome of the ciliate Paramecium, located in its micronucleus, contains thousands of short intervening sequences, the IESs, which interrupt 47% of genes. Recent data provided support to the hypothesis that an evolutionary link exists between Paramecium IESs and Tc1/mariner transposons. During development of the macronucleus, IESs are excised precisely thanks to the coordinated action of PiggyMac, a domesticated piggyBac transposase, and of the NHEJ double-strand break repair pathway. A PiggyMac homolog is also required for developmentally programmed DNA elimination in another ciliate, Tetrahymena. Here, we present an overview of the life cycle of these unicellular eukaryotes and of the developmentally programmed genome rearrangements that take place at each sexual cycle. We discuss how ancient domestication of a piggyBac transposase might have allowed Tc1/mariner elements to spread throughout the germline genome of Paramecium, without strong counterselection against insertion within genes. PMID:22888464

Functional Analyses of a Novel Splice Variant in the CHD7 Gene, Found by Next Generation Sequencing, Confirm Its Pathogenicity in a Spanish Patient and Diagnose Him with CHARGE Syndrome.

PubMed

Villate, Olatz; Ibarluzea, Nekane; Fraile-Bethencourt, Eugenia; Valenzuela, Alberto; Velasco, Eladio A; Grozeva, Detelina; Raymond, F L; Botella, María P; Tejada, María-Isabel

2018-01-01

Mutations in CHD7 have been shown to be a major cause of CHARGE syndrome, which presents many symptoms and features common to other syndromes making its diagnosis difficult. Next generation sequencing (NGS) of a panel of intellectual disability related genes was performed in an adult patient without molecular diagnosis. A splice donor variant in CHD7 (c.5665 + 1G > T) was identified. To study its potential pathogenicity, exons and flanking intronic sequences were amplified from patient DNA and cloned into the pSAD ® splicing vector. HeLa cells were transfected with this construct and a wild-type minigene and functional analysis were performed. The construct with the c.5665 + 1G > T variant produced an aberrant transcript with an insert of 63 nucleotides of intron 28 creating a premature termination codon (TAG) 25 nucleotides downstream. This would lead to the insertion of 8 new amino acids and therefore a truncated 1896 amino acid protein. As a result of this, the patient was diagnosed with CHARGE syndrome. Functional analyses underline their usefulness for studying the pathogenicity of variants found by NGS and therefore its application to accurately diagnose patients.

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed Central

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-01-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency. Images PMID:8002597

Conservation of chromosomal arrangement among three strains of the genetically unstable archaeon Halobacterium salinarium.

PubMed

Hackett, N R; Bobovnikova, Y; Heyrovska, N

1994-12-01

Phenotypic variants of Halobacterium salinarium NRC-1 arise at a frequency of 10(-2). These result from transpositions of halobacterial insertion sequences and rearrangements mediated by halobacterial insertion sequences. We have tested the hypothesis that such mutations are confined to only a portion of the genome by comparing the chromosomal restriction map of H. salinarium NRC-1 and that of the derivative S9, which was made in 1969. The two chromosomes were mapped by using two-dimensional pulsed-field gel electrophoresis and the restriction enzymes AflII, AseI, and DraI. A comparison of the two deduced maps showed a domain of about 210 kbp to be subject to many rearrangements, including an inversion in S9 relative to NRC-1. However, the rest of the chromosome was conserved among NRC-1, S9, and an independent Halobacterium isolate, GRB, previously mapped by St. Jean et al. (A. St. Jean, B. A. Trieselmann, and R. L. Charlebois, Nucleic Acids Res. 22:1476-1483, 1994). This concurs with data from eubacteria suggesting strong selective forces maintaining gene order even in the face of rearrangement events occurring at a high frequency.

Expression of Wheat High Molecular Weight Glutenin Subunit 1Bx Is Affected by Large Insertions and Deletions Located in the Upstream Flanking Sequences

PubMed Central

Hao, Chenyang; Tang, Saijun; Zhang, Xueyong; Li, Tian

2014-01-01

To better understand the transcriptional regulation of high molecular weight glutenin subunit (HMW-GS) expression, we isolated four Glu-1Bx promoters from six wheat cultivars exhibiting diverse protein expression levels. The activities of the diverse Glu-1Bx promoters were tested and compared with β-glucuronidase (GUS) reporter fusions. Although all the full-length Glu-1Bx promoters showed endosperm-specific activities, the strongest GUS activity was observed with the 1Bx7OE promoter in both transient expression assays and stable transgenic rice lines. A 43 bp insertion in the 1Bx7OE promoter, which is absent in the 1Bx7 promoter, led to enhanced expression. Analysis of promoter deletion constructs confirmed that a 185 bp MITE (miniature inverted-repeat transposable element) in the 1Bx14 promoter had a weak positive effect on Glu-1Bx expression, and a 54 bp deletion in the 1Bx13 promoter reduced endosperm-specific activity. To investigate the effect of the 43 bp insertion in the 1Bx7OE promoter, a functional marker was developed to screen 505 Chinese varieties and 160 European varieties, and only 1Bx7-type varieties harboring the 43 bp insertion in their promoters showed similar overexpression patterns. Hence, the 1Bx7OE promoter should be important tool in crop genetic engineering as well as in molecular assisted breeding. PMID:25133580

Exome sequencing of a colorectal cancer family reveals shared mutation pattern and predisposition circuitry along tumor pathways.

PubMed

Suleiman, Suleiman H; Koko, Mahmoud E; Nasir, Wafaa H; Elfateh, Ommnyiah; Elgizouli, Ubai K; Abdallah, Mohammed O E; Alfarouk, Khalid O; Hussain, Ayman; Faisal, Shima; Ibrahim, Fathelrahamn M A; Romano, Maurizio; Sultan, Ali; Banks, Lawrence; Newport, Melanie; Baralle, Francesco; Elhassan, Ahmed M; Mohamed, Hiba S; Ibrahim, Muntaser E

2015-01-01

The molecular basis of cancer and cancer multiple phenotypes are not yet fully understood. Next Generation Sequencing promises new insight into the role of genetic interactions in shaping the complexity of cancer. Aiming to outline the differences in mutation patterns between familial colorectal cancer cases and controls we analyzed whole exomes of cancer tissues and control samples from an extended colorectal cancer pedigree, providing one of the first data sets of exome sequencing of cancer in an African population against a background of large effective size typically with excess of variants. Tumors showed hMSH2 loss of function SNV consistent with Lynch syndrome. Sets of genes harboring insertions-deletions in tumor tissues revealed, however, significant GO enrichment, a feature that was not seen in control samples, suggesting that ordered insertions-deletions are central to tumorigenesis in this type of cancer. Network analysis identified multiple hub genes of centrality. ELAVL1/HuR showed remarkable centrality, interacting specially with genes harboring non-synonymous SNVs thus reinforcing the proposition of targeted mutagenesis in cancer pathways. A likely explanation to such mutation pattern is DNA/RNA editing, suggested here by nucleotide transition-to-transversion ratio that significantly departed from expected values (p-value 5e-6). NFKB1 also showed significant centrality along with ELAVL1, raising the suspicion of viral etiology given the known interaction between oncogenic viruses and these proteins.

Molecular Cloning of Drebrin: Progress and Perspectives.

PubMed

Kojima, Nobuhiko

2017-01-01

Chicken drebrin isoforms were first identified in the optic tectum of developing brain. Although the time course of protein expression was different in each drebrin isoform, the similarity between their protein structures was suggested by biochemical analysis of purified protein. To determine their protein structures, the cloning of drebrin cDNAs was conducted. Comparison between the cDNA sequences shows that all drebrin cDNAs are identical except that the internal insertion sequences are present or absent in their sequences. Chicken drebrin are now classified into three isoforms, namely, drebrins E1, E2, and A. Genomic cloning demonstrated that the three isoforms are generated by an alternative splicing of individual exons encoding the insertion sequences from single drebrin gene. The mechanism should be precisely regulated in cell-type-specific and developmental stage-specific fashion. Drebrin protein, which is well conserved in various vertebrate species, although mammalian drebrin has only two isoforms, namely, drebrin E and drebrin A, is different from chicken drebrin that has three isoforms. Drebrin belongs to an actin-depolymerizing factor homology (ADF-H) domain protein family. Besides the ADF-H domain, drebrin has other domains, including the actin-binding domain and Homer-binding motifs. Diversity of protein isoform and multiple domains of drebrin could interact differentially with the actin cytoskeleton and other intracellular proteins and regulate diverse cellular processes.

Optical mapping and sequencing of the Escherichia coli KO11 genome reveal extensive chromosomal rearrangements, and multiple tandem copies of the Zymomonas mobilis pdc and adhB genes.

PubMed

Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O

2012-04-01

Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.

High-Throughput Parallel Sequencing to Measure Fitness of Leptospira interrogans Transposon Insertion Mutants during Acute Infection

PubMed Central

Matsunaga, James; Haake, David A.

2016-01-01

Pathogenic species of Leptospira are the causative agents of leptospirosis, a zoonotic disease that causes mortality and morbidity worldwide. The understanding of the virulence mechanisms of Leptospira spp is still at an early stage due to the limited number of genetic tools available for this microorganism. The development of random transposon mutagenesis in pathogenic strains a decade ago has contributed to the identification of several virulence factors. In this study, we used the transposon sequencing (Tn-Seq) technique, which combines transposon mutagenesis with massive parallel sequencing, to study the in vivo fitness of a pool of Leptospira interrogans mutants. We infected hamsters with a pool of 42 mutants (input pool), which included control mutants with insertions in four genes previously analyzed by virulence testing (loa22, ligB, flaA1, and lic20111) and 23 mutants with disrupted signal transduction genes. We quantified the mutants in different tissues (blood, kidney and liver) at 4 days post-challenge by high-throughput sequencing and compared the frequencies of mutants recovered from tissues to their frequencies in the input pool. Control mutants that were less fit in the Tn-Seq experiment were attenuated for virulence when tested separately in the hamster model of lethal leptospirosis. Control mutants with unaltered fitness were as virulent as the wild-type strain. We identified two mutants with the transposon inserted in the same putative adenylate/guanylate cyclase gene (lic12327) that had reduced in vivo fitness in blood, kidney and liver. Both lic12327 mutants were attenuated for virulence when tested individually in hamsters. Growth of the control mutants and lic12327 mutants in culture medium were similar to that of the wild-type strain. These results demonstrate the feasibility of screening large pools of L. interrogans transposon mutants for those with altered fitness, and potentially attenuated virulence, by transposon sequencing. PMID:27824878

Sequence and Secondary Structure of the Mitochondrial Small-Subunit rRNA V4, V6, and V9 Domains Reveal Highly Species-Specific Variations within the Genus Agrocybe

PubMed Central

Gonzalez, Patrice; Labarère, Jacques

1998-01-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota. PMID:9797259

Sequence and secondary structure of the mitochondrial small-subunit rRNA V4, V6, and V9 domains reveal highly species-specific variations within the genus Agrocybe.

PubMed

Gonzalez, P; Labarère, J

1998-11-01

A comparative study of variable domains V4, V6, and V9 of the mitochondrial small-subunit (SSU) rRNA was carried out with the genus Agrocybe by PCR amplification of 42 wild isolates belonging to 10 species, Agrocybe aegerita, Agrocybe dura, Agrocybe chaxingu, Agrocybe erebia, Agrocybe firma, Agrocybe praecox, Agrocybe paludosa, Agrocybe pediades, Agrocybe alnetorum, and Agrocybe vervacti. Sequencing of the PCR products showed that the three domains in the isolates belonging to the same species were the same length and had the same sequence, while variations were found among the 10 species. Alignment of the sequences showed that nucleotide motifs encountered in the smallest sequence of each variable domain were also found in the largest sequence, indicating that the sequences evolved by insertion-deletion events. Determination of the secondary structure of each domain revealed that the insertion-deletion events commonly occurred in regions not directly involved in the secondary structure (i.e., the loops). Moreover, conserved sequences ranging from 4 to 25 nucleotides long were found at the beginning and end of each domain and could constitute genus-specific sequences. Comparisons of the V4, V6, and V9 secondary structures resulted in identification of the following four groups: (i) group I, which was characterized by the presence of additional P23-1 and P23-3 helices in the V4 domain and the lack of the P49-1 helix in V9 and included A. aegerita, A. chaxingu, and A. erebia; (ii) group II, which had the P23-3 helix in V4 and the P49-1 helix in V9 and included A. pediades; (iii) group III, which did not have additional helices in V4, had the P49-1 helix in V9 and included A. paludosa, A. firma, A. alnetorum, and A. praecox; and (iv) group IV, which lacked both the V4 additional helices and the P49-1 helix in V9 and included A. vervacti and A. dura. This grouping of species was supported by the structure of a consensus tree based on the variable domain sequences. The conservation of the sequences of the V4, V6, and V9 domains of the mitochondrial SSU rRNA within species and the high degree of interspecific variation found in the Agrocybe species studied open the way for these sequences to be used as specific molecular markers of the Basidiomycota.

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumannii.

PubMed

Rezaee, Mohammad Ahangarzadeh; Pajand, Omid; Nahaei, Mohammad Reza; Mahdian, Reza; Aghazadeh, Mohammad; Ghojazadeh, Morteza; Hojabri, Zoya

2013-07-01

We examined the prevalence of various cephalosporins' resistance mechanisms in Acinetobacter baumannii clinical isolates. Phenotypic and molecular detection of Ambler classes A, B and D β-lactamases was performed on 75 isolates. Clonal relatedness was defined using Repetitive Extragenic Palindromic PCR. PCR mapping was used to examine the linkage of insertion sequences and the ampC gene, and ampC expression was analyzed by TaqMan reverse transcriptase-PCR. Twenty-six (37%) isolates carried at least one of the blaPER-1 or blaTEM-1. Sixty-nine (98.5%) out of 70 cephalosporin-resistant isolates had insertions upstream of the ampC gene, of which 48 (69%) and 6 (8%) were identified as ISAba1and ISAba125, respectively. Higher level of expression was obtained in resistant isolates lacking ISAba1/ampC combination in comparison with that in positive ones. The ability to up-regulate the expression of ampC gene in association with different insertion elements has become an important factor in A. baumannii resistance to cephalosporins. Copyright © 2013 Elsevier Inc. All rights reserved.

Endogenous retroviral insertion in Cryge in the mouse No3 cataract mutant

PubMed Central

Nag, Nabanita; Peterson, Katherine; Wyatt, Keith; Hess, Sonja; Ray, Sugata; Favor, Jack; Bogani, Debora; Lyon, Mary; Wistow, Graeme

2007-01-01

No3 (nuclear opacity 3) is a novel congenital nuclear cataract in mice. Microsatellite mapping placed the No3 locus on chromosome 1 between D1Mit480 (32cM) and D1Mit7 (41cM), a region containing seven crystallin genes; Cryba2 and the Cryga-Crygf cluster. Although polymorphic variants were observed, no candidate mutations were found for six of the genes. However, DNA walking identified a murine endogenous retrovirus (IAPLTR1: ERVK) insertion in exon 3 of Cryge, disrupting the coding sequence for γE-crystallin. Recombinant protein for the mutant γE was completely insoluble. The No3 cataract is mild compared with the effects of similar mutations of γE. Quantitative RT-PCR showed that γE/F mRNA levels are reduced in No3, suggesting that the relatively mild phenotype results from suppression of γE levels due to ERVK insertion. However, the severity of cataract is also strain dependent suggesting that genetic background modifiers also play a role in the development of opacity. PMID:17223009

Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

PubMed

Kietrys, Anna M; Velema, Willem A; Kool, Eric T

2017-11-29

Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schuermann, Karl; Vorwerk, Dierk; Buecker, Arno

Purpose: To compare nonferromagnetic iliac artery prostheses in their suitability for patency monitoring with magnetic resonance angiography (MRA) using conventional angiography as a reference. Methods: In experiment 1, three Memotherm stents were inserted into the iliac arteries of each of six sheep: two 'tandem' stents on one side and a single stent on the other side. In experiment 2, four prostheses (normal and low-porosity Corvita stent-grafts, Memotherm, ZA-stent) were inserted in each of 11 sheep. Patency was monitored before and 1, 3, and 6 months after insertion with 3D phase-contrast and two 2D time-of-flight sequences (TOF-1: TR/TE = 18/6.9, TOF-2:more » 13/2.5) with and without contrast at 1.5 T. On 206 coronal MIP images (72 pre-, 134 post-stenting), three readers analyzed 824 iliac segments (206 x 4) for patency and artifacts. Results: There was no difference in the number of artifacts between tandem and single iliac Memotherm stents. The ZA-stent induced significantly fewer artifacts than the other prostheses (p < 0.00001). With MRA, patency of the ZA-stent was correctly diagnosed in 88% of cases, which was almost comparable to nonstented iliac segments (95%), patency of the Memotherm stent in 59%, and of the Corvita stent-grafts in 57% and 55%. The TOF-2 sequence with contrast yielded the best images. Conclusion: MRA compatibility of nonferromagnetic prostheses depends strongly on the design of the device. MRA may be used to monitor the patency of iliac ZA-stents, whereas iliac Memotherm stents and Corvita stent-grafts appear to be less suited for follow-up with MRA.« less

Complete genome sequence and architecture of crucian carp Carassius auratus herpesvirus (CaHV).

PubMed

Zeng, Xiao-Tao; Chen, Zhong-Yuan; Deng, Yuan-Sheng; Gui, Jian-Fang; Zhang, Qi-Ya

2016-12-01

Crucian carp Carassius auratus herpesvirus (CaHV) was isolated from diseased crucian carp with acute gill hemorrhages and high mortality. The CaHV genome was sequenced and analyzed. The data showed that it consists of 275,348 bp and contains 150 predicted ORFs. The architecture of the CaHV genome differs from those of four cyprinid herpesviruses (CyHV1, CyHV2, SY-C1, CyHV3), with insertions, deletions and the absence of a terminal direct repeat. Phylogenetic analysis of the DNA polymerase sequences of 17 strains of Herpesvirales members, and the concatenated 12 core ORFs from 10 strains of alloherpesviruses showed that CaHV clustered together with members of the genus Cyprinivirus, family Alloherpesviridae.

Structural and functional differences in the dio1 gene in mice with inherited type 1 deiodinase deficiency.

PubMed

Maia, A L; Berry, M J; Sabbag, R; Harney, J W; Larsen, P R

1995-08-01

The type 1 deiodinase (D1) provides the major portion of the circulating T3 in vertebrates. In C3H and certain other inbred mice, liver and kidney D1 activity is 5- to 10-fold lower than in the common phenotype, C57. The lower D1 levels are paralleled by a decreased normal-sized dio1 mRNA and hyperthyroxinemia. Low activity cosegregates with a restriction fragment length variant (RFLV) in both inbred and recombinant strains, indicating it is due to differences in the dio1 gene. The exonic structure and the deduced amino acid sequences are identical for both strains and highly homologous to that of the rat. The RFLV is due to an approximately 150-base pair expansion of repetitive sequences in the second intron of the C3H gene, but this segment does not differentially affect the transient expression of a human GH gene. The promoter and 5'-flanking regions of the C3H and C57 dio1 genes are very similar and are GC rich without TATA or CCAAT boxes. However, functional assays of 1.5-kilobase 5'-flanking dio1-CAT constructs showed 2- to 3-fold higher activity of the C57-CAT constructs. Deletion mutants showed that sequences between -705 and -162 were the cause of this. In this region, the only major difference between the two genes is a 21-base pair insert containing five CTG repeats in the C3H promoter. This difference also cosegregates with low D1 activity and the intron RFLV in four other mouse strains. The correlation of the CTG repeat insert with both in vitro and in vivo expression and the absence of other significant sequence differences in the 5'-flanking region argue that this is the major explanation for the impaired expression of the dio1 gene and the resulting hyperthyroxinemia of the C3H mouse.

Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae):Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid

USDA-ARS?s Scientific Manuscript database

We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...

Emergence of a multiresistant KPC-3 and VIM-1 carbapenemase-producing Escherichia coli strain in Spain.

PubMed

Porres-Osante, Nerea; Azcona-Gutiérrez, Jose Manuel; Rojo-Bezares, Beatriz; Undabeitia, Esther; Torres, Carmen; Sáenz, Yolanda

2014-07-01

To characterize the mechanisms involved in carbapenem resistance, as well as the genetic elements supporting their mobilization, in a multidrug-resistant Escherichia coli isolate. The E. coli isolate was obtained from a patient with fatal urinary sepsis. Antimicrobial susceptibility testing was performed by the disc diffusion and agar dilution methods. The E. coli molecular type and phylogroup were determined using multilocus sequence typing and the triple PCR technique, respectively. PCR and sequencing were used for virulence and resistance genotype characterization. Plasmid content and gene location were analysed by S1-PFGE, I-Ceu1-PFGE and hybridization experiments. Transformation assays were performed. The E. coli strain, typed as ST448 and phylogroup B1, was resistant to all tested antibiotics except fosfomycin, tigecycline and tetracycline. The following resistance and virulence genetic structures were obtained: ISKpn7 + bla(KPC-3) + ISKpn6 linked to Tn4401; tnpR + aac(6')-Ib'-9 + aadA1 + bla(OXA-9) + tnpR + bla(TEM-1a) + tnpB + strB + strA + sul2; intI1 + bla(VIM-1) + aac(6')-Ib' + aphA15 + aadA1 + catB2 + qacEΔ1-sul1 + orf5; ISEcp1 + bla(CMY-2); IS26 + bla(SHV-12); aph(3')-I; aac(3)-IV; floR; catA; and fimA. Mutations in the ampC promoter (-18, -1 and +58) and substitutions in the GyrA (Ser-83→Leu and Asp-87→Asn) and ParC (Ser-80→Ile) proteins were observed. IncFII (ST2), IncA/C and ColE(TP) plasmids of 145.5, 87 and <2 kb, respectively, were found. The bla(VIM-1) gene was located in a non-typeable plasmid of >300 kb, and the bla(KPC-3) gene in the 145.5 kb IncFII plasmid. Transformant strains carried the IncFII and ColE(TP) plasmids, and the bla(KPC-3), bla(TEM-1a), bla(OXA-9), aadA1, aac(6')-Ib'-9, aac(3)-IV and floR genes. This is the first report of the co-production of KPC-3, VIM-1, SHV-12, OXA-9 and CMY-2 in a unique clinical multiresistant E. coli isolate. The dissemination of these genes on mobile genetic elements is alarming and complicates antimicrobial therapies. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Isolation and characterization of a Ds-tagged rice (Oryza sativa L.) GA-responsive dwarf mutant defective in an early step of the gibberellin biosynthesis pathway.

PubMed

Margis-Pinheiro, Marcia; Zhou, Xue-Rong; Zhu, Qian-Hao; Dennis, Elizabeth S; Upadhyaya, Narayana M

2005-03-01

We have isolated a severe dwarf transposon (Ds) insertion mutant in rice (Oryza sativa L.), which could be differentiated early in the seedling stage by reduced shoot growth and dark green leaves, and later by severe dwarfism and failure to initiate flowering. These mutants, however, showed normal seed germination and root growth. One of the sequences flanking Ds, rescued from the mutant, was of a chromosome 4-located putative ent-kaurene synthase (KS) gene, encoding the enzyme catalyzing the second step of the gibberellin (GA) biosynthesis pathway. Dwarf mutants were always homozygous for this Ds insertion and no normal plants homozygous for this mutation were recovered in the segregating progeny, indicating that the Ds insertion mutation is recessive. As mutations in three recently reported rice GA-responsive dwarf mutant alleles and the dwarf mutation identified in this study mapped to the same locus, we designate the corresponding gene OsKS1. The osks1 mutant seedlings were responsive to exogenous gibberellin (GA3). OsKS1 transcripts of about 2.3 kb were detected in leaves and stem of wild-type plants, but not in germinating seeds or roots, suggesting that OsKS1 is not involved in germination or root growth. There are at least five OsKS1-like genes in the rice genome, four of which are also represented in rice expressed sequence tag (EST) databases. All OsKS1-like genes are transcribed with different expression patterns. ESTs corresponding to all six OsKS genes are represented in other cereal databases including barley, wheat and maize, suggesting that they are biologically active.

Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

PubMed

Traverse, Charles C; Ochman, Howard

2017-08-29

Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

[New hosts and vectors for genome cloning]. Progress report, 1990--1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Distribution of Classical and Nonclassical Virulence Genes in Enterotoxigenic Escherichia coli Isolates from Chilean Children and tRNA Gene Screening for Putative Insertion Sites for Genomic Islands▿†

PubMed Central

Del Canto, Felipe; Valenzuela, Patricio; Cantero, Lidia; Bronstein, Jonathan; Blanco, Jesús E.; Blanco, Jorge; Prado, Valeria; Levine, Myron; Nataro, James; Sommerfelt, Halvor; Vidal, Roberto

2011-01-01

Enterotoxigenic Escherichia coli (ETEC) is an important cause of diarrhea. Three adhesins (Tia, TibA, EtpA), an iron acquisition system (Irp1, Irp2, and FyuA), a GTPase (LeoA), and an autotransporter (EatA) are ETEC virulence-related proteins that, in contrast to the classical virulence factors (enterotoxins and fimbrial colonization factors) have not heretofore been targets in characterizing isolates from epidemiological studies. Here, we determined the occurrence of these nonclassical virulence genes in 103 ETEC isolates from Chilean children with diarrhea and described their association with O serogroups and classical virulence determinants. Because tia, leoA, irp2, and fyuA are harbored by pathogenicity islands inserted into the selC and asnT tRNA genes (tDNAs), we analyzed the regions flanking these loci. Ten additional tDNAs were also screened to identify hot spots for genetic insertions. Associations between the most frequent serogroups and classical colonization factor (CF)-toxin profiles included O6/LT-STh/CS1-CS3-CS21 (i.e., O6 serogroup, heat-labile [LT] and human heat-stable [STh] enterotoxins, and CFs CS1, -3 and -21), O6/LT-STh/CS2-CS3-CS21, and O104-O127/STh/CFAI-CS21. The eatA and etpA genes were detected in more than 70% of the collection, including diverse serogroups and virulence profiles. Sixteen percent of the ETEC strains were negative for classical and nonclassical adhesins, suggesting the presence of unknown determinants of adhesion. The leuX, thrW, and asnT tDNAs were disrupted in more than 65% of strains, suggesting they are hot spots for the insertion of mobile elements. Sequences similar to integrase genes were identified next to the thrW, asnT, pheV, and selC tDNAs. We propose that the eatA and etpA genes should be included in characterizations of ETEC isolates in future epidemiological studies to determine their prevalence in other geographical regions. Sequencing of tDNA-associated genetic insertions might identify new ETEC virulence determinants. PMID:21775541

A randomized controlled trial of nitrous oxide for intrauterine device insertion in nulliparous women.

PubMed

Singh, Rameet H; Thaxton, Lauren; Carr, Shannon; Leeman, Lawrence; Schneider, Emily; Espey, Eve

2016-11-01

To evaluate the effectiveness of inhaled nitrous oxide for pain management among nulliparous women undergoing intrauterine device (IUD) insertion. A double-blind, randomized controlled trial was conducted among nulliparous women aged 13-45years who underwent IUD insertion at a US center between October 1, 2013, and August 31, 2014. Using a computer-generated randomization sequence, participants were randomly assigned to inhale either oxygen (O 2 ) or a mixture of 50% nitrous oxide and 50% oxygen (N 2 O/O 2 ) through a nasal mask for 2minutes before insertion. Only the person administering the inhalation agent was aware of group assignment. The primary outcome was maximum pain assessed 2minutes after insertion via a 100-mm visual analog scale. Analyses were by intention to treat. Forty women were assigned to each group. Mean maximum pain score at the time of insertion was 54.3±24.8mm for the N 2 O/O 2 group and 55.3±20.9mm for the O 2 group (P=0.86). Adverse effects were reported for 6 (15%) women in the N 2 O/O 2 group and 7 (18%) in the O 2 group (P=0.32). N 2 O/O 2 did not reduce the pain of IUD insertion among nulliparous women. ClinicalTrials.gov: NCT02391714. Published by Elsevier Ireland Ltd.

Utilization of founder lines for improved Citrus biotechnology via RMCE

USDA-ARS?s Scientific Manuscript database

On October 1st 2011 the CRB chose to fund a unique research project, the development of citrus cultivars specifically for genetic engineering (GE). The objective of this research was to develop GE citrus ‘Founder Lines’ containing DNA sequences that will allow the precise insertion of genes for de...

Use of molecular probes to detect parasites and retrotransposons in gypsy moths

Treesearch

John H. Werren; Thomas O' Dell

1991-01-01

Retrotransposon screen: Gypsy moth families containing straggling and nonstraggling individuals were divided into categories of straggling, medium, and nonstraggling individuals, from which DNA was extracted. Four families were tested by southern hybridization and probing with ribosomal sequences designed to detect R1 and R2 retrotransposon insertions. Results showed...

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

The accommodation index measures the perturbation associated with insertions and deletions in coiled‐coils: Application to understand signaling in histidine kinases

PubMed Central

Schmidt, Nathan W.; Grigoryan, Gevorg

2017-01-01

Abstract Coiled‐coils are essential components of many protein complexes. First discovered in structural proteins such as keratins, they have since been found to figure largely in the assembly and dynamics required for diverse functions, including membrane fusion, signal transduction and motors. Coiled‐coils have a characteristic repeating seven‐residue geometric and sequence motif, which is sometimes interrupted by the insertion of one or more residues. Such insertions are often highly conserved and critical to interdomain communication in signaling proteins such as bacterial histidine kinases. Here we develop the “accommodation index” as a parameter that allows automatic detection and classification of insertions based on the three dimensional structure of a protein. This method allows precise identification of the type of insertion and the “accommodation length” over which the insertion is structurally accommodated. A simple theory is presented that predicts the structural perturbations of 1, 3, 4 residue insertions as a function of the length over which the insertion is accommodated. Analysis of experimental structures is in good agreement with theory, and shows that short accommodation lengths give rise to greater perturbation of helix packing angles, changes in local helical phase, and increased structural asymmetry relative to long accommodation lengths. Cytoplasmic domains of histidine kinases in different signaling states display large changes in their accommodation lengths, which can now be seen to underlie diverse structural transitions including symmetry/asymmetry and local variations in helical phase that accompany signal transduction. PMID:27977891

SU-E-J-224: Using UTE and T1 Weighted Spin Echo Pulse Sequences for MR-Only Treatment Planning; Phantom Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, H; Fatemi, A; Sahgal, A

Purpose: Investigating a new approach in MRI based treatment planning using the combination of (Ultrashort Echo Time) UTE and T1 weighted spin echo pulse sequences to delineate air, bone and water (soft tissues) in generating pseudo CT images comparable with CT. Methods: A gel phantom containing chicken bones, ping pang balls filled with distilled water and air bubbles, was made. It scanned with MRI using UTE and 2D T1W SE pulse sequences with (in plane resolution= 0.53mm, slice thickness= 2 mm) and CT with (in plane resolution= 0.5 mm and slice thickness= 0.75mm) as a ground truth for geometrical accuracy.more » The UTE and T1W SE images were registered with CT using mutual information registration algorithm provided by Philips Pinnacle treatment planning system. The phantom boundaries were detected using Canny edge detection algorithm for CT, and MR images. The bone, air bubbles and water in ping pong balls were segmented from CT images using threshold 300HU, - 950HU and 0HU, respectively. These tissue inserts were automatically segmented from combined UTE and T1W SE images using edge detection and relative intensity histograms of the phantom. The obtained segmentations of air, bone and water inserts were evaluated with those obtained from CT. Results: Bone and air can be clearly differentiated in UTE images comparable to CT. Combining UTE and T1W SE images successfully segmented the air, bone and water. The maximum segmentation differences from combine MRI images (UTE and T1W SE) and CT are within 1.3 mm, 1.1mm for bone, air, respectively. The geometric distortion of UTE sequence is small less than 1 pixel (0.53 mm) of MR image resolution. Conclusion: Our approach indicates that MRI can be used solely for treatment planning and its quality is comparable with CT.« less

TEs or not TEs? That is the evolutionary question.

PubMed

Vaknin, Keren; Goren, Amir; Ast, Gil

2009-10-23

Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

PubMed

Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

2016-10-15

Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-02-15

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

PubMed Central

Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

1996-01-01

Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

HERV-W group evolutionary history in non-human primates: characterization of ERV-W orthologs in Catarrhini and related ERV groups in Platyrrhini.

PubMed

Grandi, Nicole; Cadeddu, Marta; Blomberg, Jonas; Mayer, Jens; Tramontano, Enzo

2018-01-19

The genomes of all vertebrates harbor remnants of ancient retroviral infections, having affected the germ line cells during the last 100 million years. These sequences, named Endogenous Retroviruses (ERVs), have been transmitted to the offspring in a Mendelian way, being relatively stable components of the host genome even long after their exogenous counterparts went extinct. Among human ERVs (HERVs), the HERV-W group is of particular interest for our physiology and pathology. A HERV-W provirus in locus 7q21.2 has been coopted during evolution to exert an essential role in placenta, and the group expression has been tentatively linked to Multiple Sclerosis and other diseases. Following up on a detailed analysis of 213 HERV-W insertions in the human genome, we now investigated the ERV-W group genomic spread within primate lineages. We analyzed HERV-W orthologous loci in the genome sequences of 12 non-human primate species belonging to Simiiformes (parvorders Catarrhini and Platyrrhini), Tarsiiformes and to the most primitive Prosimians. Analysis of HERV-W orthologous loci in non-human Catarrhini primates revealed species-specific insertions in the genomes of Chimpanzee (3), Gorilla (4), Orangutan (6), Gibbon (2) and especially Rhesus Macaque (66). Such sequences were acquired in a retroviral fashion and, in the majority of cases, by L1-mediated formation of processed pseudogenes. There were also a number of LTR-LTR homologous recombination events that occurred subsequent to separation of Catarrhini sub-lineages. Moreover, we retrieved 130 sequences in Marmoset and Squirrel Monkeys (family Cebidae, Platyrrhini parvorder), identified as ERV1-1_CJa based on RepBase annotations, which appear closely related to the ERV-W group. Such sequences were also identified in Atelidae and Pitheciidae, representative of the other Platyrrhini families. In contrast, no ERV-W-related sequences were found in genome sequence assemblies of Tarsiiformes and Prosimians. Overall, our analysis now provides a detailed picture of the ERV-W sequences colonization of the primate lineages genomes, revealing the exact dynamics of ERV-W locus formations as well as novel insights into the evolution and origin of the group.

Complete genome sequence and the expression pattern of plasmids of the model ethanologen Zymomonas mobilis ZM4 and its xylose-utilizing derivatives 8b and 2032.

PubMed

Yang, Shihui; Vera, Jessica M; Grass, Jeff; Savvakis, Giannis; Moskvin, Oleg V; Yang, Yongfu; McIlwain, Sean J; Lyu, Yucai; Zinonos, Irene; Hebert, Alexander S; Coon, Joshua J; Bates, Donna M; Sato, Trey K; Brown, Steven D; Himmel, Michael E; Zhang, Min; Landick, Robert; Pappas, Katherine M; Zhang, Yaoping

2018-01-01

Zymomonas mobilis is a natural ethanologen being developed and deployed as an industrial biofuel producer. To date, eight Z. mobilis strains have been completely sequenced and found to contain 2-8 native plasmids. However, systematic verification of predicted Z. mobilis plasmid genes and their contribution to cell fitness has not been hitherto addressed. Moreover, the precise number and identities of plasmids in Z. mobilis model strain ZM4 have been unclear. The lack of functional information about plasmid genes in ZM4 impedes ongoing studies for this model biofuel-producing strain. In this study, we determined the complete chromosome and plasmid sequences of ZM4 and its engineered xylose-utilizing derivatives 2032 and 8b. Compared to previously published and revised ZM4 chromosome sequences, the ZM4 chromosome sequence reported here contains 65 nucleotide sequence variations as well as a 2400-bp insertion. Four plasmids were identified in all three strains, with 150 plasmid genes predicted in strain ZM4 and 2032, and 153 plasmid genes predicted in strain 8b due to the insertion of heterologous DNA for expanded substrate utilization. Plasmid genes were then annotated using Blast2GO, InterProScan, and systems biology data analyses, and most genes were found to have apparent orthologs in other organisms or identifiable conserved domains. To verify plasmid gene prediction, RNA-Seq was used to map transcripts and also compare relative gene expression under various growth conditions, including anaerobic and aerobic conditions, or growth in different concentrations of biomass hydrolysates. Overall, plasmid genes were more responsive to varying hydrolysate concentrations than to oxygen availability. Additionally, our results indicated that although all plasmids were present in low copy number (about 1-2 per cell), the copy number of some plasmids varied under specific growth conditions or due to heterologous gene insertion. The complete genome of ZM4 and two xylose-utilizing derivatives is reported in this study, with an emphasis on identifying and characterizing plasmid genes. Plasmid gene annotation, validation, expression levels at growth conditions of interest, and contribution to host fitness are reported for the first time.

Population-wide sampling of retrotransposon insertion polymorphisms using deep sequencing and efficient detection.

PubMed

Yu, Qichao; Zhang, Wei; Zhang, Xiaolong; Zeng, Yongli; Wang, Yeming; Wang, Yanhui; Xu, Liqin; Huang, Xiaoyun; Li, Nannan; Zhou, Xinlan; Lu, Jie; Guo, Xiaosen; Li, Guibo; Hou, Yong; Liu, Shiping; Li, Bo

2017-09-01

Active retrotransposons play important roles during evolution and continue to shape our genomes today, especially in genetic polymorphisms underlying a diverse set of diseases. However, studies of human retrotransposon insertion polymorphisms (RIPs) based on whole-genome deep sequencing at the population level have not been sufficiently undertaken, despite the obvious need for a thorough characterization of RIPs in the general population. Herein, we present a novel and efficient computational tool called Specific Insertions Detector (SID) for the detection of non-reference RIPs. We demonstrate that SID is suitable for high-depth whole-genome sequencing data using paired-end reads obtained from simulated and real datasets. We construct a comprehensive RIP database using a large population of 90 Han Chinese individuals with a mean ×68 depth per individual. In total, we identify 9342 recent RIPs, and 8433 of these RIPs are novel compared with dbRIP, including 5826 Alu, 2169 long interspersed nuclear element 1 (L1), 383 SVA, and 55 long terminal repeats. Among the 9342 RIPs, 4828 were located in gene regions and 5 were located in protein-coding regions. We demonstrate that RIPs can, in principle, be an informative resource to perform population evolution and phylogenetic analyses. Taking the demographic effects into account, we identify a weak negative selection on SVA and L1 but an approximately neutral selection for Alu elements based on the frequency spectrum of RIPs. SID is a powerful open-source program for the detection of non-reference RIPs. We built a non-reference RIP dataset that greatly enhanced the diversity of RIPs detected in the general population, and it should be invaluable to researchers interested in many aspects of human evolution, genetics, and disease. As a proof of concept, we demonstrate that the RIPs can be used as biomarkers in a similar way as single nucleotide polymorphisms. © The Authors 2017. Published by Oxford University Press.

Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

PubMed

Szeverényi, I; Hodel, A; Arber, W; Olasz, F

1996-09-26

We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

Targeted gene insertion for molecular medicine.

PubMed

Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

2008-11-01

Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

[cDNA library construction from panicle meristem of finger millet].

PubMed

Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

2014-01-01

The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing.

PubMed

Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J

2016-11-15

The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we have taken is applicable to other plant-interacting bacteria. Copyright © 2016 Rosconi et al.

Mycobacterium smegmatis strain for detection of Mycobacterium tuberculosis by PCR used as internal control for inhibition of amplification and for quantification of bacteria.

PubMed Central

Kolk, A H; Noordhoek, G T; de Leeuw, O; Kuijper, S; van Embden, J D

1994-01-01

For the detection of Mycobacterium tuberculosis by PCR, the IS6110 sequence was used. A modified target was constructed by insertion of 56 nucleotides in the IS6110 insertion element of Mycobacterium bovis BCG. This modified insertion sequence was integrated into the genome of Mycobacterium smegmatis, a mycobacterium species which does not contain the IS6110 element. When DNA from the modified M. smegmatis 1008 strain was amplified with IS6110-specific primers INS1 and INS2, a band of 301 bp was seen on agarose gel, whereas the PCR product of M. tuberculosis complex DNA was a 245-bp fragment with these primers. The addition of a small number of M. smegmatis 1008 cells to clinical samples before DNA purification enables the detection of problems which may be due to the loss of DNA in the isolation procedure or to the presence of inhibitors. The presence of inhibitors of the amplification reaction can be confirmed by the addition of M. smegmatis 1008 DNA after the DNA isolation procedure. Furthermore, competition between the different target DNAs of M. smegmatis 1008 DNA and M. tuberculosis complex DNA enables the estimation of the number of IS6110 elements in the clinical sample. Images PMID:8051267

The Major Cold Shock Gene, cspA, Is Involved in the Susceptibility of Staphylococcus aureus to an Antimicrobial Peptide of Human Cathepsin G

PubMed Central

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T.; Shafer, William M.

2003-01-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system. PMID:12874306

The major cold shock gene, cspA, is involved in the susceptibility of Staphylococcus aureus to an antimicrobial peptide of human cathepsin G.

PubMed

Katzif, Samuel; Danavall, Damien; Bowers, Samera; Balthazar, Jacqueline T; Shafer, William M

2003-08-01

A Tn551 insertional library of Staphylococcus aureus strain ISP479 was challenged with an antimicrobial peptide (CG 117-136) derived from human neutrophil cathepsin G (CG). After repeated selection and screening of surviving colonies, a mutant was identified that expressed increased resistance to CG 117-136. Southern hybridization analysis revealed that the Tn551 insert in this mutant (SK1) was carried on a 10.6-kb EcoRI chromosomal DNA fragment. Subsequent physical mapping of this Tn551 insert revealed that it was positioned between a putative promoter sequence and the translational start codon of the cspA gene, which encodes a protein (CspA) highly similar to the major cold shock proteins CspA and CspB of Escherichia coli and Bacillus subtilis, respectively. This Tn551 insertion as well as a separate deletion-insertion mutation in cspA decreased the capacity of S. aureus to respond to the stress of cold shock and increased resistance to CG 117-136. The results indicate for the first time that a physiologic link exists between bacterial susceptibility to an antimicrobial peptide and a stress response system.

Usefulness of immunohistochemistry for the detection of the BRAF V600E mutation in Japanese lung adenocarcinoma.

PubMed

Sasaki, Hidefumi; Shimizu, Shigeki; Tani, Yoichi; Shitara, Masayuki; Okuda, Katsuhiro; Hikosaka, Yu; Moriyama, Satoru; Yano, Motoki; Fujii, Yoshitaka

2013-10-01

Mutations in components of the mitogen-activated protein kinase (MAPK) cascade may be a new candidate for target for lung cancer. The usefulness of immunohistochemistry (IHC) as a new approach for the detection of BRAF V600E in cancer patients has been recently reported. To increase the sensitivity, we modified BRAF V600E expression detection assay by IHC using mutation specific antibody. From the screening step, we found a novel 599 insertion T BRAF mutation in lung adenocarcinoma. In this study included 26 surgically removed cases with EGFR, Kras, erbB2, EML4-ALK and KIF5B-RET wild-type (wt) lung adenocarcinomas, including 7 BRAF mutants (5 V600E, 1 N581I, and 1 novel 599 insertion T mutation) analyzed by DNA sequencing. Detection of the BRAF V600E mutation was carried out by the Dako EnVision™ FLEX detection system using the VE1 clone antibody and compared with the results of direct sequencing. The autostainer IHC VE1 assay was positive in 5 of 5 (100%) BRAF V600E-mutated tumors and negative in 20 of 21 (95.2%) BRAF non-V600E tumors, except for a novel 599 insertion T case. IHC using the VE1 clone and FLEX linker is a specific method for the detection BRAF V600E and may be an alternative to molecular biology for the detection of mutations in lung adenocarcinomas. This method might be useful for screening to use molecular target therapy for lung adenocarcinomas. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Interdependence of pyrene interactions and tetramolecular G4-DNA assembly.

PubMed

Doluca, Osman; Withers, Jamie M; Loo, Trevor S; Edwards, Patrick J B; González, Carlos; Filichev, Vyacheslav V

2015-03-28

Controlling the arrangement of organic chromophores in supramolecular architectures is of primary importance for the development of novel functional molecules. Insertion of a twisted intercalating nucleic acid (TINA) moiety, containing phenylethynylpyren-1-yl derivatives, into a G-rich DNA sequence alters G-quadruplex folding, resulting in supramolecular structures with defined pyrene arrangements. Based on CD, NMR and ESI-mass-spectra, as well as TINA excited dimer (excimer) fluorescence emission we propose that insertion of the TINA monomer in the middle of a dTG4T sequence (i.e. dTGGXGGT, where X is TINA) converts a parallel tetramolecular G-quadruplex into an assembly composed of two identical antiparallel G-quadruplex subunits stacked via TINA-TINA interface. Kinetic analysis showed that TINA-TINA association controls complex formation in the presence of Na(+) but barely competes with guanine-mediated association in K(+) or in the sequence with the longer G-run (dTGGGXGGGT). These results demonstrate new perspectives in the design of molecular entities that can kinetically control G-quadruplex formation and show how tetramolecular G-quadruplexes can be used as a tuneable scaffold to control the arrangement of organic chromophores.

CMV-promoter driven codon-optimized expression alters the assembly type and morphology of a reconstituted HERV-K(HML-2).

PubMed

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-11-11

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations.

CMV-Promoter Driven Codon-Optimized Expression Alters the Assembly Type and Morphology of a Reconstituted HERV-K(HML-2)

PubMed Central

Hohn, Oliver; Hanke, Kirsten; Lausch, Veronika; Zimmermann, Anja; Mostafa, Saeed; Bannert, Norbert

2014-01-01

The HERV-K(HML-2) family contains the most recently integrated and best preserved endogenized proviral sequences in the human genome. All known elements have nevertheless been subjected to mutations or deletions that render expressed particles non-infectious. Moreover, these post-insertional mutations hamper the analysis of the general biological properties of this ancient virus family. The expression of consensus sequences and sequences of elements with reverted post-insertional mutations has therefore been very instrumental in overcoming this limitation. We investigated the particle morphology of a recently reconstituted HERV-K113 element termed oriHERV-K113 using thin-section electron microscopy (EM) and could demonstrate that strong overexpression by substitution of the 5'LTR for a CMV promoter and partial codon optimization altered the virus assembly type and morphology. This included a conversion from the regular C-type to an A-type morphology with a mass of cytoplasmic immature cores tethered to the cell membrane and the membranes of vesicles. Overexpression permitted the release and maturation of virions but reduced the envelope content. A weaker boost of virus expression by Staufen-1 was not sufficient to induce these morphological alterations. PMID:25393897

Molecular analysis of Toxoplasma gondii Surface Antigen 1 (SAG1) gene cloned from Toxoplasma gondii DNA isolated from Javanese acute toxoplasmosis

NASA Astrophysics Data System (ADS)

Haryati, Sri; Agung Prasetyo, Afiono; Sari, Yulia; Dharmawan, Ruben

2018-05-01

Toxoplasma gondii Surface Antigen 1 (SAG1) is often used as a diagnostic tool due to its immunodominant-specific as antigen. However, data of the Toxoplasma gondii SAG1 protein from Indonesian isolate is limited. To study the protein, genomic DNA was isolated from a Javanese acute toxoplasmosis blood samples patient. A complete coding sequence of Toxoplasma gondii SAG1 was cloned and inserted into an Escherichia coli expression plasmid and sequenced. The sequencing results were subjected to bioinformatics analysis. The Toxoplasma gondii SAG1 complete coding sequences were successfully cloned. Physicochemical analysis revealed the 336 aa of SAG1 had 34.7 kDa of weight. The isoelectric point and aliphatic index were 8.4 and 78.4, respectively. The N-terminal methionine half-life in Escherichia coli was more than 10 hours. The antigenicity, secondary structure, and identification of the HLA binding motifs also had been discussed. The results of this study would contribute information about Toxoplasma gondii SAG1 and benefits for further works willing to develop diagnostic and therapeutic strategies against the parasite.

Structural features of the rice chromosome 4 centromere.

PubMed

Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin

2004-01-01

A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.

Computational allergenicity prediction of transgenic proteins expressed in genetically modified crops.

PubMed

Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D

2011-09-01

Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.

MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.

PubMed

Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

2018-03-05

Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.

SvABA: genome-wide detection of structural variants and indels by local assembly.

PubMed

Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen

2018-04-01

Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.

Optical mapping and its potential for large-scale sequencing projects.

PubMed

Aston, C; Mishra, B; Schwartz, D C

1999-07-01

Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.

BACCardI--a tool for the validation of genomic assemblies, assisting genome finishing and intergenome comparison.

PubMed

Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C

2005-04-01

We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.

Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

PubMed Central

Harden, N.; Ashburner, M.

1990-01-01

FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

Identification of a novel insertion mutation in FGFR3 that causes thanatophoric dysplasia type 1.

PubMed

Lindy, Amanda S; Basehore, Monica J; Munisha, Mumingjiang; Williams, Aimee Leanne; Friez, Michael J; Writzl, Karin; Willems, Patrick; Dougan, Scott T

2016-06-01

Thanatophoric dysplasia is a type of short-limbed neonatal dwarfism that is usually lethal in the perinatal period. It is characterized by short limbs, a narrow, bell-shaped thorax, macrocephaly with a prominent forehead, and flattened vertebral bodies. These malformations result from autosomal dominant mutations in the fibroblast growth factor receptor 3 (FGFR3) gene. In this report, we describe a novel FGFR3 insertion mutation in a fetus with shortened limbs, curved femurs, and a narrow thorax. The diagnosis of thanatophoric dysplasia type 1 was suspected clinically, and FGFR3 sequencing showed a c.742_743insTGT variant, which predicts p.R248delinsLC. In vivo studies in zebrafish demonstrated that this mutation resulted in the overexpression of zebrafish Fgfr3, leading to the over-activation of downstream signaling and dorsalized embryos. To date, no insertions or deletions in FGFR3 have been reported to cause thanatophoric dysplasia types 1 or 2; therefore, this represents the first report to describe such a mutation. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Seedling lethality in Nicotiana plumbaginifolia conferred by Ds transposable element insertion into a plant-specific gene.

PubMed

Majira, Amel; Domin, Monique; Grandjean, Olivier; Gofron, Krystyna; Houba-Hérin, Nicole

2002-10-01

A seedling lethal mutant of Nicotiana plumbaginifolia (sdl-1) was isolated by transposon tagging using a maize Dissociation (Ds) element. The insertion mutation was produced by direct co-transformation of protoplasts with two plasmids: one containing Ds and a second with an Ac transposase gene. sdl-1 seedlings exhibit several phenotypes: swollen organs, short hypocotyls in light and dark conditions, and enlarged and multinucleated cells, that altogether suggest cell growth defects. Mutant cells are able to proliferate under in vitro culture conditions. Genomic DNA sequences bordering the transposon were used to recover cDNA from the normal allele. Complementation of the mutant phenotype with the cDNA confirmed that the transposon had caused the mutation. The Ds element was inserted into the first exon of the open reading frame and the homozygous mutant lacked detectable transcript. Phenocopies of the mutant were obtained by an antisense approach. SDL-1 encodes a novel protein found in several plant genomes but apparently missingfrom animal and fungal genomes; the protein is highly conserved and has a potential plastid targeting motif.

Whole Genome Re-Sequencing Identifies a Quantitative Trait Locus Repressing Carbon Reserve Accumulation during Optimal Growth in Chlamydomonas reinhardtii

PubMed Central

Goold, Hugh Douglas; Nguyen, Hoa Mai; Kong, Fantao; Beyly-Adriano, Audrey; Légeret, Bertrand; Billon, Emmanuelle; Cuiné, Stéphan; Beisson, Fred; Peltier, Gilles; Li-Beisson, Yonghua

2016-01-01

Microalgae have emerged as a promising source for biofuel production. Massive oil and starch accumulation in microalgae is possible, but occurs mostly when biomass growth is impaired. The molecular networks underlying the negative correlation between growth and reserve formation are not known. Thus isolation of strains capable of accumulating carbon reserves during optimal growth would be highly desirable. To this end, we screened an insertional mutant library of Chlamydomonas reinhardtii for alterations in oil content. A mutant accumulating five times more oil and twice more starch than wild-type during optimal growth was isolated and named constitutive oil accumulator 1 (coa1). Growth in photobioreactors under highly controlled conditions revealed that the increase in oil and starch content in coa1 was dependent on light intensity. Genetic analysis and DNA hybridization pointed to a single insertional event responsible for the phenotype. Whole genome re-sequencing identified in coa1 a >200 kb deletion on chromosome 14 containing 41 genes. This study demonstrates that, 1), the generation of algal strains accumulating higher reserve amount without compromising biomass accumulation is feasible; 2), light is an important parameter in phenotypic analysis; and 3), a chromosomal region (Quantitative Trait Locus) acts as suppressor of carbon reserve accumulation during optimal growth. PMID:27141848

Conservative site-specific and single-copy transgenesis in human LINE-1 elements

PubMed Central

Vijaya Chandra, Shree Harsha; Makhija, Harshyaa; Peter, Sabrina; Myint Wai, Cho Mar; Li, Jinming; Zhu, Jindong; Ren, Zhonglu; D'Alcontres, Martina Stagno; Siau, Jia Wei; Chee, Sharon; Ghadessy, Farid John; Dröge, Peter

2016-01-01

Genome engineering of human cells plays an important role in biotechnology and molecular medicine. In particular, insertions of functional multi-transgene cassettes into suitable endogenous sequences will lead to novel applications. Although several tools have been exploited in this context, safety issues such as cytotoxicity, insertional mutagenesis and off-target cleavage together with limitations in cargo size/expression often compromise utility. Phage λ integrase (Int) is a transgenesis tool that mediates conservative site-specific integration of 48 kb DNA into a safe harbor site of the bacterial genome. Here, we show that an Int variant precisely recombines large episomes into a sequence, termed attH4X, found in 1000 human Long INterspersed Elements-1 (LINE-1). We demonstrate single-copy transgenesis through attH4X-targeting in various cell lines including hESCs, with the flexibility of selecting clones according to transgene performance and downstream applications. This is exemplified with pluripotency reporter cassettes and constitutively expressed payloads that remain functional in LINE1-targeted hESCs and differentiated progenies. Furthermore, LINE-1 targeting does not induce DNA damage-response or chromosomal aberrations, and neither global nor localized endogenous gene expression is substantially affected. Hence, this simple transgene addition tool should become particularly useful for applications that require engineering of the human genome with multi-transgenes. PMID:26673710

Genome-wide analysis of Tol2 transposon reintegration in zebrafish.

PubMed

Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir

2009-09-08

Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

Insertional inactivation of oprD in carbapenem-resistant Pseudomonas aeruginosa strains isolated from burn patients in Tehran, Iran.

PubMed

Shariati, A; Azimi, T; Ardebili, A; Chirani, A S; Bahramian, A; Pormohammad, A; Sadredinamin, M; Erfanimanesh, S; Bostanghadiri, N; Shams, S; Hashemi, A

2018-01-01

In this study, we report the insertion sequence IS Ppu 21 in the opr D porin gene of carbapenem-resistant Pseudomonas aeruginosa isolates from burn patients in Tehran, Iran. Antibiotic susceptibility tests for P. aeruginosa isolates were determined. Production of metallo-β-lactamases (MBLs) and carbapenemase was evaluated and the β-lactamase-encoding and aminoglycoside-modifying enzyme genes were investigated by PCR and sequencing methods. The mRNA transcription level of oprD and mex efflux pump genes were evaluated by real-time PCR. The outer membrane protein profile was determined by SDS-PAGE. The genetic relationship between the P. aeruginosa isolates was assessed by random amplified polymorphic DNA PCR. In all, 10.52% (10/95) of clinical isolates of P. aeruginosa harboured the IS Ppu 21 insertion element in the opr D gene. The extended-spectrum β-lactamase-encoding gene in IS Ppu 21-carrying isolates was bla TEM . PCR assays targeting MBL and carbapenemase-encoding genes were also negative in all ten isolates. The rmt A, aad A, aad B and arm A genes were positive in all IS Ppu 21 harbouring isolates. The relative expression levels of the mex X, mex B, mex T and mex D genes in ten isolates ranged from 0.1- to 1.4-fold, 1.1- to 3.68-fold, 0.3- to 8.22-fold and 1.7- to 35.17-fold, respectively. The relative expression levels of the oprD in ten isolates ranged from 0.57- to 35.01-fold, which was much higher than those in the control strain P. aeruginosa PAO1. Evaluation of the outer membrane protein by SDS-PAGE suggested that opr D was produced at very low levels by all isolates. Using random amplified polymorphic DNA PCR genotyping, eight of the ten isolates containing IS Ppu 21 were shown to be clonally related. The present study describes a novel molecular mechanism, IS Ppu 21 insertion of the opr D gene, associated with carbapenem resistance in clinical P. aeruginosa isolates.

Selfish DNA in protein-coding genes of Rickettsia.

PubMed

Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

2000-10-13

Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

Clostridium perfringens type A–E toxin plasmids

PubMed Central

Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

2014-01-01

Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

Stability of Tandem Repeats in the Drosophila Melanogaster HSR-Omega Nuclear RNA

PubMed Central

Hogan, N. C.; Slot, F.; Traverse, K. L.; Garbe, J. C.; Bendena, W. G.; Pardue, M. L.

1995-01-01

The Drosophila melanogaster Hsr-omega locus produces a nuclear RNA containing >5 kb of tandem repeat sequences. These repeats are unique to Hsr-omega and show concerted evolution similar to that seen with classical satellite DNAs. In D. melanogaster the monomer is ~280 bp. Sequences of 191/2 monomers differ by 8 +/- 5% (mean +/- SD), when all pairwise comparisons are considered. Differences are single nucleotide substitutions and 1-3 nucleotide deletions/insertions. Changes appear to be randomly distributed over the repeat unit. Outer repeats do not show the decrease in monomer homogeneity that might be expected if homogeneity is maintained by recombination. However, just outside the last complete repeat at each end, there are a few fragments of sequence similar to the monomer. The sequences in these flanking regions are not those predicted for sequences decaying in the absence of recombination. Instead, the fragmentation of the sequence homology suggests that flanking regions have undergone more severe disruptions, possibly during an insertion or amplification event. Hsr-omega alleles differing in the number of repeats are detected and appear to be stable over a few thousand generations; however, both increases and decreases in repeat numbers have been observed. The new alleles appear to be as stable as their predecessors. No alleles of less than ~5 kb nor more than ~16 kb of repeats were seen in any stocks examined. The evidence that there is a limit on the minimum number of repeats is consistent with the suggestion that these repeats are important in the function of the unusual Hsr-omega nuclear RNA. PMID:7540581

Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

PubMed

Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

2015-11-18

RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

PubMed Central

Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

2005-01-01

Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

Development and characterization of simple sequence repeats for Bipolaris sokiniana and cross transferability to related species

USDA-ARS?s Scientific Manuscript database

Simple sequence repeats (SSR) markers were developed from a small insert genomic library for Bipolaris sorokiniana, a mitosporic fungal pathogen that causes spot blotch and root rot in switchgrass. About 59% of sequenced clones (n=384) harbored various SSR motifs. After eliminating the redundant seq...

Two open reading frames (ORF1 and ORF2) within the 2.0-kilobase latency-associated transcript of herpes simplex virus type 1 are not essential for reactivation from latency.

PubMed Central

Fareed, M U; Spivack, J G

1994-01-01

The herpes simplex virus type 1 (HSV-1) latency-associated transcripts (LATs) are dispensable for establishment and maintenance of latent infection. However, the LATs have been implicated in reactivation of the virus from its latent state. Since the reported LAT deletion and/or insertion variants that are reactivation impaired contain deletions in the putative LAT promoter, it is not known which LAT sequences are involved in reactivation. To examine the role of the 2.0-kb LAT in the process of reactivation and the functional importance of the putative open reading frames (ORF1 and ORF2) contained within the 2.0-kb LAT, we have constructed an HSV-1 variant that contains a precise deletion and insertion within the LAT-specific DNA sequences using site-directed mutagenesis. The HSV-1 variant FS1001K contains an 1,186-bp deletion starting precisely from the 5' end of the 2.0-kb LAT and, for identification, a XbaI restriction endonuclease site insertion. The FS1001K genome contains no other deletions and/or insertions as analyzed by a variety of restriction endonucleases. The deletion in FS1001K removes the entire 556-bp intron within the 2.0-kb LAT, the first 229 nucleotides of ORF1, and the first 159 nucleotides of ORF2 without having an affect on the RL2 (ICP0) gene. Explant cocultivation reactivation assays indicated that this deletion had a minimal effect on reactivation of the variant FS1001K compared with the parental wild-type virus using a mouse eye model. As expected, Northern (RNA) blot analyses have shown that the variant virus (FS1001K) does not produce the 2.0-kb LAT or the 1.45- to 1.5-kb LAT either in vitro or in vivo; however, FS1001K produces an intact RL2 transcript in tissue culture. These data suggest that the 2.0-kb LAT putative ORF1 and ORF2 (or the first 1,186 bp of the 2.0-kb LAT) are dispensable for explant reactivation of latent HSV-1. Images PMID:7966597

Large-scale whole-genome sequencing of the Icelandic population.

PubMed

Gudbjartsson, Daniel F; Helgason, Hannes; Gudjonsson, Sigurjon A; Zink, Florian; Oddson, Asmundur; Gylfason, Arnaldur; Besenbacher, Soren; Magnusson, Gisli; Halldorsson, Bjarni V; Hjartarson, Eirikur; Sigurdsson, Gunnar Th; Stacey, Simon N; Frigge, Michael L; Holm, Hilma; Saemundsdottir, Jona; Helgadottir, Hafdis Th; Johannsdottir, Hrefna; Sigfusson, Gunnlaugur; Thorgeirsson, Gudmundur; Sverrisson, Jon Th; Gretarsdottir, Solveig; Walters, G Bragi; Rafnar, Thorunn; Thjodleifsson, Bjarni; Bjornsson, Einar S; Olafsson, Sigurdur; Thorarinsdottir, Hildur; Steingrimsdottir, Thora; Gudmundsdottir, Thora S; Theodors, Asgeir; Jonasson, Jon G; Sigurdsson, Asgeir; Bjornsdottir, Gyda; Jonsson, Jon J; Thorarensen, Olafur; Ludvigsson, Petur; Gudbjartsson, Hakon; Eyjolfsson, Gudmundur I; Sigurdardottir, Olof; Olafsson, Isleifur; Arnar, David O; Magnusson, Olafur Th; Kong, Augustine; Masson, Gisli; Thorsteinsdottir, Unnur; Helgason, Agnar; Sulem, Patrick; Stefansson, Kari

2015-05-01

Here we describe the insights gained from sequencing the whole genomes of 2,636 Icelanders to a median depth of 20×. We found 20 million SNPs and 1.5 million insertions-deletions (indels). We describe the density and frequency spectra of sequence variants in relation to their functional annotation, gene position, pathway and conservation score. We demonstrate an excess of homozygosity and rare protein-coding variants in Iceland. We imputed these variants into 104,220 individuals down to a minor allele frequency of 0.1% and found a recessive frameshift mutation in MYL4 that causes early-onset atrial fibrillation, several mutations in ABCB4 that increase risk of liver diseases and an intronic variant in GNAS associating with increased thyroid-stimulating hormone levels when maternally inherited. These data provide a study design that can be used to determine how variation in the sequence of the human genome gives rise to human diversity.

Lineage-specific expansions of retroviral insertions within the genomes of African great apes but not humans and orangutans.

PubMed

Yohn, Chris T; Jiang, Zhaoshi; McGrath, Sean D; Hayden, Karen E; Khaitovich, Philipp; Johnson, Matthew E; Eichler, Marla Y; McPherson, John D; Zhao, Shaying; Pääbo, Svante; Eichler, Evan E

2005-04-01

Retroviral infections of the germline have the potential to episodically alter gene function and genome structure during the course of evolution. Horizontal transmissions between species have been proposed, but little evidence exists for such events in the human/great ape lineage of evolution. Based on analysis of finished BAC chimpanzee genome sequence, we characterize a retroviral element (Pan troglodytes endogenous retrovirus 1 [PTERV1]) that has become integrated in the germline of African great ape and Old World monkey species but is absent from humans and Asian ape genomes. We unambiguously map 287 retroviral integration sites and determine that approximately 95.8% of the insertions occur at non-orthologous regions between closely related species. Phylogenetic analysis of the endogenous retrovirus reveals that the gorilla and chimpanzee elements share a monophyletic origin with a subset of the Old World monkey retroviral elements, but that the average sequence divergence exceeds neutral expectation for a strictly nuclear inherited DNA molecule. Within the chimpanzee, there is a significant integration bias against genes, with only 14 of these insertions mapping within intronic regions. Six out of ten of these genes, for which there are expression data, show significant differences in transcript expression between human and chimpanzee. Our data are consistent with a retroviral infection that bombarded the genomes of chimpanzees and gorillas independently and concurrently, 3-4 million years ago. We speculate on the potential impact of such recent events on the evolution of humans and great apes.

Response to crizotinib in a non-small-cell lung cancer patient harboring an EML4-ALK fusion with an atypical LTBP1 insertion.

PubMed

Aguado, Cristina; Gil, Maria-de-Los-Llanos; Yeste, Zaira; Giménez-Capitán, Ana; Teixidó, Cristina; Karachaliou, Niki; Viteri, Santiago; Rosell, Rafael; Molina-Vila, Miguel A

2018-01-01

Fusion of the anaplastic lymphoma receptor tyrosine kinase gene ( ALK ) with the echinoderm microtubule-associated protein 4 gene ( EML4 ) is the second most common actionable alteration in non-small-cell lung cancer, with a frequency of 5%. Here, we present a case of an EML4-ALK-positive patient with an atypical in-frame insertion from the LTBP1 gene in the canonical junction of variant 1 . The patient was a 39-year-old never-smoker female diagnosed with Stage IV lung adenocarcinoma. A core biopsy was negative for EGFR and KRAS mutations but positive for ALK immunohistochemistry and fluorescence in situ hybridization. When submitted to nCounter, the sample showed a 3'/5' imbalance indicative of an ALK rearrangement, but failed to give a positive signal for any of the variants tested. Finally, a band with a molecular weight higher than expected appeared after reverse transcriptase-polymerase chain reaction analysis. When Sanger sequencing was performed, the band revealed an atypical EML4-ALK fusion gene with an in-frame 129 bp insertion. A 115 bp segment of the insertion corresponded to an intronic region of LTBP1 , a gene located in the short arm of chromosome 2, between ALK and EML4 . The patient received crizotinib and showed a good therapeutic response that is still ongoing after 12 months. Our result suggests that short in-frame insertions of other genes in the EML4-ALK junction do not affect the sensitivity of the EML4-ALK fusion protein to crizotinib.

Increasing genomic diversity and evidence of constrained lifestyle evolution due to insertion sequences in Aeromonas salmonicida.

PubMed

Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J

2016-01-12

Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.

Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

PubMed

Ponce, M R; Quesada, V; Micol, J L

1998-05-01

An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

Salt Stress-Induced Loss of Iron Oxidoreduction Activities and Reacquisition of That Phenotype Depend on rus Operon Transcription in Acidithiobacillus ferridurans.

PubMed

Bonnefoy, Violaine; Grail, Barry M; Johnson, D Barrie

2018-04-01

The type strain of the mineral-oxidizing acidophilic bacterium Acidithiobacillus ferridurans was grown in liquid medium containing elevated concentrations of sodium chloride with hydrogen as electron donor. While it became more tolerant to chloride, after about 1 year, the salt-stressed acidophile was found to have lost its ability to oxidize iron, though not sulfur or hydrogen. Detailed molecular examination revealed that this was due to an insertion sequence, IS Afd1 , which belongs to the IS Pepr1 subgroup of the IS 4 family, having been inserted downstream of the two promoters PI and PII of the rus operon (which codes for the iron oxidation pathway in this acidophile), thereby preventing its transcription. The ability to oxidize iron was regained on protracted incubation of the culture inoculated onto salt-free solid medium containing ferrous iron and incubated under hydrogen. Two revertant strains were obtained. In one, the insertion sequence IS Afd1 had been excised, leaving an 11-bp signature, while in the other an ∼2,500-bp insertion sequence (belonging to the IS 66 family) was detected in the downstream inverted repeat of IS Afd1 The transcriptional start site of the rus operon in the second revertant strain was downstream of the two ISs, due to the creation of a new "hybrid" promoter. The loss and subsequent regaining of the ability of A. ferridurans T to reduce ferric iron were concurrent with those observed for ferrous iron oxidation, suggesting that these two traits are closely linked in this acidophile. IMPORTANCE Iron-oxidizing acidophilic bacteria have primary roles in the oxidative dissolution of sulfide minerals, a process that underpins commercial mineral-processing biotechnologies ("biomining"). Most of these prokaryotes have relatively low tolerance to chloride, which limits their activities when only saline or brackish waters are available. The study showed that it was possible to adapt a typical iron-oxidizing acidophile to grow in the presence of salt concentrations similar to those in seawater, but in so doing they lost their ability to oxidize iron, though not sulfur or hydrogen. The bacterium regained its capacity for oxidizing iron when the salt stress was removed but simultaneously reverted to tolerating lower concentrations of salt. These results suggest that the bacteria that have the main roles in biomining operations could survive but become ineffective in cases where saline or brackish waters are used for irrigation. Copyright © 2018 American Society for Microbiology.

The mitochondrial intermembrane loop region of rat carnitine palmitoyltransferase 1A is a major determinant of its malonyl-CoA sensitivity.

PubMed

Borthwick, Karen; Jackson, Vicky N; Price, Nigel T; Zammit, Victor A

2006-11-03

Carnitine palmitoyltransferase (CPT) 1A adopts a polytopic conformation within the mitochondrial outer membrane, having both the N- and C-terminal segments on the cytosolic aspect of the membrane and a loop region connecting the two transmembrane (TM) segments protruding into the inter membrane space. In this study we demonstrate that the loop exerts major effects on the sensitivity of the enzyme to its inhibitor, malonyl-CoA. Insertion of a 16-residue spacer between the C-terminal part of the loop sequence (i.e. between residues 100 and 101) and TM2 (which is predicted to start at residue 102) increased the sensitivity to malonyl-CoA inhibition of the resultant mutant protein by more than 10-fold. By contrast, the same insertion made between TM1 and the loop had no effects on the kinetic properties of the enzyme, indicating that effects on the catalytic C-terminal segment were specifically induced by loop-TM2 interactions. Enhanced sensitivity was also observed in all mutants in which the native TM2-loop pairing was disrupted either by making chimeras in which the loops and TM2 segments of CPT 1A and CPT 1B were exchanged or by deleting successive 9-residue segments from the loop sequence. The data suggest that the sequence spanning the loop-TM2 boundary determines the disposition of this TM in the membrane so as to alter the conformation of the C-terminal segment and thus affect its interaction with malonyl-CoA.

Continuous Influx of Genetic Material from Host to Virus Populations

PubMed Central

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane

2016-01-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124

Continuous Influx of Genetic Material from Host to Virus Populations.

PubMed

Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A

2016-02-01

Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

Hepatitis C virus genotypes in Singapore and Indonesia.

PubMed

Ng, W C; Guan, R; Tan, M F; Seet, B L; Lim, C A; Ngiam, C M; Sjaifoellah Noer, H M; Lesmana, L

1995-01-01

5' untranslated and partial core (C) region sequence of hepatitis C virus (HCV) in 21 Singaporean and 15 Indonesian isolates were amplified by reverse-transcription polymerase chain reaction and sequenced with the use of conserved primer sequences deduced from HCV genomes identified in other geographical regions. The HCV genotypes are predominantly that of Simmonds type 1 and less of type 2 and 3 with the latter genotype currently not detected in Indonesia. The 5' untranslated sequences are related to HCV-1. DK-7 (Denmark), US-11 (United States of America), HCV-J4, SA-10 (South Africa), T-3 (Taiwan), HCV-J6, HCV-J8, Eb-1 and Eb-8. When compared with the prototype HCV-1, insertions are found within the 5' untranslated region of Singaporean isolates and not in the Indonesians. There are Singaporean and Indonesian isolates that have sequences within the 5' untranslated region that differ slightly from each other. Microheterogeneity is observed in the core region of two Singaporeans and one Indonesian isolate. Finally, not all HCV isolates can be amplified with the conserved core sequence primers when compared with the ease with which these isolates can be amplified with 5' untranslated region conserved primers.

Mobile elements reveal small population size in the ancient ancestors of Homo sapiens.

PubMed

Huff, Chad D; Xing, Jinchuan; Rogers, Alan R; Witherspoon, David; Jorde, Lynn B

2010-02-02

The genealogies of different genetic loci vary in depth. The deeper the genealogy, the greater the chance that it will include a rare event, such as the insertion of a mobile element. Therefore, the genealogy of a region that contains a mobile element is on average older than that of the rest of the genome. In a simple demographic model, the expected time to most recent common ancestor (TMRCA) is doubled if a rare insertion is present. We test this expectation by examining single nucleotide polymorphisms around polymorphic Alu insertions from two completely sequenced human genomes. The estimated TMRCA for regions containing a polymorphic insertion is two times larger than the genomic average (P < <10(-30)), as predicted. Because genealogies that contain polymorphic mobile elements are old, they are shaped largely by the forces of ancient population history and are insensitive to recent demographic events, such as bottlenecks and expansions. Remarkably, the information in just two human DNA sequences provides substantial information about ancient human population size. By comparing the likelihood of various demographic models, we estimate that the effective population size of human ancestors living before 1.2 million years ago was 18,500, and we can reject all models where the ancient effective population size was larger than 26,000. This result implies an unusually small population for a species spread across the entire Old World, particularly in light of the effective population sizes of chimpanzees (21,000) and gorillas (25,000), which each inhabit only one part of a single continent.

Dictyostelium mobile elements: strategies to amplify in a compact genome.

PubMed

Winckler, T; Dingermann, T; Glöckner, G

2002-12-01

Dictyostelium discoideum is a eukaryotic microorganism that is attractive for the study of fundamental biological phenomena such as cell-cell communication, formation of multicellularity, cell differentiation and morphogenesis. Large-scale sequencing of the D. discoideum genome has provided new insights into evolutionary strategies evolved by transposable elements (TEs) to settle in compact microbial genomes and to maintain active populations over evolutionary time. The high gene density (about 1 gene/2.6 kb) of the D. discoideum genome leaves limited space for selfish molecular invaders to move and amplify without causing deleterious mutations that eradicate their host. Targeting of transfer RNA (tRNA) gene loci appears to be a generally successful strategy for TEs residing in compact genomes to insert away from coding regions. In D. discoideum, tRNA gene-targeted retrotransposition has evolved independently at least three times by both non-long terminal repeat (LTR) retrotransposons and retrovirus-like LTR retrotransposons. Unlike the nonspecifically inserting D. discoideum TEs, which have a strong tendency to insert into preexisting TE copies and form large and complex clusters near the ends of chromosomes, the tRNA gene-targeted retrotransposons have managed to occupy 75% of the tRNA gene loci spread on chromosome 2 and represent 80% of the TEs recognized on the assembled central 6.5-Mb part of chromosome 2. In this review we update the available information about D. discoideum TEs which emerges both from previous work and current large-scale genome sequencing, with special emphasis on the fact that tRNA genes are principal determinants of retrotransposon insertions into the D. discoideum genome.

Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

PubMed Central

Youderian, Philip; Hartzell, Patricia L.

2006-01-01

Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

PubMed

Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

2017-12-01

Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

Insertion Sequences

PubMed Central

Mahillon, Jacques; Chandler, Michael

1998-01-01

Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

PubMed Central

Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

2013-01-01

Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

Mrp--a new auxiliary gene essential for optimal expression of methicillin resistance in Staphylococcus aureus.

PubMed

Wu, S W; De Lencastre, H

1999-01-01

Screening of a library of Tn551 insertional mutants selected for reduction in the methicillin resistance level of the parental Staphylococcus aureus strain COL resulted in the isolation of mutant RUSA266 in which the minimal inhibitory concentration (MIC) of the parent was reduced from 1,600 to 1.5 micrograms/mL. Cloning and sequencing of the vicinity of the insertion site omega 726 identified an open reading frame (orf1365) encoding a very large polypeptide of more than 1,365 amino acids. A unique feature of the deduced amino acid sequence was the presence of multiple tandem repeats of 75 amino acids in the polypeptide, reminiscent of the structure of high-molecular-weight cell-surface proteins EF* and Emb identified in some streptococcal strains. Mutant RUSA266 with the inactivated gene, which we shall provisionally refer to as mrp (for multiple repeat polypeptide), produced a peptidoglycan with altered muropeptide composition, and both the reduced antibiotic resistance and the altered cell wall composition were co-transduced in back-crosses into the parental strain COL. Additional sequencing upstream of mrp has revealed that this gene was part of a five-gene cluster occupying a 9.2-kb region of the staphylococcal chromosome and was composed of glmM (directly upstream of mrp), two open reading frames orf310 and orf269 coding for two hypothetical proteins, and the gene encoding the staphylococcal arginase (arg). Transcriptional analysis demonstrated that the five genes in the cluster were transcribed together.

An indicator gene to demonstrate intracellular transposition of defective retroviruses.

PubMed Central

Heidmann, T; Heidmann, O; Nicolas, J F

1988-01-01

An indicator gene for detection and quantitation of RNA-mediated transposition was constructed (neoRT). It was inserted into a Moloney murine leukemia provirus (Mo-MLV) deleted for the envelope gene to test for intracellular transposition of defective retroviruses [Mo-MLV(neo)RT]. NeoRT contains the selectable neo gene (which confers resistance to the drug G418), inactivated by a polyadenylylation sequence inserted between the neo promotor and coding sequence. The polyadenylylation sequence is flanked (on the antisense strand of the DNA) by a donor and an acceptor splice site so as to be removed upon passage of the provirus through an RNA intermediate. 3T3 cells transfected with the defective Mo-MLV(neo)RT provirus are sensitive to G418. After trans-complementation with Mo-MLV, viral transcripts confer resistance to G418 upon infection of test cells. In the resistant cells, the polyadenylylation sequence has been removed, as a result in most cases of precise splicing of the intronic domain. Retrotransposition of the defective Mo-MLV(neo)RT provirus was demonstrated by submitting transfected G418-sensitive clones to selection. Between 1 and 10 G418-resistant clones were obtained per 10(7) cells. Several possess additional copies, with evidence for precise removal of the intronic domain. By using target test cells in coculture experiments, extracellular intermediates of retrotransposition could not be detected. Images PMID:2832848

Molecular dynamics simulations of certain RGD-based peptides from Kistrin provide insight into the higher activity of REI-RGD34 protein at higher temperature.

PubMed

Upadhyay, Sanjay K

2014-05-01

To determine the bioactive conformation required to bind with receptor aIIbb3, the peptide sequence RIPRGDMP from Kistrin was inserted into CDR 1 loop region of REI protein, resulting in REI-RGD34. The activity of REI-RGD34 was observed to increase at higher temperature towards the receptor aIIbb3. It could be justified in either way: the modified complex forces the restricted peptide to adapt bioactive conformation or it unfolds the peptide in a way that opens its binding surface with high affinity for receptor. Here, we model the conformational preference of RGD sequence in RIPRGDMP at 25 and 42 °C using multiple MD simulations. Further, we model the peptide sequence RGD, PRGD and PRGDMP from kistrin to observe the effect of flanking residues on conformational sampling of RGD. The presence of flanking residues around RGD peptide greatly influenced the conformational sampling. A transition from bend to turn conformation was observed for RGD sequence at 42 °C. The turn conformation shows pharmacophoric parameters required to recognize the receptor aIIbb3. Thus, the temperaturedependent activity of RIPRGDMP when inserted into the loop region of REI can be explained by the presence of the turn conformation. This study will help in designing potential antagonist for the receptor aIIbb3.

Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants.

PubMed

Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F

2015-07-08

Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.

Investigating Delamination Migration in Composite Tape Laminates

NASA Technical Reports Server (NTRS)

Ratcliffe, James G.; DeCarvalho, Nelson V.

2014-01-01

A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.

A VNTR element associated with steroid sulfatase gene deletions stimulates recombination in cultured cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gong, Y.; Li, X.M.; Shapiro, L.J.

1994-09-01

Steroid sulfatase deficiency is a common genetic disorder, with a prevalence of approximately one in every 3500 males world wide. About 90% of these patients have complete gene deletions, which appear to result from recombination between members of a low-copy repeat family (CRI-232 is the prototype) that flank the gene. RU1 and RU2 are two VNTR elements found within each of these family members. RU1 consists of 30 bp repeating units and its length shows minimal variation among individuals. The RU2 element consists of repeating sequences which are highly asymmetric, with about 90% purines and no C`s on one strand,more » and range from 0.6 kb to over 23 kb among different individuals. We conducted a study to determine if the RU1 or RU2 elements can promote recombination in an in vivo test system. We inserted these elements adjacent to the neo gene in each of two pSV2neo derivatives, one of which has a deletion in the 5{prime} portion of the neo gene and the other having a deletion in the 3{prime} portion. These plasmids were combined and used to transfect EJ cells. Survival of cells in G418 indicates restoration of a functional neo gene by recombination between two deletion constructs. Thus counting G418 resistant colonies gives a quantitative measure of the enhancement of recombination by the inserted VNTR elements. The results showed no effect on recombination by the inserted RU1 element (compared to the insertion of a nonspecific sequence), while the RU2 element stimulated recombination by 3.5-fold (P<0.01). A separate set of constructs placed RU1 or RU2 within the intron of an exon trapping vector. Following tranfection of cells, recombination events were monitored by a PCR assay that detected the approximation of primer binding sites (as a result of recombination). These studies showed that, as in the first set of experiments, the highly variable RU2 element is capable of stimulating somatic recombination in mammalian cells.« less

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

PubMed

Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

2017-10-03

A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

PubMed Central

2013-01-01

Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

A RAB3GAP1 SINE Insertion in Alaskan Huskies with Polyneuropathy, Ocular Abnormalities, and Neuronal Vacuolation (POANV) Resembling Human Warburg Micro Syndrome 1 (WARBM1)

PubMed Central

Wiedmer, Michaela; Oevermann, Anna; Borer-Germann, Stephanie E.; Gorgas, Daniela; Shelton, G. Diane; Drögemüller, Michaela; Jagannathan, Vidhya; Henke, Diana; Leeb, Tosso

2015-01-01

We observed a hereditary phenotype in Alaskan Huskies that was characterized by polyneuropathy with ocular abnormalities and neuronal vacuolation (POANV). The affected dogs developed a progressive severe ataxia, which led to euthanasia between 8 and 16 months of age. The pedigrees were consistent with a monogenic autosomal recessive inheritance. We localized the causative genetic defect to a 4 Mb interval on chromosome 19 by a combined linkage and homozygosity mapping approach. Whole genome sequencing of one affected dog, an obligate carrier, and an unrelated control revealed a 218-bp SINE insertion into exon 7 of the RAB3GAP1 gene. The SINE insertion was perfectly associated with the disease phenotype in a cohort of 43 Alaskan Huskies, and it was absent from 541 control dogs of diverse other breeds. The SINE insertion induced aberrant splicing and led to a transcript with a greatly altered exon 7. RAB3GAP1 loss-of-function variants in humans cause Warburg Micro Syndrome 1 (WARBM1), which is characterized by additional developmental defects compared to canine POANV, whereas Rab3gap1-deficient mice have a much milder phenotype than either humans or dogs. Thus, the RAB3GAP1 mutant Alaskan Huskies provide an interesting intermediate phenotype that may help to better understand the function of RAB3GAP1 in development. Furthermore, the identification of the presumed causative genetic variant will enable genetic testing to avoid the nonintentional breeding of affected dogs. PMID:26596647

Structural diversity of domain superfamilies in the CATH database.

PubMed

Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A

2006-07-14

The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).

Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan

Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

PubMed Central

Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

2015-01-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

PubMed

Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

2014-11-01

While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

Tn5401, a new class II transposable element from Bacillus thuringiensis.

PubMed Central

Baum, J A

1994-01-01

A new class II (Tn3-like) transposable element, designated Tn5401, was recovered from a sporulation-deficient variant of Bacillus thuringiensis subsp. morrisoni EG2158 following its insertion into a recombinant plasmid. Sequence analysis of the insert revealed a 4,837-bp transposon with two large open reading frames, in the same orientation, encoding proteins of 36 kDa (306 residues) and 116 kDa (1,005 residues) and 53-bp terminal inverted repeats. The deduced amino acid sequence for the 36-kDa protein shows 24% sequence identity with the TnpI recombinase of the B. thuringiensis transposon Tn4430, a member of the phage integrase family of site-specific recombinases. The deduced amino acid sequence for the 116-kDa protein shows 42% sequence identity with the transposase of Tn3 but only 28% identity with the TnpA transposase of Tn4430. Two small open reading frames of unknown function, designated orf1 (85 residues) and orf2 (74 residues), were also identified. Southern blot analysis indicated that Tn5401, in contrast to Tn4430, is not commonly found among different subspecies of B. thuringiensis and is not typically associated with known insecticidal crystal protein genes. Transposition was studied with B. thuringiensis by using plasmid pEG922, a temperature-sensitive shuttle vector containing Tn5401. Tn5401 transposed to both chromosomal and plasmid target sites but displayed an apparent preference for plasmid sites. Transposition was replicative and resulted in the generation of a 5-bp duplication at the target site. Transcriptional start sites within Tn5401 were mapped by primer extension analysis. Two promoters, designated PL and PR, direct the transcription of orf1-orf2 and tnpI-tnpA, respectively, and are negatively regulated by TnpI. Sequence comparison of the promoter regions of Tn5401 and Tn4430 suggests that the conserved sequence element ATGTCCRCTAAY mediates TnpI binding and cointegrate resolution. The same element is contained within the 53-bp terminal inverted repeats, thus accounting for their unusual lengths and suggesting an additional role for TnpI in regulating Tn5401 transposition. Images PMID:7514590

The cDNA sequence of mouse Pgp-1 and homology to human CD44 cell surface antigen and proteoglycan core/link proteins.

PubMed

Wolffe, E J; Gause, W C; Pelfrey, C M; Holland, S M; Steinberg, A D; August, J T

1990-01-05

We describe the isolation and sequencing of a cDNA encoding mouse Pgp-1. An oligonucleotide probe corresponding to the NH2-terminal sequence of the purified protein was synthesized by the polymerase chain reaction and used to screen a mouse macrophage lambda gt11 library. A cDNA clone with an insert of 1.2 kilobases was selected and sequenced. In Northern blot analysis, only cells expressing Pgp-1 contained mRNA species that hybridized with this Pgp-1 cDNA. The nucleotide sequence of the cDNA has a single open reading frame that yields a protein-coding sequence of 1076 base pairs followed by a 132-base pair 3'-untranslated sequence that includes a putative polyadenylation signal but no poly(A) tail. The translated sequence comprises a 13-amino acid signal peptide followed by a polypeptide core of 345 residues corresponding to an Mr of 37,800. Portions of the deduced amino acid sequence were identical to those obtained by amino acid sequence analysis from the purified glycoprotein, confirming that the cDNA encodes Pgp-1. The predicted structure of Pgp-1 includes an NH2-terminal extracellular domain (residues 14-265), a transmembrane domain (residues 266-286), and a cytoplasmic tail (residues 287-358). Portions of the mouse Pgp-1 sequence are highly similar to that of the human CD44 cell surface glycoprotein implicated in cell adhesion. The protein also shows sequence similarity to the proteoglycan tandem repeat sequences found in cartilage link protein and cartilage proteoglycan core protein which are thought to be involved in binding to hyaluronic acid.

Rubisco activase is required for optimal photosynthesis in the green alga Chlamydomonas reinhardtii in a low-CO(2) atmosphere.

PubMed

Pollock, Steve V; Colombo, Sergio L; Prout, Davey L; Godfrey, Ashley C; Moroney, James V

2003-12-01

This report describes a Chlamydomonas reinhardtii mutant that lacks Rubisco activase (Rca). Using the BleR (bleomycin resistance) gene as a positive selectable marker for nuclear transformation, an insertional mutagenesis screen was performed to select for cells that required a high-CO2 atmosphere for optimal growth. The DNA flanking the BleR insert of one of the high-CO2-requiring strains was cloned using thermal asymmetric interlaced-polymerase chain reaction and inverse polymerase chain reaction and sequenced. The flanking sequence matched the C. reinhardtii Rca cDNA sequence previously deposited in the National Center for Biotechnology Information database. The loss of a functional Rca in the strain was confirmed by the absence of Rca mRNA and protein. The open reading frame for Rca was cloned and expressed in pSL18, a C. reinhardtii expression vector conferring paromomycin resistance. This construct partially complemented the mutant phenotype, supporting the hypothesis that the loss of Rca was the reason the mutant grew poorly in a low-CO2 atmosphere. Sequencing of the C. reinhardtii Rca gene revealed that it contains 10 exons ranging in size from 18 to 470 bp. Low-CO2-grown rca1 cultures had a growth rate and maximum rate of photosynthesis 60% of wild-type cells. Results obtained from experiments on a cia5 rca1 double mutant also suggest that the CO2-concentrating mechanism partially compensates for the absence of an active Rca in the green alga C. reinhardtii.

[Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

PubMed

Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

2016-07-25

RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

Imperfect duplicate insertions type of mutations in plasmepsin V modulates binding properties of PEXEL motifs of export proteins in Indian Plasmodium vivax.

PubMed

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200-300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246-249 AA and SLSE from 266-269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing.

Imperfect Duplicate Insertions Type of Mutations in Plasmepsin V Modulates Binding Properties of PEXEL Motifs of Export Proteins in Indian Plasmodium vivax

PubMed Central

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Introduction Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200–300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. Method We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Results Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246–249 AA and SLSE from 266–269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Conclusion/Significance Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing. PMID:23555891

A complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus): an evolutionary history of camelidae

PubMed Central

Cui, Peng; Ji, Rimutu; Ding, Feng; Qi, Dan; Gao, Hongwei; Meng, He; Yu, Jun; Hu, Songnian; Zhang, Heping

2007-01-01

Background The family Camelidae that evolved in North America during the Eocene survived with two distinct tribes, Camelini and Lamini. To investigate the evolutionary relationship between them and to further understand the evolutionary history of this family, we determined the complete mitochondrial genome sequence of the wild two-humped camel (Camelus bactrianus ferus), the only wild survivor of the Old World camel. Results The mitochondrial genome sequence (16,680 bp) from C. bactrianus ferus contains 13 protein-coding, two rRNA, and 22 tRNA genes as well as a typical control region; this basic structure is shared by all metazoan mitochondrial genomes. Its protein-coding region exhibits codon usage common to all mammals and possesses the three cryptic stop codons shared by all vertebrates. C. bactrianus ferus together with the rest of mammalian species do not share a triplet nucleotide insertion (GCC) that encodes a proline residue found only in the nd1 gene of the New World camelid Lama pacos. This lineage-specific insertion in the L. pacos mtDNA occurred after the split between the Old and New World camelids suggests that it may have functional implication since a proline insertion in a protein backbone usually alters protein conformation significantly, and nd1 gene has not been seen as polymorphic as the rest of ND family genes among camelids. Our phylogenetic study based on complete mitochondrial genomes excluding the control region suggested that the divergence of the two tribes may occur in the early Miocene; it is much earlier than what was deduced from the fossil record (11 million years). An evolutionary history reconstructed for the family Camelidae based on cytb sequences suggested that the split of bactrian camel and dromedary may have occurred in North America before the tribe Camelini migrated from North America to Asia. Conclusion Molecular clock analysis of complete mitochondrial genomes from C. bactrianus ferus and L. pacos suggested that the two tribes diverged from their common ancestor about 25 million years ago, much earlier than what was predicted based on fossil records. PMID:17640355

A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

PubMed

Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

2014-12-01

Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

Targeting the atypical chemokine receptor ACKR3/CXCR7 for the treatment of cancer and other diseases

NASA Astrophysics Data System (ADS)

Vestal, Richard D., Jr.

One of the greatest challenges in fighting cancer is cell targeting and biomarker selection. The Atypical Chemokine Receptor ACKR3/CXCR7 is expressed on many cancer cell types, including breast cancer and glioblastoma, and binds the endogenous ligands SDF1/CXCL12 and ITAC/CXCL11. A 20 amino acid region of the ACKR3/CXCR7 N-terminus was synthesized and targeted with the NEB PhD-7 Phage Display Peptide Library. Twenty-nine phages were isolated and heptapeptide inserts sequenced; of these, 23 sequences were unique. A 3D molecular model was created for the ACKR3/CXCR7 N-terminus by mutating the corresponding region of the crystal structure of CXCR4 with bound SDF1/CXCL12. A ClustalW alignment was performed on each peptide sequence using the entire SDF1/CXCL12 sequence as the template. The 23-peptide sequences showed similarity to three distinct regions of the SDF1/CXCL12 molecule. A 3D molecular model was made for each of the phage peptide inserts to visually identify potential areas of steric interference of peptides that simulated CXCL12 regions not in contact with the receptor's N-terminus. An ELISA analysis of the relative binding affinity between the peptides identified 9 peptides with statistically significant results. The candidate pool of 9 peptides was further reduced to 3 peptides based on their affinity for the targeted N-terminus region peptide versus no target peptide present or a scrambled negative control peptide. The results clearly show the Phage Display protocol can be used to target a synthesized region of the ACKR3/CXCR7 N-terminus. The 3 peptides chosen, P20, P3, and P9, showed no effect on the viability or proliferation upon exposure to MCF-7 and U87-MG cells. Membrane binding, colocalization, and cellular uptake were confirmed by whole-cell ELISA and confocal microscopy. The recovered peptides did not activate the receptor as confirmed by a Beta-Arrestin recruitment assay. The data shows that the peptide sequences recovered from the phage display protocol are viable candidates for targeting cancer cells and delivering material to them.

Technology Insertion-Engineering Services Process Characterization. Task Order No. 1. Book 1 of 3. Database Documentation Book. OO-ALC MANPGP (Overview Layouts)

DTIC Science & Technology

1989-12-15

Missile Systems Company 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER McDonnell Douglas Missile Systems...SEQUENCE NO. B008 MCDONNELL DOUGLAS McDonnefl Douglas Missile Systems Company St. Louis, Missouri 63166-0516 (314) 232-0232 91-02815 Distribution nt pm rt...Systems Company 7.1- 1 2. TASK ORDER NO. 1 PROCESS CHARACTERIZATION The brake assembly subunit is responsible for the assembly of brakes. Brakes enter

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon.

PubMed

Lorenzen, Marcé D; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W

2008-07-22

Maternal-Effect Dominant Embryonic Arrest ("Medea") factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea(1) activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea(1) reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations.

The maternal-effect, selfish genetic element Medea is associated with a composite Tc1 transposon

PubMed Central

Lorenzen, Marcé D.; Gnirke, Andreas; Margolis, Jonathan; Garnes, Jeffrey; Campbell, Margie; Stuart, Jeffrey J.; Aggarwal, Rajat; Richards, Stephen; Park, Yoonseong; Beeman, Richard W.

2008-01-01

Maternal-Effect Dominant Embryonic Arrest (“Medea”) factors are selfish nuclear elements that combine maternal-lethal and zygotic-rescue activities to gain a postzygotic survival advantage. We show that Medea1 activity in Tribolium castaneum is associated with a composite Tc1 transposon inserted just downstream of the neurotransmitter reuptake symporter bloated tubules (blot), whose Drosophila ortholog has both maternal and zygotic functions. The 21.5-kb insertion contains defective copies of elongation initiation factor-3, ATP synthase subunit C, and an RNaseD-related gene, as well as a potentially intact copy of a prokaryotic DUF1703 gene. Sequence comparisons suggest that the current distribution of Medea1 reflects global emanation after a single transpositional event in recent evolutionary time. The Medea system in Tribolium represents an unusual type of intragenomic conflict and could provide a useful vehicle for driving desirable genes into populations. PMID:18621706

Altered Viral Replication and Cell Responses by Inserting MicroRNA Recognition Element into PB1 in Pandemic Influenza A Virus (H1N1) 2009

PubMed Central

Shen, Xiaoyue; Sun, Wenkui; Shi, Yi; Xing, Zheng; Su, Xin

2015-01-01

Objective. MicroRNAs (miRNAs) are endogenous noncoding RNAs that spatiotemporally modulate mRNAs in a posttranscriptional manner. Engineering mutant viruses by inserting cell-specific miRNA recognition element (MRE) into viral genome may alter viral infectivity and host responses in vital tissues and organs infected with pandemic influenza A virus (H1N1) 2009 (H1N1pdm). Methods. In this study, we employed reverse genetics approach to generate a recombinant H1N1pdm with a cell-specific miRNA target sequence inserted into its PB1 genomic segment to investigate whether miRNAs are able to suppress H1N1pdm replication. We inserted an MRE of microRNA-let-7b (miR-let-7b) into the open reading frame of PB1 to test the feasibility of creating a cell-restricted H1N1pdm virus since let-7b is abundant in human bronchial epithelial cells. Results. miR-let-7b is rich in human bronchial epithelial cells (HBE). Incorporation of the miR-let-7b-MRE confers upon the recombinant H1N1pdm virus susceptibility to miR-let-7b targeting, suggesting that the H1N1pdm and influenza A viruses can be engineered to exert the desired replication restrictive effect and decrease infectivity in vital tissues and organs. Conclusions. This approach provides an additional layer of biosafety and thus has great potential for the application in the rational development of safer and more effective influenza viral vaccines. PMID:25788763

Evaluating Documents: The Case of Patient Package Inserts. Technical Report No. 2.

ERIC Educational Resources Information Center

Krug, Robert E.

To illustrate the types of factors that must be considered in evaluating public documents, this paper analyzes a number of possible outcomes resulting from one type of document, the patient package insert (PPI) designed to provide consumers of prescription drugs with information about the drugs. It first outlines the intended sequence for a PPI:…

Comparative sequence analysis revealed altered chromosomal organization and a novel insertion sequence encoding DNA modification and potentially stress-related functions in an Escherichia coli O157:H7 foodborne isolate

USDA-ARS?s Scientific Manuscript database

We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...

Unlocking Short Read Sequencing for Metagenomics

DOE PAGES

Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...

2010-07-28

We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.

Retrotransposon Tf1 is targeted to pol II promoters by transcription activators

PubMed Central

Leem, Young-Eun; Ripmaster, Tracy; Kelly, Felice; Ebina, Hirotaka; Heincelman, Marc; Zhang, Ke; Grewal, Shiv I. S.; Hoffman, Charles S.; Levin, Henry L.

2008-01-01

SUMMARY The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of pol II transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly we found Tf1 contained sequences that activated transcription and these substituted for elements of the ade6 promoter disrupted by integration. PMID:18406330

Retrotransposon Tf1 is targeted to Pol II promoters by transcription activators.

PubMed

Leem, Young-Eun; Ripmaster, Tracy L; Kelly, Felice D; Ebina, Hirotaka; Heincelman, Marc E; Zhang, Ke; Grewal, Shiv I S; Hoffman, Charles S; Levin, Henry L

2008-04-11

The LTR-retrotransposon Tf1 preserves the coding capacity of its host Schizosaccharomyces pombe by integrating upstream of open reading frames (ORFs). To determine which features of the target sites were recognized by the transposon, we introduced plasmids containing candidate insertion sites into S. pombe and mapped the positions of integration. We found that Tf1 was targeted specifically to the promoters of Pol II-transcribed genes. A detailed analysis of integration in plasmids that contained either ade6 or fbp1 revealed insertions occurred in the promoters at positions where transcription factors bound. Further experiments revealed that the activator Atf1p and its binding site were required for directing integration to the promoter of fbp1. An interaction between Tf1 integrase and Atf1p was observed, indicating that integration at fbp1 was mediated by the activator bound to its promoter. Surprisingly, we found Tf1 contained sequences that activated transcription, and these substituted for elements of the ade6 promoter disrupted by integration.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

PubMed

Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

PubMed Central

Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

2015-01-01

We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

Gene expression of galectin-9/ecalectin, a potent eosinophil chemoattractant, and/or the insertional isoform in human colorectal carcinoma cell lines and detection of frame-shift mutations for protein sequence truncations in the second functional lectin domain.

PubMed

Lahm, H; Hoeflich, A; Andre, S; Sordat, B; Kaltner, H; Wolf, E; Gabius, H J

2000-09-01

The family of Ca2+-independent galactoside-binding lectins with the beta-strand topology of the jelly-roll, referred to as galectins, is known to mediate and modulate a variety of cellular activities. Their functional versatility explains the current interest in monitoring their expression in cancer research, so far primarily focused on galectin-1 and -3. Tandem-repeat-type galectin-9 and its (most probably) allelic variant ecalectin, a potent eosinophil chemoattractant, are known to be human leukocyte products. We show by RT-PCR with primers specific for both that their mRNA is expressed in 17 of 21 human colorectal cancer lines. As also indicated by restriction analysis, in addition to the expected transcript of 571 bp an otherwise identical isoform coding for a 32-amino acid extension of the link peptide was detected. Positive cell lines differentially expressed either one (7 lines) or both transcripts (10 lines). Sequence analysis of RT-PCR products, performed in four cases, allowed to assign the standard transcript to ecalectin in the case of SW480 cells and detected two point mutations in the insert of the link peptide-coding sequence in WiDr and Colo205. Furthermore, this analysis identified the insertion of a single nucleotide into the coding sequence generating a frame-shift mutation, an event which has so far not been reported for any galectin. This alteration encountered in both transcripts of the WiDr line and the isoform transcript of Colo205 cells will most likely truncate the protein part within the second (C-terminal) carbohydrate recognition domain. Our results thus reveal the presence of mRNA for a galectin-9-isoform or a potent eosinophil chemoattractant (ecalectin) or a truncated version thereof with preserved N-terminal carbohydrate recognition domain in established human colon cancer cell lines.

Three new insertion sequence elements ISLdl2, ISLdl3, and ISLdl4 in Lactobacillus delbrueckii: isolation, molecular characterization, and potential use for strain identification.

PubMed

Ravin, Victor; Alatossava, Tapani

2003-05-01

A group of new insertion sequence (IS) elements, ISLdl2, ISLdl3, and ISLdl4, from Lactobacillus delbrueckii subsp. lactis ATCC 15808 was isolated, characterized, and used for strain identification together with ISLdl1, recently characterized as an L. delbrueckii IS element belonging to the ISL3 family. ISLdl2 was 1367 bp in size and had a 24 bp IR and an 8 bp DR. The single ORF of ISLdl2 encoded a protein of 392 aa similar to transposases of the IS256 family. ISLdl3 had a single ORF encoding a protein of 343 aa similar to transposases of the IS30 family. Finally, ISLdl4 had a single ORF encoding a protein of 406 aa and displayed homology to the transposases of the IS110 family. ISLdl4 was only slight different from ISL4 (Accession No. AY040213). ISLdl1, ISLdl2, and ISLdl4 were present in all of the 10 L. delbrueckii subsp. lactis and subsp. delbrueckii strains tested, as well as in three of the 11 L. delbrueckii subsp. bulgaricus strains tested. ISLdl3 was present only in four closely related strains of L. delbrueckii subsp. lactis. These IS elements were not observed in Lactobacillus rhamnosus, Lactobacillus acidophilus, Lactobacillus helveticus, or Lactobacillus plantarum. A cluster of IS elements, ISLdl1, ISLdl2, ISLdl3, ISLdl4, and ISL6, was observed in L. delbrueckii subsp. lactis strain ATCC 15808. Within this cluster, ISLdl4 was inserted into ISLdl1 between the left IR and the start codon of ORF455, encoding a putative transposase. Most of the integration sites of the IS elements were strain-specific. We have observed that IS elements can migrate from one strain to another as integral parts of bacterial DNA by using phage LL-H as a vehicle. We demonstrate for the first time that inverse PCR and vectorette PCR methods with primers based on sequences of the IS elements could be used for identification of L. delbrueckii strains.

Simultaneous message framing and error detection

NASA Technical Reports Server (NTRS)

Frey, A. H., Jr.

1968-01-01

Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.

Fine-Mapping and Analysis of Cgl1, a Gene Conferring Glossy Trait in Cabbage (Brassica oleracea L. var. capitata)

PubMed Central

Liu, Zezhou; Fang, Zhiyuan; Zhuang, Mu; Zhang, Yangyong; Lv, Honghao; Liu, Yumei; Li, Zhansheng; Sun, Peitian; Tang, Jun; Liu, Dongming; Zhang, Zhenxian; Yang, Limei

2017-01-01

Cuticular waxes covering the outer plant surface impart a whitish appearance. Wax-less cabbage mutant shows glossy in leaf surface and plays important roles in riching cabbage germplasm resources and breeding brilliant green cabbage. This is the first report describing the characterization and fine-mapping of a wax biosynthesis gene using a novel glossy Brassica oleracea mutant. In the present paper, we identified a glossy cabbage mutant (line10Q-961) with a brilliant green phenotype. Genetic analyses indicated that the glossy trait was controlled by a single recessive gene. Preliminary mapping results using an F2 population containing 189 recessive individuals revealed that the Cgl1 gene was located at the end of chromosome C08. Several new markers closely linked to the target gene were designed according to the cabbage reference genome sequence. Another population of 1,172 recessive F2 individuals was used to fine-map the Cgl1 gene to a 188.7-kb interval between the C08SSR61 simple sequence repeat marker and the end of chromosome C08. There were 33 genes located in this region. According to gene annotation and homology analyses, the Bol018504 gene, which is a homolog of CER1 in Arabidopsis thaliana, was the most likely candidate for the Cgl1 gene. Its coding and promoter regions were sequenced, which indicated that the RNA splice site was altered because of a 2,722-bp insertion in the first intron of Bol018504 in the glossy mutant. Based on the FGENESH 2.6 prediction and sequence alignments, the PLN02869 domain, which controls fatty aldehyde decarbonylase activity, was absent from the Bol018504 gene of the 10Q-961 glossy mutant. We inferred that the inserted sequence in Bol018504 may result in the glossy cabbage mutant. This study represents the first step toward the characterization of cuticular wax biosynthesis in B. oleracea, and may contribute to the breeding of new cabbage varieties exhibiting a brilliant green phenotype. PMID:28265282

Mobile element biology – new possibilities with high-throughput sequencing

PubMed Central

Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

2014-01-01

Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

Characterization of ROP18 alleles in human toxoplasmosis.

PubMed

Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

2014-04-01

The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

The Chlamydomonas Dhc1 gene encodes a dynein heavy chain subunit required for assembly of the I1 inner arm complex.

PubMed Central

Myster, S H; Knott, J A; O'Toole, E; Porter, M E

1997-01-01

Multiple members of the dynein heavy chain (Dhc) gene family have been recovered in several organisms, but the relationships between these sequences and the Dhc isoforms that they encode are largely unknown. To identify Dhc loci and determine the specific functions of the individual Dhc isoforms, we have screened a collection of motility mutants generated by insertional mutagenesis in Chlamydomonas. In this report, we characterize one strain, pf9-3, in which the insertion event was accompanied by a deletion of approximately 13 kb of genomic DNA within the transcription unit of the Dhc1 gene. Northern blot analysis confirms that pf9-3 is a null mutation. Biochemical and structural studies of isolated axonemes demonstrate that the pf9-3 mutant fails to assemble the I1 inner arm complex, a two-headed dynein isoform composed of two Dhcs (1 alpha and 1 beta) and three intermediate chains. To determine if the Dhc1 gene product corresponds to one of the Dhcs of the I1 complex, antibodies were generated against a Dhc1-specific peptide sequence. Immunoblot analysis reveals that the Dhc1 gene encodes the 1 alpha Dhc subunit. These studies thus, identify the first inner arm Dhc locus to be described in any organism and further demonstrate that the 1 alpha Dhc subunit plays an essential role in the assembly of the I1 inner arm complex. Images PMID:9247642

Genome-Wide Mutagenesis of Dengue Virus Reveals Plasticity of the NS1 Protein and Enables Generation of Infectious Tagged Reporter Viruses

PubMed Central

Johnson, Stephen M.; Eltahla, Auda A.; Aloi, Maria; Aloia, Amanda L.; McDevitt, Christopher A.; Bull, Rowena A.

2017-01-01

ABSTRACT Dengue virus (DENV) is a major global pathogen that causes significant morbidity and mortality in tropical and subtropical areas worldwide. An improved understanding of the regions within the DENV genome and its encoded proteins that are required for the virus replication cycle will expedite the development of urgently required therapeutics and vaccines. We subjected an infectious DENV genome to unbiased insertional mutagenesis and used next-generation sequencing to identify sites that tolerate 15-nucleotide insertions during the virus replication cycle in hepatic cell culture. This revealed that the regions within capsid, NS1, and the 3′ untranslated region were the most tolerant of insertions. In contrast, prM- and NS2A-encoding regions were largely intolerant of insertions. Notably, the multifunctional NS1 protein readily tolerated insertions in regions within the Wing, connector, and β-ladder domains with minimal effects on viral RNA replication and infectious virus production. Using this information, we generated infectious reporter viruses, including a variant encoding the APEX2 electron microscopy tag in NS1 that uniquely enabled high-resolution imaging of its localization to the surface and interior of viral replication vesicles. In addition, we generated a tagged virus bearing an mScarlet fluorescent protein insertion in NS1 that, despite an impact on fitness, enabled live cell imaging of NS1 localization and traffic in infected cells. Overall, this genome-wide profile of DENV genome flexibility may be further dissected and exploited in reporter virus generation and antiviral strategies. IMPORTANCE Regions of genetic flexibility in viral genomes can be exploited in the generation of reporter virus tools and should arguably be avoided in antiviral drug and vaccine design. Here, we subjected the DENV genome to high-throughput insertional mutagenesis to identify regions of genetic flexibility and enable tagged reporter virus generation. In particular, the viral NS1 protein displayed remarkable tolerance of small insertions. This genetic flexibility enabled generation of several novel NS1-tagged reporter viruses, including an APEX2-tagged virus that we used in high-resolution imaging of NS1 localization in infected cells by electron microscopy. For the first time, this analysis revealed the localization of NS1 within viral replication factories known as “vesicle packets” (VPs), in addition to its acknowledged localization to the luminal surface of these VPs. Together, this genetic profile of DENV may be further refined and exploited in the identification of antiviral targets and the generation of reporter virus tools. PMID:28956770

Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

PubMed Central

Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

1986-01-01

Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

DNA labelling of varieties covered by patent protection: a new solution for managing intellectual property rights in the seed industry.

PubMed

Fister, Karin; Fister, Iztok; Murovec, Jana; Bohanec, Borut

2017-02-01

Plant breeders' rights are undergoing dramatic changes due to changes in patent rights in terms of plant variety rights protection. Although differences in the interpretation of »breeder's exemption«, termed research exemption in the 1991 UPOV, did exist in the past in some countries, allowing breeders to use protected varieties as parents in the creation of new varieties of plants, current developments brought about by patenting conventionally bred varieties with the European Patent Office (such as EP2140023B1) have opened new challenges. Legal restrictions on germplasm availability are therefore imposed on breeders while, at the same time, no practical information on how to distinguish protected from non-protected varieties is given. We propose here a novel approach that would solve this problem by the insertion of short DNA stretches (labels) into protected plant varieties by genetic transformation. This information will then be available to breeders by a simple and standardized procedure. We propose that such a procedure should consist of using a pair of universal primers that will generate a sequence in a PCR reaction, which can be read and translated into ordinary text by a computer application. To demonstrate the feasibility of such approach, we conducted a case study. Using the Agrobacterium tumefaciens transformation protocol, we inserted a stretch of DNA code into Nicotiana benthamiana. We also developed an on-line application that enables coding of any text message into DNA nucleotide code and, on sequencing, decoding it back into text. In the presented case study, a short command line coding the phrase »Hello world« was transformed into a DNA sequence that was inserted in the plant genome. The encoded message was reconstructed from the resulting T1 seedlings with 100 % accuracy. The feasibility and possible other applications of this approach are discussed.

Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

PubMed

Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

2016-01-01

Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Enhanced production of recombinant proteins with Corynebacterium glutamicum by deletion of insertion sequences (IS elements).

PubMed

Choi, Jae Woong; Yim, Sung Sun; Kim, Min Jeong; Jeong, Ki Jun

2015-12-29

In most bacteria, various jumping genetic elements including insertion sequences elements (IS elements) cause a variety of genetic rearrangements resulting in harmful effects such as genome and recombinant plasmid instability. The genetic stability of a plasmid in a host is critical for high-level production of recombinant proteins, and in this regard, the development of an IS element-free strain could be a useful strategy for the enhanced production of recombinant proteins. Corynebacterium glutamicum, which is a workhorse in the industrial-scale production of various biomolecules including recombinant proteins, also has several IS elements, and it is necessary to identify the critical IS elements and to develop IS element deleted strain. From the cultivation of C. glutamicum harboring a plasmid for green fluorescent protein (GFP) gene expression, non-fluorescent clones were isolated by FACS (fluorescent activated cell sorting). All the isolated clones had insertions of IS elements in the GFP coding region, and two major IS elements (ISCg1 and ISCg2 families) were identified. By co-cultivating cells harboring either the isolated IS element-inserted plasmid or intact plasmid, it was clearly confirmed that cells harboring the IS element-inserted plasmids became dominant during the cultivation due to their growth advantage over cells containing intact plasmids, which can cause a significant reduction in recombinant protein production during cultivation. To minimize the harmful effects of IS elements on the expression of heterologous genes in C. glutamicum, two IS element free C. glutamicum strains were developed in which each major IS element was deleted, and enhanced productivity in the engineered C. glutamicum strain was successfully demonstrated with three models: GFP, poly(3-hydroxybutyrate) [P(3HB)] and γ-aminobutyrate (GABA). Our findings clearly indicate that the hopping of IS elements could be detrimental to the production of recombinant proteins in C. glutamicum, emphasizing the importance of developing IS element free host strains.

Molecular Characterization and Comparative Sequence Analysis of Defense-Related Gene, Oryza rufipogon Receptor-Like Protein Kinase 1

PubMed Central

Law, Yee-Song; Gudimella, Ranganath; Song, Beng-Kah; Ratnam, Wickneswari; Harikrishna, Jennifer Ann

2012-01-01

Many of the plant leucine rich repeat receptor-like kinases (LRR-RLKs) have been found to regulate signaling during plant defense processes. In this study, we selected and sequenced an LRR-RLK gene, designated as Oryza rufipogon receptor-like protein kinase 1 (OrufRPK1), located within yield QTL yld1.1 from the wild rice Oryza rufipogon (accession IRGC105491). A 2055 bp coding region and two exons were identified. Southern blotting determined OrufRPK1 to be a single copy gene. Sequence comparison with cultivated rice orthologs (OsI219RPK1, OsI9311RPK1 and OsJNipponRPK1, respectively derived from O. sativa ssp. indica cv. MR219, O. sativa ssp. indica cv. 9311 and O. sativa ssp. japonica cv. Nipponbare) revealed the presence of 12 single nucleotide polymorphisms (SNPs) with five non-synonymous substitutions, and 23 insertion/deletion sites. The biological role of the OrufRPK1 as a defense related LRR-RLK is proposed on the basis of cDNA sequence characterization, domain subfamily classification, structural prediction of extra cellular domains, cluster analysis and comparative gene expression. PMID:22942769

Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

PubMed

Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

2006-11-01

The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB

PubMed Central

Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

2012-01-01

The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441