Sample records for insertion sequences iss

  1. Insertion sequence diversity in archaea.

    PubMed

    Filée, J; Siguier, P; Chandler, M

    2007-03-01

    Insertion sequences (ISs) can constitute an important component of prokaryotic (bacterial and archaeal) genomes. Over 1,500 individual ISs are included at present in the ISfinder database (www-is.biotoul.fr), and these represent only a small portion of those in the available prokaryotic genome sequences and those that are being discovered in ongoing sequencing projects. In spite of this diversity, the transposition mechanisms of only a few of these ubiquitous mobile genetic elements are known, and these are all restricted to those present in bacteria. This review presents an overview of ISs within the archaeal kingdom. We first provide a general historical summary of the known properties and behaviors of archaeal ISs. We then consider how transposition might be regulated in some cases by small antisense RNAs and by termination codon readthrough. This is followed by an extensive analysis of the IS content in the sequenced archaeal genomes present in the public databases as of June 2006, which provides an overview of their distribution among the major archaeal classes and species. We show that the diversity of archaeal ISs is very great and comparable to that of bacteria. We compare archaeal ISs to known bacterial ISs and find that most are clearly members of families first described for bacteria. Several cases of lateral gene transfer between bacteria and archaea are clearly documented, notably for methanogenic archaea. However, several archaeal ISs do not have bacterial equivalents but can be grouped into Archaea-specific groups or families. In addition to ISs, we identify and list nonautonomous IS-derived elements, such as miniature inverted-repeat transposable elements. Finally, we present a possible scenario for the evolutionary history of ISs in the Archaea.

  2. Insertion Sequences

    PubMed Central

    Mahillon, Jacques; Chandler, Michael

    1998-01-01

    Insertion sequences (ISs) constitute an important component of most bacterial genomes. Over 500 individual ISs have been described in the literature to date, and many more are being discovered in the ongoing prokaryotic and eukaryotic genome-sequencing projects. The last 10 years have also seen some striking advances in our understanding of the transposition process itself. Not least of these has been the development of various in vitro transposition systems for both prokaryotic and eukaryotic elements and, for several of these, a detailed understanding of the transposition process at the chemical level. This review presents a general overview of the organization and function of insertion sequences of eubacterial, archaebacterial, and eukaryotic origins with particular emphasis on bacterial elements and on different aspects of the transposition mechanism. It also attempts to provide a framework for classification of these elements by assigning them to various families or groups. A total of 443 members of the collection have been grouped in 17 families based on combinations of the following criteria: (i) similarities in genetic organization (arrangement of open reading frames); (ii) marked identities or similarities in the enzymes which mediate the transposition reactions, the recombinases/transposases (Tpases); (iii) similar features of their ends (terminal IRs); and (iv) fate of the nucleotide sequence of their target sites (generation of a direct target duplication of determined length). A brief description of the mechanism(s) involved in the mobility of individual ISs in each family and of the structure-function relationships of the individual Tpases is included where available. PMID:9729608

  3. PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

    PubMed Central

    Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

    2016-01-01

    The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

  4. The Diversity of Prokaryotic DDE Transposases of the Mutator Superfamily, Insertion Specificity, and Association with Conjugation Machineries

    PubMed Central

    Guérillot, Romain; Siguier, Patricia; Gourbeyre, Edith; Chandler, Michael; Glaser, Philippe

    2014-01-01

    Transposable elements (TEs) are major components of both prokaryotic and eukaryotic genomes and play a significant role in their evolution. In this study, we have identified new prokaryotic DDE transposase families related to the eukaryotic Mutator-like transposases. These genes were retrieved by cascade PSI-Blast using as initial query the transposase of the streptococcal integrative and conjugative element (ICE) TnGBS2. By combining secondary structure predictions and protein sequence alignments, we predicted the DDE catalytic triad and the DNA-binding domain recognizing the terminal inverted repeats. Furthermore, we systematically characterized the organization and the insertion specificity of the TEs relying on these prokaryotic Mutator-like transposases (p-MULT) for their mobility. Strikingly, two distant TE families target their integration upstream σA dependent promoters. This allowed us to identify a transposase sequence signature associated with this unique insertion specificity and to show that the dissymmetry between the two inverted repeats is responsible for the orientation of the insertion. Surprisingly, while DDE transposases are generally associated with small and simple transposons such as insertion sequences (ISs), p-MULT encoding TEs show an unprecedented diversity with several families of IS, transposons, and ICEs ranging in size from 1.1 to 52 kb. PMID:24418649

  5. Symbiosis Island Shuffling with Abundant Insertion Sequences in the Genomes of Extra-Slow-Growing Strains of Soybean Bradyrhizobia

    PubMed Central

    Iida, Takayuki; Itakura, Manabu; Anda, Mizue; Sugawara, Masayuki; Isawa, Tsuyoshi; Okubo, Takashi; Sato, Shusei; Chiba-Kakizaki, Kaori

    2015-01-01

    Extra-slow-growing bradyrhizobia from root nodules of field-grown soybeans harbor abundant insertion sequences (ISs) and are termed highly reiterated sequence-possessing (HRS) strains. We analyzed the genome organization of HRS strains with the focus on IS distribution and symbiosis island structure. Using pulsed-field gel electrophoresis, we consistently detected several plasmids (0.07 to 0.4 Mb) in the HRS strains (NK5, NK6, USDA135, 2281, USDA123, and T2), whereas no plasmids were detected in the non-HRS strain USDA110. The chromosomes of the six HRS strains (9.7 to 10.7 Mb) were larger than that of USDA110 (9.1 Mb). Using MiSeq sequences of 6 HRS and 17 non-HRS strains mapped to the USDA110 genome, we found that the copy numbers of ISRj1, ISRj2, ISFK1, IS1632, ISB27, ISBj8, and IS1631 were markedly higher in HRS strains. Whole-genome sequencing showed that the HRS strain NK6 had four small plasmids (136 to 212 kb) and a large chromosome (9,780 kb). Strong colinearity was found between 7.4-Mb core regions of the NK6 and USDA110 chromosomes. USDA110 symbiosis islands corresponded mainly to five small regions (S1 to S5) within two variable regions, V1 (0.8 Mb) and V2 (1.6 Mb), of the NK6 chromosome. The USDA110 nif gene cluster (nifDKENXSBZHQW-fixBCX) was split into two regions, S2 and S3, where ISRj1-mediated rearrangement occurred between nifS and nifB. ISs were also scattered in NK6 core regions, and ISRj1 insertion often disrupted some genes important for survival and environmental responses. These results suggest that HRS strains of soybean bradyrhizobia were subjected to IS-mediated symbiosis island shuffling and core genome degradation. PMID:25862225

  6. CRISPR regulation of intraspecies diversification by limiting IS transposition and intercellular recombination.

    PubMed

    Watanabe, Takayasu; Nozawa, Takashi; Aikawa, Chihiro; Amano, Atsuo; Maruyama, Fumito; Nakagawa, Ichiro

    2013-01-01

    Mobile genetic elements (MGEs) and genetic rearrangement are considered as major driving forces of bacterial diversification. Previous comparative genome analysis of Porphyromonas gingivalis, a pathogen related to periodontitis, implied such an important relationship. As a counterpart system to MGEs, clustered regularly interspaced short palindromic repeats (CRISPRs) in bacteria may be useful for genetic typing. We found that CRISPR typing could be a reasonable alternative to conventional methods for characterizing phylogenetic relationships among 60 highly diverse P. gingivalis isolates. Examination of genetic recombination along with multilocus sequence typing suggests the importance of such events between different isolates. MGEs appear to be strategically located at the breakpoint gaps of complicated genome rearrangements. Of these MGEs, insertion sequences (ISs) were found most frequently. CRISPR analysis identified 2,150 spacers that were clustered into 1,187 unique ones. Most of these spacers exhibited no significant nucleotide similarity to known sequences (97.6%: 1,158/1,187). Surprisingly, CRISPR spacers exhibiting high nucleotide similarity to regions of P. gingivalis genomes including ISs were predominant. The proportion of such spacers to all the unique spacers (1.6%: 19/1,187) was the highest among previous studies, suggesting novel functions for these CRISPRs. These results indicate that P. gingivalis is a bacterium with high intraspecies diversity caused by frequent insertion sequence (IS) transposition, whereas both the introduction of foreign DNA, primarily from other P. gingivalis cells, and IS transposition are limited by CRISPR interference. It is suggested that P. gingivalis CRISPRs could be an important source for understanding the role of CRISPRs in the development of bacterial diversity.

  7. ISS Expedition 18 Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA) in Node 2

    NASA Image and Video Library

    2008-12-06

    ISS018-E-010645 (6 Dec. 2008) --- Astronaut Michael Fincke, Expedition 18 commander, works on the Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA) in the Harmony node of the International Space Station.

  8. MELFI Urine Sample First Insertion

    NASA Image and Video Library

    2009-04-11

    ISS019-E-005715 (11 April 2009) --- Astronaut Michael Barratt, Expedition 19/20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  9. TnpPred: A Web Service for the Robust Prediction of Prokaryotic Transposases

    PubMed Central

    Riadi, Gonzalo; Medina-Moenne, Cristobal; Holmes, David S.

    2012-01-01

    Transposases (Tnps) are enzymes that participate in the movement of insertion sequences (ISs) within and between genomes. Genes that encode Tnps are amongst the most abundant and widely distributed genes in nature. However, they are difficult to predict bioinformatically and given the increasing availability of prokaryotic genomes and metagenomes, it is incumbent to develop rapid, high quality automatic annotation of ISs. This need prompted us to develop a web service, termed TnpPred for Tnp discovery. It provides better sensitivity and specificity for Tnp predictions than given by currently available programs as determined by ROC analysis. TnpPred should be useful for improving genome annotation. The TnpPred web service is freely available for noncommercial use. PMID:23251097

  10. Nutrition and Repository: Insertion of Urine Sample into MELFI

    NASA Image and Video Library

    2009-04-18

    ISS019-E-010170 (18 April 2009) --- Astronaut Michael Barratt, Expedition 19/20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  11. Coleman prepares to insert samples into the MELFI

    NASA Image and Video Library

    2010-12-27

    ISS026-E-023768 (27 Dec. 2010) --- NASA astronaut Catherine (Cady) Coleman, Expedition 26 flight engineer, prepares to insert samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  12. Nutrition and Repository: Insertion of Urine Sample into MELFI

    NASA Image and Video Library

    2009-04-18

    ISS019-E-010165 (18 April 2009) --- Astronaut Michael Barratt, Expedition 19/20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  13. View of Sodium Chloride inserted onto blueberry jelly within a metal loop on Expedition Six

    NASA Image and Video Library

    2003-03-14

    ISS006-E-39254 (14 March 2003) --- A view of sodium chloride inserted onto blueberry jelly within a 50-millimeter (mm) metal loop was photographed by an Expedition Six crewmember. The experiment took place in the Destiny laboratory on the International Space Station (ISS).

  14. Thirsk inserts samples into MELFI in the JPM

    NASA Image and Video Library

    2009-06-07

    ISS020-E-007156 (7 June 2009) --- Canadian Space Agency astronaut Robert Thirsk, Expedition 20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  15. View of Sodium Chloride inserted onto blueberry jelly within a metal loop on Expedition Six

    NASA Image and Video Library

    2003-03-14

    ISS006-E-39258 (14 March 2003) --- A close up view of sodium chloride inserted onto blueberry jelly within a 50-millimeter (mm) metal loop was photographed by an Expedition Six crewmember. The experiment took place in the Destiny laboratory on the International Space Station (ISS).

  16. Declic: design, integration and testing of a multi configurable instrument using optical diagnostics to study directional solidification and critical fluids

    NASA Astrophysics Data System (ADS)

    Durieux, A.; Martin, B.; Laubier, D.

    2017-11-01

    DECLIC, a Facility dedicated to the study of transparent media under microgravity, will be used in an ISS EXPRESS Rack. This paper focuses on the EXL which contains two optical boxes disposed on two opposite sides of the cavity where the Inserts to be studied shall be locked. At the moment, three types of inserts are planned to be accommodated in the EXL. Various optical diagnostics are available by configuring the EXL (sources, sensors, mechanisms). After the presentation of the EXL design, this article deals with some manufacturing and testing aspects, such as the use of COTS (cameras). Specific OGSE have been developed in order to simulate the optical interfaces and the propagation of beams in the inserts. Three models of the EXL have been integrated and fully tested, including the Flight Model. The sequence of tests, the performances measured, and then some images of the experiments performed with the inserts will be presented.

  17. Improving prokaryotic transposable elements identification using a combination of de novo and profile HMM methods.

    PubMed

    Kamoun, Choumouss; Payen, Thibaut; Hua-Van, Aurélie; Filée, Jonathan

    2013-10-11

    Insertion Sequences (ISs) and their non-autonomous derivatives (MITEs) are important components of prokaryotic genomes inducing duplication, deletion, rearrangement or lateral gene transfers. Although ISs and MITEs are relatively simple and basic genetic elements, their detection remains a difficult task due to their remarkable sequence diversity. With the advent of high-throughput genome and metagenome sequencing technologies, the development of fast, reliable and sensitive methods of ISs and MITEs detection become an important challenge. So far, almost all studies dealing with prokaryotic transposons have used classical BLAST-based detection methods against reference libraries. Here we introduce alternative methods of detection either taking advantages of the structural properties of the elements (de novo methods) or using an additional library-based method using profile HMM searches. In this study, we have developed three different work flows dedicated to ISs and MITEs detection: the first two use de novo methods detecting either repeated sequences or presence of Inverted Repeats; the third one use 28 in-house transposase alignment profiles with HMM search methods. We have compared the respective performances of each method using a reference dataset of 30 archaeal and 30 bacterial genomes in addition to simulated and real metagenomes. Compared to a BLAST-based method using ISFinder as library, de novo methods significantly improve ISs and MITEs detection. For example, in the 30 archaeal genomes, we discovered 30 new elements (+20%) in addition to the 141 multi-copies elements already detected by the BLAST approach. Many of the new elements correspond to ISs belonging to unknown or highly divergent families. The total number of MITEs has even doubled with the discovery of elements displaying very limited sequence similarities with their respective autonomous partners (mainly in the Inverted Repeats of the elements). Concerning metagenomes, with the exception of short reads data (<300 bp) for which both techniques seem equally limited, profile HMM searches considerably ameliorate the detection of transposase encoding genes (up to +50%) generating low level of false positives compare to BLAST-based methods. Compared to classical BLAST-based methods, the sensitivity of de novo and profile HMM methods developed in this study allow a better and more reliable detection of transposons in prokaryotic genomes and metagenomes. We believed that future studies implying ISs and MITEs identification in genomic data should combine at least one de novo and one library-based method, with optimal results obtained by running the two de novo methods in addition to a library-based search. For metagenomic data, profile HMM search should be favored, a BLAST-based step is only useful to the final annotation into groups and families.

  18. Living with Genome Instability: the Adaptation of Phytoplasmas to Diverse Environments of Their Insect and Plant Hosts††

    PubMed Central

    Bai, Xiaodong; Zhang, Jianhua; Ewing, Adam; Miller, Sally A.; Jancso Radek, Agnes; Shevchenko, Dmitriy V.; Tsukerman, Kiryl; Walunas, Theresa; Lapidus, Alla; Campbell, John W.; Hogenhout, Saskia A.

    2006-01-01

    Phytoplasmas (“Candidatus Phytoplasma,” class Mollicutes) cause disease in hundreds of economically important plants and are obligately transmitted by sap-feeding insects of the order Hemiptera, mainly leafhoppers and psyllids. The 706,569-bp chromosome and four plasmids of aster yellows phytoplasma strain witches' broom (AY-WB) were sequenced and compared to the onion yellows phytoplasma strain M (OY-M) genome. The phytoplasmas have small repeat-rich genomes. This comparative analysis revealed that the repeated DNAs are organized into large clusters of potential mobile units (PMUs), which contain tra5 insertion sequences (ISs) and genes for specialized sigma factors and membrane proteins. So far, these PMUs appear to be unique to phytoplasmas. Compared to mycoplasmas, phytoplasmas lack several recombination and DNA modification functions, and therefore, phytoplasmas may use different mechanisms of recombination, likely involving PMUs, for the creation of variability, allowing phytoplasmas to adjust to the diverse environments of plants and insects. The irregular GC skews and the presence of ISs and large repeated sequences in the AY-WB and OY-M genomes are indicative of high genomic plasticity. Nevertheless, segments of ∼250 kb located between the lplA and glnQ genes are syntenic between the two phytoplasmas and contain the majority of the metabolic genes and no ISs. AY-WB appears to be further along in the reductive evolution process than OY-M. The AY-WB genome is ∼154 kb smaller than the OY-M genome, primarily as a result of fewer multicopy sequences, including PMUs. Furthermore, AY-WB lacks genes that are truncated and are part of incomplete pathways in OY-M. PMID:16672622

  19. Living with genome instability: the adaptation of phytoplasmas todiverse environments of their insect and plant hosts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bai, Xiaodong; Zhang, Jianhua; Ewing, Adam

    Phytoplasmas (Candidatus Phytoplasma, Class Mollicutes) cause disease in hundreds of economically important plants, and are obligately transmitted by sap-feeding insects of the order Hemiptera, mainly leafhoppers and psyllids. The 706,569-bp chromosome and four plasmids of aster yellows phytoplasma strain witches broom (AY-WB) were sequenced and compared to the onion yellows phytoplasma strain M (OY-M) genome. The phytoplasmas have small repeat-rich genomes. The repeated DNAs are organized into large clusters, potential mobile units (PMUs), which contain tra5 insertion sequences (ISs), and specialized sigma factors and membrane proteins. So far, PMUs are unique to phytoplasmas. Compared to mycoplasmas, phytoplasmas lack several recombinationmore » and DNA modification functions, and therefore phytoplasmas probably use different mechanisms of recombination, likely involving PMUs, for the creation of variability, allowing phytoplasmas to adjust to the diverse environments of plants and insects. The irregular GC skews and presence of ISs and large repeated sequences in the AY-WB and OY-M genomes are indicative of high genomic plasticity. Nevertheless, segments of {approx}250 kb, located between genes lplA and glnQ are syntenic between the two phytoplasmas, contain the majority of the metabolic genes and no ISs. AY-WB is further along in the reductive evolution process than OY-M. The AY-WB genome is {approx}154 kb smaller than the OY-M genome, primarily as a result of fewer multicopy sequences, including PMUs. Further, AY-WB lacks genes that are truncated and are part of incomplete pathways in OY-M. This is the first comparative phytoplasma genome analysis and report of the existence of PMUs in phytoplasma genomes.« less

  20. View of Sodium Chloride inserted onto blueberry jelly within a metal loop on Expedition Six

    NASA Image and Video Library

    2003-03-15

    ISS006-E-39282 (15 March 2003) --- A view of sodium chloride inserted onto blueberry jelly within a 50-millimeter (mm) metal loop was photographed by an Expedition Six crewmember. The water in the sodium chloride solution evaporates as it leaves larger three-dimensional crystals while the blueberry jelly hardens. The experiment took place in the Destiny laboratory on the International Space Station (ISS).

  1. The distribution of a phage-related insertion sequence element in the cyanobacterium, Microcystis aeruginosa.

    PubMed

    Kuno, Sotaro; Yoshida, Takashi; Kamikawa, Ryoma; Hosoda, Naohiko; Sako, Yoshihiko

    2010-01-01

    The cyanophage Ma-LMM01, specifically-infecting Microcystis aeruginosa, has an insertion sequence (IS) element that we named IS607-cp showing high nucleotide similarity to a counterpart in the genome of the cyanobacterium Cyanothece sp. We tested 21 strains of M. aeruginosa for the presence of IS607-cp using PCR and detected the element in strains NIES90, NIES112, NIES604, and RM6. Thermal asymmetric interlaced PCR (TAIL-PCR) revealed each of these strains has multiple copies of IS607-cp. Some of the ISs were classified into three types based on their inserted positions; IS607-cp-1 is common in strains NIES90, NIES112 and NIES604, whereas IS607-cp-2 and IS607-cp-3 are specific to strains NIES90 and RM6, respectively. This multiplicity may reflect the replicative transposition of IS607-cp. The sequence of IS607-cp in Ma-LMM01 showed robust affinity to those found in M. aeruginosa and Cyanothece spp. in a phylogenetic tree inferred from counterparts of various bacteria. This suggests the transfer of IS607-cp between the cyanobacterium and its cyanophage. We discuss the potential role of Ma-LMM01-related phages as donors of IS elements that may mediate the transfer of IS607-cp; and thereby partially contribute to the genome plasticity of M. aeruginosa.

  2. ISEScan: automated identification of insertion sequence elements in prokaryotic genomes.

    PubMed

    Xie, Zhiqun; Tang, Haixu

    2017-11-01

    The insertion sequence (IS) elements are the smallest but most abundant autonomous transposable elements in prokaryotic genomes, which play a key role in prokaryotic genome organization and evolution. With the fast growing genomic data, it is becoming increasingly critical for biology researchers to be able to accurately and automatically annotate ISs in prokaryotic genome sequences. The available automatic IS annotation systems are either providing only incomplete IS annotation or relying on the availability of existing genome annotations. Here, we present a new IS elements annotation pipeline to address these issues. ISEScan is a highly sensitive software pipeline based on profile hidden Markov models constructed from manually curated IS elements. ISEScan performs better than existing IS annotation systems when tested on prokaryotic genomes with curated annotations of IS elements. Applying it to 2784 prokaryotic genomes, we report the global distribution of IS families across taxonomic clades in Archaea and Bacteria. ISEScan is implemented in Python and released as an open source software at https://github.com/xiezhq/ISEScan. hatang@indiana.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  3. Video- Soldering Iron Inserted Through a Film of Water Onboard the International Space Station (ISS)

    NASA Technical Reports Server (NTRS)

    2003-01-01

    Saturday Morning Science, the science of opportunity series of applied experiments and demonstrations, performed aboard the International Space Station (ISS) by Expedition 6 astronaut Dr. Don Pettit, revealed some remarkable findings. In this video, Dr. Pettit demonstrates the result of inserting a soldering iron into a thin film or sheet of water in space. Dr. Pettit makes comparative comments about the differences and similarities of boiling processes in space and on Earth.

  4. Expedition 28 Crew Members remove samples from the JPM MELFI

    NASA Image and Video Library

    2011-07-08

    ISS028-E-014918 (8 July 2011) --- NASA astronauts Ron Garan (left) and Mike Fossum, both Expedition 28 flight engineers, remove samples from the General Laboratory Active Cryogenic ISS Experiment Refrigerator (GLACIER) and insert in the Minus Eighty Degree Laboratory Freezer for ISS (MELFI-1) in the Kibo laboratory of the International Space Station.

  5. Expedition 28 Crew Members remove samples from the JPM MELFI

    NASA Image and Video Library

    2011-07-08

    ISS028-E-014916 (8 July 2011) --- NASA astronauts Ron Garan (left) and Mike Fossum, both Expedition 28 flight engineers, remove samples from the General Laboratory Active Cryogenic ISS Experiment Refrigerator (GLACIER) and insert in the Minus Eighty Degree Laboratory Freezer for ISS (MELFI-1) in the Kibo laboratory of the International Space Station.

  6. Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

    PubMed

    Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

    2009-09-01

    To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

  7. Repeated extragenic sequences in prokaryotic genomes: a proposal for the origin and dynamics of the RUP element in Streptococcus pneumoniae.

    PubMed

    Oggioni, M R; Claverys, J P

    1999-10-01

    A survey of all Streptococcus pneumoniae GenBank/EMBL DNA sequence entries and of the public domain sequence (representing more than 90% of the genome) of an S. pneumoniae type 4 strain allowed identification of 108 copies of a 107-bp-long highly repeated intergenic element called RUP (for repeat unit of pneumococcus). Several features of the element, revealed in this study, led to the proposal that RUP is an insertion sequence (IS)-derivative that could still be mobile. Among these features are: (1) a highly significant homology between the terminal inverted repeats (IRs) of RUPs and of IS630-Spn1, a new putative IS of S. pneumoniae; and (2) insertion at a TA dinucleotide, a characteristic target of several members of the IS630 family. Trans-mobilization of RUP is therefore proposed to be mediated by the transposase of IS630-Spn1. To account for the observation that RUPs are distributed among four subtypes which exhibit different degrees of sequence homogeneity, a scenario is invoked based on successive stages of RUP mobility and non-mobility, depending on whether an active transposase is present or absent. In the latter situation, an active transposase could be reintroduced into the species through natural transformation. Examination of sequences flanking RUP revealed a preferential association with ISs. It also provided evidence that RUPs promote sequence rearrangements, thereby contributing to genome flexibility. The possibility that RUP preferentially targets transforming DNA of foreign origin and subsequently favours disruption/rearrangement of exogenous sequences is discussed.

  8. Vascular Blood Collection stowage in MELFI

    NASA Image and Video Library

    2010-08-26

    ISS024-E-012546 (26 Aug. 2010) --- NASA astronaut Tracy Caldwell Dyson, Expedition 24 flight engineer, prepares to insert biological samples in a dewar tray in the Minus Eighty Laboratory Freezer for ISS (MELFI-1) in the Kibo laboratory of the International Space Station.

  9. Vascular Blood Collection stowage in MELFI

    NASA Image and Video Library

    2010-08-26

    ISS024-E-012548 (26 Aug. 2010) --- NASA astronaut Tracy Caldwell Dyson, Expedition 24 flight engineer, prepares to insert biological samples in a dewar tray in the Minus Eighty Laboratory Freezer for ISS (MELFI-1) in the Kibo laboratory of the International Space Station.

  10. 2nd NUTRITION w/Repository collection period

    NASA Image and Video Library

    2011-10-04

    ISS029-E-015096 (4 Oct. 2011) --- In the International Space Station?s Kibo laboratory, NASA astronaut Mike Fossum, Expedition 29 commander, prepares to insert samples into a Minus Eighty Laboratory Freezer for ISS (MELFI-1) dewar tray for the second NUTRITION w/Repository collection period.

  11. 2nd NUTRITION w/Repository collection period

    NASA Image and Video Library

    2011-10-04

    ISS029-E-015110 (4 Oct. 2011) --- In the International Space Station?s Kibo laboratory, NASA astronaut Mike Fossum, Expedition 29 commander, inserts a dewar tray of samples into the Minus Eighty Laboratory Freezer for ISS (MELFI-1) for the second NUTRITION w/Repository collection period.

  12. A proposal to rename the hyperthermophile Pyrococcus woesei as Pyrococcus furiosus subsp. woesei.

    PubMed

    Kanoksilapatham, Wirojne; González, Juan M; Maeder, Dennis L; DiRuggiero, Jocelyne; Robb, Frank T

    2004-10-01

    Pyrococcus species are hyperthermophilic members of the order Thermococcales, with optimal growth temperatures approaching 100 degrees C. All species grow heterotrophically and produce H2 or, in the presence of elemental sulfur (S(o)), H2S. Pyrococcus woesei and P. furiosus were isolated from marine sediments at the same Vulcano Island beach site and share many morphological and physiological characteristics. We report here that the rDNA operons of these strains have identical sequences, including their intergenic spacer regions and part of the 23S rRNA. Both species grow rapidly and produce H2 in the presence of 0.1% maltose and 10-100 microM sodium tungstate in S(o)-free medium. However, P. woesei shows more extensive autolysis than P. furiosus in the stationary phase. Pyrococcus furiosus and P. woesei share three closely related families of insertion sequences (ISs). A Southern blot performed with IS probes showed extensive colinearity between the genomes of P. woesei and P. furiosus. Cloning and sequencing of ISs that were in different contexts in P. woesei and P. furiosus revealed that the napA gene in P. woesei is disrupted by a type III IS element, whereas in P. furiosus, this gene is intact. A type I IS element, closely linked to the napA gene, was observed in the same context in both P. furiosus and P. woesei genomes. Our results suggest that the IS elements are implicated in genomic rearrangements and reshuffling in these closely related strains. We propose to rename P. woesei a subspecies of P. furiosus based on their identical rDNA operon sequences, many common IS elements that are shared genomic markers, and the observation that all P. woesei nucleotide sequences deposited in GenBank to date are > 99% identical to P. furiosus sequences.

  13. Thirsk in JPM

    NASA Image and Video Library

    2009-06-06

    ISS020-E-007147 (6 June 2009) --- Canadian Space Agency astronaut Robert Thirsk, Expedition 20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  14. Coleman prepares to insert samples into the MELFI

    NASA Image and Video Library

    2010-12-27

    ISS026-E-023814 (27 Dec. 2010) --- NASA astronaut Catherine (Cady) Coleman, Expedition 26 flight engineer, works with the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  15. Thirsk in JPM

    NASA Image and Video Library

    2009-06-06

    ISS020-E-007140 (6 June 2009) --- Canadian Space Agency astronaut Robert Thirsk, Expedition 20 flight engineer, performs an insertion of urine samples into the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) study in the Japanese Kibo laboratory of the International Space Station.

  16. Comparison and phylogenetic analysis of the ISS gene in two predominant avian pathogenic E. coli serogroups isolated from avian colibacillosis in Iran.

    PubMed

    Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid

    2013-02-01

    The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. Solidifying Small Satellite Access to Orbit via the International Space Station (ISS): Cyclops' Deployment of the Lonestar SmallSat from the ISS

    NASA Technical Reports Server (NTRS)

    Hershey, Matthew P.; Newswander, Daniel R.; Evernden, Brent A.

    2016-01-01

    On January 29, 2016, the Space Station Integrated Kinetic Launcher for Orbital Payload Systems (SSIKLOPS), known as "Cyclops" to the International Space Station (ISS) community, deployed Lonestar from the ISS. The deployment of Lonestar, a collaboration between Texas A&M University and the University of Texas at Austin, continued to showcase the simplicity and reliability of the Cyclops deployment system. Cyclops, a NASA-developed, dedicated 10-100 kg class ISS SmallSat deployment system, utilizes the Japanese airlock and robotic systems to seamlessly insert SmallSats into orbit. This paper will illustrate Cyclops' successful deployment of Lonestar from the ISS as well as outline its concept of operations, interfaces, requirements, and processes.

  18. View of salt crystals inserted within a 50mm metal loop in the U.S. Laboratory

    NASA Image and Video Library

    2003-03-15

    ISS006-E-39339 (15 March 2003) --- A close up view of sodium chloride crystals in a water bubble within a 50-millimeter metal loop was photographed by an Expedition Six crewmember. The experiment took place in the Destiny laboratory on the International Space Station (ISS).

  19. Space Station Integrated Kinetic Launcher for Orbital Payload Systems (SSIKLOPS) - Cyclops

    NASA Technical Reports Server (NTRS)

    Smith, James P.; Lamb, Craig R.; Ballard, Perry G.

    2013-01-01

    Access to space for satellites in the 50-100 kg class is a challenge for the small satellite community. Rideshare opportunities are limited and costly, and the small sat must adhere to the primary payloads schedule and launch needs. Launching as an auxiliary payload on an Expendable Launch Vehicle presents many technical, environmental, and logistical challenges to the small satellite community. To assist the community in mitigating these challenges and in order to provide the community with greater access to space for 50-100 kg satellites, the NASA International Space Station (ISS) and Engineering communities in collaboration with the Department of Defense (DOD) Space Test Program (STP) is developing a dedicated 50-100 kg class ISS small satellite deployment system. The system, known as Cyclops, will utilize NASA's ISS resupply vehicles to launch small sats to the ISS in a controlled pressurized environment in soft stow bags. The satellites will then be processed through the ISS pressurized environment by the astronaut crew allowing satellite system diagnostics prior to orbit insertion. Orbit insertion is achieved through use of the Japan Aerospace Exploration Agency's Experiment Module Robotic Airlock (JEM Airlock) and one of the ISS Robotic Arms. Cyclops' initial satellite deployment demonstration of DOD STP's SpinSat and UT/TAMU's Lonestar satellites will be toward the end of 2013 or beginning of 2014. Cyclops will be housed on-board the ISS and used throughout its lifetime. The anatomy of Cyclops, its concept of operations for satellite deployment, and its satellite interfaces and requirements will be addressed further in this paper.

  20. Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA)

    NASA Image and Video Library

    2013-07-24

    ISS036-E-024569 (24 July 2013) --- European Space Agency astronaut Luca Parmitano, Expedition 36 flight engineer, works on the Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA) at a maintenance work station in the Harmony node of the International Space Station.

  1. Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA)

    NASA Image and Video Library

    2013-07-24

    ISS036-E-024605 (24 July 2013) --- European Space Agency astronaut Luca Parmitano, Expedition 36 flight engineer, works on the Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA) at a maintenance work station in the Harmony node of the International Space Station.

  2. Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA)

    NASA Image and Video Library

    2013-07-24

    ISS036-E-024637 (24 July 2013) --- European Space Agency astronaut Luca Parmitano, Expedition 36 flight engineer, works on the Multi-User Droplet Combustion Apparatus (MDCA) Chamber Insert Assembly (CIA) at a maintenance work station in the Harmony node of the International Space Station.

  3. Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

    PubMed

    Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

    2014-06-01

    It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

  4. Hadfield prepares to insert biological samples in the MELFI-1

    NASA Image and Video Library

    2013-01-07

    View of Canadian Space Agency (CSA) Chris Hadfield,Expedition 34 Flight Engineer (FE),preparing to insert biological samples in the Minus Eighty Laboratory Freezer for International Space Station (ISS) - (MELFI-1),in the Japanese Experiment Module (JEM) Pressurized Module (JPM). Photo was taken during Expedition 34.

  5. Genetic plasticity of the Shigella virulence plasmid is mediated by intra- and inter-molecular events between insertion sequences.

    PubMed

    Pilla, Giulia; McVicker, Gareth; Tang, Christoph M

    2017-09-01

    Acquisition of a single copy, large virulence plasmid, pINV, led to the emergence of Shigella spp. from Escherichia coli. The plasmid encodes a Type III secretion system (T3SS) on a 30 kb pathogenicity island (PAI), and is maintained in a bacterial population through a series of toxin:antitoxin (TA) systems which mediate post-segregational killing (PSK). The T3SS imposes a significant cost on the bacterium, and strains which have lost the plasmid and/or genes encoding the T3SS grow faster than wild-type strains in the laboratory, and fail to bind the indicator dye Congo Red (CR). Our aim was to define the molecular events in Shigella flexneri that cause loss of Type III secretion (T3S), and to examine whether TA systems exert positional effects on pINV. During growth at 37°C, we found that deletions of regions of the plasmid including the PAI lead to the emergence of CR-negative colonies; deletions occur through intra-molecular recombination events between insertion sequences (ISs) flanking the PAI. Furthermore, by repositioning MvpAT (which belongs to the VapBC family of TA systems) near the PAI, we demonstrate that the location of this TA system alters the rearrangements that lead to loss of T3S, indicating that MvpAT acts both globally (by reducing loss of pINV through PSK) as well as locally (by preventing loss of adjacent sequences). During growth at environmental temperatures, we show for the first time that pINV spontaneously integrates into different sites in the chromosome, and this is mediated by inter-molecular events involving IS1294. Integration leads to reduced PAI gene expression and impaired secretion through the T3SS, while excision of pINV from the chromosome restores T3SS function. Therefore, pINV integration provides a reversible mechanism for Shigella to circumvent the metabolic burden imposed by pINV. Intra- and inter-molecular events between ISs, which are abundant in Shigella spp., mediate plasticity of S. flexneri pINV.

  6. Defining the ABC of gene essentiality in streptococci.

    PubMed

    Charbonneau, Amelia R L; Forman, Oliver P; Cain, Amy K; Newland, Graham; Robinson, Carl; Boursnell, Mike; Parkhill, Julian; Leigh, James A; Maskell, Duncan J; Waller, Andrew S

    2017-05-31

    Utilising next generation sequencing to interrogate saturated bacterial mutant libraries provides unprecedented information for the assignment of genome-wide gene essentiality. Exposure of saturated mutant libraries to specific conditions and subsequent sequencing can be exploited to uncover gene essentiality relevant to the condition. Here we present a barcoded transposon directed insertion-site sequencing (TraDIS) system to define an essential gene list for Streptococcus equi subsp. equi, the causative agent of strangles in horses, for the first time. The gene essentiality data for this group C Streptococcus was compared to that of group A and B streptococci. Six barcoded variants of pGh9:ISS1 were designed and used to generate mutant libraries containing between 33,000-66,000 unique mutants. TraDIS was performed on DNA extracted from each library and data were analysed separately and as a combined master pool. Gene essentiality determined that 19.5% of the S. equi genome was essential. Gene essentialities were compared to those of group A and group B streptococci, identifying concordances of 90.2% and 89.4%, respectively and an overall concordance of 83.7% between the three species. The use of barcoded pGh9:ISS1 to generate mutant libraries provides a highly useful tool for the assignment of gene function in S. equi and other streptococci. The shared essential gene set of group A, B and C streptococci provides further evidence of the close genetic relationships between these important pathogenic bacteria. Therefore, the ABC of gene essentiality reported here provides a solid foundation towards reporting the functional genome of streptococci.

  7. Biomolecule Sequencer: Next-Generation DNA Sequencing Technology for In-Flight Environmental Monitoring, Research, and Beyond

    NASA Technical Reports Server (NTRS)

    Smith, David J.; Burton, Aaron; Castro-Wallace, Sarah; John, Kristen; Stahl, Sarah E.; Dworkin, Jason Peter; Lupisella, Mark L.

    2016-01-01

    On the International Space Station (ISS), technologies capable of rapid microbial identification and disease diagnostics are not currently available. NASA still relies upon sample return for comprehensive, molecular-based sample characterization. Next-generation DNA sequencing is a powerful approach for identifying microorganisms in air, water, and surfaces onboard spacecraft. The Biomolecule Sequencer payload, manifested to SpaceX-9 and scheduled on the Increment 4748 research plan (June 2016), will assess the functionality of a commercially-available next-generation DNA sequencer in the microgravity environment of ISS. The MinION device from Oxford Nanopore Technologies (Oxford, UK) measures picoamp changes in electrical current dependent on nucleotide sequences of the DNA strand migrating through nanopores in the system. The hardware is exceptionally small (9.5 x 3.2 x 1.6 cm), lightweight (120 grams), and powered only by a USB connection. For the ISS technology demonstration, the Biomolecule Sequencer will be powered by a Microsoft Surface Pro3. Ground-prepared samples containing lambda bacteriophage, Escherichia coli, and mouse genomic DNA, will be launched and stored frozen on the ISS until experiment initiation. Immediately prior to sequencing, a crew member will collect and thaw frozen DNA samples, connect the sequencer to the Surface Pro3, inject thawed samples into a MinION flow cell, and initiate sequencing. At the completion of the sequencing run, data will be downlinked for ground analysis. Identical, synchronous ground controls will be used for data comparisons to determine sequencer functionality, run-time sequence, current dynamics, and overall accuracy. We will present our latest results from the ISS flight experiment the first time DNA has ever been sequenced in space and discuss the many potential applications of the Biomolecule Sequencer for environmental monitoring, medical diagnostics, higher fidelity and more adaptable Space Biology Human Research Program investigations, and even life detection experiments for astrobiology missions.

  8. NUTRITION w/Repository

    NASA Image and Video Library

    2009-06-06

    ISS020-E-007577 (6 June 2009) --- European Space Agency astronaut Frank De Winne, Expedition 20 flight engineer, returns a dewar tray to the Minus Eighty Laboratory Freezer for ISS (MELFI) after inserting biological samples into the trays in the Kibo laboratory of the International Space Station. Samples were taken as part of the Nutritional Status Assessment (Nutrition) with Repository experiment, a study done by NASA to date of human physiologic changes during long-duration spaceflight.

  9. Supercritical Water Mixture (SCWM) Experiment in the High Temperature Insert-Reflight (HTI-R)

    NASA Technical Reports Server (NTRS)

    Hicks, Michael C.; Hegde, Uday G.; Garrabos, Yves; Lecoutre, Carole; Zappoli, Bernard

    2013-01-01

    Current research on supercritical water processes on board the International Space Station (ISS) focuses on salt precipitation and transport in a test cell designed for supercritical water. This study, known as the Supercritical Water Mixture Experiment (SCWM) serves as a precursor experiment for developing a better understanding of inorganic salt precipitation and transport during supercritical water oxidation (SCWO) processes for the eventual application of this technology for waste management and resource reclamation in microgravity conditions. During typical SCWO reactions any inorganic salts present in the reactant stream will precipitate and begin to coat reactor surfaces and control mechanisms (e.g., valves) often severely impacting the systems performance. The SCWM experiment employs a Sample Cell Unit (SCU) filled with an aqueous solution of Na2SO4 0.5-w at the critical density and uses a refurbished High Temperature Insert, which was used in an earlier ISS experiment designed to study pure water at near-critical conditions. The insert, designated as the HTI-Reflight (HTI-R) will be deployed in the DECLIC (Device for the Study of Critical Liquids and Crystallization) Facility on the International Space Station (ISS). Objectives of the study include measurement of the shift in critical temperature due to the presence of the inorganic salt, assessment of the predominant mode of precipitation (i.e., heterogeneously on SCU surfaces or homogeneously in the bulk fluid), determination of the salt morphology including size and shapes of particulate clusters, and the determination of the dominant mode of transport of salt particles in the presence of an imposed temperature gradient. Initial results from the ISS experiments will be presented and compared to findings from laboratory experiments on the ground.

  10. Ribo HRM--detection of inter- and intra-species polymorphisms within ribosomal DNA by high resolution melting analysis supported by application of artificial allelic standards.

    PubMed

    Masny, Aleksander; Jagiełło, Agata; Płucienniczak, Grażyna; Golab, Elzbieta

    2012-09-01

    Ribo HRM, a single-tube PCR and high resolution melting (HRM) assay for detection of polymorphisms in the large subunit ribosomal DNA expansion segment V, was developed on a Trichinella model. Four Trichinella species: T. spiralis (isolates ISS3 and ISS160), T. nativa (isolates ISS10 and ISS70), T. britovi (isolates ISS2 and ISS392) and T. pseudospiralis (isolates ISS13 and ISS1348) were genotyped. Cloned allelic variants of the expansion segment V were used as standards to prepare reference HRM curves characteristic for single sequences and mixtures of several cloned sequences imitating allelic composition detected in Trichinella isolates. Using the primer pair Tsr1 and Trich1bi, it was possible to amplify a fragment of the ESV and detect PCR products obtained from the genomic DNA of pools of larvae belonging to the four investigated species: T. pseudospiralis, T. spiralis, T. britovi and T. nativa, in a single tube Real-Time PCR reaction. Differences in the shape of the HRM curves of Trichinella isolates suggested the presence of differences between examined isolates of T. nativa, T. britovi and T. pseudospiralis species. No differences were observed between T. spiralis isolates. The presence of polymorphisms within the amplified ESV sequence fragment of T. nativa T. britovi and T. pseudospiralis was confirmed by sequencing of the cloned PCR products. Novel sequences were discovered and deposited in GenBank (GenBank IDs: JN971020-JN971027, JN120902.1, JN120903.1, JN120904.1, JN120906.1, JN120905.1). Screening the ESV region of Trichinella for polymorphism is possible using the genotyping assay Ribo HRM at the current state of its development. The Ribo HRM assay could be useful in phylogenetic studies of the Trichinella genus. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

    PubMed

    Fléchard, Maud; Gilot, Philippe

    2014-07-01

    We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process. © 2014 The Authors.

  12. Nanopore DNA Sequencing and Genome Assembly on the International Space Station.

    PubMed

    Castro-Wallace, Sarah L; Chiu, Charles Y; John, Kristen K; Stahl, Sarah E; Rubins, Kathleen H; McIntyre, Alexa B R; Dworkin, Jason P; Lupisella, Mark L; Smith, David J; Botkin, Douglas J; Stephenson, Timothy A; Juul, Sissel; Turner, Daniel J; Izquierdo, Fernando; Federman, Scot; Stryke, Doug; Somasekar, Sneha; Alexander, Noah; Yu, Guixia; Mason, Christopher E; Burton, Aaron S

    2017-12-21

    We evaluated the performance of the MinION DNA sequencer in-flight on the International Space Station (ISS), and benchmarked its performance off-Earth against the MinION, Illumina MiSeq, and PacBio RS II sequencing platforms in terrestrial laboratories. Samples contained equimolar mixtures of genomic DNA from lambda bacteriophage, Escherichia coli (strain K12, MG1655) and Mus musculus (female BALB/c mouse). Nine sequencing runs were performed aboard the ISS over a 6-month period, yielding a total of 276,882 reads with no apparent decrease in performance over time. From sequence data collected aboard the ISS, we constructed directed assemblies of the ~4.6 Mb E. coli genome, ~48.5 kb lambda genome, and a representative M. musculus sequence (the ~16.3 kb mitochondrial genome), at 100%, 100%, and 96.7% consensus pairwise identity, respectively; de novo assembly of the E. coli genome from raw reads yielded a single contig comprising 99.9% of the genome at 98.6% consensus pairwise identity. Simulated real-time analyses of in-flight sequence data using an automated bioinformatic pipeline and laptop-based genomic assembly demonstrated the feasibility of sequencing analysis and microbial identification aboard the ISS. These findings illustrate the potential for sequencing applications including disease diagnosis, environmental monitoring, and elucidating the molecular basis for how organisms respond to spaceflight.

  13. NUTRITION w/Repository

    NASA Image and Video Library

    2009-06-06

    ISS020-E-007603 (7 June 2009) --- European Space Agency astronaut Frank De Winne, Expedition 20 flight engineer, removes a dewar tray from the Minus Eighty Laboratory Freezer for ISS (MELFI) in order to insert biological samples into the trays in the Kibo laboratory of the International Space Station. Samples were taken as part of the Nutritional Status Assessment (Nutrition) with Repository experiment, a study done by NASA to date of human physiologic changes during long-duration spaceflight.

  14. Improving Robotic Operator Performance Using Augmented Reality

    NASA Technical Reports Server (NTRS)

    Maida, James C.; Bowen, Charles K.; Pace, John W.

    2007-01-01

    The Special Purpose Dexterous Manipulator (SPDM) is a two-armed robot that functions as an extension to the end effector of the Space Station Robotics Manipulator System (SSRMS), currently in use on the International Space Station (ISS). Crew training for the SPDM is accomplished using a robotic hardware simulator, which performs most of SPDM functions under normal static Earth gravitational forces. Both the simulator and SPDM are controlled from a standard robotic workstation using a laptop for the user interface and three monitors for camera views. Most operations anticipated for the SPDM involve the manipulation, insertion, and removal of any of several types of Orbital Replaceable Unit (ORU), modules which control various ISS functions. Alignment tolerances for insertion of the ORU into its receptacle are 0.25 inch and 0.5 degree from nominal values. The pre-insertion alignment task must be performed within these tolerances by using available video camera views of the intrinsic features of the ORU and receptacle, without special registration markings. Since optimum camera views may not be available, and dynamic orbital lighting conditions may limit periods of viewing, a successful ORU insertion operation may require an extended period of time. This study explored the feasibility of using augmented reality (AR) to assist SPDM operations. Geometric graphical symbols were overlaid on one of the workstation monitors to afford cues to assist the operator in attaining adequate pre-insertion ORU alignment. Twelve skilled subjects performed eight ORU insertion tasks using the simulator with and without the AR symbols in a repeated measures experimental design. Results indicated that using the AR symbols reduced pre-insertion alignment error for all subjects and reduced the time to complete pre-insertion alignment for most subjects.

  15. Nutrition: blood sample collection

    NASA Image and Video Library

    2007-03-20

    ISS014-E-17550 (20 March 2007) --- Astronaut Michael E. Lopez-Alegria, Expedition 14 commander and NASA space station science officer, prepares to insert a test sample in the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) experiment in the Destiny laboratory of the International Space Station. MELFI is a low temperature freezer facility with nominal operating temperatures of -80, -26 and +4 degrees Celsius that will preserve experiment materials over long periods.

  16. Nutrition: blood sample collection

    NASA Image and Video Library

    2007-03-20

    ISS014-E-17547 (20 March 2007) --- Astronaut Michael E. Lopez-Alegria, Expedition 14 commander and NASA space station science officer, prepares to insert a test sample in the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as part of the Nutritional Status Assessment (NUTRITION) experiment in the Destiny laboratory of the International Space Station. MELFI is a low temperature freezer facility with nominal operating temperatures of -80, -26 and +4 degrees Celsius that will preserve experiment materials over long periods.

  17. Wakata and Thirsk with MELFI in KIBO

    NASA Image and Video Library

    2009-06-15

    ISS020-E-010028 (15 June 2009) --- Japan Aerospace Exploration Agency (JAXA) astronaut Koichi Wakata, Expedition 20 flight engineer, returns a dewar tray to the Minus Eighty Laboratory Freezer for ISS (MELFI) after inserting biological samples into the trays in the Kibo laboratory of the International Space Station. Samples were taken as part of the Nutritional Status Assessment (Nutrition) with Repository experiment, a study done by NASA to date of human physiologic changes during long-duration spaceflight. Canadian Space Agency astronaut Robert Thirsk, flight engineer, assisted Wakata.

  18. Draft Genome Sequences of Two Aspergillus fumigatus Strains, Isolated from the International Space Station.

    PubMed

    Singh, Nitin Kumar; Blachowicz, Adriana; Checinska, Aleksandra; Wang, Clay; Venkateswaran, Kasthuri

    2016-07-14

    Draft genome sequences of Aspergillus fumigatus strains (ISSFT-021 and IF1SW-F4), opportunistic pathogens isolated from the International Space Station (ISS), were assembled to facilitate investigations of the nature of the virulence characteristics of the ISS strains to other clinical strains isolated on Earth. Copyright © 2016 Singh et al.

  19. Identification of novel MITEs (miniature inverted-repeat transposable elements) in Coxiella burnetii: implications for protein and small RNA evolution.

    PubMed

    Wachter, Shaun; Raghavan, Rahul; Wachter, Jenny; Minnick, Michael F

    2018-04-11

    Coxiella burnetii is a Gram-negative gammaproteobacterium and zoonotic agent of Q fever. C. burnetii's genome contains an abundance of pseudogenes and numerous selfish genetic elements. MITEs (miniature inverted-repeat transposable elements) are non-autonomous transposons that occur in all domains of life and are thought to be insertion sequences (ISs) that have lost their transposase function. Like most transposable elements (TEs), MITEs are thought to play an active role in evolution by altering gene function and expression through insertion and deletion activities. However, information regarding bacterial MITEs is limited. We describe two MITE families discovered during research on small non-coding RNAs (sRNAs) of C. burnetii. Two sRNAs, Cbsr3 and Cbsr13, were found to originate from a novel MITE family, termed QMITE1. Another sRNA, CbsR16, was found to originate from a separate and novel MITE family, termed QMITE2. Members of each family occur ~ 50 times within the strains evaluated. QMITE1 is a typical MITE of 300-400 bp with short (2-3 nt) direct repeats (DRs) of variable sequence and is often found overlapping annotated open reading frames (ORFs). Additionally, QMITE1 elements possess sigma-70 promoters and are transcriptionally active at several loci, potentially influencing expression of nearby genes. QMITE2 is smaller (150-190 bps), but has longer (7-11 nt) DRs of variable sequences and is mainly found in the 3' untranslated region of annotated ORFs and intergenic regions. QMITE2 contains a GTAG repetitive extragenic palindrome (REP) that serves as a target for IS1111 TE insertion. Both QMITE1 and QMITE2 display inter-strain linkage and sequence conservation, suggesting that they are adaptive and existed before divergence of C. burnetii strains. We have discovered two novel MITE families of C. burnetii. Our finding that MITEs serve as a source for sRNAs is novel. QMITE2 has a unique structure and occurs in large or small versions with unique DRs that display linkage and sequence conservation between strains, allowing for tracking of genomic rearrangements. QMITE1 and QMITE2 copies are hypothesized to influence expression of neighboring genes involved in DNA repair and virulence through transcriptional interference and ribonuclease processing.

  20. Isolation and Whole-genome Sequence Analysis of the Imipenem Heteroresistant Acinetobacter baumannii Clinical Isolate HRAB-85.

    PubMed

    Li, Puyuan; Huang, Yong; Yu, Lan; Liu, Yannan; Niu, Wenkai; Zou, Dayang; Liu, Huiying; Zheng, Jing; Yin, Xiuyun; Yuan, Jing; Yuan, Xin; Bai, Changqing

    2017-09-01

    Heteroresistance is a phenomenon in which there are various responses to antibiotics from bacterial cells within the same population. Here, we isolated and characterised an imipenem heteroresistant Acinetobacter baumannii strain (HRAB-85). The genome of strain HRAB-85 was completely sequenced and analysed to understand its antibiotic resistance mechanisms. Population analysis and multilocus sequence typing were performed. Subpopulations grew in the presence of imipenem at concentrations of up to 64μg/mL, and the strain was found to belong to ST208. The total length of strain HRAB-85 was 4,098,585bp with a GC content of 39.98%. The genome harboured at least four insertion sequences: the common ISAba1, ISAba22, ISAba24, and newly reported ISAba26. Additionally, 19 antibiotic-resistance genes against eight classes of antimicrobial agents were found, and 11 genomic islands (GIs) were identified. Among them, GI3, GI10, and GI11 contained many ISs and antibiotic-resistance determinants. The existence of imipenem heteroresistant phenotypes in A. baumannii was substantiated in this hospital, and imipenem pressure, which could induce imipenem-heteroresistant subpopulations, may select for highly resistant strains. The complete genome sequencing and bioinformatics analysis of HRAB-85 could improve our understanding of the epidemiology and resistance mechanisms of carbapenem-heteroresistant A. baumannii. Copyright © 2017. Published by Elsevier Ltd.

  1. Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) Furnace Development

    NASA Technical Reports Server (NTRS)

    Crouch, Myscha R.; Carswell, William E.; Farmer, Jeff; Rose, Fred; Tidwell, Paul H., II

    2000-01-01

    The Quench Module Insert (QMI) and the Diffusion Module Insert (DMI) are microgravity furnaces under development at Marshall Space Flight Center. The furnaces are being developed for the first Materials Science Research Rack (MSRR-1) of the Materials Science Research Facility (MSRF), one of the first International Space Station (ISS) scientific payloads. QMI is a Bridgman furnace with quench capability for studying interface behavior during directional solidification of metallic and alloy materials. DMI will be a Bridgman-Stockbarger furnace to study diffusion processes in semiconductors. The design for each insert, both QMI and DMI, is driven by specific science, operations and safety requirements, as well as by constraints arising from resource limitations, such as volume, mass and power. Preliminary QMI analysis and testing indicates that the design meets these requirements.

  2. Complete Closed Genome Sequence of Nontoxigenic Invasive Corynebacterium diphtheriae bv. mitis Strain ISS 3319.

    PubMed

    Azevedo Antunes, Camila; Richardson, Emily J; Quick, Joshua; Fuentes-Utrilla, Pablo; Isom, Georgia L; Goodall, Emily C; Möller, Jens; Hoskisson, Paul A; Mattos-Guaraldi, Ana Luiza; Cunningham, Adam F; Loman, Nicholas J; Sangal, Vartul; Burkovski, Andreas; Henderson, Ian R

    2018-02-01

    The genome sequence of the human pathogen Corynebacterium diphtheriae bv. mitis strain ISS 3319 was determined and closed in this study. The genome is estimated to have 2,404,936 bp encoding 2,257 proteins. This strain also possesses a plasmid of 1,960 bp. Copyright © 2018 Azevedo Antunes et al.

  3. Wakata and Thirsk with MELFI in KIBO

    NASA Image and Video Library

    2009-06-15

    ISS020-E-010025 (15 June 2009) --- Japan Aerospace Exploration Agency (JAXA) astronaut Koichi Wakata, Expedition 20 flight engineer, removes a dewar tray from the Minus Eighty Laboratory Freezer for ISS (MELFI) in order to insert biological samples into the trays in the Kibo laboratory of the International Space Station. Samples were taken as part of the Nutritional Status Assessment (Nutrition) with Repository experiment, a study done by NASA to date of human physiologic changes during long-duration spaceflight. Canadian Space Agency astronaut Robert Thirsk, flight engineer, assisted Wakata.

  4. Insert Concepts for the Material Science Research Rack (MSRR-1) of the Material Science Research Facility (MSRF) on the International Space Station (ISS)

    NASA Technical Reports Server (NTRS)

    Crouch, Myscha; Carswell, Bill; Farmer, Jeff; Rose, Fred; Tidwell, Paul

    2000-01-01

    The Material Science Research Rack I (MSRR-1) of the Material Science Research Facility (MSRF) contains an Experiment Module (EM) being developed collaboratively by NASA and the European Space Agency (ESA). This NASA/ESA EM will accommodate several different removable and replaceable Module Inserts (MIs) which are installed on orbit NASA's planned inserts include the Quench Module Insert (QMI) and the Diffusion Module Insert (DMI). The QMI is a high-gradient Bridgman-type vacuum furnace with quench capabilities used for experiments on directional solidification of metal alloys. The DMI is a vacuum Bridgman-Stockbarger-type furnace for experiments on Fickian and Soret diffusion in liquids. This paper discusses specific design features and performance capabilities of each insert. The paper also presents current prototype QMI hardware analysis and testing activities and selected results.

  5. Identification of Genomic Insertion and Flanking Sequence of G2-EPSPS and GAT Transgenes in Soybean Using Whole Genome Sequencing Method.

    PubMed

    Guo, Bingfu; Guo, Yong; Hong, Huilong; Qiu, Li-Juan

    2016-01-01

    Molecular characterization of sequence flanking exogenous fragment insertion is essential for safety assessment and labeling of genetically modified organism (GMO). In this study, the T-DNA insertion sites and flanking sequences were identified in two newly developed transgenic glyphosate-tolerant soybeans GE-J16 and ZH10-6 based on whole genome sequencing (WGS) method. More than 22.4 Gb sequence data (∼21 × coverage) for each line was generated on Illumina HiSeq 2500 platform. The junction reads mapped to boundaries of T-DNA and flanking sequences in these two events were identified by comparing all sequencing reads with soybean reference genome and sequence of transgenic vector. The putative insertion loci and flanking sequences were further confirmed by PCR amplification, Sanger sequencing, and co-segregation analysis. All these analyses supported that exogenous T-DNA fragments were integrated in positions of Chr19: 50543767-50543792 and Chr17: 7980527-7980541 in these two transgenic lines. Identification of genomic insertion sites of G2-EPSPS and GAT transgenes will facilitate the utilization of their glyphosate-tolerant traits in soybean breeding program. These results also demonstrated that WGS was a cost-effective and rapid method for identifying sites of T-DNA insertions and flanking sequences in soybean.

  6. Williams loads the MELFI for the Nutrition Experiment during Expedition 15

    NASA Image and Video Library

    2007-06-01

    ISS015-E-10572 (1 June 2007) --- Astronaut Sunita L. Williams, Expedition 15 flight engineer, inserts test samples in the Minus Eighty Degree Laboratory Freezer for ISS (MELFI) as a part of the Nutritional Status Assessment (Nutrition) experiment in the Destiny laboratory of the International Space Station. MELFI is a low temperature freezer facility with nominal operating temperatures of -80, -26 and +4 degrees Celsius that will preserve experiment materials over long periods. The results of the Nutrition experiment will be used to better understand the time course effects of space flight on human physiology.

  7. 77 FR 63221 - Waiver of Requirement To Enter Into a Reciprocal Waiver of Claims Agreement With All Customers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-16

    ... experiments on a locker insert to put into an experimental locker on board the ISS. The Space Act Agreement.... This has been true for indemnification of claims brought by employees. See, e.g., Howard Univ. v. Good...

  8. Usage of pre-flight data in short rendezvous mission of Soyuz-TMA spacecrafts

    NASA Astrophysics Data System (ADS)

    Murtazin, Rafail; Petrov, Nikolay

    2014-01-01

    The paper describes the reduction of the vehicle autonomous flight duration before docking to the ISS. The Russian Soyuz-TMA spacecraft dock to the ISS two days after launch. Due to the limited volume inside Soyuz-TMA the reduction of time until docking to the ISS is very important, since the long stay of the cosmonauts in the limited volume adds to the strain of the space flight. In the previous papers of the authors it was shown that the existing capabilities of Soyuz-TMA, the ISS and the ground control loop make it possible to transfer to the five-orbit rendezvous profile. However, the analysis of the cosmonauts' schedule on the launch day shows that its duration is at the allowable limit and that is why it is necessary to find a way to further reduce the flight duration of Soyuz-TMA before docking to less than five orbits. In a traditional rendezvous profile, the calculation of rendezvous burns begins only after determination of the actual vehicle insertion orbit. The paper describes an approach in which the first two rendezvous burns are performed as soon as the spacecraft reaches the reference orbit and the values of the burns are calculated prior to the launch based on the pre-flight data for the nominal insertion. This approach decreases the duration of the rendezvous by one orbit. The demonstration flight of a Progress vehicle using the proposed profile was implemented on August 1, 2012 and completely confirmed the correctness of the imbedded principles. The paper considers the possible improvements of the proposed approach and recovery from the contingencies.

  9. Salt Stress-Induced Loss of Iron Oxidoreduction Activities and Reacquisition of That Phenotype Depend on rus Operon Transcription in Acidithiobacillus ferridurans.

    PubMed

    Bonnefoy, Violaine; Grail, Barry M; Johnson, D Barrie

    2018-04-01

    The type strain of the mineral-oxidizing acidophilic bacterium Acidithiobacillus ferridurans was grown in liquid medium containing elevated concentrations of sodium chloride with hydrogen as electron donor. While it became more tolerant to chloride, after about 1 year, the salt-stressed acidophile was found to have lost its ability to oxidize iron, though not sulfur or hydrogen. Detailed molecular examination revealed that this was due to an insertion sequence, IS Afd1 , which belongs to the IS Pepr1 subgroup of the IS 4 family, having been inserted downstream of the two promoters PI and PII of the rus operon (which codes for the iron oxidation pathway in this acidophile), thereby preventing its transcription. The ability to oxidize iron was regained on protracted incubation of the culture inoculated onto salt-free solid medium containing ferrous iron and incubated under hydrogen. Two revertant strains were obtained. In one, the insertion sequence IS Afd1 had been excised, leaving an 11-bp signature, while in the other an ∼2,500-bp insertion sequence (belonging to the IS 66 family) was detected in the downstream inverted repeat of IS Afd1 The transcriptional start site of the rus operon in the second revertant strain was downstream of the two ISs, due to the creation of a new "hybrid" promoter. The loss and subsequent regaining of the ability of A. ferridurans T to reduce ferric iron were concurrent with those observed for ferrous iron oxidation, suggesting that these two traits are closely linked in this acidophile. IMPORTANCE Iron-oxidizing acidophilic bacteria have primary roles in the oxidative dissolution of sulfide minerals, a process that underpins commercial mineral-processing biotechnologies ("biomining"). Most of these prokaryotes have relatively low tolerance to chloride, which limits their activities when only saline or brackish waters are available. The study showed that it was possible to adapt a typical iron-oxidizing acidophile to grow in the presence of salt concentrations similar to those in seawater, but in so doing they lost their ability to oxidize iron, though not sulfur or hydrogen. The bacterium regained its capacity for oxidizing iron when the salt stress was removed but simultaneously reverted to tolerating lower concentrations of salt. These results suggest that the bacteria that have the main roles in biomining operations could survive but become ineffective in cases where saline or brackish waters are used for irrigation. Copyright © 2018 American Society for Microbiology.

  10. High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model–based analyses of transposon-insertion sequencing data

    PubMed Central

    Chao, Michael C.; Pritchard, Justin R.; Zhang, Yanjia J.; Rubin, Eric J.; Livny, Jonathan; Davis, Brigid M.; Waldor, Matthew K.

    2013-01-01

    The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or ‘sick’). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data. PMID:23901011

  11. A microbial survey of the International Space Station (ISS)

    PubMed Central

    Lang, Jenna M.; Coil, David A.; Neches, Russell Y.; Brown, Wendy E.; Cavalier, Darlene; Severance, Mark; Hampton-Marcell, Jarrad T.; Gilbert, Jack A.

    2017-01-01

    Background Modern advances in sequencing technology have enabled the census of microbial members of many natural ecosystems. Recently, attention is increasingly being paid to the microbial residents of human-made, built ecosystems, both private (homes) and public (subways, office buildings, and hospitals). Here, we report results of the characterization of the microbial ecology of a singular built environment, the International Space Station (ISS). This ISS sampling involved the collection and microbial analysis (via 16S rDNA PCR) of 15 surfaces sampled by swabs onboard the ISS. This sampling was a component of Project MERCCURI (Microbial Ecology Research Combining Citizen and University Researchers on ISS). Learning more about the microbial inhabitants of the “buildings” in which we travel through space will take on increasing importance, as plans for human exploration continue, with the possibility of colonization of other planets and moons. Results Sterile swabs were used to sample 15 surfaces onboard the ISS. The sites sampled were designed to be analogous to samples collected for (1) the Wildlife of Our Homes project and (2) a study of cell phones and shoes that were concurrently being collected for another component of Project MERCCURI. Sequencing of the 16S rDNA genes amplified from DNA extracted from each swab was used to produce a census of the microbes present on each surface sampled. We compared the microbes found on the ISS swabs to those from both homes on Earth and data from the Human Microbiome Project. Conclusions While significantly different from homes on Earth and the Human Microbiome Project samples analyzed here, the microbial community composition on the ISS was more similar to home surfaces than to the human microbiome samples. The ISS surfaces are species-rich with 1,036–4,294 operational taxonomic units (OTUs per sample). There was no discernible biogeography of microbes on the 15 ISS surfaces, although this may be a reflection of the small sample size we were able to obtain. PMID:29492330

  12. A microbial survey of the International Space Station (ISS).

    PubMed

    Lang, Jenna M; Coil, David A; Neches, Russell Y; Brown, Wendy E; Cavalier, Darlene; Severance, Mark; Hampton-Marcell, Jarrad T; Gilbert, Jack A; Eisen, Jonathan A

    2017-01-01

    Modern advances in sequencing technology have enabled the census of microbial members of many natural ecosystems. Recently, attention is increasingly being paid to the microbial residents of human-made, built ecosystems, both private (homes) and public (subways, office buildings, and hospitals). Here, we report results of the characterization of the microbial ecology of a singular built environment, the International Space Station (ISS). This ISS sampling involved the collection and microbial analysis (via 16S rDNA PCR) of 15 surfaces sampled by swabs onboard the ISS. This sampling was a component of Project MERCCURI (Microbial Ecology Research Combining Citizen and University Researchers on ISS). Learning more about the microbial inhabitants of the "buildings" in which we travel through space will take on increasing importance, as plans for human exploration continue, with the possibility of colonization of other planets and moons. Sterile swabs were used to sample 15 surfaces onboard the ISS. The sites sampled were designed to be analogous to samples collected for (1) the Wildlife of Our Homes project and (2) a study of cell phones and shoes that were concurrently being collected for another component of Project MERCCURI. Sequencing of the 16S rDNA genes amplified from DNA extracted from each swab was used to produce a census of the microbes present on each surface sampled. We compared the microbes found on the ISS swabs to those from both homes on Earth and data from the Human Microbiome Project. While significantly different from homes on Earth and the Human Microbiome Project samples analyzed here, the microbial community composition on the ISS was more similar to home surfaces than to the human microbiome samples. The ISS surfaces are species-rich with 1,036-4,294 operational taxonomic units (OTUs per sample). There was no discernible biogeography of microbes on the 15 ISS surfaces, although this may be a reflection of the small sample size we were able to obtain.

  13. The Fiber Optic Subsystem Components on Express Logistics Carrier for International Space Station

    NASA Technical Reports Server (NTRS)

    Ott, Melanie N.; Switzer, Robert; Thomes, William Joe; Chuska, Richard; LaRocca, Frank; Day, Lance

    2009-01-01

    ISS SSP 50184 HRDL optical fiber communication subsystem, has system level requirements that were changed to accommodate large loss optical fiber links previously installed. SSQ22680 design is difficult to implement, no metal shell over socket/pin combination to protect the weak part of the pin. Additions to ISS are planned for the future. AVIM still used for interconnection in space flight applications without incident. Thermal cycling resulted in less than 0.25 dB max change in Insertion Loss for all types during cycling, nominal as compared to the AVIM. Vibration testing results conclusion; no significant changes, nominal as compared to AVIM.

  14. Solid-State Lighting Module (SSLM)

    NASA Technical Reports Server (NTRS)

    2008-01-01

    The project's goal was to build a light-emitting-diode (LED)-based light fixture that is identical in fit, form, and function to the existing International Space Station (ISS) General Luminaire Assembly (GLA) light fixture and fly it on the ISS in early FY 2008 as a Station Detailed Test Objective (SDTO). Our design offers the following strengths: proven component hardware: Our design uses components flown in other KSC-developed hardware; heat path thermal pad: LED array heat is transferred from the circuit board by silicon pad, negating the need for a cooling fan; variable colorimetry: The output light color can be changed by inserting different LED combinations.

  15. Templated sequence insertion polymorphisms in the human genome

    NASA Astrophysics Data System (ADS)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  16. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature.

    PubMed

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-03-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3-15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS.

  17. SHOX gene and conserved noncoding element deletions/duplications in Colombian patients with idiopathic short stature

    PubMed Central

    Sandoval, Gloria Tatiana Vinasco; Jaimes, Giovanna Carola; Barrios, Mauricio Coll; Cespedes, Camila; Velasco, Harvy Mauricio

    2014-01-01

    SHOX gene mutations or haploinsufficiency cause a wide range of phenotypes such as Leri Weill dyschondrosteosis (LWD), Turner syndrome, and disproportionate short stature (DSS). However, this gene has also been found to be mutated in cases of idiopathic short stature (ISS) with a 3–15% frequency. In this study, the multiplex ligation-dependent probe amplification (MLPA) technique was employed to determine the frequency of SHOX gene mutations and their conserved noncoding elements (CNE) in Colombian patients with ISS. Patients were referred from different centers around the county. From a sample of 62 patients, 8.1% deletions and insertions in the intragenic regions and in the CNE were found. This result is similar to others published in other countries. Moreover, an isolated case of CNE 9 duplication and a new intron 6b deletion in another patient, associated with ISS, are described. This is one of the first studies of a Latin American population in which deletions/duplications of the SHOX gene and its CNE are examined in patients with ISS. PMID:24689071

  18. Landscape of Insertion Polymorphisms in the Human Genome

    PubMed Central

    Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

    2015-01-01

    Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

  19. Gift from statistical learning: Visual statistical learning enhances memory for sequence elements and impairs memory for items that disrupt regularities.

    PubMed

    Otsuka, Sachio; Saiki, Jun

    2016-02-01

    Prior studies have shown that visual statistical learning (VSL) enhances familiarity (a type of memory) of sequences. How do statistical regularities influence the processing of each triplet element and inserted distractors that disrupt the regularity? Given that increased attention to triplets induced by VSL and inhibition of unattended triplets, we predicted that VSL would promote memory for each triplet constituent, and degrade memory for inserted stimuli. Across the first two experiments, we found that objects from structured sequences were more likely to be remembered than objects from random sequences, and that letters (Experiment 1) or objects (Experiment 2) inserted into structured sequences were less likely to be remembered than those inserted into random sequences. In the subsequent two experiments, we examined an alternative account for our results, whereby the difference in memory for inserted items between structured and random conditions is due to individuation of items within random sequences. Our findings replicated even when control letters (Experiment 3A) or objects (Experiment 3B) were presented before or after, rather than inserted into, random sequences. Our findings suggest that statistical learning enhances memory for each item in a regular set and impairs memory for items that disrupt the regularity. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Characterization of GM events by insert knowledge adapted re-sequencing approaches

    PubMed Central

    Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

    2013-01-01

    Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events. PMID:24088728

  1. Characterization of GM events by insert knowledge adapted re-sequencing approaches.

    PubMed

    Yang, Litao; Wang, Congmao; Holst-Jensen, Arne; Morisset, Dany; Lin, Yongjun; Zhang, Dabing

    2013-10-03

    Detection methods and data from molecular characterization of genetically modified (GM) events are needed by stakeholders of public risk assessors and regulators. Generally, the molecular characteristics of GM events are incomprehensively revealed by current approaches and biased towards detecting transformation vector derived sequences. GM events are classified based on available knowledge of the sequences of vectors and inserts (insert knowledge). Herein we present three insert knowledge-adapted approaches for characterization GM events (TT51-1 and T1c-19 rice as examples) based on paired-end re-sequencing with the advantages of comprehensiveness, accuracy, and automation. The comprehensive molecular characteristics of two rice events were revealed with additional unintended insertions comparing with the results from PCR and Southern blotting. Comprehensive transgene characterization of TT51-1 and T1c-19 is shown to be independent of a priori knowledge of the insert and vector sequences employing the developed approaches. This provides an opportunity to identify and characterize also unknown GM events.

  2. Repair of DNA double-strand breaks by templated nucleotide sequence insertions derived from distant regions of the genome.

    PubMed

    Onozawa, Masahiro; Zhang, Zhenhua; Kim, Yoo Jung; Goldberg, Liat; Varga, Tamas; Bergsagel, P Leif; Kuehl, W Michael; Aplan, Peter D

    2014-05-27

    We used the I-SceI endonuclease to produce DNA double-strand breaks (DSBs) and observed that a fraction of these DSBs were repaired by insertion of sequences, which we termed "templated sequence insertions" (TSIs), derived from distant regions of the genome. These TSIs were derived from genic, retrotransposon, or telomere sequences and were not deleted from the donor site in the genome, leading to the hypothesis that they were derived from reverse-transcribed RNA. Cotransfection of RNA and an I-SceI expression vector demonstrated insertion of RNA-derived sequences at the DNA-DSB site, and TSIs were suppressed by reverse-transcriptase inhibitors. Both observations support the hypothesis that TSIs were derived from RNA templates. In addition, similar insertions were detected at sites of DNA DSBs induced by transcription activator-like effector nuclease proteins. Whole-genome sequencing of myeloma cell lines revealed additional TSIs, demonstrating that repair of DNA DSBs via insertion was not restricted to experimentally produced DNA DSBs. Analysis of publicly available databases revealed that many of these TSIs are polymorphic in the human genome. Taken together, these results indicate that insertional events should be considered as alternatives to gross chromosomal rearrangements in the interpretation of whole-genome sequence data and that this mutagenic form of DNA repair may play a role in genetic disease, exon shuffling, and mammalian evolution.

  3. Experimental single-strain mobilomics reveals events that shape pathogen emergence.

    PubMed

    Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P

    2016-08-19

    Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Complexity of resistance mechanisms to imipenem in intensive care unit strains of Pseudomonas aeruginosa.

    PubMed

    Fournier, Damien; Richardot, Charlotte; Müller, Emeline; Robert-Nicoud, Marjorie; Llanes, Catherine; Plésiat, Patrick; Jeannot, Katy

    2013-08-01

    Pseudomonas aeruginosa can become resistant to carbapenems by both intrinsic (mutation-driven) and transferable (β-lactamase-based) mechanisms. Knowledge of the prevalence of these various mechanisms is important in intensive care units (ICUs) in order to define optimal prevention and therapeutic strategies. A total of 109 imipenem-non-susceptible (MIC >4 mg/L) strains of P. aeruginosa were collected in June 2010 from the ICUs of 26 French public hospitals. Their resistance mechanisms were characterized by phenotypic, enzymatic, western blotting and molecular methods. Single or associated imipenem resistance mechanisms were identified among the 109 strains. Seven isolates (6.4%) were found to produce a metallo-β-lactamase (one VIM-1, four VIM-2, one VIM-4 and one IMP-29). Porin OprD was lost in 94 (86.2%) strains as a result of mutations or gene disruption by various insertion sequences (ISPa1635, ISPa1328, IS911, ISPs1, IS51, IS222 and ISPa41). Thirteen other strains were shown to be regulatory mutants in which down-regulation of oprD was coupled with overexpressed efflux pumps CzcCBA (n = 1), MexXY (n = 9) and MexEF-OprN (n = 3). The lack of OprD was due to disruption of the oprD promoter by ISPsy2 in one strain and alteration of the porin signal sequence in another. Imipenem resistance in ICU P. aeruginosa strains may result from multiple mechanisms involving metallo-β-lactamase gene acquisition and genetic events (mutations and ISs) inactivating oprD, turning down its expression while increasing efflux activities or preventing insertion of porin OprD in the outer membrane. This diversity of mechanisms allows P. aeruginosa, more than any other nosocomial pathogen, to rapidly adapt to carbapenems in ICUs.

  5. Prediction of the translocon-mediated membrane insertion free energies of protein sequences.

    PubMed

    Park, Yungki; Helms, Volkhard

    2008-05-15

    Helical membrane proteins (HMPs) play crucial roles in a variety of cellular processes. Unlike water-soluble proteins, HMPs need not only to fold but also get inserted into the membrane to be fully functional. This process of membrane insertion is mediated by the translocon complex. Thus, it is of great interest to develop computational methods for predicting the translocon-mediated membrane insertion free energies of protein sequences. We have developed Membrane Insertion (MINS), a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark test gives a correlation coefficient of 0.74 between predicted and observed free energies for 357 known cases, which corresponds to a mean unsigned error of 0.41 kcal/mol. These results are significantly better than those obtained by traditional hydropathy analysis. Moreover, the ability of MINS to reasonably predict membrane insertion free energies of protein sequences allows for effective identification of transmembrane (TM) segments. Subsequently, MINS was applied to predict the membrane insertion free energies of 316 TM segments found in known structures. An in-depth analysis of the predicted free energies reveals a number of interesting findings about the biogenesis and structural stability of HMPs. A web server for MINS is available at http://service.bioinformatik.uni-saarland.de/mins

  6. International Space Station (ISS) Environmental Control and Life Support System Status: 2003-2004

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Gentry, Gregory

    2004-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between April 2003 and March 2004. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence. Work continued on the Phase 3 pressurized elements and the continued manufacturing and testing of the regenerative ECLS equipment.

  7. International Space Station Environmental Control and Life Support System Status: 2009 - 2010

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Dake, Jason R.; Gentry, Gregory J.

    2010-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non -regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between March 2009 and February 2010. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence and an increase of the ISS crew size from three to six. Work continues on the last of the Phase 3 pressurized elements.

  8. International Space Station Environmental Control and Life Support System Status: 2009 - 2010

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Dake, Jason R.; Gentry, Gregory J.

    2009-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between March 2009 and February 2010. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence and an increase of the ISS crew size from three to six. Work continues on the last of the Phase 3 pressurized elements.

  9. Development of Sub-optimal Airway Protocols for the International Space Station (ISS) by the Medical Operation Support Team (MOST)

    NASA Technical Reports Server (NTRS)

    Polk, James D.; Parazynski, Scott; Kelly, Scott; Hurst, Victor, IV; Doerr, Harold K.

    2007-01-01

    Airway management techniques are necessary to establish and maintain a patent airway while treating a patient undergoing respiratory distress. There are situations where such settings are suboptimal, thus causing the caregiver to adapt to these suboptimal conditions. Such occurrences are no exception aboard the International Space Station (ISS). As a result, the NASA flight surgeon (FS) and NASA astronaut cohorts must be ready to adapt their optimal airway management techniques for suboptimal situations. Based on previous work conducted by the Medical Operation Support Team (MOST) and other investigators, the MOST had members of both the FS and astronaut cohorts evaluate two oral airway insertion techniques for the Intubating Laryngeal Mask Airway (ILMA) to determine whether either technique is sufficient to perform in suboptimal conditions within a microgravity environment. Methods All experiments were conducted in a simulated microgravity environment provided by parabolic flight aboard DC-9 aircraft. Each participant acted as a caregiver and was directed to attempt both suboptimal ILMA insertion techniques following a preflight instruction session on the day of the flight and a demonstration of the technique by an anesthesiologist physician in the simulated microgravity environment aboard the aircraft. Results Fourteen participants conducted 46 trials of the suboptimal ILMA insertion techniques. Overall, 43 of 46 trials (94%) conducted were properly performed based on criteria developed by the MOST and other investigators. Discussion The study demonstrated the use of airway management techniques in suboptimal conditions relating to space flight. Use of these techniques will provide a crew with options for using the ILMA to manage airway issues aboard the ISS. Although it is understood that the optimal method for patient care during space flight is to have both patient and caregiver restrained, these techniques provide a needed backup should conditions not present themselves in an ideal manner.

  10. Encapsulating Immunostimulatory CpG Oligonucleotides in Listeriolysin O-Liposomes Promotes a Th1-Type Response and CTL Activity

    PubMed Central

    Andrews, Chasity D.; Huh, Myung-Sook; Patton, Kathryn; Higgins, Debbie; Van Nest, Gary; Ott, Gary; Lee, Kyung-Dall

    2013-01-01

    Immunostimulatory sequences (ISS) are short DNA sequences containing unmethylated CpG dimers that have multiple effects on the host immune system, including the ability to stimulate antigen-specific cytotoxic T lymphocytes (CTLs) and drive Th1-type immune responses. Listeriolysin O (LLO)-containing pH-sensitive liposomes have been shown to efficiently deliver macromolecules to the cytosol of APCs and efficiently stimulate CTLs. We hypothesized that encapsulating ISS-oligodeoxyribonucleotides (ODNs) in this delivery system would enhance the cell-mediated immune response and skew Th1-type responses in protein antigen-based vaccination utilizing LLO-liposomes. In vitro studies indicated that co-encapsulation of ISS in LLO-liposomes engendered activation of the NF-κB pathway while maintaining the efficient cytosolic delivery of antigen mediated by the co-encapsulated LLO. Antigen-specific CTL responses monitored by using the model antigen ovalbumin (OVA) in mice were enhanced when mice were immunized with OVA and ISS-ODN-containing LLO-liposomes compared with those immunized with either OVA-containing LLO-liposomes or OVA-ISS conjugates. The enhanced immune responses were of the Th1-type as monitored by the robust OVA-specific IgG2a induction and the OVA CD8 peptide-stimulated IFN-γ secretion. Our study suggests that including ISS-ODN in LLO-containing pH-sensitive liposomes yields a vaccine delivery system that enhances the cell-mediated immune response and skews this response toward the Th1-type. PMID:22376145

  11. MDCA Needle 1 Replacement

    NASA Image and Video Library

    2013-04-22

    ISS035-E-025557(22 April 2013) ---Multi-user Droplet Combustion Apparatus (MDCA) Hardware Replacement: Cassidy accessed the Combustion Integration Rack (CIR) Combustion Chamber and removed the MDCA Chamber Insert Assembly (CIA). He then replaced the MDCA Needle 1 due to a fuel line that was damaged during previous activities when the MDCA CIA was being removed from the Combustion Chamber.

  12. Retrotransposon Capture Sequencing (RC-Seq): A Targeted, High-Throughput Approach to Resolve Somatic L1 Retrotransposition in Humans.

    PubMed

    Sanchez-Luque, Francisco J; Richardson, Sandra R; Faulkner, Geoffrey J

    2016-01-01

    Mobile genetic elements (MGEs) are of critical importance in genomics and developmental biology. Polymorphic and somatic MGE insertions have the potential to impact the phenotype of an individual, depending on their genomic locations and functional consequences. However, the identification of polymorphic and somatic insertions among the plethora of copies residing in the genome presents a formidable technical challenge. Whole genome sequencing has the potential to address this problem; however, its efficacy depends on the abundance of cells carrying the new insertion. Robust detection of somatic insertions present in only a subset of cells within a given sample can also be prohibitively expensive due to a requirement for high sequencing depth. Here, we describe retrotransposon capture sequencing (RC-seq), a sequence capture approach in which Illumina libraries are enriched for fragments containing the 5' and 3' termini of specific MGEs. RC-seq allows the detection of known polymorphic insertions present in an individual, as well as the identification of rare or private germline insertions not previously described. Furthermore, RC-seq can be used to detect and characterize somatic insertions, providing a valuable tool to elucidate the extent and characteristics of MGE activity in healthy tissues and in various disease states.

  13. iss048e042023

    NASA Image and Video Library

    2016-07-20

    ISS048e042023 (07/20/2016) --- The SpaceX Dragon spacecraft arrives at the International Space Station with nearly 5,000 pounds of cargo. Instruments to perform the first-ever DNA sequencing in space, and the first international docking adapter for commercial crew spacecraft, are among the cargo of the SpaceX Commercial Resupply Services-9 (CRS-9) mission.

  14. Supercritical Water Mixture (SCWM) Experiment

    NASA Technical Reports Server (NTRS)

    Hicks, Michael C.; Hegde, Uday G.

    2012-01-01

    The subject presentation, entitled, Supercritical Water Mixture (SCWM) Experiment, was presented at the International Space Station (ISS) Increment 33/34 Science Symposium. This presentation provides an overview of an international collaboration between NASA and CNES to study the behavior of a dilute aqueous solution of Na2SO4 (5% w) at near-critical conditions. The Supercritical Water Mixture (SCWM) investigation, serves as important precursor work for subsequent Supercritical Water Oxidation (SCWO) experiments. The SCWM investigation will be performed in DECLICs High Temperature Insert (HTI) for the purpose of studying critical fluid phenomena at high temperatures and pressures. The HTI includes a completely sealed and integrated test cell (i.e., Sample Cell Unit SCU) that will contain approximately 0.3 ml of the aqueous test solution. During the sequence of tests, scheduled to be performed in FY13, temperatures and pressures will be elevated to critical conditions (i.e., Tc = 374C and Pc = 22 MPa) in order to observe salt precipitation, precipitate agglomeration and precipitate transport in the presence of a temperature gradient without the influences of gravitational forces. This presentation provides an overview of the motivation for this work, a description of the DECLIC HTI hardware, the proposed test sequences, and a brief discussion of the scientific research objectives.

  15. Re-sequencing transgenic plants revealed rearrangements at T-DNA inserts, and integration of a short T-DNA fragment, but no increase of small mutations elsewhere.

    PubMed

    Schouten, Henk J; Vande Geest, Henri; Papadimitriou, Sofia; Bemer, Marian; Schaart, Jan G; Smulders, Marinus J M; Perez, Gabino Sanchez; Schijlen, Elio

    2017-03-01

    Transformation resulted in deletions and translocations at T-DNA inserts, but not in genome-wide small mutations. A tiny T-DNA splinter was detected that probably would remain undetected by conventional techniques. We investigated to which extent Agrobacterium tumefaciens-mediated transformation is mutagenic, on top of inserting T-DNA. To prevent mutations due to in vitro propagation, we applied floral dip transformation of Arabidopsis thaliana. We re-sequenced the genomes of five primary transformants, and compared these to genomic sequences derived from a pool of four wild-type plants. By genome-wide comparisons, we identified ten small mutations in the genomes of the five transgenic plants, not correlated to the positions or number of T-DNA inserts. This mutation frequency is within the range of spontaneous mutations occurring during seed propagation in A. thaliana, as determined earlier. In addition, we detected small as well as large deletions specifically at the T-DNA insert sites. Furthermore, we detected partial T-DNA inserts, one of these a tiny 50-bp fragment originating from a central part of the T-DNA construct used, inserted into the plant genome without flanking other T-DNA. Because of its small size, we named this fragment a T-DNA splinter. As far as we know this is the first report of such a small T-DNA fragment insert in absence of any T-DNA border sequence. Finally, we found evidence for translocations from other chromosomes, flanking T-DNA inserts. In this study, we showed that next-generation sequencing (NGS) is a highly sensitive approach to detect T-DNA inserts in transgenic plants.

  16. Resilient microorganisms in dust samples of the International Space Station-survival of the adaptation specialists.

    PubMed

    Mora, Maximilian; Perras, Alexandra; Alekhova, Tatiana A; Wink, Lisa; Krause, Robert; Aleksandrova, Alina; Novozhilova, Tatiana; Moissl-Eichinger, Christine

    2016-12-20

    The International Space Station (ISS) represents a unique biotope for the human crew but also for introduced microorganisms. Microbes experience selective pressures such as microgravity, desiccation, poor nutrient-availability due to cleaning, and an increased radiation level. We hypothesized that the microbial community inside the ISS is modified by adapting to these stresses. For this reason, we analyzed 8-12 years old dust samples from Russian ISS modules with major focus on the long-time surviving portion of the microbial community. We consequently assessed the cultivable microbiota of these samples in order to analyze their extremotolerant potential against desiccation, heat-shock, and clinically relevant antibiotics. In addition, we studied the bacterial and archaeal communities from the stored Russian dust samples via molecular methods (next-generation sequencing, NGS) and compared our new data with previously derived information from the US American ISS dust microbiome. We cultivated and identified in total 85 bacterial, non-pathogenic isolates (17 different species) and 1 fungal isolate from the 8-12 year old dust samples collected in the Russian segment of the ISS. Most of these isolates exhibited robust resistance against heat-shock and clinically relevant antibiotics. Microbial 16S rRNA gene and archaeal 16S rRNA gene targeting Next Generation Sequencing showed signatures of human-associated microorganisms (Corynebacterium, Staphylococcus, Coprococcus etc.), but also specifically adapted extremotolerant microorganisms. Besides bacteria, the detection of archaeal signatures in higher abundance was striking. Our findings reveal (i) the occurrence of living, hardy microorganisms in archived Russian ISS dust samples, (ii) a profound resistance capacity of ISS microorganisms against environmental stresses, and (iii) the presence of archaeal signatures on board. In addition, we found indications that the microbial community in the Russian segment dust samples was different to recently reported US American ISS microbiota.

  17. Using PATIMDB to Create Bacterial Transposon Insertion Mutant Libraries

    PubMed Central

    Urbach, Jonathan M.; Wei, Tao; Liberati, Nicole; Grenfell-Lee, Daniel; Villanueva, Jacinto; Wu, Gang; Ausubel, Frederick M.

    2015-01-01

    PATIMDB is a software package for facilitating the generation of transposon mutant insertion libraries. The software has two main functions: process tracking and automated sequence analysis. The process tracking function specifically includes recording the status and fates of multiwell plates and samples in various stages of library construction. Automated sequence analysis refers specifically to the pipeline of sequence analysis starting with ABI files from a sequencing facility and ending with insertion location identifications. The protocols in this unit describe installation and use of PATIMDB software. PMID:19343706

  18. Screening of SHOX gene sequence variants in Saudi Arabian children with idiopathic short stature.

    PubMed

    Alharthi, Abdulla A; El-Hallous, Ehab I; Talaat, Iman M; Alghamdi, Hamed A; Almalki, Matar I; Gaber, Ahmed

    2017-10-01

    Short stature affects approximately 2%-3% of children, representing one of the most frequent disorders for which clinical attention is sought during childhood. Despite assumed genetic heterogeneity, mutations or deletions in the short stature homeobox-containing gene ( SHOX ) are frequently detected in subjects with short stature. Idiopathic short stature (ISS) refers to patients with short stature for various unknown reasons. The goal of this study was to screen all the exons of SHOX to identify related mutations. We screened all the exons of SHOX for mutations analysis in 105 ISS children patients (57 girls and 48 boys) living in Taif governorate, KSA using a direct DNA sequencing method. Height, arm span, and sitting height were recorded, and subischial leg length was calculated. A total of 30 of 105 ISS patients (28%) contained six polymorphic variants in exons 1, 2, 4, and 6. One mutation was found in the DNA domain binding region of exon 4. Three of these polymorphic variants were novel, while the others were reported previously. There were no significant differences in anthropometric measures in ISS patients with and without identifiable polymorphic variants in SHOX . In Saudi Arabia ISS patients, rather than SHOX , it is possible that new genes are involved in longitudinal growth. Additional molecular analysis is required to diagnose and understand the etiology of this disease.

  19. Enhancing the GABI-Kat Arabidopsis thaliana T-DNA Insertion Mutant Database by Incorporating Araport11 Annotation.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Weisshaar, Bernd

    2017-01-01

    SimpleSearch provides access to a database containing information about T-DNA insertion lines of the GABI-Kat collection of Arabidopsis thaliana mutants. These mutants are an important tool for reverse genetics, and GABI-Kat is the second largest collection of such T-DNA insertion mutants. Insertion sites were deduced from flanking sequence tags (FSTs), and the database contains information about mutant plant lines as well as insertion alleles. Here, we describe improvements within the interface (available at http://www.gabi-kat.de/db/genehits.php) and with regard to the database content that have been realized in the last five years. These improvements include the integration of the Araport11 genome sequence annotation data containing the recently updated A. thaliana structural gene descriptions, an updated visualization component that displays groups of insertions with very similar insertion positions, mapped confirmation sequences, and primers. The visualization component provides a quick way to identify insertions of interest, and access to improved data about the exact structure of confirmed insertion alleles. In addition, the database content has been extended by incorporating additional insertion alleles that were detected during the confirmation process, as well as by adding new FSTs that have been produced during continued efforts to complement gaps in FST availability. Finally, the current database content regarding predicted and confirmed insertion alleles as well as primer sequences has been made available as downloadable flat files. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.

  20. “Agrolistic” transformation of plant cells: Integration of T-strands generated in planta

    PubMed Central

    Hansen, Geneviève; Chilton, Mary-Dell

    1996-01-01

    We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167

  1. Unberthed HTV-5 grappled by SSRMS

    NASA Image and Video Library

    2015-09-28

    The unberthed Kounotori H-II Transfer Vehicle 5 (HTV-5) is grappled by the Canadarm2 Space Station Remote Manipulator System (SSRMS) prior to its release for reentry. This image is part of a time lapse sequence (iss045e125963 through iss045e126960) taken at a rate of 12 frames per minute. Image was released by astronaut on social media.

  2. Evolution of the iss gene in Escherichia coli.

    PubMed

    Johnson, Timothy J; Wannemuehler, Yvonne M; Nolan, Lisa K

    2008-04-01

    The increased serum survival gene iss has long been recognized for its role in extraintestinal pathogenic Escherichia coli (ExPEC) virulence. iss has been identified as a distinguishing trait of avian ExPEC but not of human ExPEC. This gene has been localized to large virulence plasmids and shares strong similarities with the bor gene from bacteriophage lambda. Here, we demonstrate that three alleles of iss occur among E. coli isolates that appear to have evolved from a common lambda bor precursor. In addition to the occurrence of iss on the ColV/BM virulence plasmids, at least two iss alleles occur within the E. coli chromosome. One of these alleles (designated type 3) was found to occur in the genomes of all currently sequenced ExPEC strains on a similar prophage element that also harbors the Sit iron and manganese transport system. When the prevalence of the three iss types was examined among 487 E. coli isolates, the iss type 3 gene was found to occur at a high frequency among ExPEC isolates, irrespective of the host source. The plasmid-borne iss allele (designated type 1) was highly prevalent among avian pathogenic E. coli and neonatal meningitis-associated E. coli isolates but not among uropathogenic E. coli isolates. This study demonstrates the evolution of iss in E. coli and provides an additional tool for discriminating among E. coli pathotypes through the differentiation of the three iss allele types and bor.

  3. Sequencing the Unknown

    NASA Image and Video Library

    2017-12-19

    Being able to identify microbes in real time aboard the International Space Station, without having to send them back to Earth for identification first, would be revolutionary for the world of microbiology and space exploration, and the Genes in Space-3 team turned that possibility into a reality this year when it completed the first-ever sample-to-sequence process entirely aboard the space station. This advance could aid in the ability to diagnose and treat astronaut ailments in real time, as well as assisting in the identification of DNA-based life on other planets. It could also benefit other experiments aboard the orbiting laboratory. HD Download: https://archive.org/details/jsc2017m001160_Sequencing_the_Unknown _______________________________________ FOLLOW THE SPACE STATION! Twitter: https://twitter.com/Space_Station Facebook: https://www.facebook.com/ISS Instagram: https://instagram.com/iss/

  4. A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

    NASA Astrophysics Data System (ADS)

    Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

    2017-05-01

    MR-guided high-dose-rate (HDR) brachytherapy has gained increasing interest as a treatment for patients with localized prostate cancer because of the superior value of MRI for tumor and surrounding tissues localization. To enable needle insertion into the prostate with the patient in the MR bore, a single needle MR-compatible robotic system involving needle-by-needle dose delivery has been developed at our institution. Throughout the intervention, dose delivery may be impaired by: (1) sub-optimal needle positioning caused by e.g. needle bending, (2) intra-operative internal organ motion such as prostate rotations or swelling, or intra-procedural rectum or bladder filling. This may result in failure to reach clinical constraints. To assess the first aforementioned challenge, a recent study from our research group demonstrated that the deposited dose may be greatly improved by real-time adaptive planning with feedback on the actual needle positioning. However, the needle insertion sequence is left to the doctor and therefore, this may result in sub-optimal dose delivery. In this manuscript, a new method is proposed to determine and update automatically the needle insertion sequence. This strategy is based on the determination of the most sensitive needle track. The sensitivity of a needle track is defined as its impact on the dose distribution in case of sub-optimal positioning. A stochastic criterion is thus presented to determine each needle track sensitivity based on needle insertion simulations. To assess the proposed sequencing strategy, HDR prostate brachytherapy was simulated on 11 patients with varying number of needle insertions. Sub-optimal needle positioning was simulated at each insertion (modeled by typical random angulation errors). In 91% of the scenarios, the dose distribution improved when the needle was inserted into the most compared to the least sensitive needle track. The computation time for sequencing was less than 6 s per needle track. The proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

  5. A Comprehensive Analysis of In Vitro and In Vivo Genetic Fitness of Pseudomonas aeruginosa Using High-Throughput Sequencing of Transposon Libraries

    PubMed Central

    Aschard, Hugues; Cattoir, Vincent; Yoder-Himes, Deborah; Lory, Stephen; Pier, Gerald B.

    2013-01-01

    High-throughput sequencing of transposon (Tn) libraries created within entire genomes identifies and quantifies the contribution of individual genes and operons to the fitness of organisms in different environments. We used insertion-sequencing (INSeq) to analyze the contribution to fitness of all non-essential genes in the chromosome of Pseudomonas aeruginosa strain PA14 based on a library of ∼300,000 individual Tn insertions. In vitro growth in LB provided a baseline for comparison with the survival of the Tn insertion strains following 6 days of colonization of the murine gastrointestinal tract as well as a comparison with Tn-inserts subsequently able to systemically disseminate to the spleen following induction of neutropenia. Sequencing was performed following DNA extraction from the recovered bacteria, digestion with the MmeI restriction enzyme that hydrolyzes DNA 16 bp away from the end of the Tn insert, and fractionation into oligonucleotides of 1,200–1,500 bp that were prepared for high-throughput sequencing. Changes in frequency of Tn inserts into the P. aeruginosa genome were used to quantify in vivo fitness resulting from loss of a gene. 636 genes had <10 sequencing reads in LB, thus defined as unable to grow in this medium. During in vivo infection there were major losses of strains with Tn inserts in almost all known virulence factors, as well as respiration, energy utilization, ion pumps, nutritional genes and prophages. Many new candidates for virulence factors were also identified. There were consistent changes in the recovery of Tn inserts in genes within most operons and Tn insertions into some genes enhanced in vivo fitness. Strikingly, 90% of the non-essential genes were required for in vivo survival following systemic dissemination during neutropenia. These experiments resulted in the identification of the P. aeruginosa strain PA14 genes necessary for optimal survival in the mucosal and systemic environments of a mammalian host. PMID:24039572

  6. Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

    PubMed Central

    Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

  7. Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

    PubMed

    Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

    2012-01-01

    We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

  8. Effects of a Transposable Element Insertion on Alcohol Dehydrogenase Expression in Drosophila Melanogaster

    PubMed Central

    Dunn, R. C.; Laurie, C. C.

    1995-01-01

    Variation in the DNA sequence and level of alcohol dehydrogenase (Adh) gene expression in Drosophila melanogaster have been studied to determine what types of DNA polymorphisms contribute to phenotypic variation in natural populations. The Adh gene, like many others, shows a high level of variability in both DNA sequence and quantitative level of expression. A number of transposable element insertions occur in the Adh region and one of these, a copia insertion in the 5' flanking region, is associated with unusually low Adh expression. To determine whether this insertion (called RI42) causes the low expression level, the insertion was excised from the cloned RI42 Adh gene and the effect was assessed by P-element transformation. Removal of this insertion causes a threefold increase in the level of ADH, clearly showing that it contributes to the naturally occurring variation in expression at this locus. Removal of all but one LTR also causes a threefold increase, indicating that the mechanism is not a simple sequence disruption. Furthermore, this copia insertion, which is located between the two Adh promoters and their upstream enhancer sequences, has differential effects on the levels of proximal and distal transcripts. Finally, a test for the possible modifying effects of two suppressor loci, su(w(a)) and su(f), on this insertional mutation was negative, in contrast to a previous report in the literature. PMID:7498745

  9. Identifying transposon insertions and their effects from RNA-sequencing data.

    PubMed

    de Ruiter, Julian R; Kas, Sjors M; Schut, Eva; Adams, David J; Koudijs, Marco J; Wessels, Lodewyk F A; Jonkers, Jos

    2017-07-07

    Insertional mutagenesis using engineered transposons is a potent forward genetic screening technique used to identify cancer genes in mouse model systems. In the analysis of these screens, transposon insertion sites are typically identified by targeted DNA-sequencing and subsequently assigned to predicted target genes using heuristics. As such, these approaches provide no direct evidence that insertions actually affect their predicted targets or how transcripts of these genes are affected. To address this, we developed IM-Fusion, an approach that identifies insertion sites from gene-transposon fusions in standard single- and paired-end RNA-sequencing data. We demonstrate IM-Fusion on two separate transposon screens of 123 mammary tumors and 20 B-cell acute lymphoblastic leukemias, respectively. We show that IM-Fusion accurately identifies transposon insertions and their true target genes. Furthermore, by combining the identified insertion sites with expression quantification, we show that we can determine the effect of a transposon insertion on its target gene(s) and prioritize insertions that have a significant effect on expression. We expect that IM-Fusion will significantly enhance the accuracy of cancer gene discovery in forward genetic screens and provide initial insight into the biological effects of insertions on candidate cancer genes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Evolutionary force of AT-rich repeats to trap genomic and episomal DNAs into the rice genome: lessons from endogenous pararetrovirus.

    PubMed

    Liu, Ruifang; Koyanagi, Kanako O; Chen, Sunlu; Kishima, Yuji

    2012-12-01

    In plant genomes, the incorporation of DNA segments is not a common method of artificial gene transfer. Nevertheless, various segments of pararetroviruses have been found in plant genomes in recent decades. The rice genome contains a number of segments of endogenous rice tungro bacilliform virus-like sequences (ERTBVs), many of which are present between AT dinucleotide repeats (ATrs). Comparison of genomic sequences between two closely related rice subspecies, japonica and indica, allowed us to verify the preferential insertion of ERTBVs into ATrs. In addition to ERTBVs, the comparative analyses showed that ATrs occasionally incorporate repeat sequences including transposable elements, and a wide range of other sequences. Besides the known genomic sequences, the insertion sequences also represented DNAs of unclear origins together with ERTBVs, suggesting that ATrs have integrated episomal DNAs that would have been suspended in the nucleus. Such insertion DNAs might be trapped by ATrs in the genome in a host-dependent manner. Conversely, other simple mono- and dinucleotide sequence repeats (SSR) were less frequently involved in insertion events relative to ATrs. Therefore, ATrs could be regarded as hot spots of double-strand breaks that induce non-homologous end joining. The insertions within ATrs occasionally generated new gene-related sequences or involved structural modifications of existing genes. Likewise, in a comparison between Arabidopsis thaliana and Arabidopsis lyrata, the insertions preferred ATrs to other SSRs. Therefore ATrs in plant genomes could be considered as genomic dumping sites that have trapped various DNA molecules and may have exerted a powerful evolutionary force. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  11. The Genome Sequence of Avibacterium paragallinarum Strain CL Has a Large Repertoire of Insertion Sequence Elements.

    PubMed

    Horta-Valerdi, Guillermo; Sanchez-Alonso, Maria Patricia; Perez-Marquez, Victor M; Negrete-Abascal, Erasmo; Vaca-Pacheco, Sergio; Hernandez-Gonzalez, Ismael; Gomez-Lunar, Zulema; Olmedo-Álvarez, Gabriela; Vázquez-Cruz, Candelario

    2017-04-13

    The draft genome sequence of Avibacterium paragallinarum strain CL serovar C is reported here. The genome comprises 154 contigs corresponding to 2.4 Mb with 41% G+C content and many insertion sequence (IS) elements, a characteristic not previously reported in A. paragallinarum . Copyright © 2017 Horta-Valerdi et al.

  12. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  13. High-Throughput Analysis of T-DNA Location and Structure Using Sequence Capture.

    PubMed

    Inagaki, Soichi; Henry, Isabelle M; Lieberman, Meric C; Comai, Luca

    2015-01-01

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA-genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously, using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. Our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.

  14. Identification of the first recurrent PAR1 deletion in Léri-Weill dyschondrosteosis and idiopathic short stature reveals the presence of a novel SHOX enhancer.

    PubMed

    Benito-Sanz, Sara; Royo, Jose Luis; Barroso, Eva; Paumard-Hernández, Beatriz; Barreda-Bonis, Ana C; Liu, Pengfei; Gracía, Ricardo; Lupski, James R; Campos-Barros, Ángel; Gómez-Skarmeta, José Luis; Heath, Karen Elise

    2012-07-01

    SHOX, located in the pseudoautosomal region 1 (PAR1) of the sexual chromosomes, encodes a transcription factor implicated in human growth. Defects in SHOX or its enhancers have been observed in ∼60% of Leri-Weill dyschondrosteosis (LWD) patients, a skeletal dysplasia characterised by short stature and/or the characteristic Madelung deformity, and in 2-5% of idiopathic short stature (ISS). To identify the molecular defect in the remaining genetically undiagnosed LWD and ISS patients, this study screened previously unanalysed PAR1 regions in 124 LWD and 576 ISS probands. PAR1 screening was undertaken by multiplex ligation dependent probe amplification (MLPA). Copy number alterations were subsequently confirmed and delimited by locus-specific custom-designed MLPA, array comparative genomic hybridisation (CGH) and breakpoint junction PCR/sequencing. A recurrent PAR1 deletion downstream of SHOX spanning 47543 bp with identical breakpoints was identified in 19 LWD (15.3%) and 11 ISS (1.9%) probands, from 30 unrelated families. Eight evolutionarily conserved regions (ECRs 1-8) identified within the deleted sequence were evaluated for SHOX regulatory activity by means of chromosome conformation capture (3C) in chicken embryo limbs and luciferase reporter assays in human U2OS osteosarcoma cells. The 3C assay indicated potential SHOX regulatory activity by ECR1, which was subsequently confirmed to act as a SHOX enhancer, operating in an orientation and position independent manner, in human U2OS cells. This study has identified the first recurrent PAR1 deletion in LWD and ISS, which results in the loss of a previously uncharacterised SHOX enhancer. The loss of this enhancer may decrease SHOX transcription, resulting in LWD or ISS due to SHOX haploinsufficiency.

  15. A new molecular evolution model for limited insertion independent of substitution.

    PubMed

    Lèbre, Sophie; Michel, Christian J

    2013-10-01

    We recently introduced a new molecular evolution model called the IDIS model for Insertion Deletion Independent of Substitution [13,14]. In the IDIS model, the three independent processes of substitution, insertion and deletion of residues have constant rates. In order to control the genome expansion during evolution, we generalize here the IDIS model by introducing an insertion rate which decreases when the sequence grows and tends to 0 for a maximum sequence length nmax. This new model, called LIIS for Limited Insertion Independent of Substitution, defines a matrix differential equation satisfied by a vector P(t) describing the sequence content in each residue at evolution time t. An analytical solution is obtained for any diagonalizable substitution matrix M. Thus, the LIIS model gives an expression of the sequence content vector P(t) in each residue under evolution time t as a function of the eigenvalues and the eigenvectors of matrix M, the residue insertion rate vector R, the total insertion rate r, the initial and maximum sequence lengths n0 and nmax, respectively, and the sequence content vector P(t0) at initial time t0. The derivation of the analytical solution is much more technical, compared to the IDIS model, as it involves Gauss hypergeometric functions. Several propositions of the LIIS model are derived: proof that the IDIS model is a particular case of the LIIS model when the maximum sequence length nmax tends to infinity, fixed point, time scale, time step and time inversion. Using a relation between the sequence length l and the evolution time t, an expression of the LIIS model as a function of the sequence length l=n(t) is obtained. Formulas for 'insertion only', i.e. when the substitution rates are all equal to 0, are derived at evolution time t and sequence length l. Analytical solutions of the LIIS model are explicitly derived, as a function of either evolution time t or sequence length l, for two classical substitution matrices: the 3-parameter symmetric substitution matrix [12] (LIIS-SYM3) and the HKY asymmetric substitution matrix[9] (LIIS-HKY). An evaluation of the LIIS model (precisely, LIIS-HKY) based on four statistical analyses of the GC content in complete genomes of four prokaryotic taxonomic groups, namely Chlamydiae, Crenarchaeota, Spirochaetes and Thermotogae, shows the expected improvement from the theory of the LIIS model compared to the IDIS model. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. Genome characterization of the selected long- and short-sleep mouse lines.

    PubMed

    Dowell, Robin; Odell, Aaron; Richmond, Phillip; Malmer, Daniel; Halper-Stromberg, Eitan; Bennett, Beth; Larson, Colin; Leach, Sonia; Radcliffe, Richard A

    2016-12-01

    The Inbred Long- and Short-Sleep (ILS, ISS) mouse lines were selected for differences in acute ethanol sensitivity using the loss of righting response (LORR) as the selection trait. The lines show an over tenfold difference in LORR and, along with a recombinant inbred panel derived from them (the LXS), have been widely used to dissect the genetic underpinnings of acute ethanol sensitivity. Here we have sequenced the genomes of the ILS and ISS to investigate the DNA variants that contribute to their sensitivity difference. We identified ~2.7 million high-confidence SNPs and small indels and ~7000 structural variants between the lines; variants were found to occur in 6382 annotated genes. Using a hidden Markov model, we were able to reconstruct the genome-wide ancestry patterns of the eight inbred progenitor strains from which the ILS and ISS were derived, and found that quantitative trait loci that have been mapped for LORR were slightly enriched for DNA variants. Finally, by mapping and quantifying RNA-seq reads from the ILS and ISS to their strain-specific genomes rather than to the reference genome, we found a substantial improvement in a differential expression analysis between the lines. This work will help in identifying and characterizing the DNA sequence variants that contribute to the difference in ethanol sensitivity between the ILS and ISS and will also aid in accurate quantification of RNA-seq data generated from the LXS RIs.

  17. Draft Genome Sequences of Two Fusarium oxysporum Isolates Cultured from Infected Zinnia hybrida Plants Grown on the International Space Station

    PubMed Central

    Urbaniak, Camilla; Massa, Gioia; Hummerick, Mary; Khodadad, Christina; Schuerger, Andrew

    2018-01-01

    ABSTRACT Here, we present the whole-genome sequences of two Fusarium oxysporum isolates cultured from infected Zinnia hybrida plants that were grown onboard the International Space Station (ISS). PMID:29773617

  18. Mice Drawer System (MDS): procedures performed on-orbit during experiment phase

    NASA Astrophysics Data System (ADS)

    Ciparelli, Paolo; Falcetti, Giancarlo; Tenconi, Chiara; Pignataro, Salvatore; Cotronei, Vittorio

    Mice Drawer System is a payload that can be integrated inside the Space Shuttle middeck during transportation to/from the ISS, and inside the Express Rack in the ISS during experi-ment execution. It is designed to perform experiment as much automatically as possible; only maintenance activities require procedures involving crew. The first MDS experiment has been performed with Shuttle STS-128, launched in August, 28 2009 at EDT time 23:58 (06:58 Italian time). During the permanence in the Shuttle, MDS was switched on in SURVIVAL mode, cooled by air from rear part of the middeck: this mode allows to supply water and night-and-day cycles to mice in automatic mode, but not food that was supplied ad libitum before launch by a dedicated food bar inserted inside the cage. In this phase, a visual check has been performed every day by crew to verify the well-being of the mice. During the permanence in ISS, MDS was switched on in EXPERIMENT mode, cooled by water from EXPRESS RACK. In this case, MDS experiment was completely automatic: water, food, night-and-day cycles were commanded every day by the payload. Only Maintenance activities to replace consumable items and to fill the potable water reservoir were foreseen and executed by the crew. Food Envelope replacement was foreseen every 19 days, the Waste Filter replacement has been performed every 30 days. Potable Water Reservoir refilling has been performed every 9 days. Nominal activities performed on ISS were also the transfer from Shuttle to ISS and reconfiguration from ascent to on-orbit operation after launch. The reconfiguration from on-orbit to descent and transfer from ISS to Shuttle has been performed before Shuttle undock and landing.

  19. Visual attention distracter insertion for improved EEG rapid serial visual presentation (RSVP) target stimuli detection

    NASA Astrophysics Data System (ADS)

    Khosla, Deepak; Huber, David J.; Martin, Kevin

    2017-05-01

    This paper† describes a technique in which we improve upon the prior performance of the Rapid Serial Visual Presentation (RSVP) EEG paradigm for image classification though the insertion of visual attention distracters and overall sequence reordering based upon the expected ratio of rare to common "events" in the environment and operational context. Inserting distracter images maintains the ratio of common events to rare events at an ideal level, maximizing the rare event detection via P300 EEG response to the RSVP stimuli. The method has two steps: first, we compute the optimal number of distracters needed for an RSVP stimuli based on the desired sequence length and expected number of targets and insert the distracters into the RSVP sequence, and then we reorder the RSVP sequence to maximize P300 detection. We show that by reducing the ratio of target events to nontarget events using this method, we can allow RSVP sequences with more targets without sacrificing area under the ROC curve (azimuth).

  20. Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

    PubMed

    Bashir, Ali; Bansal, Vikas; Bafna, Vineet

    2010-06-18

    Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

  1. International Space Station Environmental Control and Life Support System Status: 2006 - 2007

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Gentry, Gregory J.

    2007-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between March 2006 and February 2007. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence. Work continued on the Phase 3 pressurized elements and the continued manufacturing and testing of the regenerative ECLS equipment.

  2. International Space Station Environmental Control and Life Support System Status: 2008 - 2009

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Gentry, Gregory J.; Gentry, Gregory J.

    2009-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between March 2008 and February 2009. The ISS continued permanent crew operations, with the continuation of Phase 3 of the ISS Assembly Sequence. Work continues on the last of the Phase 3 pressurized elements and the continued manufacturing and testing of the regenerative ECLS equipment.

  3. International Space Station Environmental Control and Life Support System Status: 2005 - 2006

    NASA Technical Reports Server (NTRS)

    Williams, David E.; Gentry, Gregory J.

    2006-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between March 2005 and February 2006. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence. Work continued on the Phase 3 pressurized elements and the continued manufacturing and testing of the regenerative ECLS equipment.

  4. Germ line insertion of mtDNA at the breakpoint junction of a reciprocal constitutional translocation.

    PubMed

    Willett-Brozick, J E; Savul, S A; Richey, L E; Baysal, B E

    2001-08-01

    Constitutional chromosomal translocations are relatively common causes of human morbidity, yet the DNA double-strand break (DSB) repair mechanisms that generate them are incompletely understood. We cloned, sequenced and analyzed the breakpoint junctions of a familial constitutional reciprocal translocation t(9;11)(p24;q23). Within the 10-kb region flanking the breakpoints, chromosome 11 had 25% repeat elements, whereas chromosome 9 had 98% repeats, 95% of which were L1-type LINE elements. The breakpoints occurred within an L1-type repeat element at 9p24 and at the 3'-end of an Alu sequence at 11q23. At the breakpoint junction of derivative chromosome 9, we discovered an unusually large 41-bp insertion, which showed 100% identity to 12S mitochondrial DNA (mtDNA) between nucleotides 896 and 936 of the mtDNA sequence. Analysis of the human genome failed to show the preexistence of the inserted sequence at normal chromosomes 9 and 11 breakpoint junctions or elsewhere in the genome, strongly suggesting that the insertion was derived from human mtDNA and captured into the junction during the DSB repair process. To our knowledge, these findings represent the first observation of spontaneous germ line insertion of modern human mtDNA sequences and suggest that DSB repair may play a role in inter-organellar gene transfer in vivo. Our findings also provide evidence for a previously unrecognized insertional mechanism in human, by which non-mobile extra-chromosomal fragments can be inserted into the genome at DSB repair junctions.

  5. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  6. High-throughput analysis of T-DNA location and structure using sequence capture

    DOE PAGES

    Inagaki, Soichi; Henry, Isabelle M.; Lieberman, Meric C.; ...

    2015-10-07

    Agrobacterium-mediated transformation of plants with T-DNA is used both to introduce transgenes and for mutagenesis. Conventional approaches used to identify the genomic location and the structure of the inserted T-DNA are laborious and high-throughput methods using next-generation sequencing are being developed to address these problems. Here, we present a cost-effective approach that uses sequence capture targeted to the T-DNA borders to select genomic DNA fragments containing T-DNA—genome junctions, followed by Illumina sequencing to determine the location and junction structure of T-DNA insertions. Multiple probes can be mixed so that transgenic lines transformed with different T-DNA types can be processed simultaneously,more » using a simple, index-based pooling approach. We also developed a simple bioinformatic tool to find sequence read pairs that span the junction between the genome and T-DNA or any foreign DNA. We analyzed 29 transgenic lines of Arabidopsis thaliana, each containing inserts from 4 different T-DNA vectors. We determined the location of T-DNA insertions in 22 lines, 4 of which carried multiple insertion sites. Additionally, our analysis uncovered a high frequency of unconventional and complex T-DNA insertions, highlighting the needs for high-throughput methods for T-DNA localization and structural characterization. Transgene insertion events have to be fully characterized prior to use as commercial products. As a result, our method greatly facilitates the first step of this characterization of transgenic plants by providing an efficient screen for the selection of promising lines.« less

  7. Draft Genome Sequences of Two Fusarium oxysporum Isolates Cultured from Infected Zinnia hybrida Plants Grown on the International Space Station.

    PubMed

    Urbaniak, Camilla; Massa, Gioia; Hummerick, Mary; Khodadad, Christina; Schuerger, Andrew; Venkateswaran, Kasthuri

    2018-05-17

    Here, we present the whole-genome sequences of two Fusarium oxysporum isolates cultured from infected Zinnia hybrida plants that were grown onboard the International Space Station (ISS). Copyright © 2018 Urbaniak et al.

  8. A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

    PubMed

    Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

    2017-08-15

    Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

  9. Expedition 21 FE Thirsk installs the new CSI-03

    NASA Image and Video Library

    2009-11-18

    ISS021-E-029873 (18 Nov. 2009) --- Canadian Space Agency astronaut Robert Thirsk, Expedition 21 flight engineer, works with the new Commercial Generic Bioprocessing Apparatus (CGBA) Science Insert 03 (CSI-03) assembly in the Kibo laboratory of the International Space Station. CSI-03 is flying two butterfly habitats during this mission and will examine the complete life cycle of the butterflies as they eat, grow and undergo metamorphosis in space.

  10. Expedition 21 FE Thirsk installs the new CSI-03

    NASA Image and Video Library

    2009-11-18

    ISS021-E-029871 (18 Nov. 2009) --- Canadian Space Agency astronaut Robert Thirsk, Expedition 21 flight engineer, works with the new Commercial Generic Bioprocessing Apparatus (CGBA) Science Insert 03 (CSI-03) assembly in the Kibo laboratory of the International Space Station. CSI-03 is flying two butterfly habitats during this mission and will examine the complete life cycle of the butterflies as they eat, grow and undergo metamorphosis in space.

  11. ISS and Space Environment Interactions in Event of Plasma Contactor Failure

    NASA Technical Reports Server (NTRS)

    Carruth, M. R., Jr.; Munafo, Paul M. (Technical Monitor)

    2000-01-01

    The International Space Station (ISS), illustrated in Figure 1, will be the largest, highest power spacecraft placed in orbit. Because of this the design of the electrical power system diverged markedly from previous systems. The solar arrays will operate at 160 V and the power distribution voltage will be 120 V. The structure is grounded to the negative side of the solar arrays so under the right circumstances it is possible to drive the ISS potential very negative. A plasma contactor has been added to the ISS to provide control of the ISS structure potential relative to the ambient plasma. The ISS requirement is that the ISS structure not be greater than 40 V positive or negative of local plasma. What are the ramifications of operating large structures with such high voltage power systems? The application of a plasma contactor on ISS controls the potential between the structure and the local plasma, preventing degrading effects. It is conceivable that there can be situations where the plasma contactor might be non-functional. This might be due to lack of power, the need to turn it off during some of the build-up sequences, the loss of functionality for both plasma contactors before a replacement can be installed, and similar circumstances. A study was undertaken to understand how important it is to have the contactor functioning and how long it might be off before unacceptable degradation to ISS could occur.

  12. A Year in the Life of International Space Station

    NASA Technical Reports Server (NTRS)

    Uri, John J.

    2006-01-01

    The past twelve months (October 2005 to September 2006) have been among the busiest in the life of the International Space Station (ISS), both in terms of on-orbit operations as well as future planning, for both ISS systems and research. The Expedition 12 and 13 crews completed their missions successfully, carrying out research for Russia, the United States, Europe and Japan, and bringing continuous ISS occupancy to nearly six years. The European Space Agency's (ESA) first Long Duration Mission on ISS is underway, involving significant international research. The Expedition 14 crew completed its training and is embarking on its own 6-month mission with a full slate of international research. Future crews are in training for their respective assembly and research missions. Shuttle flights resumed after a 10-month hiatus, delivering new research facilities and resuming assembly of ISS. ESA's Columbus research module was delivered to the Kennedy Space Center, joining Japan's Kibo research module already there. Following preflight testing, the two modules will launch in 2007 and 2008, respectively, joining Destiny as ISS's research infrastructure. A revised ISS configuration and assembly sequence were endorsed by all the Partners, with a reduced number of Shuttle flights, but for the first time including plans for post-Shuttle ISS operations after 2010. The new plan will pose significant challenges to the ISS research community. As Europe and Japan build their on-orbit research infrastructure, and long-term plans become firmer, the next 12 months should prove to be equally challenging and exciting.

  13. Differential effects of simple repeating DNA sequences on gene expression from the SV40 early promoter.

    PubMed

    Amirhaeri, S; Wohlrab, F; Wells, R D

    1995-02-17

    The influence of simple repeat sequences, cloned into different positions relative to the SV40 early promoter/enhancer, on the transient expression of the chloramphenicol acetyltransferase (CAT) gene was investigated. Insertion of (G)29.(C)29 in either orientation into the 5'-untranslated region of the CAT gene reduced expression in CV-1 cells 50-100 fold when compared with controls with random sequence inserts. Analysis of CAT-specific mRNA levels demonstrated that the effect was due to a reduction of CAT mRNA production rather than to posttranscriptional events. In contrast, insertion of the same insert in either orientation upstream of the promoter-enhancer or downstream of the gene stimulated gene expression 2-3-fold. These effects could be reversed by cotransfection of a competitor plasmid carrying (G)25.(C)25 sequences. The results suggest that a G.C-binding transcription factor modulates gene expression in this system and that promoter strength can be regulated by providing protein-binding sites in trans. Although constructs containing longer tracts of alternating (C-G), (T-G), or (A-T) sequences inhibited CAT expression when inserted in the 5'-untranslated region of the CAT gene, the amount of CAT mRNA was unaffected. Hence, these inhibitions must be due to posttranscriptional events, presumably at the level of translation. These effects of microsatellite sequences on gene expression are discussed with respect to recent data on related simple repeat sequences which cause several human genetic diseases.

  14. Influence of flanking sequences on presentation efficiency of a CD8+ cytotoxic T-cell epitope delivered by parvovirus-like particles.

    PubMed

    Rueda, P; Morón, G; Sarraseca, J; Leclerc, C; Casal, J I

    2004-03-01

    We have previously developed an antigen-delivery system based on hybrid recombinant porcine parvovirus-like particles (PPV-VLPs) formed by the self-assembly of the VP2 protein of PPV carrying a foreign epitope at its N terminus. In this study, different constructs were made containing a CD8(+) T-cell epitope of chicken ovalbumin (OVA) to analyse the influence of the sequence inserted into VP2 on the correct processing of VLPs by antigen-presenting cells. We analysed the presentation of the OVA epitope inserted without flanking sequences or with either different natural flanking sequences or with the natural flanking sequences of a CD8(+) T-cell epitope from the lymphocytic choriomeningitis virus nucleoprotein, and as a dimer with or without linker sequences. All constructs were studied in terms of level of expression, assembly of VLPs and ability to deliver the inserted epitope into the MHC I pathway. The presentation of the OVA epitope was considerably improved by insertion of short natural flanking sequences, which indicated the relevance of the flanking sequences on the processing of PPV-VLPs. Only PPV-VLPs carrying two copies of the OVA epitope linked by two glycines were able to be properly processed, suggesting that the introduction of flexible residues between the two consecutive OVA epitopes may be necessary for the correct presentation of these dimers by PPV-VLPs. These results provide information to improve the insertion of epitopes into PPV-VLPs to facilitate their processing and presentation by MHC class I molecules.

  15. A genomic landscape of mitochondrial DNA insertions in the pig nuclear genome provides evolutionary signatures of interspecies admixture.

    PubMed

    Schiavo, Giuseppina; Hoffmann, Orsolya Ivett; Ribani, Anisa; Utzeri, Valerio Joe; Ghionda, Marco Ciro; Bertolini, Francesca; Geraci, Claudia; Bovo, Samuele; Fontanesi, Luca

    2017-10-01

    Nuclear DNA sequences of mitochondrial origin (numts) are derived by insertion of mitochondrial DNA (mtDNA), into the nuclear genome. In this study, we provide, for the first time, a genome picture of numts inserted in the pig nuclear genome. The Sus scrofa reference nuclear genome (Sscrofa10.2) was aligned with circularized and consensus mtDNA sequences using LAST software. A total of 430 numt sequences that may represent 246 different numt integration events (57 numt regions determined by at least two numt sequences and 189 singletons) were identified, covering about 0.0078% of the nuclear genome. Numt integration events were correlated (0.99) to the chromosome length. The longest numt sequence (about 11 kbp) was located on SSC2. Six numts were sequenced and PCR amplified in pigs of European commercial and local pig breeds, of the Chinese Meishan breed and in European wild boars. Three of them were polymorphic for the presence or absence of the insertion. Surprisingly, the estimated age of insertion of two of the three polymorphic numts was more ancient than that of the speciation time of the Sus scrofa, supporting that these polymorphic sites were originated from interspecies admixture that contributed to shape the pig genome. © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  16. Isolation of an insertion sequence (IS1051) from Xanthomonas campestris pv. dieffenbachiae with potential use for strain identification and characterization.

    PubMed Central

    Berthier, Y; Thierry, D; Lemattre, M; Guesdon, J L

    1994-01-01

    A new insertion sequence was isolated from Xanthomonas campestris pv. dieffenbachiae. Sequence analysis showed that this element is 1,158 bp long and has 15-bp inverted repeat ends containing two mismatches. Comparison of this sequence with sequences in data bases revealed significant homology with Escherichia coli IS5. IS1051, which detected multiple restriction fragment length polymorphisms, was used as a probe to characterize strains from the pathovar dieffenbachiae. Images PMID:7906933

  17. The 3'-end region of the human PDGFR-β core promoter nuclease hypersensitive element forms a mixture of two unique end-insertion G-quadruplexes.

    PubMed

    Onel, Buket; Carver, Megan; Agrawal, Prashansa; Hurley, Laurence H; Yang, Danzhou

    2018-04-01

    While the most stable G-quadruplex formed in the human PDGFR-β promoter nuclease hypersensitive element (NHE) is the 5'-mid G-quadruplex, the 3'-end sequence that contains a 3'-GGA run forms a less stable G-quadruplex. Recently, the 3'-end G-quadruplex was found to be a transcriptional repressor and can be selectively targeted by a small molecule for PDGFR-β downregulation. We use 1D and 2D high-field NMR, in combination with Dimethylsulfate Footprinting, Circular Dichroism Spectroscopy, and Electrophoretic Mobility Shift Assay. We determine that the PDGFR-β extended 3'-end NHE sequence forms two novel end-insertion intramolecular G-quadruplexes that co-exist in equilibrium under physiological salt conditions. One G-quadruplex has a 3'-non-adjacent flanking guanine inserted into the 3'-external tetrad (3'-insertion-G4), and another has a 5'-non-adjacent flanking guanine inserted into the 5'-external tetrad (5'-insertion-G4). The two guanines in the GGA-run move up or down within the G-quadruplex to accommodate the inserted guanine. Each end-insertion G-quadruplex has a low thermal stability as compared to the 5'-mid G-quadruplex, but the selective stabilization of GSA1129 shifts the equilibrium toward the 3'-end G-quadruplex in the PDGFR-β NHE. An equilibrium mixture of two unique end-insertion intramolecular G-quadruplexes forms in the PDGFR-β NHE 3'-end sequence that contains a GGA-run and non-adjacent guanines in both the 3'- and 5'- flanking segments; the novel end-insertion structures of the 3'-end G-quadruplex are selectively stabilized by GSA1129. We show for the first time that an equilibrium mixture of two unusual end-insertion G-quadruplexes forms in a native promoter sequence and appears to be the molecular recognition for PDGFR-β downregulation. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing

    DTIC Science & Technology

    2010-10-14

    High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and Massively Parallel Sequencing...Venezuelan equine encephalitis virus (VEEV) genome. We initially used a capillary electrophoresis method to gain insight into the role of the VEEV...Smith JM, Schmaljohn CS (2010) High-Resolution Functional Mapping of the Venezuelan Equine Encephalitis Virus Genome by Insertional Mutagenesis and

  19. GABI-Kat SimpleSearch: new features of the Arabidopsis thaliana T-DNA mutant database.

    PubMed

    Kleinboelting, Nils; Huep, Gunnar; Kloetgen, Andreas; Viehoever, Prisca; Weisshaar, Bernd

    2012-01-01

    T-DNA insertion mutants are very valuable for reverse genetics in Arabidopsis thaliana. Several projects have generated large sequence-indexed collections of T-DNA insertion lines, of which GABI-Kat is the second largest resource worldwide. User access to the collection and its Flanking Sequence Tags (FSTs) is provided by the front end SimpleSearch (http://www.GABI-Kat.de). Several significant improvements have been implemented recently. The database now relies on the TAIRv10 genome sequence and annotation dataset. All FSTs have been newly mapped using an optimized procedure that leads to improved accuracy of insertion site predictions. A fraction of the collection with weak FST yield was re-analysed by generating new FSTs. Along with newly found predictions for older sequences about 20,000 new FSTs were included in the database. Information about groups of FSTs pointing to the same insertion site that is found in several lines but is real only in a single line are included, and many problematic FST-to-line links have been corrected using new wet-lab data. SimpleSearch currently contains data from ~71,000 lines with predicted insertions covering 62.5% of the 27,206 nuclear protein coding genes, and offers insertion allele-specific data from 9545 confirmed lines that are available from the Nottingham Arabidopsis Stock Centre.

  20. Experimental single-strain mobilomics reveals events that shape pathogen emergence

    DOE PAGES

    Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.; ...

    2016-07-04

    Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schoeniger, Joseph S.; Hudson, Corey M.; Bent, Zachary W.

    Virulence and resistance genes carried on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. An early step in the mobilization of GIs is their excision, which produces both a circular form of the GI and a deletion site in the chromosome; circular forms have also been described for some bacterial insertion sequences (ISs). We demonstrate that the recombinant sequence produced at the junction of such circles, and their corresponding deletion sites, can be detected sensitively in high throughput sequencing data, using new computational methods that enable empirical discovery of new mobile DNAs. Applied to themore » rich mobilome of a single strain (Kpn2146) of the emerging multidrug-resistant pathogen Klebsiella pneumoniae, our approach detected circular junctions for six GIs and seven IS types (several of the latter not previously known to circularize). Our methods further revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21. Exonuclease was used to enrich for circular dsDNA molecules, and internal calibration with the native Kpn2146 plasmids showed that not all molecules bearing GI and IS circular junctions were circular dsDNAs. Transposition events were also detected, revealing replicon preference (ISKpn18 preferring a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis), and left-right IS end swapping. Efficient discovery and global characterization of numerous mobile elements per experiment will allow detailed accounting of bacterial evolution, explaining the new gene combinations that arise in emerging pathogens.« less

  2. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie.

    PubMed

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol; Na, Ki-Jeong

    2010-12-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance.

  3. Novel insertion mutation of ABCB1 gene in an ivermectin-sensitive Border Collie

    PubMed Central

    Han, Jae-Ik; Son, Hyoung-Won; Park, Seung-Cheol

    2010-01-01

    P-glycoprotein (P-gp) is encoded by the ABCB1 gene and acts as an efflux pump for xenobiotics. In the Border Collie, a nonsense mutation caused by a 4-base pair deletion in the ABCB1 gene is associated with a premature stop to P-gp synthesis. In this study, we examined the full-length coding sequence of the ABCB1 gene in an ivermectin-sensitive Border Collie that lacked the aforementioned deletion mutation. The sequence was compared to the corresponding sequences of a wild-type Beagle and seven ivermectin-tolerant family members of the Border Collie. When compared to the wild-type Beagle sequence, that of the ivermectin-sensitive Border Collie was found to have one insertion mutation and eight single nucleotide polymorphisms (SNPs) in the coding sequence of the ABCB1 gene. While the eight SNPs were also found in the family members' sequences, the insertion mutation was found only in the ivermectin-sensitive dog. These results suggest the possibility that the SNPs are species-specific features of the ABCB1 gene in Border Collies, and that the insertion mutation may be related to ivermectin intolerance. PMID:21113104

  4. Non-Toxin-Producing Bacillus cereus Strains Belonging to the B. anthracis Clade Isolated from the International Space Station.

    PubMed

    Venkateswaran, Kasthuri; Singh, Nitin K; Checinska Sielaff, Aleksandra; Pope, Robert K; Bergman, Nicholas H; van Tongeren, Sandra P; Patel, Nisha B; Lawson, Paul A; Satomi, Masataka; Williamson, Charles H D; Sahl, Jason W; Keim, Paul; Pierson, Duane; Perry, Jay

    2017-01-01

    In an ongoing Microbial Observatory investigation of the International Space Station (ISS), 11 Bacillus strains (2 from the Kibo Japanese experimental module, 4 from the U.S. segment, and 5 from the Russian module) were isolated and their whole genomes were sequenced. A comparative analysis of the 16S rRNA gene sequences of these isolates showed the highest similarity (>99%) to the Bacillus anthracis - B. cereus - B. thuringiensis group. The fatty acid composition, polar lipid profile, peptidoglycan type, and matrix-assisted laser desorption ionization-time of flight profiles were consistent with the B. cereus sensu lato group. The phenotypic traits such as motile rods, enterotoxin production, lack of capsule, and resistance to gamma phage/penicillin observed in ISS isolates were not characteristics of B. anthracis . Whole-genome sequence characterizations showed that ISS strains had the plcR non- B. anthracis ancestral "C" allele and lacked anthrax toxin-encoding plasmids pXO1 and pXO2, excluding their identification as B. anthracis . The genetic identities of all 11 ISS isolates characterized via gyrB analyses arbitrarily identified them as members of the B. cereus group, but traditional DNA-DNA hybridization (DDH) showed that the ISS isolates are similar to B. anthracis (88% to 90%) but distant from the B. cereus (42%) and B. thuringiensis (48%) type strains. The DDH results were supported by average nucleotide identity (>98.5%) and digital DDH (>86%) analyses. However, the collective phenotypic traits and genomic evidence were the reasons to exclude the ISS isolates from B. anthracis . Nevertheless, multilocus sequence typing and whole-genome single nucleotide polymorphism analyses placed these isolates in a clade that is distinct from previously described members of the B. cereus sensu lato group but closely related to B. anthracis . IMPORTANCE The International Space Station Microbial Observatory (Microbial Tracking-1) study is generating a microbial census of the space station's surfaces and atmosphere by using advanced molecular microbial community analysis techniques supported by traditional culture-based methods and modern bioinformatic computational modeling. This approach will lead to long-term, multigenerational studies of microbial population dynamics in a closed environment and address key questions, including whether microgravity influences the evolution and genetic modification of microorganisms. The spore-forming Bacillus cereus sensu lato group consists of pathogenic ( B. anthracis ), food poisoning ( B. cereus ), and biotechnologically useful ( B. thuringiensis ) microorganisms; their presence in a closed system such as the ISS might be a concern for the health of crew members. A detailed characterization of these potential pathogens would lead to the development of suitable countermeasures that are needed for long-term future missions and a better understanding of microorganisms associated with space missions.

  5. Non-Toxin-Producing Bacillus cereus Strains Belonging to the B. anthracis Clade Isolated from the International Space Station

    PubMed Central

    Singh, Nitin K.; Checinska Sielaff, Aleksandra; Pope, Robert K.; Bergman, Nicholas H.; van Tongeren, Sandra P.; Patel, Nisha B.; Lawson, Paul A.; Satomi, Masataka; Williamson, Charles H. D.; Sahl, Jason W.; Pierson, Duane; Perry, Jay

    2017-01-01

    ABSTRACT In an ongoing Microbial Observatory investigation of the International Space Station (ISS), 11 Bacillus strains (2 from the Kibo Japanese experimental module, 4 from the U.S. segment, and 5 from the Russian module) were isolated and their whole genomes were sequenced. A comparative analysis of the 16S rRNA gene sequences of these isolates showed the highest similarity (>99%) to the Bacillus anthracis-B. cereus-B. thuringiensis group. The fatty acid composition, polar lipid profile, peptidoglycan type, and matrix-assisted laser desorption ionization–time of flight profiles were consistent with the B. cereus sensu lato group. The phenotypic traits such as motile rods, enterotoxin production, lack of capsule, and resistance to gamma phage/penicillin observed in ISS isolates were not characteristics of B. anthracis. Whole-genome sequence characterizations showed that ISS strains had the plcR non-B. anthracis ancestral “C” allele and lacked anthrax toxin-encoding plasmids pXO1 and pXO2, excluding their identification as B. anthracis. The genetic identities of all 11 ISS isolates characterized via gyrB analyses arbitrarily identified them as members of the B. cereus group, but traditional DNA-DNA hybridization (DDH) showed that the ISS isolates are similar to B. anthracis (88% to 90%) but distant from the B. cereus (42%) and B. thuringiensis (48%) type strains. The DDH results were supported by average nucleotide identity (>98.5%) and digital DDH (>86%) analyses. However, the collective phenotypic traits and genomic evidence were the reasons to exclude the ISS isolates from B. anthracis. Nevertheless, multilocus sequence typing and whole-genome single nucleotide polymorphism analyses placed these isolates in a clade that is distinct from previously described members of the B. cereus sensu lato group but closely related to B. anthracis. IMPORTANCE The International Space Station Microbial Observatory (Microbial Tracking-1) study is generating a microbial census of the space station’s surfaces and atmosphere by using advanced molecular microbial community analysis techniques supported by traditional culture-based methods and modern bioinformatic computational modeling. This approach will lead to long-term, multigenerational studies of microbial population dynamics in a closed environment and address key questions, including whether microgravity influences the evolution and genetic modification of microorganisms. The spore-forming Bacillus cereus sensu lato group consists of pathogenic (B. anthracis), food poisoning (B. cereus), and biotechnologically useful (B. thuringiensis) microorganisms; their presence in a closed system such as the ISS might be a concern for the health of crew members. A detailed characterization of these potential pathogens would lead to the development of suitable countermeasures that are needed for long-term future missions and a better understanding of microorganisms associated with space missions. PMID:28680972

  6. Whole Genome Sequencing Identifies a 78 kb Insertion from Chromosome 8 as the Cause of Charcot-Marie-Tooth Neuropathy CMTX3

    PubMed Central

    Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.

    2016-01-01

    With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001

  7. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08835 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  8. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08778 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  9. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08775 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  10. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08773 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  11. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08822 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  12. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08831 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  13. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08805 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  14. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08784 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  15. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08836 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  16. Bubble formed as a result of a Zeolite Crystal Growth experiment in the U.S. Laboratory

    NASA Image and Video Library

    2002-12-14

    ISS006-E-08799 (14 December 2002) --- View of a bubble formed as a result of a Zeolite Crystal Growth (ZCG) experiment in the Destiny laboratory on the International Space Station (ISS). Expedition Six Commander Kenneth D. Bowersox used a Space Station drill to mix 12 Zeolite samples in clear tubes. Scientists on the ground watching on TV noticed bubbles in the samples. Bowersox used a modified mixing procedure to process autoclaves to isolate bubbles. He re-inserted the samples in the ZCG furnace in Express Rack 2 in the U.S. laboratory/Destiny. This experiment has shown that the bubbles could cause larger number of smaller deformed crystals to grow. Bowersox rotated the samples so that the heavier fluid was thrown to the outside while the lighter bubbles stayed on the inside.

  17. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health

    PubMed Central

    Martin, William F.

    2017-01-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. PMID:28444372

  18. The ODDI Odyssey: Developing and Integrating Operations for the International Space Station

    NASA Astrophysics Data System (ADS)

    Deal, Ryan W.

    2002-01-01

    International Space Station (ISS) comprise the deliverable products (OP-01 Reports) of the Boeing Operations Data Development and Integration (ODDI) Integrated Product Team (IPT) to the NASA customer. The ODDI IPT's mission is to exceed the customer's expectations by providing high-quality data and sound techniques for assembling and operating the ISS. strategies in order to streamline the generation of operations products that the Mission Operations Directorate (MOD) utilizes for its crew and ground operations procedures development. Just as for other business practices, operations is a transformation process, converting inputs (resources) into outputs (products) based on a strategy that works best for the established competitive priorities of the operations organization. product reviews, and supporting other ISS operations duties (such as Mission Evaluation Room support) must be balanced with meeting schedules for delivery of the ODDI IPT's OP-01 Reports in accordance with the ISS assembly sequence timeline.

  19. Biomolecular Analysis Capability for Cellular and Omics Research on the International Space Station

    NASA Technical Reports Server (NTRS)

    Guinart-Ramirez, Y.; Cooley, V. M.; Love, J. E.

    2016-01-01

    International Space Station (ISS) assembly complete ushered a new era focused on utilization of this state-of-the-art orbiting laboratory to advance science and technology research in a wide array of disciplines, with benefits to Earth and space exploration. ISS enabling capability for research in cellular and molecular biology includes equipment for in situ, on-orbit analysis of biomolecules. Applications of this growing capability range from biomedicine and biotechnology to the emerging field of Omics. For example, Biomolecule Sequencer is a space-based miniature DNA sequencer that provides nucleotide sequence data for entire samples, which may be used for purposes such as microorganism identification and astrobiology. It complements the use of WetLab-2 SmartCycler"TradeMark", which extracts RNA and provides real-time quantitative gene expression data analysis from biospecimens sampled or cultured onboard the ISS, for downlink to ground investigators, with applications ranging from clinical tissue evaluation to multigenerational assessment of organismal alterations. And the Genes in Space-1 investigation, aimed at examining epigenetic changes, employs polymerase chain reaction to detect immune system alterations. In addition, an increasing assortment of tools to visualize the subcellular distribution of tagged macromolecules is becoming available onboard the ISS. For instance, the NASA LMM (Light Microscopy Module) is a flexible light microscopy imaging facility that enables imaging of physical and biological microscopic phenomena in microgravity. Another light microscopy system modified for use in space to image life sciences payloads is initially used by the Heart Cells investigation ("Effects of Microgravity on Stem Cell-Derived Cardiomyocytes for Human Cardiovascular Disease Modeling and Drug Discovery"). Also, the JAXA Microscope system can perform remotely controllable light, phase-contrast, and fluorescent observations. And upcoming confocal microscopy capability will allow for optical sectioning of biological tissues to determine microanatomical localization of biomarkers. Furthermore, NASA's geneLAB effort addresses integration of genomic, epigenomic, transcriptomic, proteomic and metabolomic datasets, by applying an innovative open source science platform for multi-investigator high throughput utilization of the ISS. In sum, the expanding ISS capability for analysis of biomolecules is enabling innovative research in a broad spectrum of areas such as cellular and molecular biology, biotechnology, tissue engineering, biomedicine, and Omics, providing manifold benefits for humanity.

  20. TU-H-CAMPUS-JeP3-05: Adaptive Determination of Needle Sequence HDR Prostate Brachytherapy with Divergent Needle-By-Needle Delivery

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borot de Battisti, M; Maenhout, M; Lagendijk, J J W

    Purpose: To develop a new method which adaptively determines the optimal needle insertion sequence for HDR prostate brachytherapy involving divergent needle-by-needle dose delivery by e.g. a robotic device. A needle insertion sequence is calculated at the beginning of the intervention and updated after each needle insertion with feedback on needle positioning errors. Methods: Needle positioning errors and anatomy changes may occur during HDR brachytherapy which can lead to errors in the delivered dose. A novel strategy was developed to calculate and update the needle sequence and the dose plan after each needle insertion with feedback on needle positioning errors. Themore » dose plan optimization was performed by numerical simulations. The proposed needle sequence determination optimizes the final dose distribution based on the dose coverage impact of each needle. This impact is predicted stochastically by needle insertion simulations. HDR procedures were simulated with varying number of needle insertions (4 to 12) using 11 patient MR data-sets with PTV, prostate, urethra, bladder and rectum delineated. Needle positioning errors were modeled by random normally distributed angulation errors (standard deviation of 3 mm at the needle’s tip). The final dose parameters were compared in the situations where the needle with the largest vs. the smallest dose coverage impact was selected at each insertion. Results: Over all scenarios, the percentage of clinically acceptable final dose distribution improved when the needle selected had the largest dose coverage impact (91%) compared to the smallest (88%). The differences were larger for few (4 to 6) needle insertions (maximum difference scenario: 79% vs. 60%). The computation time of the needle sequence optimization was below 60s. Conclusion: A new adaptive needle sequence determination for HDR prostate brachytherapy was developed. Coupled to adaptive planning, the selection of the needle with the largest dose coverage impact increases chances of reaching the clinical constraints. M. Borot de Battisti is funded by Philips Medical Systems Nederland B.V.; M. Moerland is principal investigator on a contract funded by Philips Medical Systems Nederland B.V.; G. Hautvast and D. Binnekamp are fulltime employees of Philips Medical Systems Nederland B.V.« less

  1. In vivo insertion pool sequencing identifies virulence factors in a complex fungal–host interaction

    PubMed Central

    Uhse, Simon; Pflug, Florian G.; Stirnberg, Alexandra; Ehrlinger, Klaus; von Haeseler, Arndt

    2018-01-01

    Large-scale insertional mutagenesis screens can be powerful genome-wide tools if they are streamlined with efficient downstream analysis, which is a serious bottleneck in complex biological systems. A major impediment to the success of next-generation sequencing (NGS)-based screens for virulence factors is that the genetic material of pathogens is often underrepresented within the eukaryotic host, making detection extremely challenging. We therefore established insertion Pool-Sequencing (iPool-Seq) on maize infected with the biotrophic fungus U. maydis. iPool-Seq features tagmentation, unique molecular barcodes, and affinity purification of pathogen insertion mutant DNA from in vivo-infected tissues. In a proof of concept using iPool-Seq, we identified 28 virulence factors, including 23 that were previously uncharacterized, from an initial pool of 195 candidate effector mutants. Because of its sensitivity and quantitative nature, iPool-Seq can be applied to any insertional mutagenesis library and is especially suitable for genetically complex setups like pooled infections of eukaryotic hosts. PMID:29684023

  2. Comparison of global brain gene expression profiles between inbred long-sleep and inbred short-sleep mice by high-density gene array hybridization.

    PubMed

    Xu, Y; Ehringer, M; Yang, F; Sikela, J M

    2001-06-01

    Inbred long-sleep (ILS) and short-sleep (ISS) mice show significant central nervous system-mediated differences in sleep time for sedative dose of ethanol and are frequently used as a rodent model for ethanol sensitivity. In this study, we have used complementary DNA (cDNA) array hybridization methodology to identify genes that are differentially expressed between the brains of ILS and ISS mice. To carry out this analysis, we used both the gene discovery array (GDA) and the Mouse GEM 1 Microarray. GDA consists of 18,378 nonredundant mouse cDNA clones on a single nylon filter. Complex probes were prepared from total brain mRNA of ILS or ISS mice by using reverse transcription and 33P labeling. The labeled probes were hybridized in parallel to the gene array filters. Data from GDA experiments were analyzed with SQL-Plus and Oracle 8. The GEM microarray includes 8,730 sequence-verified clones on a glass chip. Two fluorescently labeled probes were used to hybridize a microarray simultaneously. Data from GEM experiments were analyzed by using the GEMTools software package (Incyte). Differentially expressed genes identified from each method were confirmed by relative quantitative reverse transcription-polymerase chain reaction (RT-PCR). A total of 41 genes or expressed sequence tags (ESTs) display significant expression level differences between brains of ILS and ISS mice after GDA, GEM1 hybridization, and quantitative RT-PCR confirmation. Among them, 18 clones were expressed higher in ILS mice, and 23 clones were expressed higher in ISS mice. The individual gene or EST's function and mapping information have been analyzed. This study identified 41 genes that are differentially expressed between brains of ILS and ISS mice. Some of them may have biological relevance in mediation of phenotypic variation between ILS and ISS mice for ethanol sensitivity. This study also demonstrates that parallel gene expression comparison with high-density cDNA arrays is a rapid and efficient way to discover potential genes and pathways involved in alcoholism and alcohol-related physiologic processes.

  3. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    PubMed Central

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  4. Sorting genomes by reciprocal translocations, insertions, and deletions.

    PubMed

    Qi, Xingqin; Li, Guojun; Li, Shuguang; Xu, Ying

    2010-01-01

    The problem of sorting by reciprocal translocations (abbreviated as SBT) arises from the field of comparative genomics, which is to find a shortest sequence of reciprocal translocations that transforms one genome Pi into another genome Gamma, with the restriction that Pi and Gamma contain the same genes. SBT has been proved to be polynomial-time solvable, and several polynomial algorithms have been developed. In this paper, we show how to extend Bergeron's SBT algorithm to include insertions and deletions, allowing to compare genomes containing different genes. In particular, if the gene set of Pi is a subset (or superset, respectively) of the gene set of Gamma, we present an approximation algorithm for transforming Pi into Gamma by reciprocal translocations and deletions (insertions, respectively), providing a sorting sequence with length at most OPT + 2, where OPT is the minimum number of translocations and deletions (insertions, respectively) needed to transform Pi into Gamma; if Pi and Gamma have different genes but not containing each other, we give a heuristic to transform Pi into Gamma by a shortest sequence of reciprocal translocations, insertions, and deletions, with bounds for the length of the sorting sequence it outputs. At a conceptual level, there is some similarity between our algorithm and the algorithm developed by El Mabrouk which is used to sort two chromosomes with different gene contents by reversals, insertions, and deletions.

  5. Quantifying the Number of Independent Organelle DNA Insertions in Genome Evolution and Human Health.

    PubMed

    Hazkani-Covo, Einat; Martin, William F

    2017-05-01

    Fragments of organelle genomes are often found as insertions in nuclear DNA. These fragments of mitochondrial DNA (numts) and plastid DNA (nupts) are ubiquitous components of eukaryotic genomes. They are, however, often edited out during the genome assembly process, leading to systematic underestimation of their frequency. Numts and nupts, once inserted, can become further fragmented through subsequent insertion of mobile elements or other recombinational events that disrupt the continuity of the inserted sequence relative to the genuine organelle DNA copy. Because numts and nupts are typically identified through sequence comparison tools such as BLAST, disruption of insertions into smaller fragments can lead to systematic overestimation of numt and nupt frequencies. Accurate identification of numts and nupts is important, however, both for better understanding of their role during evolution, and for monitoring their increasingly evident role in human disease. Human populations are polymorphic for 141 numt loci, five numts are causal to genetic disease, and cancer genomic studies are revealing an abundance of numts associated with tumor progression. Here, we report investigation of salient parameters involved in obtaining accurate estimates of numt and nupt numbers in genome sequence data. Numts and nupts from 44 sequenced eukaryotic genomes reveal lineage-specific differences in the number, relative age and frequency of insertional events as well as lineage-specific dynamics of their postinsertional fragmentation. Our findings outline the main technical parameters influencing accurate identification and frequency estimation of numts in genomic studies pertinent to both evolution and human health. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Analysis of plastid and mitochondrial DNA insertions in the nucleus (NUPTs and NUMTs) of six plant species: size, relative age and chromosomal localization.

    PubMed

    Michalovova, M; Vyskot, B; Kejnovsky, E

    2013-10-01

    We analysed the size, relative age and chromosomal localization of nuclear sequences of plastid and mitochondrial origin (NUPTs-nuclear plastid DNA and NUMTs-nuclear mitochondrial DNA) in six completely sequenced plant species. We found that the largest insertions showed lower divergence from organelle DNA than shorter insertions in all species, indicating their recent origin. The largest NUPT and NUMT insertions were localized in the vicinity of the centromeres in the small genomes of Arabidopsis and rice. They were also present in other chromosomal regions in the large genomes of soybean and maize. Localization of NUPTs and NUMTs correlated positively with distribution of transposable elements (TEs) in Arabidopsis and sorghum, negatively in grapevine and soybean, and did not correlate in rice or maize. We propose a model where new plastid and mitochondrial DNA sequences are inserted close to centromeres and are later fragmented by TE insertions and reshuffled away from the centromere or removed by ectopic recombination. The mode and tempo of TE dynamism determines the turnover of NUPTs and NUMTs resulting in their species-specific chromosomal distributions.

  7. Draft Genome Sequences of Biosafety Level 2 Opportunistic Pathogens Isolated from the Environmental Surfaces of the International Space Station.

    PubMed

    Checinska Sielaff, Aleksandra; Singh, Nitin K; Allen, Jonathan E; Thissen, James; Jaing, Crystal; Venkateswaran, Kasthuri

    2016-12-29

    The draft genome sequences of 20 biosafety level 2 (BSL-2) opportunistic pathogens isolated from the environmental surfaces of the International Space Station (ISS) were presented. These genomic sequences will help in understanding the influence of microgravity on the pathogenicity and virulence of these strains when compared with Earth strains. Copyright © 2016 Checinska Sielaff et al.

  8. Williams working on the JAXA MS (Marangoni Surface) Experiment

    NASA Image and Video Library

    2009-11-05

    ISS021-E-020304 (5 Nov. 2009) --- NASA astronaut Jeffrey Williams, Expedition 21 flight engineer, works with Fluid Physics Experiment Facility/Marangoni Surface (FPEF MS) Core hardware in the Kibo laboratory of the International Space Station. Williams first inserted the Marangoni Inside (MI) cassette in the MI Core for a leak check, and then installed the MI Core into the FPEF MI Body. The Marangoni convection experiment in the FPEF examines fluid tension flow in micro-G.

  9. Microgravity

    NASA Image and Video Library

    1997-03-11

    This photo shows the access through the internal airlock on the Microgravity Science Glovebox (MSG) being developed by the European Space Agency (ESA) and NASA for use aboard the International Space Station (ISS). The airlock will allow the insertion or removal of equipment and samples without opening the working volume of the glovebox. Scientists will use the MSG to carry out multidisciplinary studies in combustion science, fluid physics and materials science. The MSG is managed by NASA's Marshall Space Flight Center (MSFC). Photo Credit: NASA/MSFC

  10. Microgravity

    NASA Image and Video Library

    1997-03-11

    Once the Microgravity Science Glovebox (MSG) is sealed, additional experiment items can be inserted through a small airlock at the bottom right of the work volume. It is shown here with the door open. The European Space Agency (ESA) and NASA are developing the MSG for use aboard the International Space Station (ISS). Scientists will use the MSG to carry out multidisciplinary studies in combustion science, fluid physics and materials science. The MSG is managed by NASA's Marshall Space Flight Center (MSFC). Photo Credit: NASA/MSFC

  11. International Space Station Environmental Control and Life Support System Status: 2002-2003

    NASA Technical Reports Server (NTRS)

    Wiliams, David E.; Lewis, John F.; Gentry, Gregory

    2003-01-01

    The International Space Station (ISS) Environmental Control and Life Support (ECLS) system includes regenerative and non-regenerative technologies that provide the basic life support functions to support the crew, while maintaining a safe and habitable shirtsleeve environment. This paper provides a summary of the U.S. ECLS system activities over the past year, covering the period of time between April 2002 and March 2003. The ISS continued permanent crew operations, with the start of Phase 3 of the ISS Assembly Sequence. Work continued on the Phase 3 pressurized elements with Node 3 just completing its final design review so that it can proceed towards manufacturing and the continued manufacturing of the regenerative ECLS equipment that will be integrated into Node 3.

  12. A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

    PubMed Central

    2012-01-01

    Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

  13. Ghrelin plasma levels in patients with idiopathic short stature.

    PubMed

    Iñiguez, Germán; Román, Rossana; Youlton, Ronald; Cassorla, Fernando; Mericq, Verónica

    2011-02-01

    Novel molecular insights have suggested that ghrelin may be involved in the pathogenesis of some forms of short stature. Recently, growth hormone secretagogue receptor (GHSR) mutations that segregate with short stature have been reported. To study plasma ghrelin levels in prepubertal patients with idiopathic short stature (ISS). Fasting total plasma ghrelin levels (radioimmunoassay) in 41 prepubertal patients with ISS (18 females, age 7.9 ± 0.5 years) compared with 42 age- and sex-matched controls (27 females, age 8.0 ± 0.3 years) with normal height. In a subset of 28 patients, the ghrelin receptor was sequenced. ISS patients exhibited a higher level of ghrelin (1,458 ± 137 vs. 935 ± 55 pg/ml, p < 0.01) and similar IGF-I levels (-0.66 ± 1.29 vs. -0.32 ± 0.78 SDS) compared to controls. Ten patients with ISS had ghrelin levels greater than +2 SDS compared to controls. These patients did not differ in height, BMI or IGF-I SDS compared to ISS patients with ghrelin levels within the normal range. Molecular analysis of GHSR did not show any mutations, but showed some polymorphisms. These results suggest that in ISS patients, short stature does not appear to be frequently caused by abnormalities in ghrelin signaling. Copyright © 2010 S. Karger AG, Basel.

  14. Alu repeat discovery and characterization within human genomes

    PubMed Central

    Hormozdiari, Fereydoun; Alkan, Can; Ventura, Mario; Hajirasouliha, Iman; Malig, Maika; Hach, Faraz; Yorukoglu, Deniz; Dao, Phuong; Bakhshi, Marzieh; Sahinalp, S. Cenk; Eichler, Evan E.

    2011-01-01

    Human genomes are now being rapidly sequenced, but not all forms of genetic variation are routinely characterized. In this study, we focus on Alu retrotransposition events and seek to characterize differences in the pattern of mobile insertion between individuals based on the analysis of eight human genomes sequenced using next-generation sequencing. Applying a rapid read-pair analysis algorithm, we discover 4342 Alu insertions not found in the human reference genome and show that 98% of a selected subset (63/64) experimentally validate. Of these new insertions, 89% correspond to AluY elements, suggesting that they arose by retrotransposition. Eighty percent of the Alu insertions have not been previously reported and more novel events were detected in Africans when compared with non-African samples (76% vs. 69%). Using these data, we develop an experimental and computational screen to identify ancestry informative Alu retrotransposition events among different human populations. PMID:21131385

  15. Cloning of a CACTA transposon-like insertion in intron I of tomato invertase Lin5 gene and identification of transposase-like sequences of Solanaceae species.

    PubMed

    Proels, Reinhard K; Roitsch, Thomas

    2006-03-01

    Very few CACTA transposon-like sequences have been described in Solanaceae species. Sequence information has been restricted to partial transposase (TPase)-like fragments, and no target gene of CACTA-like transposon insertion has been described in tomato to date. In this manuscript, we report on a CACTA transposon-like insertion in intron I of tomato (Lycopersicon esculentum) invertase gene Lin5 and TPase-like sequences of several Solanaceae species. Consensus primers deduced from the TPase region of the tomato CACTA transposon-like element allowed the amplification of similar sequences from various Solanaceae species of different subfamilies including Solaneae (Solanum tuberosum), Cestreae (Nicotiana tabacum) and Datureae (Datura stramonium). This demonstrates the ubiquitous presence of CACTA-like elements in Solanaceae genomes. The obtained partial sequences are highly conserved, and allow further detection and detailed analysis of CACTA-like transposons throughout Solanaceae species. CACTA-like transposon sequences make possible the evaluation of their use for genome analysis, functional studies of genes and the evolutionary relationships between plant species.

  16. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    2001-01-01

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

  17. Triple helix purification and sequencing

    DOEpatents

    Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

    1995-01-01

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

  18. Triple helix purification and sequencing

    DOEpatents

    Wang, R.; Smith, L.M.; Tong, X.E.

    1995-03-28

    Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

  19. [Isolation and function of genes regulating aphB expression in Vibrio cholerae].

    PubMed

    Chen, Haili; Zhu, Zhaoqin; Zhong, Zengtao; Zhu, Jun; Kan, Biao

    2012-02-04

    We identified genes that regulate the expression of aphB, the gene encoding a key virulence regulator in Vibrio cholerae O1 E1 Tor C6706(-). We constructed a transposon library in V. cholerae C6706 strain containing a P(aphB)-luxCDABE and P(aphB)-lacZ transcriptional reporter plasmids. Using a chemiluminescence imager system, we rapidly detected aphB promoter expression level at a large scale. We then sequenced the transposon insertion sites by arbitrary PCR and sequencing analysis. We obtained two candidate mutants T1 and T2 which displayed reduced aphB expression from approximately 40,000 transposon insertion mutants. Sequencing analysis shows that Tn inserted in vc1585 reading frame in the T1 mutant and Tn inserted in the end of coding sequence of vc1602 in the T2 mutant. By using a genetic screen, we identified two potential genes that may involve in regulation of the expression of the key virulence regulator AphB. This study sheds light on our further investigation to fully understand V. cholerae virulence gene regulatory cascades.

  20. Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

    PubMed

    Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

    2016-05-01

    Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

  1. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    PubMed

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  2. Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

    PubMed Central

    Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

    2006-01-01

    Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

  3. Efforts to deregulate Rainbow papaya in Japan: Molecular Characterization of Transgene and Vector Inserts

    USDA-ARS?s Scientific Manuscript database

    Transformation plasmid-derived insert number and insert site sequence in 55-1 line papaya derivatives Rainbow and SunUp was determined as part of a larger petition to allow its import into Japan (Suzuki, et al., 2007, 2008). Three insertions were detected by Southern analysis and their correspondin...

  4. The Paramecium germline genome provides a niche for intragenic parasitic DNA: evolutionary dynamics of internal eliminated sequences.

    PubMed

    Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

    2012-01-01

    Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of -45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a -10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated.

  5. The Paramecium Germline Genome Provides a Niche for Intragenic Parasitic DNA: Evolutionary Dynamics of Internal Eliminated Sequences

    PubMed Central

    Arnaiz, Olivier; Mathy, Nathalie; Baudry, Céline; Malinsky, Sophie; Aury, Jean-Marc; Denby Wilkes, Cyril; Garnier, Olivier; Labadie, Karine; Lauderdale, Benjamin E.; Le Mouël, Anne; Marmignon, Antoine; Nowacki, Mariusz; Poulain, Julie; Prajer, Malgorzata; Wincker, Patrick; Meyer, Eric; Duharcourt, Sandra; Duret, Laurent; Bétermier, Mireille; Sperling, Linda

    2012-01-01

    Insertions of parasitic DNA within coding sequences are usually deleterious and are generally counter-selected during evolution. Thanks to nuclear dimorphism, ciliates provide unique models to study the fate of such insertions. Their germline genome undergoes extensive rearrangements during development of a new somatic macronucleus from the germline micronucleus following sexual events. In Paramecium, these rearrangements include precise excision of unique-copy Internal Eliminated Sequences (IES) from the somatic DNA, requiring the activity of a domesticated piggyBac transposase, PiggyMac. We have sequenced Paramecium tetraurelia germline DNA, establishing a genome-wide catalogue of ∼45,000 IESs, in order to gain insight into their evolutionary origin and excision mechanism. We obtained direct evidence that PiggyMac is required for excision of all IESs. Homology with known P. tetraurelia Tc1/mariner transposons, described here, indicates that at least a fraction of IESs derive from these elements. Most IES insertions occurred before a recent whole-genome duplication that preceded diversification of the P. aurelia species complex, but IES invasion of the Paramecium genome appears to be an ongoing process. Once inserted, IESs decay rapidly by accumulation of deletions and point substitutions. Over 90% of the IESs are shorter than 150 bp and present a remarkable size distribution with a ∼10 bp periodicity, corresponding to the helical repeat of double-stranded DNA and suggesting DNA loop formation during assembly of a transpososome-like excision complex. IESs are equally frequent within and between coding sequences; however, excision is not 100% efficient and there is selective pressure against IES insertions, in particular within highly expressed genes. We discuss the possibility that ancient domestication of a piggyBac transposase favored subsequent propagation of transposons throughout the germline by allowing insertions in coding sequences, a fraction of the genome in which parasitic DNA is not usually tolerated. PMID:23071448

  6. International Space Station (ISS)

    NASA Image and Video Library

    2001-01-01

    This is the STS-102 mission crew insignia. The central image on the crew patch depicts the International Space Station (ISS) in the build configuration that it had at the time of the arrival and docking of Discovery during the STS-102 mission, the first crew exchange flight to the Space Station. The station is shown along the direction of the flight as was seen by the shuttle crew during their final approach and docking, the so-called V-bar approach. The names of the shuttle crew members are depicted in gold around the top of the patch, and surnames of the Expedition crew members being exchanged are shown in the lower barner. The three ribbons swirling up to and around the station signify the rotation of these ISS crew members. The number 2 is for the Expedition 2 crew who flew up to the station, and the number 1 is for the Expedition 1 crew who then returned down to Earth. In conjunction with the face of the Lab module of the Station, these Expedition numbers create the shuttle mission number 102. Shown mated below the ISS is the Italian-built Multipurpose Logistics Module, Leonardo, that flew for the first time on this flight. The flags of the countries that were the major contributors to this effort, the United States, Russia, and Italy are also shown in the lower part of the patch. The build-sequence number of this flight in the overall station assembly sequence, 5A.1, is captured by the constellations in the background.

  7. ISS-based Development of Elements and Operations for Robotic Assembly of A Space Solar Power Collector

    NASA Technical Reports Server (NTRS)

    Valinia, Azita; Moe, Rud; Seery, Bernard D.; Mankins, John C.

    2013-01-01

    We present a concept for an ISS-based optical system assembly demonstration designed to advance technologies related to future large in-space optical facilities deployment, including space solar power collectors and large-aperture astronomy telescopes. The large solar power collector problem is not unlike the large astronomical telescope problem, but at least conceptually it should be easier in principle, given the tolerances involved. We strive in this application to leverage heavily the work done on the NASA Optical Testbed Integration on ISS Experiment (OpTIIX) effort to erect a 1.5 m imaging telescope on the International Space Station (ISS). Specifically, we examine a robotic assembly sequence for constructing a large (meter diameter) slightly aspheric or spherical primary reflector, comprised of hexagonal mirror segments affixed to a lightweight rigidizing backplane structure. This approach, together with a structured robot assembler, will be shown to be scalable to the area and areal densities required for large-scale solar concentrator arrays.

  8. Microbiomes of the dust particles collected from the International Space Station and Spacecraft Assembly Facilities.

    PubMed

    Checinska, Aleksandra; Probst, Alexander J; Vaishampayan, Parag; White, James R; Kumar, Deepika; Stepanov, Victor G; Fox, George E; Nilsson, Henrik R; Pierson, Duane L; Perry, Jay; Venkateswaran, Kasthuri

    2015-10-27

    The International Space Station (ISS) is a unique built environment due to the effects of microgravity, space radiation, elevated carbon dioxide levels, and especially continuous human habitation. Understanding the composition of the ISS microbial community will facilitate further development of safety and maintenance practices. The primary goal of this study was to characterize the viable microbiome of the ISS-built environment. A second objective was to determine if the built environments of Earth-based cleanrooms associated with space exploration are an appropriate model of the ISS environment. Samples collected from the ISS and two cleanrooms at the Jet Propulsion Laboratory (JPL, Pasadena, CA) were analyzed by traditional cultivation, adenosine triphosphate (ATP), and propidium monoazide-quantitative polymerase chain reaction (PMA-qPCR) assays to estimate viable microbial populations. The 16S rRNA gene Illumina iTag sequencing was used to elucidate microbial diversity and explore differences between ISS and cleanroom microbiomes. Statistical analyses showed that members of the phyla Actinobacteria, Firmicutes, and Proteobacteria were dominant in the samples examined but varied in abundance. Actinobacteria were predominant in the ISS samples whereas Proteobacteria, least abundant in the ISS, dominated in the cleanroom samples. The viable bacterial populations seen by PMA treatment were greatly decreased. However, the treatment did not appear to have an effect on the bacterial composition (diversity) associated with each sampling site. The results of this study provide strong evidence that specific human skin-associated microorganisms make a substantial contribution to the ISS microbiome, which is not the case in Earth-based cleanrooms. For example, Corynebacterium and Propionibacterium (Actinobacteria) but not Staphylococcus (Firmicutes) species are dominant on the ISS in terms of viable and total bacterial community composition. The results obtained will facilitate future studies to determine how stable the ISS environment is over time. The present results also demonstrate the value of measuring viable cell diversity and population size at any sampling site. This information can be used to identify sites that can be targeted for more stringent cleaning. Finally, the results will allow comparisons with other built sites and facilitate future improvements on the ISS that will ensure astronaut health.

  9. Microbial Characterization During the Early Habitation of the International Space Station

    NASA Technical Reports Server (NTRS)

    Castro, V. A.; Thrasher, A. N.; Healy, M.; Ott, C. M.; Pierson, D. L.

    2004-01-01

    An evaluation of the microbiota from air, water, and surface samples provided a baseline of microbial characterization onboard the International Space Station (ISS) to gain insight into bacterial and fungal contamination during the initial stages of construction and habitation. Using 16S genetic sequencing and rep-PCR, 63 bacterial strains were isolated for identification and fingerprinted for microbial tracking. Of the bacterial strains that were isolated and fingerprinted, 19 displayed similarity to each other. The use of these molecular tools allowed for the identification of bacteria not previously identified using automated biochemical analysis and provided a clear indication of the source of several ISS contaminants. Strains of Bradyrhizobium and Sphingomonas unable to be identified using sequencing were identified by comparison of rep-PCR DNA fingerprints. Distinct DNA fingerprints for several strains of Methylobacterium provided a clear indication of the source of an ISS water supply contaminant. Fungal and bacterial data acquired during monitoring do not suggest there is a current microbial hazard to the spacecraft, nor does any trend indicate a potential health risk. Previous spacecraft environmental analysis indicated that microbial contamination will increase with time and will require continued surveillance. Copyright 2004 Springer-Verlag.

  10. Payload Planning for the International Space Station

    NASA Technical Reports Server (NTRS)

    Johnson, Tameka J.

    1995-01-01

    A review of the evolution of the International Space Station (ISS) was performed for the purpose of understanding the project objectives. It was requested than an analysis of the current Office of Space Access and Technology (OSAT) Partnership Utilization Plan (PUP) traffic model be completed to monitor the process through which the scientific experiments called payloads are manifested for flight to the ISS. A viewing analysis of the ISS was also proposed to identify the capability to observe the United States Laboratory (US LAB) during the assembly sequence. Observations of the Drop-Tower experiment and nondestructive testing procedures were also performed to maximize the intern's technical experience. Contributions were made to the meeting in which the 1996 OSAT or Code X PUP traffic model was generated using the software tool, Filemaker Pro. The current OSAT traffic model satisfies the requirement for manifesting and delivering the proposed payloads to station. The current viewing capability of station provides the ability to view the US LAB during station assembly sequence. The Drop Tower experiment successfully simulates the effect of microgravity and conveniently documents the results for later use. The non-destructive test proved effective in determining stress in various components tested.

  11. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  12. Microgravity Science Glovebox - Airlock

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Once the Microgravity Science Glovebox (MSG) is sealed, additional experiment items can be inserted through a small airlock at the bottom right of the work volume. It is shown here with the door removed. The European Space Agency (ESA) and NASA are developing the MSG for use aboard the International Space Station (ISS). Scientists will use the MSG to carry out multidisciplinary studies in combustion science, fluid physics and materials science. The MSG is managed by NASA's Marshall Space Flight Center (MSFC). Photo Credit: NASA/MSFC

  13. Microgravity Science Glovebox - Airlock

    NASA Technical Reports Server (NTRS)

    1997-01-01

    Once the Microgravity Science Glovebox (MSG) is sealed, additional experiment items can be inserted through a small airlock at the bottom right of the work volume. It is shown here with the door open. The European Space Agency (ESA) and NASA are developing the MSG for use aboard the International Space Station (ISS). Scientists will use the MSG to carry out multidisciplinary studies in combustion science, fluid physics and materials science. The MSG is managed by NASA's Marshall Space Flight Center (MSFC). Photo Credit: NASA/MSFC

  14. Microgravity

    NASA Image and Video Library

    1997-03-11

    This photo shows the access through the internal airlock (bottom right) on the Microgravity Science Glovebox (MSG) being developed by the European Space Agency (ESA) and NASA for use aboard the International Space Station (ISS). The airlock will allow the insertion or removal of equipment and samples without opening the working volume of the glovebox. Scientists will use the MSG to carry out multidisciplinary studies in combustion science, fluid physics and materials science. The MSG is managed by NASA's Marshall Space Flight Center (MSFC). Photo Credit: NASA/MSFC

  15. Nanopore sequencing in microgravity

    PubMed Central

    McIntyre, Alexa B R; Rizzardi, Lindsay; Yu, Angela M; Alexander, Noah; Rosen, Gail L; Botkin, Douglas J; Stahl, Sarah E; John, Kristen K; Castro-Wallace, Sarah L; McGrath, Ken; Burton, Aaron S; Feinberg, Andrew P; Mason, Christopher E

    2016-01-01

    Rapid DNA sequencing and analysis has been a long-sought goal in remote research and point-of-care medicine. In microgravity, DNA sequencing can facilitate novel astrobiological research and close monitoring of crew health, but spaceflight places stringent restrictions on the mass and volume of instruments, crew operation time, and instrument functionality. The recent emergence of portable, nanopore-based tools with streamlined sample preparation protocols finally enables DNA sequencing on missions in microgravity. As a first step toward sequencing in space and aboard the International Space Station (ISS), we tested the Oxford Nanopore Technologies MinION during a parabolic flight to understand the effects of variable gravity on the instrument and data. In a successful proof-of-principle experiment, we found that the instrument generated DNA reads over the course of the flight, including the first ever sequenced in microgravity, and additional reads measured after the flight concluded its parabolas. Here we detail modifications to the sample-loading procedures to facilitate nanopore sequencing aboard the ISS and in other microgravity environments. We also evaluate existing analysis methods and outline two new approaches, the first based on a wave-fingerprint method and the second on entropy signal mapping. Computationally light analysis methods offer the potential for in situ species identification, but are limited by the error profiles (stays, skips, and mismatches) of older nanopore data. Higher accuracies attainable with modified sample processing methods and the latest version of flow cells will further enable the use of nanopore sequencers for diagnostics and research in space. PMID:28725742

  16. Insertion sequence 1515 in the ply gene of a type 1 clinical isolate of Streptococcus pneumoniae abolishes pneumolysin expression.

    PubMed

    Garnier, Fabien; Janapatla, Rajendra Prasad; Charpentier, Emmanuelle; Masson, Geoffrey; Grélaud, Carole; Stach, Jean François; Denis, François; Ploy, Marie-Cécile

    2007-07-01

    A serotype 1 Streptococcus pneumoniae strain isolated by blood culture from a woman with pneumonia was found to harbor insertion sequence (IS) 1515 in the pneumolysin gene, abolishing pneumolysin expression. To our knowledge, this is the first report of an IS in the pneumolysin gene of S. pneumoniae.

  17. Methods and compositions for controlling gene expression by RNA processing

    DOEpatents

    Doudna, Jennifer A.; Qi, Lei S.; Haurwitz, Rachel E.; Arkin, Adam P.

    2017-08-29

    The present disclosure provides nucleic acids encoding an RNA recognition sequence positioned proximal to an insertion site for the insertion of a sequence of interest; and host cells genetically modified with the nucleic acids. The present disclosure also provides methods of modifying the activity of a target RNA, and kits and compositions for carrying out the methods.

  18. Linear and exponential TAIL-PCR: a method for efficient and quick amplification of flanking sequences adjacent to Tn5 transposon insertion sites.

    PubMed

    Jia, Xianbo; Lin, Xinjian; Chen, Jichen

    2017-11-02

    Current genome walking methods are very time consuming, and many produce non-specific amplification products. To amplify the flanking sequences that are adjacent to Tn5 transposon insertion sites in Serratia marcescens FZSF02, we developed a genome walking method based on TAIL-PCR. This PCR method added a 20-cycle linear amplification step before the exponential amplification step to increase the concentration of the target sequences. Products of the linear amplification and the exponential amplification were diluted 100-fold to decrease the concentration of the templates that cause non-specific amplification. Fast DNA polymerase with a high extension speed was used in this method, and an amplification program was used to rapidly amplify long specific sequences. With this linear and exponential TAIL-PCR (LETAIL-PCR), we successfully obtained products larger than 2 kb from Tn5 transposon insertion mutant strains within 3 h. This method can be widely used in genome walking studies to amplify unknown sequences that are adjacent to known sequences.

  19. The wheat cytochrome oxidase subunit II gene has an intron insert and three radical amino acid changes relative to maize

    PubMed Central

    Bonen, Linda; Boer, Poppo H.; Gray, Michael W.

    1984-01-01

    We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565

  20. MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system.

    PubMed

    Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I

    2018-05-01

    Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1 H frequency, and chemical shift imaging at 13 C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1 H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45-59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1 H/ 13 C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23-30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

  1. Compositions and methods for the expression of selenoproteins in eukaryotic cells

    DOEpatents

    Gladyshev, Vadim [Lincoln, NE; Novoselov, Sergey [Puschino, RU

    2012-09-25

    Recombinant nucleic acid constructs for the efficient expression of eukaryotic selenoproteins and related methods for production of recombinant selenoproteins are provided. The nucleic acid constructs comprise novel selenocysteine insertion sequence (SECIS) elements. Certain novel SECIS elements of the invention contain non-canonical quartet sequences. Other novel SECIS elements provided by the invention are chimeric SECIS elements comprising a canonical SECIS element that contains a non-canonical quartet sequence and chimeric SECIS elements comprising a non-canonical SECIS element that contains a canonical quartet sequence. The novel SECIS elements of the invention facilitate the insertion of selenocysteine residues into recombinant polypeptides.

  2. The International Space Station: Operations and Assembly - Learning From Experiences - Past, Present, and Future

    NASA Technical Reports Server (NTRS)

    Fuller, Sean; Dillon, William F.

    2006-01-01

    As the Space Shuttle continues flight, construction and assembly of the International Space Station (ISS) carries on as the United States and our International Partners resume the building, and continue to carry on the daily operations, of this impressive and historical Earth-orbiting research facility. In his January 14, 2004, speech announcing a new vision for America s space program, President Bush ratified the United States commitment to completing construction of the ISS by 2010. Since the launch and joining of the first two elements in 1998, the ISS and the partnership have experienced and overcome many challenges to assembly and operations, along with accomplishing many impressive achievements and historical firsts. These experiences and achievements over time have shaped our strategy, planning, and expectations. The continual operation and assembly of ISS leads to new knowledge about the design, development and operation of systems and hardware that will be utilized in the development of new deep-space vehicles needed to fulfill the Vision for Exploration and to generate the data and information that will enable our programs to return to the Moon and continue on to Mars. This paper will provide an overview of the complexity of the ISS Program, including a historical review of the major assembly events and operational milestones of the program, along with the upcoming assembly plans and scheduled missions of the space shuttle flights and ISS Assembly sequence.

  3. Lesion bypass activity of DNA polymerase θ (POLQ) is an intrinsic property of the pol domain and depends on unique sequence inserts.

    PubMed

    Hogg, Matthew; Seki, Mineaki; Wood, Richard D; Doublié, Sylvie; Wallace, Susan S

    2011-01-21

    DNA polymerase θ (POLQ, polθ) is a large, multidomain DNA polymerase encoded in higher eukaryotic genomes. It is important for maintaining genetic stability in cells and helping protect cells from DNA damage caused by ionizing radiation. POLQ contains an N-terminal helicase-like domain, a large central domain of indeterminate function, and a C-terminal polymerase domain with sequence similarity to the A-family of DNA polymerases. The enzyme has several unique properties, including low fidelity and the ability to insert and extend past abasic sites and thymine glycol lesions. It is not known whether the abasic site bypass activity is an intrinsic property of the polymerase domain or whether helicase activity is also required. Three "insertion" sequence elements present in POLQ are not found in any other A-family DNA polymerase, and it has been proposed that they may lend some unique properties to POLQ. Here, we analyzed the activity of the DNA polymerase in the absence of each sequence insertion. We found that the pol domain is capable of highly efficient bypass of abasic sites in the absence of the helicase-like or central domains. Insertion 1 increases the processivity of the polymerase but has little, if any, bearing on the translesion synthesis properties of the enzyme. However, removal of insertions 2 and 3 reduces activity on undamaged DNA and completely abrogates the ability of the enzyme to bypass abasic sites or thymine glycol lesions. Copyright © 2010 Elsevier Ltd. All rights reserved.

  4. The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

    PubMed

    Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

    2014-01-01

    The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

  5. A High-Throughput Arabidopsis Reverse Genetics System

    PubMed Central

    Sessions, Allen; Burke, Ellen; Presting, Gernot; Aux, George; McElver, John; Patton, David; Dietrich, Bob; Ho, Patrick; Bacwaden, Johana; Ko, Cynthia; Clarke, Joseph D.; Cotton, David; Bullis, David; Snell, Jennifer; Miguel, Trini; Hutchison, Don; Kimmerly, Bill; Mitzel, Theresa; Katagiri, Fumiaki; Glazebrook, Jane; Law, Marc; Goff, Stephen A.

    2002-01-01

    A collection of Arabidopsis lines with T-DNA insertions in known sites was generated to increase the efficiency of functional genomics. A high-throughput modified thermal asymetric interlaced (TAIL)-PCR protocol was developed and used to amplify DNA fragments flanking the T-DNA left borders from ∼100,000 transformed lines. A total of 85,108 TAIL-PCR products from 52,964 T-DNA lines were sequenced and compared with the Arabidopsis genome to determine the positions of T-DNAs in each line. Predicted T-DNA insertion sites, when mapped, showed a bias against predicted coding sequences. Predicted insertion mutations in genes of interest can be identified using Arabidopsis Gene Index name searches or by BLAST (Basic Local Alignment Search Tool) search. Insertions can be confirmed by simple PCR assays on individual lines. Predicted insertions were confirmed in 257 of 340 lines tested (76%). This resource has been named SAIL (Syngenta Arabidopsis Insertion Library) and is available to the scientific community at www.tmri.org. PMID:12468722

  6. Transposon Insertion Finder (TIF): a novel program for detection of de novo transpositions of transposable elements.

    PubMed

    Nakagome, Mariko; Solovieva, Elena; Takahashi, Akira; Yasue, Hiroshi; Hirochika, Hirohiko; Miyao, Akio

    2014-03-14

    Transposition event detection of transposable element (TE) in the genome using short reads from the next-generation sequence (NGS) was difficult, because the nucleotide sequence of TE itself is repetitive, making it difficult to identify locations of its insertions by alignment programs for NGS. We have developed a program with a new algorithm to detect the transpositions from NGS data. In the process of tool development, we used next-generation sequence (NGS) data of derivative lines (ttm2 and ttm5) of japonica rice cv. Nipponbare, regenerated through cell culture. The new program, called a transposon insertion finder (TIF), was applied to detect the de novo transpositions of Tos17 in the regenerated lines. TIF searched 300 million reads of a line within 20 min, identifying 4 and 12 de novo transposition in ttm2 and ttm5 lines, respectively. All of the transpositions were confirmed by PCR/electrophoresis and sequencing. Using the program, we also detected new transposon insertions of P-element from NGS data of Drosophila melanogaster. TIF operates to find the transposition of any elements provided that target site duplications (TSDs) are generated by their transpositions.

  7. Insertion sequence typing of Mycobacterium tuberculosis: characterization of a widespread subtype with a single copy of IS6110.

    PubMed

    Fomukong, N G; Tang, T H; al-Maamary, S; Ibrahim, W A; Ramayah, S; Yates, M; Zainuddin, Z F; Dale, J W

    1994-12-01

    DNA fingerprinting with the insertion sequence IS6110 (also known as IS986) has become established as a major tool for investigating the spread of tuberculosis. Most strains of Mycobacterium tuberculosis have multiple copies of IS6110, but a small minority carry a single copy only. We have examined selected strains from Malaysia, Tanzania and Oman, in comparison with M. bovis isolates and BCG strains carrying one or two copies of IS6110. The insertion sequence appears to be present in the same position in all these strains, which suggests that in these organisms the element is defective in transposition and that the loss of transposability may have occurred at an early stage in the evolution of the M. tuberculosis complex.

  8. SHOX mutations in idiopathic short stature and Leri-Weill dyschondrosteosis: frequency and phenotypic variability.

    PubMed

    Jorge, Alexander A L; Souza, Silvia C; Nishi, Miriam Y; Billerbeck, Ana E; Libório, Débora C C; Kim, Chong A; Arnhold, Ivo J P; Mendonca, Berenice B

    2007-01-01

    The frequency of SHOX mutations in children with idiopathic short stature (ISS) has been found to be variable. We analysed the SHOX gene in children with ISS and Leri-Weill dyschondrosteosis (LWD) and evaluated the phenotypic variability in patients harbouring SHOX mutations. Sixty-three ISS, nine LWD children and 21 affected relatives. SHOX gene deletion was evaluated by fluorescence in situ hybridization (FISH), Southern blotting and segregation study of polymorphic marker. Point mutations were assessed by direct DNA sequencing. None of the ISS patients presented SHOX deletions, but two (3.2%) presented heterozygous point mutations, including the novel R147H mutation. However, when ISS patients were selected by sitting height : height ratio (SH/H) for age > 2 SD, mutation frequency detection increased to 22%. Eight (89%) LWD patients had SHOX deletions, but none had point mutations. Analysis of the other relatives in the families carrying SHOX mutations identified 14 children and 17 adult patients. A broad phenotypic variability was observed in all families regarding short stature severity and Madelung deformities. However, the presence of disproportional height, assessed by SH/H, was observed in all children and 82% of adult patients, being the most common feature in our patients with SHOX mutations. Patients with SHOX mutations present a broad phenotypic variability. SHOX mutations are very frequent in LWD (89%), in opposition to ISS (3.2%) in our cohort. The use of SH/H SDS as a selection criterion increases the frequency of SHOX mutation detection to 22% and should be used for selecting ISS children to undergo SHOX mutation molecular studies.

  9. IS30-related transposon mediated insertional inactivation of bile salt hydrolase (bsh1) gene of Lactobacillus plantarum strain Lp20.

    PubMed

    Kumar, Rajesh; Grover, Sunita; Kaushik, Jai K; Batish, Virender Kumar

    2014-01-01

    Lactobacillus plantarum is a flexible and versatile microorganism that inhabits a variety of niches, and its genome may express up to four bsh genes to maximize its survival in the mammalian gut. However, the ecological significance of multiple bsh genes in L. plantarum is still not clearly understood. Hence, this study demonstrated the disruption of bile salt hydrolase (bsh1) gene due to the insertion of a transposable element in L. plantarum Lp20 - a wild strain of human fecal origin. Surprisingly, L. plantarum strain Lp20 produced a ∼2.0 kb bsh1 amplicon against the normal size (∼1.0 kb) bsh1 amplicon of Bsh(+)L. plantarum Lp21. Strain Lp20 exhibited minimal Bsh activity in spite of having intact bsh2, bsh3 and bsh4 genes in its genome and hence had a Bsh(-) phenotype. Cloning and sequence characterization of Lp20 bsh1 gene predicted four individual open reading frames (ORFs) within this region. BLAST analysis of ORF1 and ORF2 revealed significant sequence similarity to the L. plantarum bsh1 gene while ORF3 and ORF4 showed high sequence homology to IS30-family transposases. Since, IS30-related transposon element was inserted within Lp20 bsh1 gene in reverse orientation (3'-5'), it introduced several stop codons and disrupted the protein reading frames of both Bsh1 and transposase. Inverted terminal repeats (GGCAGATTG) of transposon, mediated its insertion at 255-263 nt and 1301-1309 nt positions of Lp20 bsh1 gene. In conclusion, insertion of IS30 related-transposon within the bsh1 gene sequence of L. plantarum strain Lp20 demolished the integrity and functionality of Bsh1 enzyme. Additionally, this transposon DNA sequence remains active among various Lactobacillus spp. and hence harbors the potential to be explored in the development of efficient insertion mutagenesis system. Copyright © 2013 Elsevier GmbH. All rights reserved.

  10. Utilization of next generation sequencing for analyzing transgenic insertions in plum

    USDA-ARS?s Scientific Manuscript database

    When utilizing transgenic plants, it is useful to know how many copies of the genes were inserted and the locations of these insertions in the genome. This information can provide important insights for the interpretation of transgene expression and the resulting phenotype. Traditionally, these qu...

  11. Characterization of (CA)n microsatellite repeats from large-insert clones.

    PubMed

    Litt, M; Browne, D

    2001-05-01

    The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

  12. Allexiviruses may have acquired inserted sequences between the CP and CRP genes to change the translation reinitiation strategy of CRP.

    PubMed

    Yoshida, Naoto; Shimura, Hanako; Masuta, Chikara

    2018-06-01

    Allexiviruses are economically important garlic viruses that are involved in garlic mosaic diseases. In this study, we characterized the allexivirus cysteine-rich protein (CRP) gene located just downstream of the coat protein (CP) gene in the viral genome. We determined the nucleotide sequences of the CP and CRP genes from numerous allexivirus isolates and performed a phylogenetic analysis. According to the resulting phylogenetic tree, we found that allexiviruses were clearly divided into two major groups (group I and group II) based on the sequences of the CP and CRP genes. In addition, the allexiviruses in group II had distinct sequences just before the CRP gene, while group I isolates did not. The inserted sequence between the CP and CRP genes was partially complementary to garlic 18S rRNA. Using a potato virus X vector, we showed that the CRPs affected viral accumulation and symptom induction in Nicotiana benthamiana, suggesting that the allexivirus CRP is a pathogenicity determinant. We assume that the inserted sequences before the CRP gene may have been generated during viral evolution to alter the termination-reinitiation mechanism for coupled translation of CP and CRP.

  13. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe.

    PubMed

    Chen, Bo-Ruei; Hale, Devin C; Ciolek, Peter J; Runge, Kurt W

    2012-05-03

    Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches.

  14. Retrotransposon insertion targeting: a mechanism for homogenization of centromere sequences on nonhomologous chromosomes.

    PubMed

    Birchler, James A; Presting, Gernot G

    2012-04-01

    The centromeres of most eukaryotic organisms consist of highly repetitive arrays that are similar across nonhomologous chromosomes. These sequences evolve rapidly, thus posing a mystery as to how such arrays can be homogenized. Recent work in species in which centromere-enriched retrotransposons occur indicates that these elements preferentially insert into the centromeric regions. In two different Arabidopsis species, a related element was recognized in which the specificity for such targeting was altered. These observations provide a partial explanation for how homogenization of centromere DNA sequences occurs.

  15. The DNA of Bacteria of the World Ocean and the Earth in Cosmic Dust at the International Space Station

    PubMed Central

    Grebennikova, T. V.; Syroeshkin, A. V.; Shubralova, E. V.; Eliseeva, O. V.; Kostina, L. V.; Kulikova, N. Y.; Latyshev, O. E.; Morozova, M. A.; Yuzhakov, A. G.; Chichaeva, M. A.; Tsygankov, O. S.

    2018-01-01

    Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria, DNA of the strains of capsular bacteria Bacillus, and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin. PMID:29849510

  16. The DNA of Bacteria of the World Ocean and the Earth in Cosmic Dust at the International Space Station.

    PubMed

    Grebennikova, T V; Syroeshkin, A V; Shubralova, E V; Eliseeva, O V; Kostina, L V; Kulikova, N Y; Latyshev, O E; Morozova, M A; Yuzhakov, A G; Zlatskiy, I A; Chichaeva, M A; Tsygankov, O S

    2018-01-01

    Cosmic dust samples from the surface of the illuminator of the International Space Station (ISS) were collected by a crew member during his spacewalk. The sampler with tampon in a vacuum container was delivered to the Earth. Washouts from the tampon's material and the tampon itself were analyzed for the presence of bacterial DNA by the method of nested PCR with primers specific to DNA of the genus Mycobacteria , DNA of the strains of capsular bacteria Bacillus , and DNA encoding 16S ribosomal RNA. The results of amplification followed by sequencing and phylogenetic analysis indicated the presence of the bacteria of the genus Mycobacteria and the extreme bacterium of the genus Delftia in the samples of cosmic dust. It was shown that the DNA sequence of one of the bacteria of the genus Mycobacteria was genetically similar to that previously observed in superficial micro layer at the Barents and Kara seas' coastal zones. The presence of the wild land and marine bacteria DNA on the ISS suggests their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit. Alternatively, the wild land and marine bacteria as well as the ISS bacteria may all have an ultimate space origin.

  17. Furnishing spaceship environment: evaluation of bacterial biofilms on different materials used inside International Space Station.

    PubMed

    Perrin, Elena; Bacci, Giovanni; Garrelly, Laurent; Canganella, Francesco; Bianconi, Giovanna; Fani, Renato; Mengoni, Alessio

    2018-05-08

    Performed inside International Space Station (ISS) from 2011 to 2016, VIABLE (eValuatIon And monitoring of microBiofiLms insidE International Space Station) ISS was a long-lasting experiment aimed at evaluating the bacterial contamination on different surface space materials subjected to different pre-treatment, to provide useful information for future space missions. In this work, surfaces samples of the VIABLE ISS experiment were analyzed to determine both the total bacterial load (ATP-metry, qPCR) and the composition of the microbial communities (16S rRNA genes amplicon sequencing). Data obtained showed a low bacterial contamination of all the surfaces, with values in agreement with those allowed inside ISS, and with a taxonomic composition similar to those found in previous studies (Enterobacteriales, Bacillales, Lactobacillales and Actinomycetales). No pre-treatment or material effect were observed on both the bacterial load and the composition of the communities, but for both a slight effect of the position (expose/not expose to air) was observed. In conclusion, under the conditions used for VIABLE ISS, no material or pre-treatment seems to be better than others in terms of quantity and type of bacterial contamination. Copyright © 2018 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  18. Definitive airway management after pre-hospital supraglottic airway insertion: Outcomes and a management algorithm for trauma patients.

    PubMed

    Hernandez, Matthew C; Aho, Johnathon M; Zielinski, Martin D; Zietlow, Scott P; Kim, Brian D; Morris, David S

    2018-01-01

    Prehospital airway management increasingly involves supraglottic airway insertion and a paucity of data evaluates outcomes in trauma populations. We aim to describe definitive airway management in traumatically injured patients who necessitated prehospital supraglottic airway insertion. We performed a single institution retrospective review of multisystem injured patients (≥15years) that received prehospital supraglottic airway insertion during 2009 to 2016. Baseline demographics, number and type of: supraglottic airway insertion attempts, definitive airway and complications were recorded. Primary outcome was need for tracheostomy. Univariate and multivariable statistics were performed. 56 patients met inclusion criteria and were reviewed, 78% were male. Median age [IQR] was 36 [24-56] years. Injuries comprised blunt (94%), penetrating (4%) and burns (2%). Median ISS was 26 [22-41]. Median number of prehospital endotracheal intubation (PETI) attempts was 2 [1-3]. Definitive airway management included: (n=20, 36%, tracheostomy), (n=10, 18%, direct laryngoscopy), (n=6, 11%, bougie), (n=9, 15%, Glidescope), (n=11, 20%, bronchoscopic assistance). 24-hour mortality was 41%. Increasing number of PETI was associated with increasing facial injury. On regression, increasing cervical and facial injury patterns as well as number of PETI were associated with definitive airway control via surgical tracheostomy. After supraglottic airway insertion, operative or non-operative approaches can be utilized to obtain a definitive airway. Patients with increased craniofacial injuries have an increased risk for airway complications and need for tracheostomy. We used these factors to generate an evidence based algorithm that requires prospective validation. Level IV - Retrospective study. Retrospective single institution study. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Characterization of IS1515, a Functional Insertion Sequence in Streptococcus pneumoniae

    PubMed Central

    Muñoz, Rosario; López, Rubens; García, Ernesto

    1998-01-01

    We describe the characterization of a new insertion sequence, IS1515, identified in the genome of Streptococcus pneumoniae I41R, an unencapsulated mutant isolated many years ago (R. Austrian, H. P. Bernheimer, E. E. B. Smith, and G. T. Mills, J. Exp. Med. 110:585–602, 1959). A copy of this element located in the cap1EI41R gene was sequenced. The 871-bp-long IS1515 element possesses 12-bp perfect inverted repeats and generates a 3-bp target duplication upon insertion. The IS encodes a protein of 271 amino acid residues similar to the putative transposases of other insertion sequences, namely IS1381 from S. pneumoniae, ISL2 from Lactobacillus helveticus, IS702 from the cyanobacterium Calothrix sp. strain PCC 7601, and IS112 from Streptomyces albus G. IS1515 appears to be present in the genome of most type 1 pneumococci in a maximum of 13 copies, although it has also been found in the chromosome of pneumococcal isolates belonging to other serotypes. We have found that the unencapsulated phenotype of strain I41R is the result of both the presence of an IS1515 copy and a frameshift mutation in the cap1EI41R gene. Precise excision of the IS was observed in the type 1 encapsulated transformants isolated in experiments designed to repair the frameshift. These results reveal that IS1515 behaves quite differently from other previously described pneumococcal insertion sequences. Several copies of IS1515 were also able to excise and move to another locations in the chromosome of S. pneumoniae. To our knowledge, this is the first report of a functional IS in pneumococcus. PMID:9580131

  20. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  1. Nuclear Mitochondrial DNA Activates Replication in Saccharomyces cerevisiae

    PubMed Central

    Chatre, Laurent; Ricchetti, Miria

    2011-01-01

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in. PMID:21408151

  2. Nuclear mitochondrial DNA activates replication in Saccharomyces cerevisiae.

    PubMed

    Chatre, Laurent; Ricchetti, Miria

    2011-03-08

    The nuclear genome of eukaryotes is colonized by DNA fragments of mitochondrial origin, called NUMTs. These insertions have been associated with a variety of germ-line diseases in humans. The significance of this uptake of potentially dangerous sequences into the nuclear genome is unclear. Here we provide functional evidence that sequences of mitochondrial origin promote nuclear DNA replication in Saccharomyces cerevisiae. We show that NUMTs are rich in key autonomously replicating sequence (ARS) consensus motifs, whose mutation results in the reduction or loss of DNA replication activity. Furthermore, 2D-gel analysis of the mrc1 mutant exposed to hydroxyurea shows that several NUMTs function as late chromosomal origins. We also show that NUMTs located close to or within ARS provide key sequence elements for replication. Thus NUMTs can act as independent origins, when inserted in an appropriate genomic context or affect the efficiency of pre-existing origins. These findings show that migratory mitochondrial DNAs can impact on the replication of the nuclear region they are inserted in.

  3. Time Distribution Using SpaceWire in the SCaN Testbed on ISS

    NASA Technical Reports Server (NTRS)

    Lux, James P.

    2012-01-01

    A paper describes an approach for timekeeping and time transfer among the devices on the CoNNeCT project s SCaN Testbed. It also describes how the clocks may be synchronized with an external time reference; e.g., time tags from the International Space Station (ISS) or RF signals received by a radio (TDRSS time service or GPS). All the units have some sort of counter that is fed by an oscillator at some convenient frequency. The basic problem in timekeeping is relating the counter value to some external time standard such as UTC. With SpaceWire, there are two approaches possible: one is to just use SpaceWire to send a message, and use an external wire for the sync signal. This is much the same as with the RS- 232 messages and l pps line from a GPS receiver. However, SpaceWire has an additional capability that was added to make it easier - it can insert and receive a special "timecode" word in the data stream.

  4. Intraocular Lens Use in an Astronaut During Long Duration Spaceflight.

    PubMed

    Mader, Thomas H; Gibson, C Robert; Schmid, Josef F; Lipsky, William; Sargsyan, Ashot E; Garcia, Kathleen; Williams, Jeffrey N

    2018-01-01

    The purpose of this paper is to report the first use of an intraocular lens (IOL) in an astronaut during long duration spaceflight (LDSF). An astronaut developed a unilateral cataract and underwent phacoemulsification with insertion of an acrylic IOL. Approximately 15 mo later he flew on a Soyuz spacecraft to the International Space Station (ISS), where he successfully completed a 6-mo mission. Ocular examination, including ultrasound (US), was performed before, during, and after his mission and he was questioned regarding visual changes during each portion of his flight. We documented no change in IOL position during his space mission. This astronaut reported excellent and stable vision during liftoff, entry into microgravity (MG), 6 mo on the ISS, descent, and landing. Our results suggest that modern IOLs are stable, effective, and well tolerated during LDSF.Mader TH, Gibson CR, Schmid JF, Lipsky W, Sargsyan AE, Garcia K, Williams JN. Intraocular lens use in an astronaut during long duration spaceflight. Aerosp Med Hum Perform. 2018; 89(1):63-65.

  5. 3D Position and Velocity Vector Computations of Objects Jettisoned from the International Space Station Using Close-Range Photogrammetry Approach

    NASA Technical Reports Server (NTRS)

    Papanyan, Valeri; Oshle, Edward; Adamo, Daniel

    2008-01-01

    Measurement of the jettisoned object departure trajectory and velocity vector in the International Space Station (ISS) reference frame is vitally important for prompt evaluation of the object s imminent orbit. We report on the first successful application of photogrammetric analysis of the ISS imagery for the prompt computation of the jettisoned object s position and velocity vectors. As post-EVA analyses examples, we present the Floating Potential Probe (FPP) and the Russian "Orlan" Space Suit jettisons, as well as the near-real-time (provided in several hours after the separation) computations of the Video Stanchion Support Assembly Flight Support Assembly (VSSA-FSA) and Early Ammonia Servicer (EAS) jettisons during the US astronauts space-walk. Standard close-range photogrammetry analysis was used during this EVA to analyze two on-board camera image sequences down-linked from the ISS. In this approach the ISS camera orientations were computed from known coordinates of several reference points on the ISS hardware. Then the position of the jettisoned object for each time-frame was computed from its image in each frame of the video-clips. In another, "quick-look" approach used in near-real time, orientation of the cameras was computed from their position (from the ISS CAD model) and operational data (pan and tilt) then location of the jettisoned object was calculated only for several frames of the two synchronized movies. Keywords: Photogrammetry, International Space Station, jettisons, image analysis.

  6. Structure of genes and an insertion element in the methane producing archaebacterium Methanobrevibacter smithii.

    PubMed

    Hamilton, P T; Reeve, J N

    1985-01-01

    DNA fragments cloned from the methanogenic archaebacterium Methanobrevibacter smithii which complement mutations in the purE and proC genes of E. coli have been sequenced. Sequence analyses, transposon mutagenesis and expression in E. coli minicells indicate that purE and proC complementations result from the synthesis of M. smithii polypeptides with molecular weights of 36,697 and 27,836 respectively. The encoding genes appear to be located in operons. The M. smithii genome contains 69% A/T basepairs (bp) which is reflected in unusual codon usages and intergenic regions containing approximately 85% A/T bp. An insertion element, designated ISM1, was found within the cloned M. smithii DNA located adjacent to the proC complementing region. ISM1 is 1381 bp in length, has 29 bp terminal inverted repeat sequences and contains one major ORF encoded in 87% of the ISM1 sequence. ISM1 is mobile, present in approximately 10 copies per genome and integration duplicates 8 bp at the site of insertion. The duplicated sequences show homology with sequences within the 29 bp terminal repeat sequence of ISM1. Comparison of our data with sequences from halophilic archaebacteria suggests that 5'GAANTTTCA and 5'TTTTAATATAAA may be consensus promoter sequences for archaebacteria. These sequences closely resemble the consensus sequences which precede Drosophila heat-shock genes (Pelham 1982; Davidson et al. 1983). Methanogens appear to employ the eubacterial system of mRNA: 16SrRNA hybridization to ensure initiation of translation; the consensus ribosome binding sequence is 5'AGGTGA.

  7. Cassidy conducts MDCA Fuel Reservoir Remove and Replace OPS

    NASA Image and Video Library

    2013-04-10

    ISS035-E-017699 (10 April 2013) --- This is one of several photos documenting the Multi-user Droplet Combustion Apparatus (MDCA) Fuel Reservoir replacement. Here, Expedition 35 Flight Engineer Chris Cassidy removes and replaces one of the Fuel Reservoirs with the MDCA Chamber Insert Assembly (CIA) pulled partially out of the Combustion Chamber. The MDCA Fuel Reservoirs contain the liquid fuel used during droplet combustion experiments. This reservoir change-out was in support of the FLame EXtinguishment (FLEX)-2 experiment, scheduled to be executed by ground controllers.

  8. Cassidy conducts MDCA Fuel Reservoir Remove and Replace OPS

    NASA Image and Video Library

    2013-04-10

    ISS035-E-017712 (10 April 2013)?-- This is one of several photos documenting the Multi-user Droplet Combustion Apparatus (MDCA) Fuel Reservoir replacement in the U.S. lab Destiny. Here, Expedition 35 Flight Engineer Chris Cassidy removes and replaces one of the Fuel Reservoirs with the MDCA Chamber Insert Assembly (CIA) pulled partially out of the Combustion Chamber. The MDCA Fuel Reservoirs contain the liquid fuel used during droplet combustion experiments. This reservoir change-out was in support of the FLame EXtinguishment (FLEX)-2 experiment, scheduled to be executed by ground controllers.

  9. MR-compatibility assessment of MADPET4: a study of interferences between an SiPM-based PET insert and a 7 T MRI system

    NASA Astrophysics Data System (ADS)

    Omidvari, Negar; Topping, Geoffrey; Cabello, Jorge; Paul, Stephan; Schwaiger, Markus; Ziegler, Sibylle I.

    2018-05-01

    Compromises in the design of a positron emission tomography (PET) insert for a magnetic resonance imaging (MRI) system should minimize the deterioration of image quality in both modalities, particularly when simultaneous demanding acquisitions are performed. In this work, the advantages of using individually read-out crystals with high-gain silicon photomultipliers (SiPMs) were studied with a small animal PET insert for a 7 T MRI system, in which the SiPM charge was transferred to outside the MRI scanner using coaxial cables. The interferences between the two systems were studied with three radio-frequency (RF) coil configurations. The effects of PET on the static magnetic field, flip angle distribution, RF noise, and image quality of various MRI sequences (gradient echo, spin echo, and echo planar imaging (EPI) at 1H frequency, and chemical shift imaging at 13C frequency) were investigated. The effects of fast-switching gradient fields and RF pulses on PET count rate were studied, while the PET insert and the readout electronics were not shielded. Operating the insert inside a 1H volume coil, used for RF transmission and reception, limited the MRI to T1-weighted imaging, due to coil detuning and RF attenuation, and resulted in significant PET count loss. Using a surface receive coil allowed all tested MR sequences to be used with the insert, with 45–59% signal-to-noise ratio (SNR) degradation, compared to without PET. With a 1H/13C volume coil inside the insert and shielded by a copper tube, the SNR degradation was limited to 23–30% with all tested sequences. The insert did not introduce any discernible distortions into images of two tested EPI sequences. Use of truncated sinc shaped RF excitation pulses and gradient field switching had negligible effects on PET count rate. However, PET count rate was substantially affected by high-power RF block pulses and temperature variations due to high gradient duty cycles.

  10. Rapid molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus L., based on large Y-chromosomal insertions.

    PubMed

    Bakker, Theo C M; Giger, Thomas; Frommen, Joachim G; Largiadèr, Carlo R

    2017-08-01

    There is a need for rapid and reliable molecular sexing of three-spined sticklebacks, Gasterosteus aculeatus, the supermodel species for evolutionary biology. A DNA region at the 5' end of the sex-linked microsatellite Gac4202 was sequenced for the X chromosome of six females and the Y chromosome of five males from three populations. The Y chromosome contained two large insertions, which did not recombine with the phenotype of sex in a cross of 322 individuals. Genetic variation (SNPs and indels) within the insertions was smaller than on flanking DNA sequences. Three molecular PCR-based sex tests were developed, in which the first, the second or both insertions were covered. In five European populations (from DE, CH, NL, GB) of three-spined sticklebacks, tests with both insertions combined showed two clearly separated bands on agarose minigels in males and one band in females. The tests with the separate insertions gave similar results. Thus, the new molecular sexing method gave rapid and reliable results for sexing three-spined sticklebacks and is an improvement and/or alternative to existing methods.

  11. CHARACTERIZATION AND NUCLEOTIDE SEQUENCE DETERMINATION OF A REPEAT ELEMENT ISOLATED FROM A 2,4,5,-T DEGRADING STRAIN OF PSEUDOMONAS CEPACIA

    EPA Science Inventory

    Pseudomonas cepacia strain AC1100, capable of growth on 2,4,5-trichlorophenoxyacetic acid (2,4,5-T), was mutated to the 2,4,5-T− strain PT88 by a ColE1 :: Tn5 chromosomal insertion. Using cloned DNA from the region flanking the insertion, a 1477-bp sequence (designated RS1100) wa...

  12. Import of honeybee prepromelittin into the endoplasmic reticulum: structural basis for independence of SRP and docking protein.

    PubMed Central

    Müller, G; Zimmermann, R

    1987-01-01

    Honeybee prepromelittin is correctly processed and imported by dog pancreas microsomes. Insertion of prepromelittin into microsomal membranes, as assayed by signal sequence removal, does not depend on signal recognition particle (SRP) and docking protein. We addressed the question as to how prepromelittin bypasses the SRP/docking protein system. Hybrid proteins between prepromelittin, or carboxy-terminally truncated derivatives, and the cytoplasmic protein dihydrofolate reductase from mouse were constructed. These hybrid proteins were analysed for membrane insertion and sequestration into microsomes. The results suggest the following: (i) The signal sequence of prepromelittin is capable of interacting with the SRP/docking protein system, but this interaction is not mandatory for membrane insertion; this is related to the small size of prepromelittin. (ii) In prepromelittin a cluster of negatively charged amino acids must be balanced by a cluster of positively charged amino acids in order to allow membrane insertion. (iii) In general, a signal sequence can be sufficient to mediate membrane insertion independently of SRP and docking protein in the case of short precursor proteins; however, the presence and distribution of charged amino acids within the mature part of these precursors can play distinct roles. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 8. Fig. 9. PMID:2820722

  13. Derivation of Failure Rates and Probability of Failures for the International Space Station Probabilistic Risk Assessment Study

    NASA Technical Reports Server (NTRS)

    Vitali, Roberto; Lutomski, Michael G.

    2004-01-01

    National Aeronautics and Space Administration s (NASA) International Space Station (ISS) Program uses Probabilistic Risk Assessment (PRA) as part of its Continuous Risk Management Process. It is used as a decision and management support tool to not only quantify risk for specific conditions, but more importantly comparing different operational and management options to determine the lowest risk option and provide rationale for management decisions. This paper presents the derivation of the probability distributions used to quantify the failure rates and the probability of failures of the basic events employed in the PRA model of the ISS. The paper will show how a Bayesian approach was used with different sources of data including the actual ISS on orbit failures to enhance the confidence in results of the PRA. As time progresses and more meaningful data is gathered from on orbit failures, an increasingly accurate failure rate probability distribution for the basic events of the ISS PRA model can be obtained. The ISS PRA has been developed by mapping the ISS critical systems such as propulsion, thermal control, or power generation into event sequences diagrams and fault trees. The lowest level of indenture of the fault trees was the orbital replacement units (ORU). The ORU level was chosen consistently with the level of statistically meaningful data that could be obtained from the aerospace industry and from the experts in the field. For example, data was gathered for the solenoid valves present in the propulsion system of the ISS. However valves themselves are composed of parts and the individual failure of these parts was not accounted for in the PRA model. In other words the failure of a spring within a valve was considered a failure of the valve itself.

  14. Norepinephrine transporter: a candidate gene for initial ethanol sensitivity in inbred long-sleep and short-sleep mice.

    PubMed

    Haughey, Heather M; Kaiser, Alan L; Johnson, Thomas E; Bennett, Beth; Sikela, James M; Zahniser, Nancy R

    2005-10-01

    Altered noradrenergic neurotransmission is associated with depression and may contribute to drug abuse and alcoholism. Differential initial sensitivity to ethanol is an important predictor of risk for future alcoholism, making the inbred long-sleep (ILS) and inbred short-sleep (ISS) mice a useful model for identifying genes that may contribute to alcoholism. In this study, molecular biological, neurochemical, and behavioral approaches were used to test the hypothesis that the norepinephrine transporter (NET) contributes to the differences in ethanol-induced loss of righting reflex (LORR) in ILS and ISS mice. We used these mice to investigate the NET as a candidate gene contributing to this phenotype. The ILS and ISS mice carry different DNA haplotypes for NET, showing eight silent differences between allelic coding regions. Only the ILS haplotype is found in other mouse strains thus far sequenced. Brain regional analyses revealed that ILS mice have 30 to 50% lower [3H]NE uptake, NET binding, and NET mRNA levels than ISS mice. Maximal [3H]NE uptake and NET number were reduced, with no change in affinity, in the ILS mice. These neurobiological changes were associated with significant influences on the behavioral phenotype of these mice, as demonstrated by (1) a differential response in the duration of ethanol-induced LORR in ILS and ISS mice pretreated with a NET inhibitor and (2) increased ethanol-induced LORR in LXS recombinant inbred (RI) strains, homozygous for ILS in the NET chromosomal region (44-47 cM), compared with ISS homozygous strains. This is the first report to suggest that the NET gene is one of many possible genetic factors influencing ethanol sensitivity in ILS, ISS, and LXS RI mouse strains.

  15. Insights into the transposable mobilome of Paracoccus spp. (Alphaproteobacteria).

    PubMed

    Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

    2012-01-01

    Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial evolution.

  16. Insights into the Transposable Mobilome of Paracoccus spp. (Alphaproteobacteria)

    PubMed Central

    Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

    2012-01-01

    Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial evolution. PMID:22359677

  17. MiMIC: a highly versatile transposon insertion resource for engineering Drosophila melanogaster genes

    PubMed Central

    Venken, Koen J. T.; Schulze, Karen L.; Haelterman, Nele A.; Pan, Hongling; He, Yuchun; Evans-Holm, Martha; Carlson, Joseph W.; Levis, Robert W.; Spradling, Allan C.; Hoskins, Roger A.; Bellen, Hugo J.

    2011-01-01

    We demonstrate the versatility of a collection of insertions of the transposon Minos mediated integration cassette (MiMIC), in Drosophila melanogaster. MiMIC contains a gene-trap cassette and the yellow+ marker flanked by two inverted bacteriophage ΦC31 attP sites. MiMIC integrates almost at random in the genome to create sites for DNA manipulation. The attP sites allow the replacement of the intervening sequence of the transposon with any other sequence through recombinase mediated cassette exchange (RMCE). We can revert insertions that function as gene traps and cause mutant phenotypes to wild type by RMCE and modify insertions to control GAL4 or QF overexpression systems or perform lineage analysis using the Flp system. Insertions within coding introns can be exchanged with protein-tag cassettes to create fusion proteins to follow protein expression and perform biochemical experiments. The applications of MiMIC vastly extend the Drosophila melanogaster toolkit. PMID:21985007

  18. Active role of a human genomic insert in replication of a yeast artificial chromosome.

    PubMed

    van Brabant, A J; Fangman, W L; Brewer, B J

    1999-06-01

    Yeast artificial chromosomes (YACs) are a common tool for cloning eukaryotic DNA. The manner by which large pieces of foreign DNA are assimilated by yeast cells into a functional chromosome is poorly understood, as is the reason why some of them are stably maintained and some are not. We examined the replication of a stable YAC containing a 240-kb insert of DNA from the human T-cell receptor beta locus. The human insert contains multiple sites that serve as origins of replication. The activity of these origins appears to require the yeast ARS consensus sequence and, as with yeast origins, additional flanking sequences. In addition, the origins in the human insert exhibit a spacing, a range of activation efficiencies, and a variation in times of activation during S phase similar to those found for normal yeast chromosomes. We propose that an appropriate combination of replication origin density, activation times, and initiation efficiencies is necessary for the successful maintenance of YAC inserts.

  19. Alu element insertion in PKLR gene as a novel cause of pyruvate kinase deficiency in Middle Eastern patients.

    PubMed

    Lesmana, Harry; Dyer, Lisa; Li, Xia; Denton, James; Griffiths, Jenna; Chonat, Satheesh; Seu, Katie G; Heeney, Matthew M; Zhang, Kejian; Hopkin, Robert J; Kalfa, Theodosia A

    2018-03-01

    Pyruvate kinase deficiency (PKD) is the most frequent red blood cell enzyme abnormality of the glycolytic pathway and the most common cause of hereditary nonspherocytic hemolytic anemia. Over 250 PKLR-gene mutations have been described, including missense/nonsense, splicing and regulatory mutations, small insertions, small and gross deletions, causing PKD and hemolytic anemia of variable severity. Alu retrotransposons are the most abundant mobile DNA sequences in the human genome, contributing to almost 11% of its mass. Alu insertions have been associated with a number of human diseases either by disrupting a coding region or a splice signal. Here, we report on two unrelated Middle Eastern patients, both born from consanguineous parents, with transfusion-dependent hemolytic anemia, where sequence analysis revealed a homozygous insertion of AluYb9 within exon 6 of the PKLR gene, causing precipitous decrease of PKLR RNA levels. This Alu element insertion consists a previously unrecognized mechanism underlying pathogenesis of PKD. © 2017 Wiley Periodicals, Inc.

  20. Mechanism for DNA transposons to generate introns on genomic scales

    PubMed Central

    Huff, Jason T.; Zilberman, Daniel; Roy, Scott W.

    2017-01-01

    Discovered four decades ago, the existence of introns was one of the most unexpected findings in molecular biology1. Introns are sequences interrupting genes that must be removed as part of mRNA production. Genome sequencing projects have documented that most eukaryotic genes contain at least one and frequently many introns2,3. Comparison of these genomes reveals a history of long evolutionary periods with little intron gain punctuated by episodes of rapid, extensive gain2,3. However, no detailed mechanism for such episodic intron generation has been empirically supported on a sufficient scale, despite several proposals4–8. Here we show how short non-autonomous DNA transposons independently generated hundreds to thousands of introns in the prasinophyte Micromonas pusilla and the pelagophyte Aureococcus anophagefferens. Each transposon carries one splice site. The other splice site is co-opted from gene sequence duplicated upon transposon insertion, allowing perfect splicing out of RNA. The distributions of sequences that can be co-opted are biased with respect to codons, and phasing of transposon-generated introns is similarly biased. These transposons insert between preexisting nucleosomes, so that multiple nearby insertions generate nucleosome-sized intervening segments. Thus, transposon insertion and sequence co-option may explain the intron phase biases2 and prevalence of nucleosome-sized exons9 observed in eukaryotes. Overall, the two independent examples of proliferating elements illustrate a general DNA transposon mechanism plausibly accounting for episodes of rapid, extensive intron gain during eukaryotic evolution2,3. PMID:27760113

  1. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    PubMed

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  2. A Predictive Model of Intein Insertion Site for Use in the Engineering of Molecular Switches

    PubMed Central

    Apgar, James; Ross, Mary; Zuo, Xiao; Dohle, Sarah; Sturtevant, Derek; Shen, Binzhang; de la Vega, Humberto; Lessard, Philip; Lazar, Gabor; Raab, R. Michael

    2012-01-01

    Inteins are intervening protein domains with self-splicing ability that can be used as molecular switches to control activity of their host protein. Successfully engineering an intein into a host protein requires identifying an insertion site that permits intein insertion and splicing while allowing for proper folding of the mature protein post-splicing. By analyzing sequence and structure based properties of native intein insertion sites we have identified four features that showed significant correlation with the location of the intein insertion sites, and therefore may be useful in predicting insertion sites in other proteins that provide native-like intein function. Three of these properties, the distance to the active site and dimer interface site, the SVM score of the splice site cassette, and the sequence conservation of the site showed statistically significant correlation and strong predictive power, with area under the curve (AUC) values of 0.79, 0.76, and 0.73 respectively, while the distance to secondary structure/loop junction showed significance but with less predictive power (AUC of 0.54). In a case study of 20 insertion sites in the XynB xylanase, two features of native insertion sites showed correlation with the splice sites and demonstrated predictive value in selecting non-native splice sites. Structural modeling of intein insertions at two sites highlighted the role that the insertion site location could play on the ability of the intein to modulate activity of the host protein. These findings can be used to enrich the selection of insertion sites capable of supporting intein splicing and hosting an intein switch. PMID:22649521

  3. Whole metagenome profiles of particulates collected from the International Space Station

    DOE PAGES

    Be, Nicholas A.; Avila-Herrera, Aram; Allen, Jonathan E.; ...

    2017-07-17

    Background The built environment of the International Space Station (ISS) is a highly specialized space in terms of both physical characteristics and habitation requirements. It is unique with respect to conditions of microgravity, exposure to space radiation, and increased carbon dioxide concentrations. Additionally, astronauts inhabit a large proportion of this environment. The microbial composition of ISS particulates has been reported; however, its functional genomics, which are pertinent due to potential impact of its constituents on human health and operational mission success, are not yet characterized. Methods This study examined the whole metagenome of ISS microbes at both species- and gene-levelmore » resolution. Air filter and dust samples from the ISS were analyzed and compared to samples collected in a terrestrial cleanroom environment. Furthermore, metagenome mining was carried out to characterize dominant, virulent, and novel microorganisms. The whole genome sequences of select cultivable strains isolated from these samples were extracted from the metagenome and compared. Results Species-level composition in the ISS was found to be largely dominated by Corynebacterium ihumii GD7, with overall microbial diversity being lower in the ISS relative to the cleanroom samples. When examining detection of microbial genes relevant to human health such as antimicrobial resistance and virulence genes, it was found that a larger number of relevant gene categories were observed in the ISS relative to the cleanroom. Strain-level cross-sample comparisons were made for Corynebacterium, Bacillus, and Aspergillus showing possible distinctions in the dominant strain between samples. Conclusion Species-level analyses demonstrated distinct differences between the ISS and cleanroom samples, indicating that the cleanroom population is not necessarily reflective of space habitation environments. Lastly, the overall population of viable microorganisms and the functional diversity inherent to this unique closed environment are of critical interest with respect to future space habitation. Observations and studies such as these will be important to evaluating the conditions required for long-term health of human occupants in such environments.« less

  4. Whole metagenome profiles of particulates collected from the International Space Station

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Be, Nicholas A.; Avila-Herrera, Aram; Allen, Jonathan E.

    Background The built environment of the International Space Station (ISS) is a highly specialized space in terms of both physical characteristics and habitation requirements. It is unique with respect to conditions of microgravity, exposure to space radiation, and increased carbon dioxide concentrations. Additionally, astronauts inhabit a large proportion of this environment. The microbial composition of ISS particulates has been reported; however, its functional genomics, which are pertinent due to potential impact of its constituents on human health and operational mission success, are not yet characterized. Methods This study examined the whole metagenome of ISS microbes at both species- and gene-levelmore » resolution. Air filter and dust samples from the ISS were analyzed and compared to samples collected in a terrestrial cleanroom environment. Furthermore, metagenome mining was carried out to characterize dominant, virulent, and novel microorganisms. The whole genome sequences of select cultivable strains isolated from these samples were extracted from the metagenome and compared. Results Species-level composition in the ISS was found to be largely dominated by Corynebacterium ihumii GD7, with overall microbial diversity being lower in the ISS relative to the cleanroom samples. When examining detection of microbial genes relevant to human health such as antimicrobial resistance and virulence genes, it was found that a larger number of relevant gene categories were observed in the ISS relative to the cleanroom. Strain-level cross-sample comparisons were made for Corynebacterium, Bacillus, and Aspergillus showing possible distinctions in the dominant strain between samples. Conclusion Species-level analyses demonstrated distinct differences between the ISS and cleanroom samples, indicating that the cleanroom population is not necessarily reflective of space habitation environments. Lastly, the overall population of viable microorganisms and the functional diversity inherent to this unique closed environment are of critical interest with respect to future space habitation. Observations and studies such as these will be important to evaluating the conditions required for long-term health of human occupants in such environments.« less

  5. Whole metagenome profiles of particulates collected from the International Space Station.

    PubMed

    Be, Nicholas A; Avila-Herrera, Aram; Allen, Jonathan E; Singh, Nitin; Checinska Sielaff, Aleksandra; Jaing, Crystal; Venkateswaran, Kasthuri

    2017-07-17

    The built environment of the International Space Station (ISS) is a highly specialized space in terms of both physical characteristics and habitation requirements. It is unique with respect to conditions of microgravity, exposure to space radiation, and increased carbon dioxide concentrations. Additionally, astronauts inhabit a large proportion of this environment. The microbial composition of ISS particulates has been reported; however, its functional genomics, which are pertinent due to potential impact of its constituents on human health and operational mission success, are not yet characterized. This study examined the whole metagenome of ISS microbes at both species- and gene-level resolution. Air filter and dust samples from the ISS were analyzed and compared to samples collected in a terrestrial cleanroom environment. Furthermore, metagenome mining was carried out to characterize dominant, virulent, and novel microorganisms. The whole genome sequences of select cultivable strains isolated from these samples were extracted from the metagenome and compared. Species-level composition in the ISS was found to be largely dominated by Corynebacterium ihumii GD7, with overall microbial diversity being lower in the ISS relative to the cleanroom samples. When examining detection of microbial genes relevant to human health such as antimicrobial resistance and virulence genes, it was found that a larger number of relevant gene categories were observed in the ISS relative to the cleanroom. Strain-level cross-sample comparisons were made for Corynebacterium, Bacillus, and Aspergillus showing possible distinctions in the dominant strain between samples. Species-level analyses demonstrated distinct differences between the ISS and cleanroom samples, indicating that the cleanroom population is not necessarily reflective of space habitation environments. The overall population of viable microorganisms and the functional diversity inherent to this unique closed environment are of critical interest with respect to future space habitation. Observations and studies such as these will be important to evaluating the conditions required for long-term health of human occupants in such environments.

  6. Insertion sequences enrichment in extreme Red sea brine pool vent.

    PubMed

    Elbehery, Ali H A; Aziz, Ramy K; Siam, Rania

    2017-03-01

    Mobile genetic elements are major agents of genome diversification and evolution. Limited studies addressed their characteristics, including abundance, and role in extreme habitats. One of the rare natural habitats exposed to multiple-extreme conditions, including high temperature, salinity and concentration of heavy metals, are the Red Sea brine pools. We assessed the abundance and distribution of different mobile genetic elements in four Red Sea brine pools including the world's largest known multiple-extreme deep-sea environment, the Red Sea Atlantis II Deep. We report a gradient in the abundance of mobile genetic elements, dramatically increasing in the harshest environment of the pool. Additionally, we identified a strong association between the abundance of insertion sequences and extreme conditions, being highest in the harshest and deepest layer of the Red Sea Atlantis II Deep. Our comparative analyses of mobile genetic elements in secluded, extreme and relatively non-extreme environments, suggest that insertion sequences predominantly contribute to polyextremophiles genome plasticity.

  7. Complete Genome Sequence of a Novel Newcastle Disease Virus Strain Isolated from a Chicken in West Africa

    PubMed Central

    Kim, Shin-Hee; Nayak, Subhashree; Paldurai, Anandan; Nayak, Baibaswata; Samuel, Arthur; Aplogan, Gilbert L.; Awoume, Kodzo A.; Webby, Richard J.; Ducatez, Mariette F.; Collins, Peter L.

    2012-01-01

    The complete genome sequence of an African Newcastle disease virus (NDV) strain isolated from a chicken in Togo in 2009 was determined. The genome is 15,198 nucleotides (nt) in length and is classified in genotype VII in the class II cluster. Compared to common vaccine strains, the African strain contains a previously described 6-nt insert in the downstream untranslated region of the N gene and a novel 6-nt insert in the HN-L intergenic region. Genome length differences are a marker of the natural history of NDV. This is the first description of a class II NDV strain with a genome of 15,198 nt and a 6-nt insert in the HN-L intergenic region. Sequence divergence relative to vaccine strains was substantial, likely contributes to outbreaks, and illustrates the continued evolution of new NDV strains in West Africa. PMID:22997417

  8. A Sequence of Sorting Strategies.

    ERIC Educational Resources Information Center

    Duncan, David R.; Litwiller, Bonnie H.

    1984-01-01

    Describes eight increasingly sophisticated and efficient sorting algorithms including linear insertion, binary insertion, shellsort, bubble exchange, shakersort, quick sort, straight selection, and tree selection. Provides challenges for the reader and the student to program these efficiently. (JM)

  9. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma

    PubMed Central

    Weiser, Keith C.; Liu, Bin; Hansen, Gwenn M.; Skapura, Darlene; Hentges, Kathryn E.; Yarlagadda, Sujatha; Morse III, Herbert C.

    2007-01-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFκB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision. PMID:17926094

  10. Retroviral insertions in the VISION database identify molecular pathways in mouse lymphoid leukemia and lymphoma.

    PubMed

    Weiser, Keith C; Liu, Bin; Hansen, Gwenn M; Skapura, Darlene; Hentges, Kathryn E; Yarlagadda, Sujatha; Morse Iii, Herbert C; Justice, Monica J

    2007-10-01

    AKXD recombinant inbred (RI) strains develop a variety of leukemias and lymphomas due to somatically acquired insertions of retroviral DNA into the genome of hematopoetic cells that can mutate cellular proto-oncogenes and tumor suppressor genes. We generated a new set of tumors from nine AKXD RI strains selected for their propensity to develop B-cell tumors, the most common type of human hematopoietic cancers. We employed a PCR technique called viral insertion site amplification (VISA) to rapidly isolate genomic sequence at the site of provirus insertion. Here we describe 550 VISA sequence tags (VSTs) that identify 74 common insertion sites (CISs), of which 21 have not been identified previously. Several suspected proto-oncogenes and tumor suppressor genes lie near CISs, providing supportive evidence for their roles in cancer. Furthermore, numerous previously uncharacterized genes lie near CISs, providing a pool of candidate disease genes for future research. Pathway analysis of candidate genes identified several signaling pathways as common and powerful routes to blood cancer, including Notch, E-protein, NFkappaB, and Ras signaling. Misregulation of several Notch signaling genes was confirmed by quantitative RT-PCR. Our data suggest that analyses of insertional mutagenesis on a single genetic background are biased toward the identification of cooperating mutations. This tumor collection represents the most comprehensive study of the genetics of B-cell leukemia and lymphoma development in mice. We have deposited the VST sequences, CISs in a genome viewer, histopathology, and molecular tumor typing data in a public web database called VISION (Viral Insertion Sites Identifying Oncogenes), which is located at http://www.mouse-genome.bcm.tmc.edu/vision .

  11. Phylogenetic Placement of Exact Amplicon Sequences Improves Associations with Clinical Information

    PubMed Central

    McDonald, Daniel; Gonzalez, Antonio; Navas-Molina, Jose A.; Jiang, Lingjing; Xu, Zhenjiang Zech; Winker, Kevin; Kado, Deborah M.; Orwoll, Eric; Manary, Mark; Mirarab, Siavash

    2018-01-01

    ABSTRACT Recent algorithmic advances in amplicon-based microbiome studies enable the inference of exact amplicon sequence fragments. These new methods enable the investigation of sub-operational taxonomic units (sOTU) by removing erroneous sequences. However, short (e.g., 150-nucleotide [nt]) DNA sequence fragments do not contain sufficient phylogenetic signal to reproduce a reasonable tree, introducing a barrier in the utilization of critical phylogenetically aware metrics such as Faith’s PD or UniFrac. Although fragment insertion methods do exist, those methods have not been tested for sOTUs from high-throughput amplicon studies in insertions against a broad reference phylogeny. We benchmarked the SATé-enabled phylogenetic placement (SEPP) technique explicitly against 16S V4 sequence fragments and showed that it outperforms the conceptually problematic but often-used practice of reconstructing de novo phylogenies. In addition, we provide a BSD-licensed QIIME2 plugin (https://github.com/biocore/q2-fragment-insertion) for SEPP and integration into the microbial study management platform QIITA. IMPORTANCE The move from OTU-based to sOTU-based analysis, while providing additional resolution, also introduces computational challenges. We demonstrate that one popular method of dealing with sOTUs (building a de novo tree from the short sequences) can provide incorrect results in human gut metagenomic studies and show that phylogenetic placement of the new sequences with SEPP resolves this problem while also yielding other benefits over existing methods. PMID:29719869

  12. Service Life Extension of the ISS Propulsion System Elements

    NASA Technical Reports Server (NTRS)

    Kamath, Ulhas; Grant, Gregory; Kuznetsov, Sergei; Shaevich, Sergey; Spencer, Victor

    2015-01-01

    The International Space Station (ISS) is a result of international collaboration in building a sophisticated laboratory of an unprecedented scale in Low Earth Orbit. After a complex assembly sequence spanning over a decade, some of the early modules launched at the beginning of the program would reach the end of their certified lives, while the newer modules were just being commissioned into operation. To maximize the return on global investments in this one-of-a-kind orbiting platform that was initially conceived for a service life until 2016, it is essential for the cutting edge research on ISS to continue as long as the station can be sustained safely in orbit. ISS Program is assessing individual modules in detail to extend the service life of the ISS to 2024, and possibly to 2028. Without life extension, Functional Cargo Block (known by its Russian acronym as FGB) and the Service Module (SM), two of the early modules on the Russian Segment, would reach the end of their certified lives in 2013 and 2015 respectively. Both FGB and SM are critical for the propulsive function of the ISS. This paper describes the approach used for the service life extension of the FGB propulsion system. Also presented is an overview of the system description along with the process adopted for developing the life test plans based on considerations of system failure modes, fault tolerance and safety provisions. Tests and analyses performed, important findings and life estimates are summarized. Based on the life extension data, FGB propulsion system, in general, is considered ready for a service life until 2028.

  13. Transposon variation by order during allopolyploidisation between Brassica oleracea and Brassica rapa.

    PubMed

    An, Z; Tang, Z; Ma, B; Mason, A S; Guo, Y; Yin, J; Gao, C; Wei, L; Li, J; Fu, D

    2014-07-01

    Although many studies have shown that transposable element (TE) activation is induced by hybridisation and polyploidisation in plants, much less is known on how different types of TE respond to hybridisation, and the impact of TE-associated sequences on gene function. We investigated the frequency and regularity of putative transposon activation for different types of TE, and determined the impact of TE-associated sequence variation on the genome during allopolyploidisation. We designed different types of TE primers and adopted the Inter-Retrotransposon Amplified Polymorphism (IRAP) method to detect variation in TE-associated sequences during the process of allopolyploidisation between Brassica rapa (AA) and Brassica oleracea (CC), and in successive generations of self-pollinated progeny. In addition, fragments with TE insertions were used to perform Blast2GO analysis to characterise the putative functions of the fragments with TE insertions. Ninety-two primers amplifying 548 loci were used to detect variation in sequences associated with four different orders of TE sequences. TEs could be classed in ascending frequency into LTR-REs, TIRs, LINEs, SINEs and unknown TEs. The frequency of novel variation (putative activation) detected for the four orders of TEs was highest from the F1 to F2 generations, and lowest from the F2 to F3 generations. Functional annotation of sequences with TE insertions showed that genes with TE insertions were mainly involved in metabolic processes and binding, and preferentially functioned in organelles. TE variation in our study severely disturbed the genetic compositions of the different generations, resulting in inconsistencies in genetic clustering. Different types of TE showed different patterns of variation during the process of allopolyploidisation. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  14. Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

    PubMed

    Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

    2015-12-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers.

  15. In vitro optimization of truncated stem-loop II variants of the hammerhead ribozyme for cleavage in low concentrations of magnesium under non-turnover conditions.

    PubMed Central

    Zillmann, M; Limauro, S E; Goodchild, J

    1997-01-01

    By truncating helix II to two base pairs in a hammerhead ribozyme having long flanking sequences (greater than 30 bases), the rate of cleavage in 1 mM magnesium can be increased roughly 100-fold. Replacing most of the nucleotides in a typical stem-loop II with 1-4 randomized nucleotides gave an RNA library that, even before selection, was more active in 1 mM magnesium than the parent ribozyme, but considerably less active than the truncated stem-loop II ribozyme. A novel, multiround selection for intermolecular cleavage was exploited to optimize this library for cleavage in low concentrations of magnesium. After three rounds of selection at sequentially lower concentrations of magnesium, the library cleaved substrate RNA 20-fold faster than the initial pool and was cloned. This pool was heavily enriched for one particular sequence (5'-CGUG-3') that represented 16 of 52 isolates (the next most common sequence was represented only six times). This sequence also represented the most active sequence, exceeding the activity of the short helix II variant under the conditions of the selection, thereby demonstrating the effectiveness of the selection technique. Analysis of the cleavage rates of RNAs made from eight isolates having different four-base insert sequences allowed assignment of highly preferred bases at each position in the insert. Analysis of pool clones having insert of differing lengths showed that, in general, activity decreased as the length of the insert decreased from 4 to 1. This supports the suggested role of stem-loop II in stabilizing the non-Watson-Crick interactions between the conserved bases of the catalytic core. PMID:9214657

  16. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae): Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid.

    PubMed

    Spooner, David M; Ruess, Holly; Iorizzo, Massimo; Senalik, Douglas; Simon, Philipp

    2017-02-01

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results with prior phylogenetic results using plastid and nuclear DNA sequences. We used Illumina sequencing to obtain full plastid sequences of 37 accessions of 20 Daucus taxa and outgroups, analyzed the data with phylogenetic methods, and examined evidence for mitochondrial DNA transfer to the plastid ( Dc MP). Our phylogenetic trees of the entire data set were highly resolved, with 100% bootstrap support for most of the external and many of the internal clades, except for the clade of D. carota and its most closely related species D. syrticus . Subsets of the data, including regions traditionally used as phylogenetically informative regions, provide various degrees of soft congruence with the entire data set. There are areas of hard incongruence, however, with phylogenies using nuclear data. We extended knowledge of a mitochondrial to plastid DNA insertion sequence previously named Dc MP and identified the first instance in flowering plants of a sequence of potential nuclear genome origin inserted into the plastid genome. There is a relationship of inverted repeat junction classes and repeat DNA to phylogeny, but no such relationship with nonsynonymous mutations. Our data have allowed us to (1) produce a well-resolved plastid phylogeny of Daucus , (2) evaluate subsets of the entire plastid data for phylogeny, (3) examine evidence for plastid and nuclear DNA phylogenetic incongruence, and (4) examine mitochondrial and nuclear DNA insertion into the plastid. © 2017 Spooner et al. Published by the Botanical Society of America. This work is licensed under a Creative Commons public domain license (CC0 1.0).

  17. Few mitochondrial DNA sequences are inserted into the turkey (Meleagris gallopavo) nuclear genome: evolutionary analyses and informativity in the domestic lineage.

    PubMed

    Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L

    2018-06-01

    Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.

  18. MRKAd5 HIV-1 Gag/Pol/Nef Vaccine-Induced T-Cell Responses Inadequately Predict Distance of Breakthrough HIV-1 Sequences to the Vaccine or Viral Load

    PubMed Central

    Janes, Holly; Frahm, Nicole; DeCamp, Allan; Rolland, Morgane; Gabriel, Erin; Wolfson, Julian; Hertz, Tomer; Kallas, Esper; Goepfert, Paul; Friedrich, David P.; Corey, Lawrence; Mullins, James I.; McElrath, M. Juliana; Gilbert, Peter

    2012-01-01

    Background The sieve analysis for the Step trial found evidence that breakthrough HIV-1 sequences for MRKAd5/HIV-1 Gag/Pol/Nef vaccine recipients were more divergent from the vaccine insert than placebo sequences in regions with predicted epitopes. We linked the viral sequence data with immune response and acute viral load data to explore mechanisms for and consequences of the observed sieve effect. Methods Ninety-one male participants (37 placebo and 54 vaccine recipients) were included; viral sequences were obtained at the time of HIV-1 diagnosis. T-cell responses were measured 4 weeks post-second vaccination and at the first or second week post-diagnosis. Acute viral load was obtained at RNA-positive and antibody-negative visits. Findings Vaccine recipients had a greater magnitude of post-infection CD8+ T cell response than placebo recipients (median 1.68% vs 1.18%; p = 0·04) and greater breadth of post-infection response (median 4.5 vs 2; p = 0·06). Viral sequences for vaccine recipients were marginally more divergent from the insert than placebo sequences in regions of Nef targeted by pre-infection immune responses (p = 0·04; Pol p = 0·13; Gag p = 0·89). Magnitude and breadth of pre-infection responses did not correlate with distance of the viral sequence to the insert (p>0·50). Acute log viral load trended lower in vaccine versus placebo recipients (estimated mean 4·7 vs 5·1) but the difference was not significant (p = 0·27). Neither was acute viral load associated with distance of the viral sequence to the insert (p>0·30). Interpretation Despite evidence of anamnestic responses, the sieve effect was not well explained by available measures of T-cell immunogenicity. Sequence divergence from the vaccine was not significantly associated with acute viral load. While point estimates suggested weak vaccine suppression of viral load, the result was not significant and more viral load data would be needed to detect suppression. PMID:22952672

  19. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  20. iss048e041836

    NASA Image and Video Library

    2016-07-20

    ISS048e041836 (07/20/2016) --- NASA astronauts Kate Rubins (left) and Jeff Williams (right) prepare to grapple the SpaceX Dragon supply spacecraft from aboard the International Space Station. The nearly 5,000 pounds of supplies and equipment includes science supplies and hardware, including instruments to perform the first-ever DNA sequencing in space, and the first of two identical international docking adapters (IDA.) The IDAs will provide a means for commercial crew spacecraft to dock to the station in the near future as part of NASA’s Commercial Crew Program. Dragon is scheduled to depart the space station Aug. 29 when it will return critical science research back to Earth.

  1. Sequence variations of the partially dominant DELLA gene Rht-B1c in wheat and their functional impacts

    PubMed Central

    Ma, Zhengqiang

    2013-01-01

    Rht-B1c, allelic to the DELLA protein-encoding gene Rht-B1a, is a natural mutation documented in common wheat (Triticum aestivum). It confers variation to a number of traits related to cell and plant morphology, seed dormancy, and photosynthesis. The present study was conducted to examine the sequence variations of Rht-B1c and their functional impacts. The results showed that Rht-B1c was partially dominant or co-dominant for plant height, and exhibited an increased dwarfing effect. At the sequence level, Rht-B1c differed from Rht-B1a by one 2kb Veju retrotransposon insertion, three coding region single nucleotide polymorphisms (SNPs), one 197bp insertion, and four SNPs in the 1kb upstream sequence. Haplotype investigations, association analyses, transient expression assays, and expression profiling showed that the Veju insertion was primarily responsible for the extreme dwarfing effect. It was found that the Veju insertion changed processing of the Rht-B1c transcripts and resulted in DELLA motif primary structure disruption. Expression assays showed that Rht-B1c caused reduction of total Rht-1 transcript levels, and up-regulation of GATA-like transcription factors and genes positively regulated by these factors, suggesting that one way in which Rht-1 proteins affect plant growth and development is through GATA-like transcription factor regulation. PMID:23918966

  2. Detection of antimicrobial resistance genes associated with the International Space Station environmental surfaces

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Urbaniak, C.; Sielaff, A. Checinska; Frey, K. G.

    Antimicrobial resistance (AMR) is a global health issue. In an effort to minimize this threat to astronauts, who may be immunocompromised and thus at a greater risk of infection from antimicrobial resistant pathogens, a comprehensive study of the ISS “resistome’ was conducted. Using whole genome sequencing (WGS) and disc diffusion antibiotic resistance assays, 9 biosafety level 2 organisms isolated from the ISS were assessed for their antibiotic resistance. Molecular analysis of AMR genes from 24 surface samples collected from the ISS during 3 different sampling events over a span of a year were analyzed with Ion AmpliSeq™ and metagenomics. Discmore » diffusion assays showed that Enterobacter bugandensis strains were resistant to all 9 antibiotics tested and Staphylococcus haemolyticus being resistant to none. Ion AmpliSeq™ revealed that 123 AMR genes were found, with those responsible for beta-lactam and trimethoprim resistance being the most abundant and widespread. Using a variety of methods, the genes involved in antimicrobial resistance have been examined for the first time from the ISS. Lastly, this information could lead to mitigation strategies to maintain astronaut health during long duration space missions when return to Earth for treatment is not possible.« less

  3. Detection of antimicrobial resistance genes associated with the International Space Station environmental surfaces

    DOE PAGES

    Urbaniak, C.; Sielaff, A. Checinska; Frey, K. G.; ...

    2018-01-16

    Antimicrobial resistance (AMR) is a global health issue. In an effort to minimize this threat to astronauts, who may be immunocompromised and thus at a greater risk of infection from antimicrobial resistant pathogens, a comprehensive study of the ISS “resistome’ was conducted. Using whole genome sequencing (WGS) and disc diffusion antibiotic resistance assays, 9 biosafety level 2 organisms isolated from the ISS were assessed for their antibiotic resistance. Molecular analysis of AMR genes from 24 surface samples collected from the ISS during 3 different sampling events over a span of a year were analyzed with Ion AmpliSeq™ and metagenomics. Discmore » diffusion assays showed that Enterobacter bugandensis strains were resistant to all 9 antibiotics tested and Staphylococcus haemolyticus being resistant to none. Ion AmpliSeq™ revealed that 123 AMR genes were found, with those responsible for beta-lactam and trimethoprim resistance being the most abundant and widespread. Using a variety of methods, the genes involved in antimicrobial resistance have been examined for the first time from the ISS. Lastly, this information could lead to mitigation strategies to maintain astronaut health during long duration space missions when return to Earth for treatment is not possible.« less

  4. STS-100 Photo-op/Shut-up/Depart O&C/Launch Endeavour On Orbit/Landing/Crew Egress

    NASA Technical Reports Server (NTRS)

    2001-01-01

    This video shows an overview of crew activities from STS-100. The crew of Space Shuttle Shuttle Endeavour includes: Commander Kent Rominger; Pilot Jeffrey Ashby; and Mission Specialists Chris Hadfield, John Phillips, Scott Parazynski, Umberto Guidoni, and Yuri Lonchakov. Sections of the video include: Photo-op; Suit-up; Depart O&C; Ingress; Launch with Playbacks; On-orbit; Landing with Playbacks; Crew Egress & Departure. Voiceover narration introduces the astronauts at their pre-flight meal, and continues during the video, except for the launch and landing sequences. Launch playback views include: NEXT; Beach Tracker; VAB; PAD-A; Tower-1; UCS-15; Grandstand; OTV-60; OTV-70; OTV-71; DOAMS; UCS-10 Tracker; UCS-23 Tracker; On-board Ascent Camera. The On-orbit section of the video shows preparations for an extravehicular activity (EVA) to install Canadarm 2 on the International Space Station (ISS). Preparation for docking with the ISS, and the docking of the orbiter and ISS are shown. The attachment of Canadarm 2 and the Raffaello Logistics Module, a resupply vehicle, are shown. The crew also undertakes some maintenance of the ISS. Landing playback views include: TV-1; TV-2; LRO-1; LRO-2; PPOV.

  5. Detection of antimicrobial resistance genes associated with the International Space Station environmental surfaces.

    PubMed

    Urbaniak, C; Sielaff, A Checinska; Frey, K G; Allen, J E; Singh, N; Jaing, C; Wheeler, K; Venkateswaran, K

    2018-01-16

    Antimicrobial resistance (AMR) is a global health issue. In an effort to minimize this threat to astronauts, who may be immunocompromised and thus at a greater risk of infection from antimicrobial resistant pathogens, a comprehensive study of the ISS "resistome' was conducted. Using whole genome sequencing (WGS) and disc diffusion antibiotic resistance assays, 9 biosafety level 2 organisms isolated from the ISS were assessed for their antibiotic resistance. Molecular analysis of AMR genes from 24 surface samples collected from the ISS during 3 different sampling events over a span of a year were analyzed with Ion AmpliSeq ™ and metagenomics. Disc diffusion assays showed that Enterobacter bugandensis strains were resistant to all 9 antibiotics tested and Staphylococcus haemolyticus being resistant to none. Ion AmpliSeq ™ revealed that 123 AMR genes were found, with those responsible for beta-lactam and trimethoprim resistance being the most abundant and widespread. Using a variety of methods, the genes involved in antimicrobial resistance have been examined for the first time from the ISS. This information could lead to mitigation strategies to maintain astronaut health during long duration space missions when return to Earth for treatment is not possible.

  6. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

  7. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

    PubMed Central

    2012-01-01

    Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

  8. Stable zymomonas mobilis xylose and arabinose fermenting strains

    DOEpatents

    Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Taipei, TW

    2008-04-08

    The present invention briefly includes a transposon for stable insertion of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, and at least one promoter for expression of the structural genes in the bacterium, a pair of inverted insertion sequences, the operons contained inside the insertion sequences, and a transposase gene located outside of the insertion sequences. A plasmid shuttle vector for transformation of foreign genes into a bacterial genome, comprising at least one operon having structural genes encoding enzymes selected from the group consisting of xylAxylB, araBAD and tal/tkt, at least one promoter for expression of the structural genes in the bacterium, and at least two DNA fragments having homology with a gene in the bacterial genome to be transformed, is also provided.The transposon and shuttle vectors are useful in constructing significantly different Zymomonas mobilis strains, according to the present invention, which are useful in the conversion of the cellulose derived pentose sugars into fuels and chemicals, using traditional fermentation technology, because they are stable for expression in a non-selection medium.

  9. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity

    PubMed Central

    Traverse, Charles C.

    2017-01-01

    ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848

  10. [Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

    PubMed

    Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

    2011-03-01

    To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

  11. Equivalent Indels – Ambiguous Functional Classes and Redundancy in Databases

    PubMed Central

    Assmus, Jens; Kleffe, Jürgen; Schmitt, Armin O.; Brockmann, Gudrun A.

    2013-01-01

    There is considerable interest in studying sequenced variations. However, while the positions of substitutions are uniquely identifiable by sequence alignment, the location of insertions and deletions still poses problems. Each insertion and deletion causes a change of sequence. Yet, due to low complexity or repetitive sequence structures, the same indel can sometimes be annotated in different ways. Two indels which differ in allele sequence and position can be one and the same, i.e. the alternative sequence of the whole chromosome is identical in both cases and, therefore, the two deletions are biologically equivalent. In such a case, it is impossible to identify the exact position of an indel merely based on sequence alignment. Thus, variation entries in a mutation database are not necessarily uniquely defined. We prove the existence of a contiguous region around an indel in which all deletions of the same length are biologically identical. Databases often show only one of several possible locations for a given variation. Furthermore, different data base entries can represent equivalent variation events. We identified 1,045,590 such problematic entries of insertions and deletions out of 5,860,408 indel entries in the current human database of Ensembl. Equivalent indels are found in sequence regions of different functions like exons, introns or 5' and 3' UTRs. One and the same variation can be assigned to several different functional classifications of which only one is correct. We implemented an algorithm that determines for each indel database entry its complete set of equivalent indels which is uniquely characterized by the indel itself and a given interval of the reference sequence. PMID:23658777

  12. Night galaxy sequence

    NASA Image and Video Library

    2015-05-14

    ISS043E193686 (05/14/2015) --- NASA astronaut Terry Virts commander of Expedition 43 on the International Space Station tweeted this night Earth observation with the comment: "This reddish brownish layer of our atmosphere is facinating- it's made of O and OH and is only seen in certain areas".

  13. Mapping Sequence performed during the STS-120 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2007-10-25

    ISS016-E-005979 (25 Oct. 2007) --- Space Shuttle Discovery's crew cabin is featured in this close-up image photographed by an Expedition 16 crewmember during a backflip maneuver performed by the approaching visitors (STS-120) to the International Space Station.

  14. Evidence of pathogenic microbes in the International Space Station drinking water: reason for concern?

    NASA Technical Reports Server (NTRS)

    La Duc, Myron T.; Sumner, Randall; Pierson, Duane; Venkat, Parth; Venkateswaran, Kasthuri

    2004-01-01

    Molecular analyses were carried out on four preflight and six postflight International Space Station (ISS)-associated potable water samples at various stages of purification, storage, and transport, to ascertain their associated microbial diversities and overall microbial burdens. Following DNA extraction, PCR amplification, and molecular cloning procedures, rDNA sequences closely related to pathogenic species of Acidovorax, Afipia, Brevundimonas, Propionibacterium, Serratia, and others were recovered in varying abundance. Retrieval of sequences arising from the iodine (biocide)-reducing Delftia acidovorans in postflight waters is also of concern. Total microbial burdens of ISS potable waters were derived from data generated by an ATP-based enumeration procedure, with results ranging from 0 to 4.9 x 10(4) cells/ml. Regardless of innate biases in sample collection and analysis, such circumstantial evidence for the presence of viable, intact pathogenic cells should not be taken lightly. Implementation of new cultivation approaches and/or viability-based assays are requisite to confirm such an occurrence.

  15. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  16. Plastome Sequencing of Ten Nonmodel Crop Species Uncovers a Large Insertion of Mitochondrial DNA in Cashew.

    PubMed

    Rabah, Samar O; Lee, Chaehee; Hajrah, Nahid H; Makki, Rania M; Alharby, Hesham F; Alhebshi, Alawiah M; Sabir, Jamal S M; Jansen, Robert K; Ruhlman, Tracey A

    2017-11-01

    In plant evolution, intracellular gene transfer (IGT) is a prevalent, ongoing process. While nuclear and mitochondrial genomes are known to integrate foreign DNA via IGT and horizontal gene transfer (HGT), plastid genomes (plastomes) have resisted foreign DNA incorporation and only recently has IGT been uncovered in the plastomes of a few land plants. In this study, we completed plastome sequences for l0 crop species and describe a number of structural features including variation in gene and intron content, inversions, and expansion and contraction of the inverted repeat (IR). We identified a putative in cinnamon ( J. Presl) and other sequenced Lauraceae and an apparent functional transfer of to the nucleus of quinoa ( Willd.). In the orchard tree cashew ( L.), we report the insertion of an ∼6.7-kb fragment of mitochondrial DNA into the plastome IR. BLASTn analyses returned high identity hits to mitogenome sequences including an intact open reading frame. Using three plastome markers for five species of , we generated a phylogeny to investigate the distribution and timing of the insertion. Four species share the insertion, suggesting that this event occurred <20 million yr ago in a single clade in the genus. Our study extends the observation of mitochondrial to plastome IGT to include long-lived tree species. While previous studies have suggested possible mechanisms facilitating IGT to the plastome, more examples of this phenomenon, along with more complete mitogenome sequences, will be required before a common, or variable, mechanism can be elucidated. Copyright © 2017 Crop Science Society of America.

  17. Medical Operations Console Procedure Evaluation: BME Response to Crew Call Down for an Emergency

    NASA Technical Reports Server (NTRS)

    Johnson-Troop; Pettys, Marianne; Hurst, Victor, IV; Smaka, Todd; Paul, Bonnie; Rosenquist, Kevin; Gast, Karin; Gillis, David; McCulley, Phyllis

    2006-01-01

    International Space Station (ISS) Mission Operations are managed by multiple flight control disciplines located at the lead Mission Control Center (MCC) at NASA-Johnson Space Center (JSC). ISS Medical Operations are supported by the complementary roles of Flight Surgeons (Surgeon) and Biomedical Engineer (BME) flight controllers. The Surgeon, a board certified physician, oversees all medical concerns of the crew and the BME provides operational and engineering support for Medical Operations Crew Health Care System. ISS Medical Operations is currently addressing the coordinated response to a crew call down for an emergent medical event, in particular when the BME is the only Medical Operations representative in MCC. In this case, the console procedure BME Response to Crew Call Down for an Emergency will be used. The procedure instructs the BME to contact a Surgeon as soon as possible, coordinate with other flight disciplines to establish a Private Medical Conference (PMC) for the crew and Surgeon, gather information from the crew if time permits, and provide Surgeon with pertinent console resources. It is paramount that this procedure is clearly written and easily navigated to assist the BME to respond consistently and efficiently. A total of five BME flight controllers participated in the study. Each BME participant sat in a simulated MCC environment at a console configured with resources specific to the BME MCC console and was presented with two scripted emergency call downs from an ISS crew member. Each participant used the procedure while interacting with analog MCC disciplines to respond to the crew call down. Audio and video recordings of the simulations were analyzed and each BME participant's actions were compared to the procedure. Structured debriefs were conducted at the conclusion of both simulations. The procedure was evaluated for its ability to elicit consistent responses from each BME participant. Trials were examined for deviations in procedure task completion and/or navigation, in particular the execution of the Surgeon call sequence. Debrief comments were used to analyze unclear procedural steps and to discern any discrepancies between the procedure and generally accepted BME actions. The sequence followed by BME participants differed considerably from the sequence intended by the procedure. Common deviations included the call sequence used to contact Surgeon, the content of BME and crew interaction and the gathering of pertinent console resources. Differing perceptions of task priority and imprecise language seem to have caused multiple deviations from the procedure s intended sequence. The study generated 40 recommendations for the procedure, of which 34 are being implemented. These recommendations address improving the clarity of the instructions, identifying training considerations, expediting Surgeon contact, improving cues for anticipated flight control team communication and identifying missing console tools.

  18. Materials Science Research Rack Onboard the International Space Station Hardware and Operations

    NASA Technical Reports Server (NTRS)

    Lehman, John R.; Frazier, Natalie C.; Johnson, Jimmie

    2012-01-01

    The Materials Science Research Rack (MSRR) is a research facility developed under a cooperative research agreement between NASA and ESA for materials science investigations on the International Space Station (ISS). MSRR was launched on STS-128 in August 2009, and is currently installed in the U.S. Destiny Laboratory Module. Since that time, MSRR has performed virtually flawlessly, logging more than 620 hours of operating time. The MSRR accommodates advanced investigations in the microgravity environment on the ISS for basic materials science research in areas such as solidification of metals and alloys. The purpose is to advance the scientific understanding of materials processing as affected by microgravity and to gain insight into the physical behavior of materials processing. MSRR allows for the study of a variety of materials including metals, ceramics, semiconductor crystals, and glasses. Materials science research benefits from the microgravity environment of space, where the researcher can better isolate chemical and thermal properties of materials from the effects of gravity. With this knowledge, reliable predictions can be made about the conditions required on Earth to achieve improved materials. MSRR is a highly automated facility with a modular design capable of supporting multiple types of investigations. Currently the NASA-provided Rack Support Subsystem provides services (power, thermal control, vacuum access, and command and data handling) to the ESA developed Materials Science Laboratory (MSL) which accommodates interchangeable Furnace Inserts (FI). Two ESA-developed FIs are presently available on the ISS: the Low Gradient Furnace (LGF) and the Solidification and Quenching Furnace (SQF). Sample-Cartridge Assemblies (SCAs), each containing one or more material samples, are installed in the FI by the crew and can be processed at temperatures up to 1400 C. Once an SCA is installed, the experiment can be run by automatic command or science conducted via telemetry commands from the ground. Initially, 12 SCAs were processed in the first furnace insert for a team of European and US investigators. After these samples were processed the Furnaces Inserts were exchanged and an additional single sample was processed. The processed samples have been returned to Earth for evaluation and comparison of their properties to samples similarly processed on the ground. A preliminary examination of the samples indicates that the majority of the desired science objectives have been successfully met leading to significant improvements in the understanding of alloy solidification processes. Six SCAs were launched on Space Shuttle Mission STS-135 in July 2011 for processing during the Fall of 2011. Additional batches are planned for future processing. This facility is available to support additional materials science investigations through programs such as the US National Laboratory, Technology Development, NASA Research Announcements, and others.

  19. Determination of Membrane-Insertion Free Energies by Molecular Dynamics Simulations

    PubMed Central

    Gumbart, James; Roux, Benoît

    2012-01-01

    The accurate prediction of membrane-insertion probability for arbitrary protein sequences is a critical challenge to identifying membrane proteins and determining their folded structures. Although algorithms based on sequence statistics have had moderate success, a complete understanding of the energetic factors that drive the insertion of membrane proteins is essential to thoroughly meeting this challenge. In the last few years, numerous attempts to define a free-energy scale for amino-acid insertion have been made, yet disagreement between most experimental and theoretical scales persists. However, for a recently resolved water-to-bilayer scale, it is found that molecular dynamics simulations that carefully mimic the conditions of the experiment can reproduce experimental free energies, even when using the same force field as previous computational studies that were cited as evidence of this disagreement. Therefore, it is suggested that experimental and simulation-based scales can both be accurate and that discrepancies stem from disparities in the microscopic processes being considered rather than methodological errors. Furthermore, these disparities make the development of a single universally applicable membrane-insertion free energy scale difficult. PMID:22385850

  20. The Design and Analysis of Transposon-Insertion Sequencing Experiments

    PubMed Central

    Chao, Michael C.; Abel, Sören; Davis, Brigid M.; Waldor, Matthew K.

    2016-01-01

    Preface Transposon-insertion sequencing (TIS) is a powerful approach that can be widely applied to genome-wide definition of loci that are required for growth in diverse conditions. However, experimental design choices and stochastic biological processes can heavily influence the results of TIS experiments and affect downstream statistical analysis. Here, we discuss TIS experimental parameters and how these factors relate to the benefits and limitations of the various statistical frameworks that can be applied to computational analysis of TIS data. PMID:26775926

  1. Word and frame synchronization with verification for PPM optical communications

    NASA Technical Reports Server (NTRS)

    Marshall, William K.

    1986-01-01

    A method for obtaining word and frame synchronization in pulse position modulated optical communication systems is described. The method uses a short sync sequence inserted at the beginning of each data frame and a verification procedure to distinguish between inserted and randomly occurring sequences at the receiver. This results in an easy to implement sync system which provides reliable synchronization even at high symbol error rates. Results are given for the application of this approach to a highly energy efficient 256-ary PPM test system.

  2. QuickMap: a public tool for large-scale gene therapy vector insertion site mapping and analysis.

    PubMed

    Appelt, J-U; Giordano, F A; Ecker, M; Roeder, I; Grund, N; Hotz-Wagenblatt, A; Opelz, G; Zeller, W J; Allgayer, H; Fruehauf, S; Laufs, S

    2009-07-01

    Several events of insertional mutagenesis in pre-clinical and clinical gene therapy studies have created intense interest in assessing the genomic insertion profiles of gene therapy vectors. For the construction of such profiles, vector-flanking sequences detected by inverse PCR, linear amplification-mediated-PCR or ligation-mediated-PCR need to be mapped to the host cell's genome and compared to a reference set. Although remarkable progress has been achieved in mapping gene therapy vector insertion sites, public reference sets are lacking, as are the possibilities to quickly detect non-random patterns in experimental data. We developed a tool termed QuickMap, which uniformly maps and analyzes human and murine vector-flanking sequences within seconds (available at www.gtsg.org). Besides information about hits in chromosomes and fragile sites, QuickMap automatically determines insertion frequencies in +/- 250 kb adjacency to genes, cancer genes, pseudogenes, transcription factor and (post-transcriptional) miRNA binding sites, CpG islands and repetitive elements (short interspersed nuclear elements (SINE), long interspersed nuclear elements (LINE), Type II elements and LTR elements). Additionally, all experimental frequencies are compared with the data obtained from a reference set, containing 1 000 000 random integrations ('random set'). Thus, for the first time a tool allowing high-throughput profiling of gene therapy vector insertion sites is available. It provides a basis for large-scale insertion site analyses, which is now urgently needed to discover novel gene therapy vectors with 'safe' insertion profiles.

  3. The DECLIC Research Facility - a Fertile Platform for NASA/CNES Scientific Collaboration

    NASA Technical Reports Server (NTRS)

    Hicks, Michael C.; Hegde,Uday G.; Hahn, Inseob; Strutzenberg, Louise S.; Pont, Gabriel; Zappoli, Bernard

    2012-01-01

    The DECLIC (Device for the Study of Critical Liquids and Crystalization) Facility was launched to the International Space Station (ISS) on Shuttle flight 17-A (August 2009) and has been in service for a little over three years. Activity from the three originally planned investigations, the HTI (High Temperature Insert) investigation, the ALI (Alice Like Insert) investigation and the DSI (Directional Solidication Insert) investigation has led to fruitful collaborations among a team of scientists, sponsored by NASA and CNES, to extend the utility of the inserts and the breadth of science beyond its initial scope. These follow-on investigations plan to use inserts that have been returned to earth for refurbishment, two of which (i.e., HTI-R and DSI-R) simply entail changing the test sample and the third (i.e., ALI-R) entails a slight hardware modication to allow for precise changes in sample volume. The first investigation, the Supercritical Water Mixture (SCWM) experiment, uses the refurbished HTI-R, which will accommodate a dilute aqueous mixture of Na2SO4 -0.5% w. This investigation will extend earlier observations of pure water at near-critical conditions. The second experiment uses a modified insert, the DSI-R, with a different concentration of succinonitrile-camphor than the original flight sample. This will allow, among other objectives, a detailed study of dendritic sidebranch formation in extended three-dimensional arrays, with the goal of elucidating whether noise amplication and/or a deterministic limit cycle is the main cause of sidebranch formation. The final experiment, the ALI-R, uses a sample cell with variable density to allow for additional observations of thermo-physical properties on SF6 at near critical conditions. The presentation will provide a discussion of the DECLIC facility's hardware, its modied inserts, and an overview of the extended science that will be achieved through these collaborative activities.

  4. Construction and sequence sampling of deep-coverage, large-insert BAC libraries for three model lepidopteran species

    PubMed Central

    Wu, Chengcang; Proestou, Dina; Carter, Dorothy; Nicholson, Erica; Santos, Filippe; Zhao, Shaying; Zhang, Hong-Bin; Goldsmith, Marian R

    2009-01-01

    Background Manduca sexta, Heliothis virescens, and Heliconius erato represent three widely-used insect model species for genomic and fundamental studies in Lepidoptera. Large-insert BAC libraries of these insects are critical resources for many molecular studies, including physical mapping and genome sequencing, but not available to date. Results We report the construction and characterization of six large-insert BAC libraries for the three species and sampling sequence analysis of the genomes. The six BAC libraries were constructed with two restriction enzymes, two libraries for each species, and each has an average clone insert size ranging from 152–175 kb. We estimated that the genome coverage of each library ranged from 6–9 ×, with the two combined libraries of each species being equivalent to 13.0–16.3 × haploid genomes. The genome coverage, quality and utility of the libraries were further confirmed by library screening using 6~8 putative single-copy probes. To provide a first glimpse into these genomes, we sequenced and analyzed the BAC ends of ~200 clones randomly selected from the libraries of each species. The data revealed that the genomes are AT-rich, contain relatively small fractions of repeat elements with a majority belonging to the category of low complexity repeats, and are more abundant in retro-elements than DNA transposons. Among the species, the H. erato genome is somewhat more abundant in repeat elements and simple repeats than those of M. sexta and H. virescens. The BLAST analysis of the BAC end sequences suggested that the evolution of the three genomes is widely varied, with the genome of H. virescens being the most conserved as a typical lepidopteran, whereas both genomes of H. erato and M. sexta appear to have evolved significantly, resulting in a higher level of species- or evolutionary lineage-specific sequences. Conclusion The high-quality and large-insert BAC libraries of the insects, together with the identified BACs containing genes of interest, provide valuable information, resources and tools for comprehensive understanding and studies of the insect genomes and for addressing many fundamental questions in Lepidoptera. The sample of the genomic sequences provides the first insight into the constitution and evolution of the insect genomes. PMID:19558662

  5. Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers

    PubMed Central

    2012-01-01

    Background Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Results Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. Conclusions This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion. PMID:22541534

  6. Orangutan Alu quiescence reveals possible source element: support for ancient backseat drivers.

    PubMed

    Walker, Jerilyn A; Konkel, Miriam K; Ullmer, Brygg; Monceaux, Christopher P; Ryder, Oliver A; Hubley, Robert; Smit, Arian Fa; Batzer, Mark A

    2012-04-30

    Sequence analysis of the orangutan genome revealed that recent proliferative activity of Alu elements has been uncharacteristically quiescent in the Pongo (orangutan) lineage, compared with all previously studied primate genomes. With relatively few young polymorphic insertions, the genomic landscape of the orangutan seemed like the ideal place to search for a driver, or source element, of Alu retrotransposition. Here we report the identification of a nearly pristine insertion possessing all the known putative hallmarks of a retrotranspositionally competent Alu element. It is located in an intronic sequence of the DGKB gene on chromosome 7 and is highly conserved in Hominidae (the great apes), but absent from Hylobatidae (gibbon and siamang). We provide evidence for the evolution of a lineage-specific subfamily of this shared Alu insertion in orangutans and possibly the lineage leading to humans. In the orangutan genome, this insertion contains three orangutan-specific diagnostic mutations which are characteristic of the youngest polymorphic Alu subfamily, AluYe5b5_Pongo. In the Homininae lineage (human, chimpanzee and gorilla), this insertion has acquired three different mutations which are also found in a single human-specific Alu insertion. This seemingly stealth-like amplification, ongoing at a very low rate over millions of years of evolution, suggests that this shared insertion may represent an ancient backseat driver of Alu element expansion.

  7. A Metagenome-Wide Association Study and Arrayed Mutant Library Confirm Acetobacter Lipopolysaccharide Genes Are Necessary for Association with Drosophila melanogaster.

    PubMed

    White, K Makay; Matthews, Melinda K; Hughes, Rachel C; Sommer, Andrew J; Griffitts, Joel S; Newell, Peter D; Chaston, John M

    2018-03-28

    A metagenome wide association (MGWA) study of bacterial host association determinants in Drosophila predicted that LPS biosynthesis genes are significantly associated with host colonization. We were unable to create site-directed mutants for each of the predicted genes in Acetobacter , so we created an arrayed transposon insertion library using Acetobacter fabarum DsW_054 isolated from Drosophila Creation of the A. fabarum DsW_054 gene knock-out library was performed by combinatorial mapping and Illumina sequencing of random transposon insertion mutants. Transposon insertion locations for 6,418 mutants were successfully mapped, including hits within 63% of annotated genes in the A. fabarum DsW_054 genome. For 45/45 members of the library, insertion sites were verified by arbitrary PCR and Sanger sequencing. Mutants with insertions in four different LPS biosynthesis genes were selected from the library to validate the MGWA predictions. Insertion mutations in two genes biosynthetically upstream of Lipid-A formation, lpxC and lpxB , show significant differences in host association, whereas mutations in two genes encoding LPS biosynthesis functions downstream of Lipid-A biosynthesis had no effect. These results suggest an impact of bacterial cell surface molecules on the bacterial capacity for host association. Also, the transposon insertion mutant library will be a useful resource for ongoing research on the genetic basis for Acetobacter traits. Copyright © 2018 White et al.

  8. Antigenic Diversity of the Plasmodium vivax Circumsporozoite Protein in Parasite Isolates of Western Colombia

    PubMed Central

    Hernández-Martínez, Miguel Ángel; Escalante, Ananías A.; Arévalo-Herrera, Myriam; Herrera, Sócrates

    2011-01-01

    Circumsporozoite (CS) protein is a malaria antigen involved in sporozoite invasion of hepatocytes, and thus considered to have good vaccine potential. We evaluated the polymorphism of the Plasmodium vivax CS gene in 24 parasite isolates collected from malaria-endemic areas of Colombia. We sequenced 27 alleles, most of which (25/27) corresponded to the VK247 genotype and the remainder to the VK210 type. All VK247 alleles presented a mutation (Gly → Asn) at position 28 in the N-terminal region, whereas the C-terminal presented three insertions: the ANKKAGDAG, which is common in all VK247 isolates; 12 alleles presented the insertion GAGGQAAGGNAANKKAGDAG; and 5 alleles presented the insertion GGNAGGNA. Both repeat regions were polymorphic in gene sequence and size. Sequences coding for B-, T-CD4+, and T-CD8+ cell epitopes were found to be conserved. This study confirms the high polymorphism of the repeat domain and the highly conserved nature of the flanking regions. PMID:21292878

  9. Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

    PubMed

    Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

    2015-04-01

    In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. SHOX gene defects and selected dysmorphic signs in patients of idiopathic short stature and Léri-Weill dyschondrosteosis.

    PubMed

    Hirschfeldova, K; Solc, R; Baxova, A; Zapletalova, J; Kebrdlova, V; Gaillyova, R; Prasilova, S; Soukalova, J; Mihalova, R; Lnenicka, P; Florianova, M; Stekrova, J

    2012-01-10

    The aim of the study was to analyze frequency of SHOX gene defects and selected dysmorphic signs in patients of both idiopathic short stature (ISS) and Léri-Weill dyschondrosteosis (LWD), all derived from the Czech population. Overall, 98 subjects were analyzed in the study. Inclusion criteria were the presence of short stature (-2.0 SD), in combination with at least one of the selected dysmorphic signs for the ISS+ group; and the presence of Madelung deformity, without positive karyotyping for the LWD+ group. Each proband was analyzed by use of P018 MLPA kit, which covers SHOX and its regulatory sequences. Additionally, mutational analysis was done of the coding portions of the SHOX. Both extent and breakpoint localizations in the deletions/duplications found were quite variable. Some PAR1 rearrangements were detected, without obvious phenotypic association. In the ISS+ group, MLPA analysis detected four PAR1 deletions associated with a SHOX gene defect, PAR1 duplication with an ambiguous effect, and two SHOX mutations (13.7%). In the LWD+ group, MLPA analysis detected nine deletions in PAR1 region, with a deleterious effect on SHOX, first reported case of isolated SHOX enhancer duplication, and SHOX mutation (68.8%). In both ISS+ and LWD+ groups were positivity associated with a disproportionately short stature; in the ISS+ group, in combination with muscular hypertrophy. It seems that small PAR1 rearrangements might be quite frequent in the population. Our study suggests disproportionateness, especially in combination with muscular hypertrophy, as relevant indicators of ISS to be the effect of SHOX defect. Copyright © 2011 Elsevier B.V. All rights reserved.

  11. Development of a Human Behavior and Performance Training Curriculum for ISS Astronauts

    NASA Technical Reports Server (NTRS)

    VanderArk, Steve; Tomi, Leena; Vassin, Alexander; Inoue, Natsuhiko; Bessone, Lorendana; OConnor, Sharon; Mukai, Chiaki; Coffee, Emily; Sipes, Walter; Salnitskiy, Vyecheslav; hide

    2007-01-01

    The paper will describe the DACUM process and summarize the core competencies that were agreed upon, internationally, as important for ISS astronauts. The paper will further discuss the ongoing work being completed by the subgroup, Human Behaviour and Performance Training Working Group, including defining the competencies and behavioural markers. Finally, an overview of remaining work will be provided, including determining which competencies require formal training and which require no formal training, developing training objectives, sequencing the training, and establishing how to assess training effectiveness. DISCUSSION: Designing a common set of goals for behavioural training has been the desire of the SHBP WG since its inception in 1998. This group, along with training specialists and astronauts, are making great strides toward defining these competencies. The road ahead will be exceedingly challenging as training objectives are defined and a training flow is proposed to the MCOP; with proposed ISS crews increasing to six people in the near future, such enhanced behavioural training may be all the more essential for mission success.

  12. Healthy offspring from freeze-dried mouse spermatozoa held on the International Space Station for 9 months

    PubMed Central

    Wakayama, Sayaka; Kamada, Yuko; Yamanaka, Kaori; Kohda, Takashi; Suzuki, Hiromi; Shimazu, Toru; Tada, Motoki N.; Osada, Ikuko; Nagamatsu, Aiko; Kamimura, Satoshi; Nagatomo, Hiroaki; Mizutani, Eiji; Ishino, Fumitoshi; Yano, Sachiko

    2017-01-01

    If humans ever start to live permanently in space, assisted reproductive technology using preserved spermatozoa will be important for producing offspring; however, radiation on the International Space Station (ISS) is more than 100 times stronger than that on Earth, and irradiation causes DNA damage in cells and gametes. Here we examined the effect of space radiation on freeze-dried mouse spermatozoa held on the ISS for 9 mo at –95 °C, with launch and recovery at room temperature. DNA damage to the spermatozoa and male pronuclei was slightly increased, but the fertilization and birth rates were similar to those of controls. Next-generation sequencing showed only minor genomic differences between offspring derived from space-preserved spermatozoa and controls, and all offspring grew to adulthood and had normal fertility. Thus, we demonstrate that although space radiation can damage sperm DNA, it does not affect the production of viable offspring after at least 9 mo of storage on the ISS. PMID:28533361

  13. Healthy offspring from freeze-dried mouse spermatozoa held on the International Space Station for 9 months.

    PubMed

    Wakayama, Sayaka; Kamada, Yuko; Yamanaka, Kaori; Kohda, Takashi; Suzuki, Hiromi; Shimazu, Toru; Tada, Motoki N; Osada, Ikuko; Nagamatsu, Aiko; Kamimura, Satoshi; Nagatomo, Hiroaki; Mizutani, Eiji; Ishino, Fumitoshi; Yano, Sachiko; Wakayama, Teruhiko

    2017-06-06

    If humans ever start to live permanently in space, assisted reproductive technology using preserved spermatozoa will be important for producing offspring; however, radiation on the International Space Station (ISS) is more than 100 times stronger than that on Earth, and irradiation causes DNA damage in cells and gametes. Here we examined the effect of space radiation on freeze-dried mouse spermatozoa held on the ISS for 9 mo at -95 °C, with launch and recovery at room temperature. DNA damage to the spermatozoa and male pronuclei was slightly increased, but the fertilization and birth rates were similar to those of controls. Next-generation sequencing showed only minor genomic differences between offspring derived from space-preserved spermatozoa and controls, and all offspring grew to adulthood and had normal fertility. Thus, we demonstrate that although space radiation can damage sperm DNA, it does not affect the production of viable offspring after at least 9 mo of storage on the ISS.

  14. Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

    NASA Astrophysics Data System (ADS)

    Chen, Ellson Y.

    1997-05-01

    So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

  15. Quick and clean cloning.

    PubMed

    Thieme, Frank; Marillonnet, Sylvestre

    2014-01-01

    Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

  16. Insertion sequence ISRP10 inactivation of the oprD gene in imipenem-resistant Pseudomonas aeruginosa clinical isolates.

    PubMed

    Sun, Qinghui; Ba, Zhaofen; Wu, Guoying; Wang, Wei; Lin, Shuxiang; Yang, Hongjiang

    2016-05-01

    Carbapenem resistance mechanisms were investigated in 32 imipenem-resistant Pseudomonas aeruginosa clinical isolates recovered from hospitalised children. Sequence analysis revealed that 31 of the isolates had an insertion sequence element ISRP10 disrupting the porin gene oprD, demonstrating that ISRP10 inactivation of oprD conferred imipenem resistance in the majority of the isolates. Multilocus sequence typing (MLST) was used to discriminate the isolates. In total, 11 sequence types (STs) were identified including 3 novel STs, and 68.3% (28/41) of the tested strains were characterised as clone ST253. In combination with random amplified polymorphic DNA (RAPD) analysis, the imipenem-resistant isolates displayed a relatively high degree of genetic variability and were unlikely associated with nosocomial infections. Copyright © 2016 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  17. ISS Payload Operations: The Need for and Benefit of Responsive Planning

    NASA Technical Reports Server (NTRS)

    Nahay, Ed; Boster, Mandee

    2000-01-01

    International Space Station (ISS) payload operations are controlled through implementation of a payload operations plan. This plan, which represents the defined approach to payload operations in general, can vary in terms of level of definition. The detailed plan provides the specific sequence and timing of each component of a payload's operations. Such an approach to planning was implemented in the Spacelab program. The responsive plan provides a flexible approach to payload operations through generalization. A responsive approach to planning was implemented in the NASA/Mir Phase 1 program, and was identified as a need during the Skylab program. The current approach to ISS payload operations planning and control tends toward detailed planning, rather than responsive planning. The use of detailed plans provides for the efficient use of limited resources onboard the ISS. It restricts flexibility in payload operations, which is inconsistent with the dynamic nature of the ISS science program, and it restricts crew desires for flexibility and autonomy. Also, detailed planning is manpower intensive. The development and implementation of a responsive plan provides for a more dynamic, more accommodating, and less manpower intensive approach to planning. The science program becomes more dynamic and responsive as the plan provides flexibility to accommodate real-time science accomplishments. Communications limitations and the crew desire for flexibility and autonomy in plan implementation are readily accommodated with responsive planning. Manpower efficiencies are accomplished through a reduction in requirements collection and coordination, plan development, and maintenance. Through examples and assessments, this paper identifies the need to transition from detailed to responsive plans for ISS payload operations. Examples depict specific characteristics of the plans. Assessments identify the following: the means by which responsive plans accommodate the dynamic nature of science programs and the crew desire for flexibility; the means by which responsive plans readily accommodate ISS communications constraints; manpower efficiencies to be achieved through use of responsive plans; and the implications of responsive planning relative to resource utilization efficiency.

  18. Occurrence of Can-SINEs and intron sequence evolution supports robust phylogeny of pinniped carnivores and their terrestrial relatives.

    PubMed

    Schröder, Christiane; Bleidorn, Christoph; Hartmann, Stefanie; Tiedemann, Ralph

    2009-12-15

    Investigating the dog genome we found 178965 introns with a moderate length of 200-1000 bp. A screening of these sequences against 23 different repeat libraries to find insertions of short interspersed elements (SINEs) detected 45276 SINEs. Virtually all of these SINEs (98%) belong to the tRNA-derived Can-SINE family. Can-SINEs arose about 55 million years ago before Carnivora split into two basal groups, the Caniformia (dog-like carnivores) and the Feliformia (cat-like carnivores). Genome comparisons of dog and cat recovered 506 putatively informative SINE loci for caniformian phylogeny. In this study we show how to use such genome information of model organisms to research the phylogeny of related non-model species of interest. Investigating a dataset including representatives of all major caniformian lineages, we analysed 24 randomly chosen loci for 22 taxa. All loci were amplifiable and revealed 17 parsimony-informative SINE insertions. The screening for informative SINE insertions yields a large amount of sequence information, in particular of introns, which contain reliable phylogenetic information as well. A phylogenetic analysis of intron- and SINE sequence data provided a statistically robust phylogeny which is congruent with the absence/presence pattern of our SINE markers. This phylogeny strongly supports a sistergroup relationship of Musteloidea and Pinnipedia. Within Pinnipedia, we see strong support from bootstrapping and the presence of a SINE insertion for a sistergroup relationship of the walrus with the Otariidae.

  19. Alterations in the 5 'untranslated region of the EPSPS gene influence EPSPS overexpression in glyphosate-resistant Eleusine indica.

    PubMed

    Zhang, Chun; Feng, Li; Tian, Xing-Shan

    2018-04-26

    The herbicide glyphosate inhibits the enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). Overexpression of the EPSPS gene is one of the molecular mechanisms conferring glyphosate resistance in weeds, but the transcriptional regulation of this gene is poorly understood. The EPSPS gene was found to be significantly up-regulated following glyphosate treatment in a glyphosate- resistant Eleusine indica population from South China. To further investigate the regulation of EPSPS overexpression, the promoter of the EPSPS gene from this E. indica population was cloned and analyzed. Two upstream regulatory sequences, Epro-S (862 bp) and Epro-R (877 bp) of EPSPS were obtained from glyphosate-susceptible (S) and -resistant (R) E. indica plants respectively by HiTAIL-PCR. The Epro-S and Epro-R sequences were 99% homologous, except for the two insertions (3 bp and12 bp) in the R sequence. The 12-base insertion of the Epro-R sequence was located in the 5'-UTR-Py-rich stretch element. The promoter activity tests showed that the 12-base insertion resulted in significant enhancement of the Epro-R promoter activity, whereas the 3-base insertion had little effect on Epro-R promoter activity. Alterations in the 5'-UTR-Py-rich stretch element of EPSPS are responsible for glyphosate induced EPSPS overexpression. Therefore, EPSPS transcriptional regulation confers glyphosate resistance in this E. indica population. This article is protected by copyright. All rights reserved.

  20. Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    PubMed Central

    Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

    2017-01-01

    Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either by DNA-binding proteins or by the architecture of the nucleoid. PMID:28249011

  1. A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

    PubMed

    Guimond, A; Moss, T

    1999-02-01

    We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

  2. Diagnostic use of computational retrotransposon detection: Successful definition of pathogenetic mechanism in a ciliopathy phenotype.

    PubMed

    Takenouchi, Toshiki; Kuchikata, Tomu; Yoshihashi, Hiroshi; Fujiwara, Mineko; Uehara, Tomoko; Miyama, Sahoko; Yamada, Shiro; Kosaki, Kenjiro

    2017-05-01

    Among more than 5,000 human monogenic disorders with known causative genes, transposable element insertion of a Long Interspersed Nuclear Element 1 (LINE1, L1) is known as the mechanistic basis in only 13 genetic conditions. Meckel-Gruber syndrome is a rare ciliopathy characterized by occipital encephalocele and cystic kidney disease. Here, we document a boy with occipital encephalocele, post-axial polydactyly, and multicystic renal disease. A medical exome analysis detected a heterozygous frameshift mutation, c.4582_4583delCG p.(Arg1528Serfs*17) in CC2D2A in the maternally derived allele. The further use of a dedicated bioinformatics algorithm for detecting retrotransposon insertions led to the detection of an L1 insertion affecting exon 7 in the paternally derived allele. The complete sequencing and sequence homology analysis of the inserted L1 element showed that the L1 element was classified as L1HS (L1 human specific) and that the element had intact open reading frames in the two L1-encoded proteins. This observation ranks Meckel-Gruber syndrome as only the 14th disorder to be caused by an L1 insertion among more than 5,000 known human genetic disorders. Although a transposable element detection algorithm is not included in the current best-practice next-generation sequencing analysis, the present observation illustrates the utility of such an algorithm, which would require modest computational time and resources. Whether the seemingly infrequent recognition of L1 insertion in the pathogenesis of human genetic diseases might simply reflect a lack of appropriate detection methods remains to be seen. © 2017 Wiley Periodicals, Inc.

  3. Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

    PubMed

    Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

    2016-09-12

    Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

  4. Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

    PubMed

    Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

    2014-07-01

    Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework. © 2014 American Academy of Forensic Sciences.

  5. The American cranberry mitochondrial genome reveals the presence of selenocysteine (tRNA-Sec and SECIS) insertion machinery in land plants.

    PubMed

    Fajardo, Diego; Schlautman, Brandon; Steffan, Shawn; Polashock, James; Vorsa, Nicholi; Zalapa, Juan

    2014-02-25

    This is the first de novo assembly and annotation of a complete mitochondrial genome in the Ericales order from the American cranberry (Vaccinium macrocarpon Ait.). Moreover, only four complete Asterid mitochondrial genomes have been made publicly available. The cranberry mitochondrial genome was assembled and reconstructed from whole genome 454 Roche GS-FLX and Illumina shotgun sequences. Compared with other Asterids, the reconstruction of the genome revealed an average size mitochondrion (459,678 nt) with relatively little repetitive sequences and DNA of plastid origin. The complete mitochondrial genome of cranberry was annotated obtaining a total of 34 genes classified based on their putative function, plus three ribosomal RNAs, and 17 transfer RNAs. Maternal organellar cranberry inheritance was inferred by analyzing gene variation in the cranberry mitochondria and plastid genomes. The annotation of cranberry mitochondrial genome revealed the presence of two copies of tRNA-Sec and a selenocysteine insertion sequence (SECIS) element which were lost in plants during evolution. This is the first report of a land plant possessing selenocysteine insertion machinery at the sequence level. Published by Elsevier B.V.

  6. Long interspersed element-1 (LINE-1): passenger or driver in human neoplasms?

    PubMed

    Rodić, Nemanja; Burns, Kathleen H

    2013-03-01

    LINE-1 (L1) retrotransposons make up a significant portion of human genomes, with an estimated 500,000 copies per genome. Like other retrotransposons, L1 retrotransposons propagate through RNA sequences that are reverse transcribed into DNA sequences, which are integrated into new genomic loci. L1 somatic insertions have the potential to disrupt the transcriptome by inserting into or nearby genes. By mutating genes and playing a role in epigenetic dysregulation, L1 transposons may contribute to tumorigenesis. Studies of the "mobilome" have lagged behind other tumor characterizations at the sequence, transcript, and epigenetic levels. Here, we consider evidence that L1 retrotransposons may sometimes drive human tumorigenesis.

  7. Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

    PubMed

    Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

    1978-11-16

    Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

  8. Unique transposon landscapes are pervasive across Drosophila melanogaster genomes

    PubMed Central

    Rahman, Reazur; Chirn, Gung-wei; Kanodia, Abhay; Sytnikova, Yuliya A.; Brembs, Björn; Bergman, Casey M.; Lau, Nelson C.

    2015-01-01

    To understand how transposon landscapes (TLs) vary across animal genomes, we describe a new method called the Transposon Insertion and Depletion AnaLyzer (TIDAL) and a database of >300 TLs in Drosophila melanogaster (TIDAL-Fly). Our analysis reveals pervasive TL diversity across cell lines and fly strains, even for identically named sub-strains from different laboratories such as the ISO1 strain used for the reference genome sequence. On average, >500 novel insertions exist in every lab strain, inbred strains of the Drosophila Genetic Reference Panel (DGRP), and fly isolates in the Drosophila Genome Nexus (DGN). A minority (<25%) of transposon families comprise the majority (>70%) of TL diversity across fly strains. A sharp contrast between insertion and depletion patterns indicates that many transposons are unique to the ISO1 reference genome sequence. Although TL diversity from fly strains reaches asymptotic limits with increasing sequencing depth, rampant TL diversity causes unsaturated detection of TLs in pools of flies. Finally, we show novel transposon insertions negatively correlate with Piwi-interacting RNA (piRNA) levels for most transposon families, except for the highly-abundant roo retrotransposon. Our study provides a useful resource for Drosophila geneticists to understand how transposons create extensive genomic diversity in fly cell lines and strains. PMID:26578579

  9. Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

    PubMed

    Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

    1987-07-01

    Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

  10. Characterization of Aspergillus fumigatus Isolates from Air and Surfaces of the International Space Station

    PubMed Central

    Knox, Benjamin P.; Blachowicz, Adriana; Romsdahl, Jillian; Huttenlocher, Anna; Wang, Clay C. C.; Keller, Nancy P.

    2016-01-01

    ABSTRACT One mission of the Microbial Observatory Experiments on the International Space Station (ISS) is to examine the traits and diversity of fungal isolates to gain a better understanding of how fungi may adapt to microgravity environments and how this may affect interactions with humans in a closed habitat. Here, we report an initial characterization of two isolates, ISSFT-021 and IF1SW-F4, of Aspergillus fumigatus collected from the ISS and a comparison to the experimentally established clinical isolates Af293 and CEA10. Whole-genome sequencing of ISSFT-021 and IF1SW-F4 showed 54,960 and 52,129 single nucleotide polymorphisms, respectively, compared to Af293, which is consistent with observed genetic heterogeneity among sequenced A. fumigatus isolates from diverse clinical and environmental sources. Assessment of in vitro growth characteristics, secondary metabolite production, and susceptibility to chemical stresses revealed no outstanding differences between ISS and clinical strains that would suggest special adaptation to life aboard the ISS. Virulence assessment in a neutrophil-deficient larval zebrafish model of invasive aspergillosis revealed that both ISSFT-021 and IF1SW-F4 were significantly more lethal than Af293 and CEA10. Taken together, these genomic, in vitro, and in vivo analyses of two A. fumigatus strains isolated from the ISS provide a benchmark for future investigations of these strains and for continuing research on specific microbial isolates from manned space environments. IMPORTANCE As durations of manned space missions increase, it is imperative to understand the long-term consequence of microbial exposure on human health in a closed human habitat. To date, studies aimed at bacterial and fungal contamination of space vessels have highlighted species compositions biased toward hardy, persistent organisms capable of withstanding harsh conditions. In the current study, we assessed traits of two independent Aspergillus fumigatus strains isolated from the International Space Station. Ubiquitously found in terrestrial soil and atmospheric environments, A. fumigatus is a significant opportunistic fungal threat to human health, particularly among the immunocompromised. Using two well-known clinical isolates of A. fumigatus as comparators, we found that both ISS isolates exhibited normal in vitro growth and chemical stress tolerance yet caused higher lethality in a vertebrate model of invasive disease. These findings substantiate the need for additional studies of physical traits and biological activities of microbes adapted to microgravity and other extreme extraterrestrial conditions. PMID:27830189

  11. Characterization of Aspergillus fumigatus Isolates from Air and Surfaces of the International Space Station.

    PubMed

    Knox, Benjamin P; Blachowicz, Adriana; Palmer, Jonathan M; Romsdahl, Jillian; Huttenlocher, Anna; Wang, Clay C C; Keller, Nancy P; Venkateswaran, Kasthuri

    2016-01-01

    One mission of the Microbial Observatory Experiments on the International Space Station (ISS) is to examine the traits and diversity of fungal isolates to gain a better understanding of how fungi may adapt to microgravity environments and how this may affect interactions with humans in a closed habitat. Here, we report an initial characterization of two isolates, ISSFT-021 and IF1SW-F4, of Aspergillus fumigatus collected from the ISS and a comparison to the experimentally established clinical isolates Af293 and CEA10. Whole-genome sequencing of ISSFT-021 and IF1SW-F4 showed 54,960 and 52,129 single nucleotide polymorphisms, respectively, compared to Af293, which is consistent with observed genetic heterogeneity among sequenced A. fumigatus isolates from diverse clinical and environmental sources. Assessment of in vitro growth characteristics, secondary metabolite production, and susceptibility to chemical stresses revealed no outstanding differences between ISS and clinical strains that would suggest special adaptation to life aboard the ISS. Virulence assessment in a neutrophil-deficient larval zebrafish model of invasive aspergillosis revealed that both ISSFT-021 and IF1SW-F4 were significantly more lethal than Af293 and CEA10. Taken together, these genomic, in vitro , and in vivo analyses of two A. fumigatus strains isolated from the ISS provide a benchmark for future investigations of these strains and for continuing research on specific microbial isolates from manned space environments. IMPORTANCE As durations of manned space missions increase, it is imperative to understand the long-term consequence of microbial exposure on human health in a closed human habitat. To date, studies aimed at bacterial and fungal contamination of space vessels have highlighted species compositions biased toward hardy, persistent organisms capable of withstanding harsh conditions. In the current study, we assessed traits of two independent Aspergillus fumigatus strains isolated from the International Space Station. Ubiquitously found in terrestrial soil and atmospheric environments, A. fumigatus is a significant opportunistic fungal threat to human health, particularly among the immunocompromised. Using two well-known clinical isolates of A. fumigatus as comparators, we found that both ISS isolates exhibited normal in vitro growth and chemical stress tolerance yet caused higher lethality in a vertebrate model of invasive disease. These findings substantiate the need for additional studies of physical traits and biological activities of microbes adapted to microgravity and other extreme extraterrestrial conditions.

  12. MINS2: revisiting the molecular code for transmembrane-helix recognition by the Sec61 translocon.

    PubMed

    Park, Yungki; Helms, Volkhard

    2008-08-15

    To be fully functional, membrane proteins should not only fold, but also get inserted into the membrane, which is mediated by the Sec61 translocon. Recent experimental studies have attempted to elucidate how the Sec61 translocon accomplishes this delicate task by measuring the translocon-mediated membrane insertion free energies of 357 systematically designed peptides. On the basis of this data set, we have developed MINS2, a novel sequence-based computational method for predicting the membrane insertion free energies of protein sequences. A benchmark analysis of MINS2 shows that MINS2 signi.cantly outperforms previously proposed methods. Importantly, the application of MINS2 to known membrane protein structures shows that a better prediction of membrane insertion free energies does not lead to a better prediction of transmembrane segments of polytopic membrane proteins. A web server for MINS2 is publicly available at http://service.bioinformatik.uni-saarland.de/mins. Supplementary data are available at Bioinformatics online.

  13. Structure of yeast Argonaute with guide RNA

    PubMed Central

    Nakanishi, Kotaro; Weinberg, David E.; Bartel, David P.; Patel, Dinshaw J.

    2012-01-01

    The RNA-induced silencing complex, comprising Argonaute and guide RNA, mediates RNA interference. Here we report the 3.2 Å crystal structure of Kluyveromyces Argonaute (KpAGO) fortuitously complexed with guide RNA originating from small-RNA duplexes autonomously loaded and processed by recombinant KpAGO. Despite their diverse sequences, guide-RNA nucleotides 1–8 are positioned similarly, with sequence-independent contacts to bases, phosphates and 2′-hydroxyl groups pre-organizing the backbone of nucleotides 2–8 in a near–A-form conformation. Compared with prokaryotic Argonautes, KpAGO has numerous surface-exposed insertion segments, with a cluster of conserved insertions repositioning the N domain to enable full propagation of guide–target pairing. Compared with Argonautes in inactive conformations, KpAGO has a hydrogen-bond network that stabilizes an expanded and repositioned loop, which inserts an invariant glutamate into the catalytic pocket. Mutation analyses and analogies to Ribonuclease H indicate that insertion of this glutamate finger completes a universally conserved catalytic tetrad, thereby activating Argonaute for RNA cleavage. PMID:22722195

  14. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    PubMed

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

  15. Identification of genomic indels and structural variations using split reads

    PubMed Central

    2011-01-01

    Background Recent studies have demonstrated the genetic significance of insertions, deletions, and other more complex structural variants (SVs) in the human population. With the development of the next-generation sequencing technologies, high-throughput surveys of SVs on the whole-genome level have become possible. Here we present split-read identification, calibrated (SRiC), a sequence-based method for SV detection. Results We start by mapping each read to the reference genome in standard fashion using gapped alignment. Then to identify SVs, we score each of the many initial mappings with an assessment strategy designed to take into account both sequencing and alignment errors (e.g. scoring more highly events gapped in the center of a read). All current SV calling methods have multilevel biases in their identifications due to both experimental and computational limitations (e.g. calling more deletions than insertions). A key aspect of our approach is that we calibrate all our calls against synthetic data sets generated from simulations of high-throughput sequencing (with realistic error models). This allows us to calculate sensitivity and the positive predictive value under different parameter-value scenarios and for different classes of events (e.g. long deletions vs. short insertions). We run our calculations on representative data from the 1000 Genomes Project. Coupling the observed numbers of events on chromosome 1 with the calibrations gleaned from the simulations (for different length events) allows us to construct a relatively unbiased estimate for the total number of SVs in the human genome across a wide range of length scales. We estimate in particular that an individual genome contains ~670,000 indels/SVs. Conclusions Compared with the existing read-depth and read-pair approaches for SV identification, our method can pinpoint the exact breakpoints of SV events, reveal the actual sequence content of insertions, and cover the whole size spectrum for deletions. Moreover, with the advent of the third-generation sequencing technologies that produce longer reads, we expect our method to be even more useful. PMID:21787423

  16. Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

    PubMed Central

    Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

    2000-01-01

    Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

  17. Fingerprints of Modified RNA Bases from Deep Sequencing Profiles.

    PubMed

    Kietrys, Anna M; Velema, Willem A; Kool, Eric T

    2017-11-29

    Posttranscriptional modifications of RNA bases are not only found in many noncoding RNAs but have also recently been identified in coding (messenger) RNAs as well. They require complex and laborious methods to locate, and many still lack methods for localized detection. Here we test the ability of next-generation sequencing (NGS) to detect and distinguish between ten modified bases in synthetic RNAs. We compare ultradeep sequencing patterns of modified bases, including miscoding, insertions and deletions (indels), and truncations, to unmodified bases in the same contexts. The data show widely varied responses to modification, ranging from no response, to high levels of mutations, insertions, deletions, and truncations. The patterns are distinct for several of the modifications, and suggest the future use of ultradeep sequencing as a fingerprinting strategy for locating and identifying modifications in cellular RNAs.

  18. Draft genome sequences of Actinomyces timonensis strain 7400942T and its prophage.

    PubMed

    Gorlas, Aurore; Gimenez, Grégory; Raoult, Didier; Roux, Véronique

    2012-12-01

    A draft genome sequence of Actinomyces timonensis, an anaerobic bacterium isolated from a human clinical osteoarticular sample, is described here. CRISPR-associated proteins, insertion sequence, and toxin-antitoxin loci were found on the genome. A new virus or provirus, AT-1, was characterized.

  19. Characterisation of IS153, an IS3-family insertion sequence isolated from Lactobacillus sanfranciscensis and its use for strain differentiation.

    PubMed

    Ehrmann, M A; Vogel, R E

    2001-11-01

    An insertion sequence has been identified in the genome of Lactobacillus sanfranciscensis DSM 20451T as segment of 1351 nucleotides containing 37-bp imperfect terminal inverted repeats. The sequence of this element encodes two out of phase, overlapping open reading frames, orfA and orfB, from which three putative proteins are produced. OrfAB is a transframe protein produced by -1 translational frame shifting between orf A and orf B that is presumed to be the transposase. The large orfAB of this element encodes a 342 amino acid protein that displays similarities with transposases encoded by bacterial insertion sequences belonging to the IS3 family. In L. sanfranciscensis type strain DSM 20451T multiple truncated IS elements were identified. Inverse PCR was used to analyze target sites of four of these elements, but except of their highly AT rich character not any sequence specificity was identified so far. Moreover, no flanking direct repeats were identified. Multiple copies of IS153 were detected by hybridization in other strains of L. sanfranciscensis. Resulting hybridization patterns were shown to differentiate between organisms at strain level rather than a probe targeted against the 16S rDNA. With a PCR based approach IS153 or highly similar sequences were detected in L. acidophilus, L. casei, L. malefermentans, L. plantarum, L. hilgardii, L. collinoides L. farciminis L. sakei and L. salivarius, L. reuteri as well as in Enterococcus faecium, Pediococcus acidilactici and P. pentosaceus.

  20. The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.

    PubMed

    Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J

    2017-05-01

    Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. © 2017 American Cancer Society. © 2016 American Cancer Society.

  1. Entire plastid phylogeny of the carrot genus (Daucus, Apiaceae):Concordance with nuclear data and mitochondrial and nuclear DNA insertions to the plastid

    USDA-ARS?s Scientific Manuscript database

    We explored the phylogenetic utility of entire plastid DNA sequences in Daucus and compared the results to prior phylogenetic results using plastid, nuclear, and mitochondrial DNA sequences. We obtained, using Illumina sequencing, full plastid sequences of 37 accessions of 20 Daucus taxa and outgrou...

  2. Formation of cis-diamminedichloroplatinum(II) 1,2-intrastrand cross-links on DNA is flanking-sequence independent.

    PubMed

    Burstyn, J N; Heiger-Bernays, W J; Cohen, S M; Lippard, S J

    2000-11-01

    Mapping of cis-diamminedichloroplatinum(II) (cis-DDP, cisplatin) DNA adducts over >3000 nucleotides was carried out using a replication blockage assay. The sites of inhibition of modified T4 DNA polymerase, also referred to as stop sites, were analyzed to determine the effects of local sequence context on the distribution of intrastrand cisplatin cross-links. In a 3120 base fragment from replicative form M13mp18 DNA containing 24.6% guanine, 25.5% thymine, 26.9% adenine and 23.0% cytosine, 166 individual stop sites were observed at a bound platinum/nucleotide ratio of 1-2 per thousand. The majority of stop sites (90%) occurred at G(n>2) sequences and the remainder were located at sites containing an AG dinucleotide. For all of the GG sites present in the mapped sequences, including those with Gn(>)2, 89% blocked replication, whereas for the AG sites only 17% blocked replication. These blockage sites were independent of flanking nucleotides in a sequence of N(1)G*G*N(2) where N(1), N(2) = A, C, G, T and G*G* indicates a 1,2-intrastrand platinum cross-link. The absence of long-range sequence dependence was confirmed by monitoring the reaction of cisplatin with a plasmid containing an 800 bp insert of the human telomere repeat sequence (TTAGGG)(n). Platination reactions monitored at several formal platinum/nucleotide ratios or as a function of time reveal that the telomere insert was not preferentially damaged by cisplatin. Both replication blockage and telomere-insert plasmid platination experiments indicate that cisplatin 1,2-intrastrand adducts do not form preferentially at G-rich sequences in vitro.

  3. Genome-Wide Spectra of Transcription Insertions and Deletions Reveal That Slippage Depends on RNA:DNA Hybrid Complementarity.

    PubMed

    Traverse, Charles C; Ochman, Howard

    2017-08-29

    Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola , which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. IMPORTANCE The high level of mistakes generated during transcription can result in the accumulation of malfunctioning and misfolded proteins which can alter global gene regulation and in the expenditure of energy to degrade these nonfunctional proteins. The transcriptome-wide occurrence of base substitutions has been elucidated in bacteria, but information on transcription insertions and deletions-errors that potentially have more dire effects on protein function-is limited to reporter gene constructs. Here, we capture the transcriptome-wide spectrum of insertions and deletions in Escherichia coli and Buchnera aphidicola and show that they occur at rates approaching those of base substitutions. Knowledge of the full extent of sequences subject to transcription indels supports a new model of bacterial transcription slippage, one that relies on the number of complementary bases between the transcript and the DNA template to which it slipped. Copyright © 2017 Traverse and Ochman.

  4. Enhanced Lighting Techniques and Augmented Reality to Improve Human Task Performance

    NASA Technical Reports Server (NTRS)

    Maida, James C.; Bowen, Charles K.; Pace, John W.

    2005-01-01

    One of the most versatile tools designed for use on the International Space Station (ISS) is the Special Purpose Dexterous Manipulator (SPDM) robot. Operators for this system are trained at NASA Johnson Space Center (JSC) using a robotic simulator, the Dexterous Manipulator Trainer (DMT), which performs most SPDM functions under normal static Earth gravitational forces. The SPDM is controlled from a standard Robotic Workstation. A key feature of the SPDM and DMT is the Force/Moment Accommodation (FMA) system, which limits the contact forces and moments acting on the robot components, on its payload, an Orbital Replaceable Unit (ORU), and on the receptacle for the ORU. The FMA system helps to automatically alleviate any binding of the ORU as it is inserted or withdrawn from a receptacle, but it is limited in its correction capability. A successful ORU insertion generally requires that the reference axes of the ORU and receptacle be aligned to within approximately 0.25 inch and 0.5 degree of nominal values. The only guides available for the operator to achieve these alignment tolerances are views from any available video cameras. No special registration markings are provided on the ORU or receptacle, so the operator must use their intrinsic features in the video display to perform the pre-insertion alignment task. Since optimum camera views may not be available, and dynamic orbital lighting conditions may limit viewing periods, long times are anticipated for performing some ORU insertion or extraction operations. This study explored the feasibility of using augmented reality (AR) to assist with SPDM operations. Geometric graphical symbols were overlaid on the end effector (EE) camera view to afford cues to assist the operator in attaining adequate pre-insertion ORU alignment.

  5. Inter-individual and intragenomic variations in the ITS region of Clonorchis sinensis (Trematoda: Opisthorchiidae) from Russia and Vietnam.

    PubMed

    Tatonova, Yulia V; Chelomina, Galina N; Nguyen, Hung Manh

    2017-11-01

    Here we examined the intraspecific genetic variability of Clonorchis sinensis from Russia and Vietnam using nuclear DNA sequences (the 5.8S gene and two internal transcribed spacers of the ribosomal cluster). Despite the low level of variability in the ITS1 region, this marker has revealed some features of C. sinensis across multiple geographic regions. The genetic diversity levels for the Russian and Vietnamese populations were similar (0.1 and 0.09%, respectively) but were significantly lower than the C. sinensis from China (0.31%). About half of the sequences of the Chinese (53%) and Korean (47%) populations and about a tenth of the Vietnamese (12%) and Russian (8%) sequences included a 5bp insertion. No sequences with nucleotide substitutions both upstream and downstream of the 5bp insertion were found within the whole data set. The population of northern China had both sequence variants (with substitutions either upstream or downstream of the insertion), while only one of these variants was presented at the other localities. The Vietnamese population had a higher frequency of intragenomic polymorphism than the Russian population (69% vs. 46% and 23% vs. 3% at the 114bp and 339bp positions, respectively). These data are discussed in connection with parasite origin and adaptation, and also its invasive capacity and drug-resistance. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903.

    PubMed Central

    Grindley, N D; Joyce, C M

    1980-01-01

    The kanamycin resistance transposon Tn903 consists of a unique region of about 1000 base pairs bounded by a pair of 1050-base-pair inverted repeat sequences. Each repeat contains two Pvu II endonuclease cleavage sites separated by 520 base pairs. We have constructed derivatives of Tn903 in which this 520-base-pair fragment is deleted from one or both repeats. Those derivatives that lack both 520-base-pair fragments cannot transpose, whereas those that lack just one remain transposition proficient. One such transposable derivative, Tn903 delta I, has been selected for further study. We have determined the sequence of the intact inverted repeat. The 18 base pairs at each end are identical and inverted relative to one another, a structure characteristic of insertion sequences. Additional experiments indicate that a single inverted repeat from Tn903 can, in fact, transpose; we propose that this element be called IS903. To correlate the DNA sequence with genetic activities, we have created mutations by inserting a 10-base-pair DNA fragment at several sites within the intact repeat of Tn903 delta 1, and we have examined the effect of such insertions on transposability. The results suggest that IS903 encodes a 307-amino-acid polypeptide (a "transposase") that is absolutely required for transposition of IS903 or Tn903. Images PMID:6261245

  7. Miniature Transposable Sequences Are Frequently Mobilized in the Bacterial Plant Pathogen Pseudomonas syringae pv. phaseolicola

    PubMed Central

    Bardaji, Leire; Añorga, Maite; Jackson, Robert W.; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

    2011-01-01

    Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10−5 and 1.1×10−6, depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria. PMID:22016774

  8. Miniature transposable sequences are frequently mobilized in the bacterial plant pathogen Pseudomonas syringae pv. phaseolicola.

    PubMed

    Bardaji, Leire; Añorga, Maite; Jackson, Robert W; Martínez-Bilbao, Alejandro; Yanguas-Casás, Natalia; Murillo, Jesús

    2011-01-01

    Mobile genetic elements are widespread in Pseudomonas syringae, and often associate with virulence genes. Genome reannotation of the model bean pathogen P. syringae pv. phaseolicola 1448A identified seventeen types of insertion sequences and two miniature inverted-repeat transposable elements (MITEs) with a biased distribution, representing 2.8% of the chromosome, 25.8% of the 132-kb virulence plasmid and 2.7% of the 52-kb plasmid. Employing an entrapment vector containing sacB, we estimated that transposition frequency oscillated between 2.6×10(-5) and 1.1×10(-6), depending on the clone, although it was stable for each clone after consecutive transfers in culture media. Transposition frequency was similar for bacteria grown in rich or minimal media, and from cells recovered from compatible and incompatible plant hosts, indicating that growth conditions do not influence transposition in strain 1448A. Most of the entrapped insertions contained a full-length IS801 element, with the remaining insertions corresponding to sequences smaller than any transposable element identified in strain 1448A, and collectively identified as miniature sequences. From these, fragments of 229, 360 and 679-nt of the right end of IS801 ended in a consensus tetranucleotide and likely resulted from one-ended transposition of IS801. An average 0.7% of the insertions analyzed consisted of IS801 carrying a fragment of variable size from gene PSPPH_0008/PSPPH_0017, showing that IS801 can mobilize DNA in vivo. Retrospective analysis of complete plasmids and genomes of P. syringae suggests, however, that most fragments of IS801 are likely the result of reorganizations rather than one-ended transpositions, and that this element might preferentially contribute to genome flexibility by generating homologous regions of recombination. A further miniature sequence previously found to affect host range specificity and virulence, designated MITEPsy1 (100-nt), represented an average 2.4% of the total number of insertions entrapped in sacB, demonstrating for the first time the mobilization of a MITE in bacteria.

  9. Laboratory racks are installed in the MPLM Leonardo

    NASA Technical Reports Server (NTRS)

    2000-01-01

    In the Space Station Processing Facility, another laboratory rack is placed on the arm of the Rack Insertion Unit to lift it to the workstand height of the Multi-Purpose Logistics Module Leonardo (not seen). The MPLM will transport laboratory racks filled with equipment, experiments and supplies to and from the International Space Station aboard the Space Shuttle. Leonardo will be launched for the first time March 1, 2001, on Shuttle mission STS-102. On that flight, Leonardo will be filled with equipment and supplies to outfit the U.S. laboratory module, being carried to the ISS on the Jan. 19, 2001, launch of STS-98.

  10. TEs or not TEs? That is the evolutionary question.

    PubMed

    Vaknin, Keren; Goren, Amir; Ast, Gil

    2009-10-23

    Transposable elements (TEs) have contributed a wide range of functional sequences to their host genomes. A recent paper in BMC Molecular Biology discusses the creation of new transcripts by transposable element insertion upstream of retrocopies and the involvement of such insertions in tissue-specific post-transcriptional regulation.

  11. Mapping Sequence performed during the STS-120 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2007-10-25

    ISS016-E-005947 (25 Oct. 2007) --- Space Shuttle Discovery's crew cabin and docking apparatus in the forward payload bay are featured in this close-up image photographed by an Expedition 16 crewmember during a backflip maneuver performed by the approaching visitors (STS-120) to the International Space Station.

  12. Mapping Sequence performed during the STS-120 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2007-10-25

    ISS016-E-005926 (25 Oct. 2007) --- A close-up view of the Harmony node in the payload bay of Space Shuttle Discovery is provided by this image photographed by an Expedition 16 crewmember during a backflip maneuver performed by the approaching visitors (STS-120) to the International Space Station.

  13. Mapping sequence performed during the STS-115 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2006-09-11

    ISS013-E-79880 (11 Sept. 2006) --- This view of part of the starboard wing and one of the Orbital Maneuvering System (OMS) pods of the Space Shuttle Atlantis was provided by an Expedition 13 crew member during a backflip maneuver performed by the approaching visitors to the International Space Station.

  14. Mapping Sequence performed during the STS-120 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2007-10-25

    ISS016-E-005934 (25 Oct. 2007) --- The Space Shuttle Discovery's tail section is featured in this image photographed by an Expedition 16 crewmember during a backflip maneuver performed by the approaching visitors (STS-120) to the International Space Station. Visible are the shuttle's main engines and vertical stabilizer.

  15. Vecuum: identification and filtration of false somatic variants caused by recombinant vector contamination.

    PubMed

    Kim, Junho; Maeng, Ju Heon; Lim, Jae Seok; Son, Hyeonju; Lee, Junehawk; Lee, Jeong Ho; Kim, Sangwoo

    2016-10-15

    Advances in sequencing technologies have remarkably lowered the detection limit of somatic variants to a low frequency. However, calling mutations at this range is still confounded by many factors including environmental contamination. Vector contamination is a continuously occurring issue and is especially problematic since vector inserts are hardly distinguishable from the sample sequences. Such inserts, which may harbor polymorphisms and engineered functional mutations, can result in calling false variants at corresponding sites. Numerous vector-screening methods have been developed, but none could handle contamination from inserts because they are focusing on vector backbone sequences alone. We developed a novel method-Vecuum-that identifies vector-originated reads and resultant false variants. Since vector inserts are generally constructed from intron-less cDNAs, Vecuum identifies vector-originated reads by inspecting the clipping patterns at exon junctions. False variant calls are further detected based on the biased distribution of mutant alleles to vector-originated reads. Tests on simulated and spike-in experimental data validated that Vecuum could detect 93% of vector contaminants and could remove up to 87% of variant-like false calls with 100% precision. Application to public sequence datasets demonstrated the utility of Vecuum in detecting false variants resulting from various types of external contamination. Java-based implementation of the method is available at http://vecuum.sourceforge.net/ CONTACT: swkim@yuhs.acSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  16. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  17. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed Central

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-01-01

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

  18. The site-specific ribosomal DNA insertion element R1Bm belongs to a class of non-long-terminal-repeat retrotransposons.

    PubMed Central

    Xiong, Y; Eickbush, T H

    1988-01-01

    Two types of insertion elements, R1 and R2 (previously called type I and type II), are known to interrupt the 28S ribosomal genes of several insect species. In the silkmoth, Bombyx mori, each element occupies approximately 10% of the estimated 240 ribosomal DNA units, while at most only a few copies are located outside the ribosomal DNA units. We present here the complete nucleotide sequence of an R1 insertion from B. mori (R1Bm). This 5.1-kilobase element contains two overlapping open reading frames (ORFs) which together occupy 88% of its length. ORF1 is 461 amino acids in length and exhibits characteristics of retroviral gag genes. ORF2 is 1,051 amino acids in length and contains homology to reverse transcriptase-like enzymes. The analysis of 3' and 5' ends of independent isolates from the ribosomal locus supports the suggestion that R1 is still functioning as a transposable element. The precise location of the element within the genome implies that its transposition must occur with remarkable insertion sequence specificity. Comparison of the deduced amino acid sequences from six retrotransposons, R1 and R2 of B. mori, I factor and F element of Drosophila melanogaster, L1 of Mus domesticus, and Ingi of Trypanosoma brucei, reveals a relatively high level of sequence homology in the reverse transcriptase region. Like R1, these elements lack long terminal repeats. We have therefore named this class of related elements the non-long-terminal-repeat (non-LTR) retrotransposons. Images PMID:2447482

  19. The OCO-3 MIssion

    NASA Astrophysics Data System (ADS)

    Eldering, A.; Kaki, S.; Crisp, D.; Gunson, M. R.

    2013-12-01

    For the OCO-3 mission, NASA has approved a proposal to install the OCO-2 flight spare instrument on the International Space Station (ISS). The OCO-3 mission on ISS will have a key role in delivering sustained, global, scientifically-based, spaceborne measurements of atmospheric CO2 to monitor natural sources and sinks as part of NASA's proposed OCO-2/OCO-3/ASCENDS mission sequence and NASA's Climate Architecture. The OCO-3 mission will contribute to understanding of the terrestrial carbon cycle through enabling flux estimates at smaller spatial scales and through fluorescence measurements that will reduce the uncertainty in terrestrial carbon flux measurements and drive bottom-up land surface models through constraining GPP. The combined nominal missions of both OCO-2 and OCO-3 will likely span a complete El Niño Southern Oscillation (ENSO) cycle, a key indicator of ocean variability. In addition, OCO-3 may allow investigation of the high-frequency and wavenumber structures suggested by eddying ocean circulation and ecosystem dynamics models. Finally, significant growth of urban agglomerations is underway and projected to continue in the coming decades. With the city mode sampling of the OCO-3 instrument on ISS we can evaluate different sampling strategies aimed at studying anthropogenic sources and demonstrate elements of a Greenhouse Gas Information system, as well as providing a gap-filler for tracking trends in the fastest-changing anthropogenic signals during the coming decade. In this presentation, we will describe our science objectives, the overall approach of utilization of the ISS for OCO-3, and the unique features of XCO2 measurements from ISS.

  20. Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

    PubMed

    Szeverényi, I; Hodel, A; Arber, W; Olasz, F

    1996-09-26

    We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

  1. Targeted gene insertion for molecular medicine.

    PubMed

    Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

    2008-11-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

  2. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  3. [Determination of genetic bases of auxotrophy in Yersinia pestis ssp. caucasica strains].

    PubMed

    Odinokov, G N; Eroshenko, G A; Kukleva, L M; Shavina, N Iu; Krasnov, Ia M; Kutyrev, V V

    2012-04-01

    Based on the results of computer analysis of nucleotide sequences in strains Yersinia pestis and Y. pseudotuberculosis recorded in the files of NCBI GenBank database, differences between genes argA, aroG, aroF, thiH, and thiG of strain Pestoides F (subspecies caucasica) were found, compared to other strains of plaque agent and pseudotuberculosis microbe. Using PCR with calculated primers and the method of sequence analysis, the structure of variable regions of these genes was studied in 96 natural Y. pestis and Y. pseudotuberculosis strains. It was shown that all examined strains of subspecies caucasica, unlike strains of plague-causing agent of other subspecies and pseudotubercolosis microbe, had identical mutations in genes argA (integration of the insertion sequence IS100), aroG (insertion of ten nucleotides), aroF (inserion of IS100), thiH (insertion of nucleotide T), and thiG (deletion of 13 nucleotides). These mutations are the reason for the absence in strains belonging to this subspecies of the ability to synthesize arginine, phenylalanine, tyrosine, and vitamin B1 (thiamine), and cause their auxotrophy for these growth factors.

  4. Modeling Payload Stowage Impacts on Fire Risks On-Board the International Space Station

    NASA Technical Reports Server (NTRS)

    Anton, Kellie e.; Brown, Patrick F.

    2010-01-01

    The purpose of this presentation is to determine the risks of fire on-board the ISS due to non-standard stowage. ISS stowage is constantly being reexamined for optimality. Non-standard stowage involves stowing items outside of rack drawers, and fire risk is a key concern and is heavily mitigated. A Methodology is needed to account for fire risk due to non-standard stowage to capture the risk. The contents include: 1) Fire Risk Background; 2) General Assumptions; 3) Modeling Techniques; 4) Event Sequence Diagram (ESD); 5) Qualitative Fire Analysis; 6) Sample Qualitative Results for Fire Risk; 7) Qualitative Stowage Analysis; 8) Sample Qualitative Results for Non-Standard Stowage; and 9) Quantitative Analysis Basic Event Data.

  5. Analysis of BAC end sequences in oak, a keystone forest tree species, providing insight into the composition of its genome

    PubMed Central

    2011-01-01

    Background One of the key goals of oak genomics research is to identify genes of adaptive significance. This information may help to improve the conservation of adaptive genetic variation and the management of forests to increase their health and productivity. Deep-coverage large-insert genomic libraries are a crucial tool for attaining this objective. We report herein the construction of a BAC library for Quercus robur, its characterization and an analysis of BAC end sequences. Results The EcoRI library generated consisted of 92,160 clones, 7% of which had no insert. Levels of chloroplast and mitochondrial contamination were below 3% and 1%, respectively. Mean clone insert size was estimated at 135 kb. The library represents 12 haploid genome equivalents and, the likelihood of finding a particular oak sequence of interest is greater than 99%. Genome coverage was confirmed by PCR screening of the library with 60 unique genetic loci sampled from the genetic linkage map. In total, about 20,000 high-quality BAC end sequences (BESs) were generated by sequencing 15,000 clones. Roughly 5.88% of the combined BAC end sequence length corresponded to known retroelements while ab initio repeat detection methods identified 41 additional repeats. Collectively, characterized and novel repeats account for roughly 8.94% of the genome. Further analysis of the BESs revealed 1,823 putative genes suggesting at least 29,340 genes in the oak genome. BESs were aligned with the genome sequences of Arabidopsis thaliana, Vitis vinifera and Populus trichocarpa. One putative collinear microsyntenic region encoding an alcohol acyl transferase protein was observed between oak and chromosome 2 of V. vinifera. Conclusions This BAC library provides a new resource for genomic studies, including SSR marker development, physical mapping, comparative genomics and genome sequencing. BES analysis provided insight into the structure of the oak genome. These sequences will be used in the assembly of a future genome sequence for oak. PMID:21645357

  6. Mentoring SFRM: A New Approach to International Space Station Flight Controller Training

    NASA Technical Reports Server (NTRS)

    Huning, Therese; Barshi, Immanuel; Schmidt, Lacey

    2008-01-01

    The Mission Operations Directorate (MOD) of the Johnson Space Center is responsible for providing continuous operations support for the International Space Station (ISS). Operations support requires flight controllers who are skilled in team performance as well as the technical operations of the ISS. Space Flight Resource Management (SFRM), a NASA adapted variant of Crew Resource Management (CRM), is the competency model used in the MOD. ISS flight controller certification has evolved to include a balanced focus on development of SFRM and technical expertise. The latest challenge the MOD faces is how to certify an ISS flight controller (operator) to a basic level of effectiveness in 1 year. SFRM training uses a two-pronged approach to expediting operator certification: 1) imbed SFRM skills training into all operator technical training and 2) use senior flight controllers as mentors. This paper focuses on how the MOD uses senior flight controllers as mentors to train SFRM skills. Methods: A mentor works with an operator throughout the training flow. Inserted into the training flow are guided-discussion sessions and on-the-job observation opportunities focusing on specific SFRM skills, including: situational leadership, conflict management, stress management, cross-cultural awareness, self care and team care while on-console, communication, workload management, and situation awareness. The mentor and operator discuss the science and art behind the skills, cultural effects on skills applications, recognition of good and bad skills applications, recognition of how skills application changes subtly in different situations, and individual goals and techniques for improving skills. Discussion: This mentoring program provides an additional means of transferring SFRM knowledge compared to traditional CRM training programs. Our future endeavors in training SFRM skills (as well as other organization s) may benefit from adding team performance skills mentoring. This paper explains our mentoring approach and discusses its effectiveness and future applicability in promoting SFRM/CRM skills.

  7. The International Space Station Urine Monitoring System (UMS)

    NASA Technical Reports Server (NTRS)

    Feeback, Daniel L.; Cibuzar, Branelle R.; Milstead, Jeffery R.; Pietrzyk,, Robert A.; Clark, Mark S.F.

    2009-01-01

    A device capable of making in-flight volume measurements of single void urine samples, the Urine Monitoring System (UMS), was developed and flown on seven U.S. Space Shuttle missions. This device provided volume data for each urine void from multiple crewmembers and allowed samples of each to be taken and returned to Earth for post-flight analysis. There were a number of design flaws in the original instrument including the presence of liquid carry-over producing invalid "actual" micturition volumes and cross-contamination between successive users from residual urine in "dead" spots". Additionally, high or low volume voids could not be accurately measured, the on-orbit calibration and nominal use sequence was time intensive, and the unit had to be returned and disassembled to retrieve the volume data. These problems have been resolved in a new version, the International Space Station (ISS) UMS, that has been designed to provide real-time in-flight volume data with accuracy and precision equivalent to measurements made on Earth and the ability to provide urine samples that are unadulterated by the device. Originally conceived to be interfaced with a U.S.-built Waste Collection System (WCS), the unit now has been modified to interface with the Russian-supplied Sanitary Hygiene Device (ASY). The ISS UMS provides significant advantages over the current method of collecting urine samples into Urine Collection Devices (UCDs), from which samples are removed and returned to Earth for analyses. A significant future advantage of the UMS is that it can provide an interface to analytical instrumentation that will allow real-time measurement of urine bioanalytes allowing monitoring of crewmember health status during flight and the ability to provide medical interventions based on the results of these measurements. Currently, the ISS UMS is scheduled to launch along with Node-3 on STS-130 (20A) in December 2009. UMS will be installed and scientific/functional verification completed prior to placing the instrument into operation. Samples collected during the verification sequence will be returned for analyses on STS-131 (19A) currently scheduled for launch in March 2010. The presence of a UMS on ISS will provide the capability to conduct additional collaborative human life science investigations among the ISS International Partners.

  8. Structural features of the rice chromosome 4 centromere.

    PubMed

    Zhang, Yu; Huang, Yuchen; Zhang, Lei; Li, Ying; Lu, Tingting; Lu, Yiqi; Feng, Qi; Zhao, Qiang; Cheng, Zhukuan; Xue, Yongbiao; Wing, Rod A; Han, Bin

    2004-01-01

    A complete sequence of a chromosome centromere is necessary for fully understanding centromere function. We reported the sequence structures of the first complete rice chromosome centromere through sequencing a large insert bacterial artificial chromosome clone-based contig, which covered the rice chromosome 4 centromere. Complete sequencing of the 124-kb rice chromosome 4 centromere revealed that it consisted of 18 tracts of 379 tandemly arrayed repeats known as CentO and a total of 19 centromeric retroelements (CRs) but no unique sequences were detected. Four tracts, composed of 65 CentO repeats, were located in the opposite orientation, and 18 CentO tracts were flanked by 19 retroelements. The CRs were classified into four types, and the type I retroelements appeared to be more specific to rice centromeres. The preferential insert of the CRs among CentO repeats indicated that the centromere-specific retroelements may contribute to centromere expansion during evolution. The presence of three intact retrotransposons in the centromere suggests that they may be responsible for functional centromere initiation through a transcription-mediated mechanism.

  9. Computational allergenicity prediction of transgenic proteins expressed in genetically modified crops.

    PubMed

    Verma, Alok Kumar; Misra, Amita; Subash, Swarna; Das, Mukul; Dwivedi, Premendra D

    2011-09-01

    Development of genetically modified (GM) crops is on increase to improve food quality, increase harvest yields, and reduce the dependency on chemical pesticides. Before their release in marketplace, they should be scrutinized for their safety. Several guidelines of different regulatory agencies like ILSI, WHO Codex, OECD, and so on for allergenicity evaluation of transgenics are available and sequence homology analysis is the first test to determine the allergenic potential of inserted proteins. Therefore, to test and validate, 312 allergenic, 100 non-allergenic, and 48 inserted proteins were assessed for sequence similarity using 8-mer, 80-mer, and full FASTA search. On performing sequence homology studies, ~94% the allergenic proteins gave exact matches for 8-mer and 80-mer homology. However, 20 allergenic proteins showed non-allergenic behavior. Out of 100 non-allergenic proteins, seven qualified as allergens. None of the inserted proteins demonstrated allergenic behavior. In order to improve the predictability, proteins showing anomalous behavior were tested by Algpred and ADFS separately. Use of Algpred and ADFS softwares reduced the tendency of false prediction to a great extent (74-78%). In conclusion, routine sequence homology needs to be coupled with some other bioinformatic method like ADFS/Algpred to reduce false allergenicity prediction of novel proteins.

  10. MSeq-CNV: accurate detection of Copy Number Variation from Sequencing of Multiple samples.

    PubMed

    Malekpour, Seyed Amir; Pezeshk, Hamid; Sadeghi, Mehdi

    2018-03-05

    Currently a few tools are capable of detecting genome-wide Copy Number Variations (CNVs) based on sequencing of multiple samples. Although aberrations in mate pair insertion sizes provide additional hints for the CNV detection based on multiple samples, the majority of the current tools rely only on the depth of coverage. Here, we propose a new algorithm (MSeq-CNV) which allows detecting common CNVs across multiple samples. MSeq-CNV applies a mixture density for modeling aberrations in depth of coverage and abnormalities in the mate pair insertion sizes. Each component in this mixture density applies a Binomial distribution for modeling the number of mate pairs with aberration in the insertion size and also a Poisson distribution for emitting the read counts, in each genomic position. MSeq-CNV is applied on simulated data and also on real data of six HapMap individuals with high-coverage sequencing, in 1000 Genomes Project. These individuals include a CEU trio of European ancestry and a YRI trio of Nigerian ethnicity. Ancestry of these individuals is studied by clustering the identified CNVs. MSeq-CNV is also applied for detecting CNVs in two samples with low-coverage sequencing in 1000 Genomes Project and six samples form the Simons Genome Diversity Project.

  11. SvABA: genome-wide detection of structural variants and indels by local assembly.

    PubMed

    Wala, Jeremiah A; Bandopadhayay, Pratiti; Greenwald, Noah F; O'Rourke, Ryan; Sharpe, Ted; Stewart, Chip; Schumacher, Steve; Li, Yilong; Weischenfeldt, Joachim; Yao, Xiaotong; Nusbaum, Chad; Campbell, Peter; Getz, Gad; Meyerson, Matthew; Zhang, Cheng-Zhong; Imielinski, Marcin; Beroukhim, Rameen

    2018-04-01

    Structural variants (SVs), including small insertion and deletion variants (indels), are challenging to detect through standard alignment-based variant calling methods. Sequence assembly offers a powerful approach to identifying SVs, but is difficult to apply at scale genome-wide for SV detection due to its computational complexity and the difficulty of extracting SVs from assembly contigs. We describe SvABA, an efficient and accurate method for detecting SVs from short-read sequencing data using genome-wide local assembly with low memory and computing requirements. We evaluated SvABA's performance on the NA12878 human genome and in simulated and real cancer genomes. SvABA demonstrates superior sensitivity and specificity across a large spectrum of SVs and substantially improves detection performance for variants in the 20-300 bp range, compared with existing methods. SvABA also identifies complex somatic rearrangements with chains of short (<1000 bp) templated-sequence insertions copied from distant genomic regions. We applied SvABA to 344 cancer genomes from 11 cancer types and found that short templated-sequence insertions occur in ∼4% of all somatic rearrangements. Finally, we demonstrate that SvABA can identify sites of viral integration and cancer driver alterations containing medium-sized (50-300 bp) SVs. © 2018 Wala et al.; Published by Cold Spring Harbor Laboratory Press.

  12. Optical mapping and its potential for large-scale sequencing projects.

    PubMed

    Aston, C; Mishra, B; Schwartz, D C

    1999-07-01

    Physical mapping has been rediscovered as an important component of large-scale sequencing projects. Restriction maps provide landmark sequences at defined intervals, and high-resolution restriction maps can be assembled from ensembles of single molecules by optical means. Such optical maps can be constructed from both large-insert clones and genomic DNA, and are used as a scaffold for accurately aligning sequence contigs generated by shotgun sequencing.

  13. Construction of Pseudomolecule Sequences of the aus Rice Cultivar Kasalath for Comparative Genomics of Asian Cultivated Rice

    PubMed Central

    Sakai, Hiroaki; Kanamori, Hiroyuki; Arai-Kichise, Yuko; Shibata-Hatta, Mari; Ebana, Kaworu; Oono, Youko; Kurita, Kanako; Fujisawa, Hiroko; Katagiri, Satoshi; Mukai, Yoshiyuki; Hamada, Masao; Itoh, Takeshi; Matsumoto, Takashi; Katayose, Yuichi; Wakasa, Kyo; Yano, Masahiro; Wu, Jianzhong

    2014-01-01

    Having a deep genetic structure evolved during its domestication and adaptation, the Asian cultivated rice (Oryza sativa) displays considerable physiological and morphological variations. Here, we describe deep whole-genome sequencing of the aus rice cultivar Kasalath by using the advanced next-generation sequencing (NGS) technologies to gain a better understanding of the sequence and structural changes among highly differentiated cultivars. The de novo assembled Kasalath sequences represented 91.1% (330.55 Mb) of the genome and contained 35 139 expressed loci annotated by RNA-Seq analysis. We detected 2 787 250 single-nucleotide polymorphisms (SNPs) and 7393 large insertion/deletion (indel) sites (>100 bp) between Kasalath and Nipponbare, and 2 216 251 SNPs and 3780 large indels between Kasalath and 93-11. Extensive comparison of the gene contents among these cultivars revealed similar rates of gene gain and loss. We detected at least 7.39 Mb of inserted sequences and 40.75 Mb of unmapped sequences in the Kasalath genome in comparison with the Nipponbare reference genome. Mapping of the publicly available NGS short reads from 50 rice accessions proved the necessity and the value of using the Kasalath whole-genome sequence as an additional reference to capture the sequence polymorphisms that cannot be discovered by using the Nipponbare sequence alone. PMID:24578372

  14. BACCardI--a tool for the validation of genomic assemblies, assisting genome finishing and intergenome comparison.

    PubMed

    Bartels, Daniela; Kespohl, Sebastian; Albaum, Stefan; Drüke, Tanja; Goesmann, Alexander; Herold, Julia; Kaiser, Olaf; Pühler, Alfred; Pfeiffer, Friedhelm; Raddatz, Günter; Stoye, Jens; Meyer, Folker; Schuster, Stephan C

    2005-04-01

    We provide the graphical tool BACCardI for the construction of virtual clone maps from standard assembler output files or BLAST based sequence comparisons. This new tool has been applied to numerous genome projects to solve various problems including (a) validation of whole genome shotgun assemblies, (b) support for contig ordering in the finishing phase of a genome project, and (c) intergenome comparison between related strains when only one of the strains has been sequenced and a large insert library is available for the other. The BACCardI software can seamlessly interact with various sequence assembly packages. Genomic assemblies generated from sequence information need to be validated by independent methods such as physical maps. The time-consuming task of building physical maps can be circumvented by virtual clone maps derived from read pair information of large insert libraries.

  15. Characterization of the Fb-Nof Transposable Element of Drosophila Melanogaster

    PubMed Central

    Harden, N.; Ashburner, M.

    1990-01-01

    FB-NOF is a composite transposable element of Drosophila melanogaster. It is composed of foldback sequences, of variable length, which flank a 4-kb NOF sequence with 308-bp inverted repeat termini. The NOF sequence could potentially code for a 120-kD polypeptide. The FB-NOF element is responsible for unstable mutations of the white gene (w(c) and w(DZL)) and is associated with the large TEs of G. Ising. Although most strains of D. melanogaster have 20-30 sites of FB insertion, FB-NOF elements are usually rare, many strains lack this composite element or have only one copy of it. A few strains, including w(DZL) and Basc have many (8-21) copies of FB-NOF, and these show a tendency to insert at ``hot-spots.'' These strains also have an increased number of FB elements. The DNA sequence of the NOF region associated with TE146(Z) has been determined. PMID:2174013

  16. Environmental "Omics" of International Space Station: Insights, Significance, and Consequences

    NASA Astrophysics Data System (ADS)

    Venkateswaran, Kasthuri

    2016-07-01

    The NASA Space Biology program funded two multi-year studies to catalogue International Space Station (ISS) environmental microbiome. The first Microbial Observatory (MO) experiment will generate a microbial census of the ISS surfaces and atmosphere using advanced molecular microbial community analysis "omics" techniques, supported by traditional culture-based methods and state-of-the art molecular techniques. The second MO experiment will measure presence of viral and select bacterial and fungal pathogens on ISS surfaces and correlate their presence on crew. The "omics" methodologies of the MO experiments will serve as the foundation for an extensive microbial census, offering significant insight into spaceflight-induced changes in the populations of beneficial and potentially harmful microbes. The safety of crewmembers and the maintenance of hardware are the primary goals for monitoring microorganisms in this closed habitat. The statistical analysis of the ISS microbiomes showed that three bacterial phyla dominated both in ISS and Earth cleanrooms, but varied in their abundances. While members of Actinobacteria were predominant on ISS, Proteobacteria dominated the Earth cleanrooms. Alpha diversity estimators indicated a significant drop in viable microbial diversity. To better characterize the shared community composition among samples, beta-diversity metrics analysis were conducted. At the bacterial species level characterization, the microbial community composition is strongly associated with sampling site. Results of the study indicate significant differences between ISS and Earth cleanroom microbiomes in terms of community structure and composition. Bacterial strains isolated from ISS surfaces were also tested for their resistance to nine antibiotics using conventional disc method and Vitek 2 system. Most of the Staphylococcus aureus strains were resistant to penicillin. Five strains were specifically resistant to erythromycin and the ermA gene was also detected. The nine-erythromycin sensitive S. aureus strains exhibited spontaneous mutation when rifampin was tested. Some of the S. aureus strains tolerated gentamycin and tobramycin but cefazolin, cefoxitin, ciprofloxacin and oxacillin inhibited the growth of the S. aureus. Whole genome sequencing (WGS) of 21 ISS strains, exhibiting resistance to various antibiotics, was carried out. The antibiotic resistant genes deduced from the WGS were compared with the resistomes generated directly from the gene pool of the environmental samples. Using a targeted amplification panel consisting of over 500 antimicrobial resistance genes, we were able to confirm the results of the phenotypic assays. Specifically, the presence of multiple β-lactamase genes was observed. The class A β-lactamase genes, tem-1 (ampicillin-resistance) and ctx-M-14 (cefotaxime conferring gene), were found in multiple sites of ISS. In addition, presence of mecA gene (penicillin clusters) was confirmed in several sampling locations from both ISS flights. Finally, the existence of the ermA gene (erythromycin) was established. These results suggest widespread and consistent distribution of multiple antibiotic resistance genes throughout the ISS. The resistome data generated via molecular methods will be extremely important in determining the microbial significance to the crew health and the ISS maintenance. These data sets will be placed in the NASA GeneLab bioinformatics environment - consisting of a database, computational tools, and improved methods - that would subsequently be made open to the scientific research community to encourage innovation.

  17. Genome-wide analysis of Tol2 transposon reintegration in zebrafish.

    PubMed

    Kondrychyn, Igor; Garcia-Lecea, Marta; Emelyanov, Alexander; Parinov, Sergey; Korzh, Vladimir

    2009-09-08

    Tol2, a member of the hAT family of transposons, has become a useful tool for genetic manipulation of model animals, but information about its interactions with vertebrate genomes is still limited. Furthermore, published reports on Tol2 have mainly been based on random integration of the transposon system after co-injection of a plasmid DNA harboring the transposon and a transposase mRNA. It is important to understand how Tol2 would behave upon activation after integration into the genome. We performed a large-scale enhancer trap (ET) screen and generated 338 insertions of the Tol2 transposon-based ET cassette into the zebrafish genome. These insertions were generated by remobilizing the transposon from two different donor sites in two transgenic lines. We found that 39% of Tol2 insertions occurred in transcription units, mostly into introns. Analysis of the transposon target sites revealed no strict specificity at the DNA sequence level. However, Tol2 was prone to target AT-rich regions with weak palindromic consensus sequences centered at the insertion site. Our systematic analysis of sequential remobilizations of the Tol2 transposon from two independent sites within a vertebrate genome has revealed properties such as a tendency to integrate into transcription units and into AT-rich palindrome-like sequences. This information will influence the development of various applications involving DNA transposons and Tol2 in particular.

  18. Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

    PubMed

    Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

    2016-12-07

    Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant impact of the insertion on gene expression. We demonstrated that specific Ty1-copia families have been active since breeding commenced in flax. The retrotransposon-derived polymorphism can be used to separate flax types, and the close association of many insertions with genes defines a good source of potential mutations that could be associated with phenotypic changes, resulting in diversification processes.

  19. Selfish DNA in protein-coding genes of Rickettsia.

    PubMed

    Ogata, H; Audic, S; Barbe, V; Artiguenave, F; Fournier, P E; Raoult, D; Claverie, J M

    2000-10-13

    Rickettsia conorii, the aetiological agent of Mediterranean spotted fever, is an intracellular bacterium transmitted by ticks. Preliminary analyses of the nearly complete genome sequence of R. conorii have revealed 44 occurrences of a previously undescribed palindromic repeat (150 base pairs long) throughout the genome. Unexpectedly, this repeat was found inserted in-frame within 19 different R. conorii open reading frames likely to encode functional proteins. We found the same repeat in proteins of other Rickettsia species. The finding of a mobile element inserted in many unrelated genes suggests the potential role of selfish DNA in the creation of new protein sequences.

  20. Clostridium perfringens type A–E toxin plasmids

    PubMed Central

    Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.

    2014-01-01

    Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728

  1. Optimizing and benchmarking de novo transcriptome sequencing: from library preparation to assembly evaluation.

    PubMed

    Hara, Yuichiro; Tatsumi, Kaori; Yoshida, Michio; Kajikawa, Eriko; Kiyonari, Hiroshi; Kuraku, Shigehiro

    2015-11-18

    RNA-seq enables gene expression profiling in selected spatiotemporal windows and yields massive sequence information with relatively low cost and time investment, even for non-model species. However, there remains a large room for optimizing its workflow, in order to take full advantage of continuously developing sequencing capacity. Transcriptome sequencing for three embryonic stages of Madagascar ground gecko (Paroedura picta) was performed with the Illumina platform. The output reads were assembled de novo for reconstructing transcript sequences. In order to evaluate the completeness of transcriptome assemblies, we prepared a reference gene set consisting of vertebrate one-to-one orthologs. To take advantage of increased read length of >150 nt, we demonstrated shortened RNA fragmentation time, which resulted in a dramatic shift of insert size distribution. To evaluate products of multiple de novo assembly runs incorporating reads with different RNA sources, read lengths, and insert sizes, we introduce a new reference gene set, core vertebrate genes (CVG), consisting of 233 genes that are shared as one-to-one orthologs by all vertebrate genomes examined (29 species)., The completeness assessment performed by the computational pipelines CEGMA and BUSCO referring to CVG, demonstrated higher accuracy and resolution than with the gene set previously established for this purpose. As a result of the assessment with CVG, we have derived the most comprehensive transcript sequence set of the Madagascar ground gecko by means of assembling individual libraries followed by clustering the assembled sequences based on their overall similarities. Our results provide several insights into optimizing de novo RNA-seq workflow, including the coordination between library insert size and read length, which manifested in improved connectivity of assemblies. The approach and assembly assessment with CVG demonstrated here would be applicable to transcriptome analysis of other species as well as whole genome analyses.

  2. Noncytopathogenic Pestivirus Strains Generated by Nonhomologous RNA Recombination: Alterations in the NS4A/NS4B Coding Region

    PubMed Central

    Gallei, Andreas; Orlich, Michaela; Thiel, Heinz-Juergen; Becher, Paul

    2005-01-01

    Several studies have demonstrated that cytopathogenic (cp) pestivirus strains evolve from noncytopathogenic (noncp) viruses by nonhomologous RNA recombination. In addition, two recent reports showed the rapid emergence of noncp Bovine viral diarrhea virus (BVDV) after a few cell culture passages of cp BVDV strains by homologous recombination between identical duplicated viral sequences. To allow the identification of recombination sites from noncp BVDV strains that evolve from cp viruses, we constructed the cp BVDV strains CP442 and CP552. Both harbor duplicated viral sequences of different origin flanking the cellular insertion Nedd8*; the latter is a prerequisite for their cytopathogenicity. In contrast to the previous studies, isolation of noncp strains was possible only after extensive cell culture passages of CP442 and CP552. Sequence analysis of 15 isolated noncp BVDVs confirmed that all recombinant strains lack at least most of Nedd8*. Interestingly, only one strain resulted from homologous recombination while the other 14 strains were generated by nonhomologous recombination. Accordingly, our data suggest that the extent of sequence identity between participating sequences influences both frequency and mode (homologous versus nonhomologous) of RNA recombination in pestiviruses. Further analyses of the noncp recombinant strains revealed that a duplication of 14 codons in the BVDV nonstructural protein 4B (NS4B) gene does not interfere with efficient viral replication. Moreover, an insertion of viral sequences between the NS4A and NS4B genes was well tolerated. These findings thus led to the identification of two genomic loci which appear to be suited for the insertion of heterologous sequences into the genomes of pestiviruses and related viruses. PMID:16254361

  3. Zarya Energy Balance Analysis: The Effect of Spacecraft Shadowing on Solar Array Performance

    NASA Technical Reports Server (NTRS)

    Hoffman, David J.; Kolosov, Vladimir

    1999-01-01

    The first element of the International Space Station (ISS). Zarya, was funded by NASA and built by the Russian aerospace company Khrunichev State Research and Production Space Center (KhSC). NASA Glenn Research Center (GRC) and KhSC collaborated in performing analytical predictions of the on-orbit electrical performance of Zarya's solar arrays. GRC assessed the pointing characteristics of and shadow patterns on Zarya's solar arrays to determine the average solar energy incident on the arrays. KHSC used the incident energy results to determine Zarya's electrical power generation capability and orbit-average power balance. The power balance analysis was performed over a range of solar beta angles and vehicle operational conditions. This analysis enabled identification of problems that could impact the power balance for specific flights during ISS assembly and was also used as the primary means of verifying that Zarya complied with electrical power requirements. Analytical results are presented for select stages in the ISS assembly sequence along with a discussion of the impact of shadowing on the electrical performance of Zarya's solar arrays.

  4. Development and characterization of simple sequence repeats for Bipolaris sokiniana and cross transferability to related species

    USDA-ARS?s Scientific Manuscript database

    Simple sequence repeats (SSR) markers were developed from a small insert genomic library for Bipolaris sorokiniana, a mitosporic fungal pathogen that causes spot blotch and root rot in switchgrass. About 59% of sequenced clones (n=384) harbored various SSR motifs. After eliminating the redundant seq...

  5. Increasing genomic diversity and evidence of constrained lifestyle evolution due to insertion sequences in Aeromonas salmonicida.

    PubMed

    Vincent, Antony T; Trudel, Mélanie V; Freschi, Luca; Nagar, Vandan; Gagné-Thivierge, Cynthia; Levesque, Roger C; Charette, Steve J

    2016-01-12

    Aeromonads make up a group of Gram-negative bacteria that includes human and fish pathogens. The Aeromonas salmonicida species has the peculiarity of including five known subspecies. However, few studies of the genomes of A. salmonicida subspecies have been reported to date. We sequenced the genomes of additional A. salmonicida isolates, including three from India, using next-generation sequencing in order to gain a better understanding of the genomic and phylogenetic links between A. salmonicida subspecies. Their relative phylogenetic positions were confirmed by a core genome phylogeny based on 1645 gene sequences. The Indian isolates, which formed a sub-group together with A. salmonicida subsp. pectinolytica, were able to grow at either at 18 °C and 37 °C, unlike the A. salmonicida psychrophilic isolates that did not grow at 37 °C. Amino acid frequencies, GC content, tRNA composition, loss and gain of genes during evolution, pseudogenes as well as genes under positive selection and the mobilome were studied to explain this intraspecies dichotomy. Insertion sequences appeared to be an important driving force that locked the psychrophilic strains into their particular lifestyle in order to conserve their genomic integrity. This observation, based on comparative genomics, is in agreement with previous results showing that insertion sequence mobility induced by heat in A. salmonicida subspecies causes genomic plasticity, resulting in a deleterious effect on the virulence of the bacterium. We provide a proof-of-concept that selfish DNAs play a major role in the evolution of bacterial species by modeling genomes.

  6. Rapid discrimination of sequences flanking and within T-DNA insertions in the Arabidopsis genome.

    PubMed

    Ponce, M R; Quesada, V; Micol, J L

    1998-05-01

    An improvement to previous methods for recovering Arabidopsis thaliana genomic DNA flanking T-DNA insertions is presented that allows for the avoidance of some of the cloning difficulties caused by the concatameric nature of T-DNA inserts. The principle of the procedure is to categorize by size restriction fragments of mutant DNA, produced in separate digestions with NdeI and Bst1107I. Given that the sites for these two enzymes are contiguous within the pGV3850:1003 T-DNA construct, the restriction fragments obtained fall into two categories: those showing identical size in both digestions, which correspond to sequences internal to T-DNA concatamers; and those of different sizes, that contain the junctions between plant DNA and the T-DNA insert. Such a criterion makes it possible to easily distinguish the digestion products corresponding to internal T-DNA parts, which do not deserve further attention, and those which presumably include a segment of the locus of interest. Discrimination between restriction fragments of genomic mutant DNA can be made on rescued plasmids, inverse PCR amplification products or bands in a genomic blot.

  7. Cassini ISS and VIMS observations of Titan's north polar region during the T120 and T121 flybys: The Curious Case of the Clouds

    NASA Astrophysics Data System (ADS)

    Turtle, E. P.; Barnes, J. W.; Perry, J.; Barbara, J.; Hayes, A.; Corlies, P.; Kelland, J.; West, R. A.; Del Genio, A. D.; Soderblom, J. M.; McEwen, A. S.; Sotin, C.

    2016-12-01

    As northern summer approaches, atmospheric circulation models predict storm activity will pick up at Titan's high northern latitudes, as was observed at high southern latitudes upon Cassini's arrival during late southern summer in 2004. Cassini's Imaging Science Subsystem (ISS) and Visual and Infrared Mapping Spectrometer (VIMS) teams have been targeting Titan to document changes in weather patterns over the course of the mission, and there is particular interest in following the onset of clouds in the north polar region where Titan's lakes and seas are concentrated. The T120 and T121 flybys of Titan, on 7 June and 25 July 2016, respectively, provided views of high northern latitudes, and each instrument performed a series of observations over more than 24 hours during both flybys. Intriguingly, at first look the ISS and VIMS observations appear strikingly different from each other: in the ISS observations made during each flyby, surface features are apparent and only a few isolated clouds are detected; however, the VIMS observations suggest widespread cloud cover at high northern latitudes during both flybys. Although the instruments achieve different resolutions, that alone cannot explain the differences. The observations were made over the same time periods, so differences in illumination geometry or changes in the clouds themselves are also unlikely to be the cause for the apparent discrepancy; VIMS shows persistent atmospheric features over the entire observation period and ISS consistently detects surface features with just a few localized clouds. Clouds with low optical depth (lower than the optical depth of Titan's atmospheric haze at the same wavelength) might be more easily apparent at the longer wavelengths of the VIMS observations, which extend out to 5 µm (haze optical depth 0.2), compared to the ISS observations at 938 nm (haze optical depth 2). However, the lack of any apparent change in the visibility of lakes and seas in the ISS images compared to previous flybys where no clouds were observed is still difficult to explain. We will present our analyses of the sequences of observations made by ISS and VIMS during T120 and T121, as well as an ongoing ground-based observing campaign (including data from 8 June and 23 July), and the implications for the behavior of Titan's atmosphere leading up to northern summer.

  8. Antibody classes & subclasses induced by mucosal immunization of mice with Streptococcus pyogenes M6 protein & oligodeoxynucleotides containing CpG motifs.

    PubMed

    Teloni, R; von Hunolstein, C; Mariotti, S; Donati, S; Orefici, G; Nisini, R

    2004-05-01

    Type-specific antibodies against M protein are critical for human protection as they enhance phagocytosis and are protective. An ideal vaccine for the protection against Streptococcus pyogenes would warrant mucosal immunity, but mucosally administered M-protein has been shown to be poorly immunogenic in animals. We used a recombinant M type 6 protein to immunize mice in the presence of synthetic oligodeoxynucleotides containing CpG motifs (immunostimulatory sequences: ISS) or cholera toxin (CT) to explore its possible usage in a mucosal vaccine. Mice were immunized by intranasal (in) or intradermal (id) administration with four doses at weekly intervals of M6-protein (10 microg/mouse) with or without adjuvant (ISS, 10 microg/mouse or CT, 0,5 microg/mouse). M6 specific antibodies were measured by enzyme linked immunosorbent assay using class and subclass specific monoclonal antibodies. The use of ISS induced an impressive anti M-protein serum IgG response but when id administered was not detectable in the absence of adjuvant. When used in, M-protein in the presence of both ISS and CT induced anti M-protein IgA in the bronchoalveolar lavage, as well as specific IgG in the serum. IgG were able to react with serotype M6 strains of S. pyogenes. The level of antibodies obtained by immunizing mice in with M-protein and CT was higher in comparison to M-protein and ISS. The analysis of anti-M protein specific IgG subclasses showed high levels of IgG1, IgG2a and IgG2b, and low levels of IgG3 when ISS were used as adjuvant. Thus, in the presence of ISS, the ratio IgG2a/IgG1 and (IgG2a+IgG3)/IgG1 >1 indicated a type 1-like response obtained both in mucosally or systemically vaccinated mice. Our study offers a reproducible model of anti-M protein vaccination that could be applied to test new antigenic formulations to induce an anti-group A Streptococcus (GAS) vaccination suitable for protection against the different diseases caused by this bacterium.

  9. Orbital Evolution and Physical Characteristics of Object "Peggy" at the Edge of Saturn's A Ring

    NASA Astrophysics Data System (ADS)

    Murray, C.; Cooper, N. J.; Noyelles, B.; Renner, S.; Araujo, N.

    2016-12-01

    Images taken with the Cassini ISS instrument on 2013 April 15 showed the presence of a bright, extended object at the edge of Saturn's A ring. The gravitational signature of the object often appears as a discontinuity in the azimuthal profile of the ring edge and a subsequent analysis revealed that the object (nicknamed "Peggy") was detectable in ISS images as far back as 2012. The morphology of the signature is a function of the orbital phase suggesting that the object has a relative eccentricity or periapse with respect to the surrounding ring material. Tracking the signature allows a determination of the object's semi-major axis and following the initial detection this has varied by as much as 5 km. At no stage has the object been as bright as it was at the time of its discovery, suggesting that a collisional event had recently occurred. Here we report on the latest Cassini ISS observations of "Peggy" and their interpretation. These will include the calculated changes in its semi-major axis since 2013, constraints on its mass based on numerical integrations of its perturbing effect on adjacent ring particles, and what has been learned from a recent 8 h sequence of high resolution ISS images specially designed to track "Peggy" for more than half an orbital period.

  10. Continuous Influx of Genetic Material from Host to Virus Populations

    PubMed Central

    Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane

    2016-01-01

    Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124

  11. Continuous Influx of Genetic Material from Host to Virus Populations.

    PubMed

    Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A

    2016-02-01

    Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.

  12. Transposon Insertions of magellan-4 That Impair Social Gliding Motility in Myxococcus xanthus

    PubMed Central

    Youderian, Philip; Hartzell, Patricia L.

    2006-01-01

    Myxococcus xanthus has two different mechanisms of motility, adventurous (A) motility, which permits individual cells to glide over solid surfaces, and social (S) motility, which permits groups of cells to glide. To identify the genes involved in S-gliding motility, we mutagenized a ΔaglU (A−) strain with the defective transposon, magellan-4, and screened for S− mutants that form nonmotile colonies. Sequence analysis of the sites of the magellan-4 insertions in these mutants and the alignment of these sites with the M. xanthus genome sequence show that two-thirds of these insertions lie within 27 of the 37 nonessential genes known to be required for social motility, including those necessary for the biogenesis of type IV pili, exopolysaccharide, and lipopolysaccharide. The remaining insertions also identify 31 new, nonessential genes predicted to encode both structural and regulatory determinants of S motility. These include three tetratricopeptide repeat proteins, several regulators of transcription that may control the expression of genes involved in pilus extension and retraction, and additional enzymes involved in polysaccharide metabolism. Three insertions that abolish S motility lie within genes predicted to encode glycolytic enzymes, suggesting that the signal for pilus retraction may be a simple product of exopolysaccharide catabolism. PMID:16299386

  13. Activity of genes with functions in human Williams-Beuren Syndrome are impacted by mobile element insertions in the gray wolf genome.

    PubMed

    vonHoldt, Bridgett M; Ji, Sarah S; Aardema, Matthew L; Stahler, Daniel; Udell, Monique A R; Sinsheimer, Janet S

    2018-06-01

    In canines, transposon dynamics have been associated with a hyper-social behavioral syndrome, although the functional mechanism has yet to be described. We investigate the epigenetic and transcriptional consequences of these behavior-associated mobile element insertions in dogs and Yellowstone wolves. We posit that the transposons themselves may not be the causative feature; rather, their transcriptional regulation may exert the functional impact. We survey four outlier transposons associated with hyper-sociability, with the expectation that they are targeted for epigenetic silencing. We predict hyper-methylation of mobile element insertions (MEIs), suggestive that the epigenetic silencing of and not the MEIs themselves may be driving dysregulation of nearby genes. We found that transposon-derived sequences are significantly hyper-methylated, regardless of their copy number or species. Further, we have assessed transcriptome sequence data and found evidence that mobile element insertions impact the expression levels of six genes (WBSCR17, LIMK1, GTF2I, WBSCR27, BAZ1B, and BCL7B), all of which have known roles in human Williams-Beuren syndrome due to changes in copy number, typically hemizygosity. Although further evidence is needed, our results suggest that a few insertions alter local expression at multiple genes, likely through a cis-regulatory mechanism that excludes proximal methylation.

  14. STS-74/Mir photogrammetric appendage structural dynamics experiment

    NASA Technical Reports Server (NTRS)

    Welch, Sharon S.; Gilbert, Michael G.

    1996-01-01

    The Photogrammetric Appendage Structural Dynamics Experiment (PASDE) is an International Space Station (ISS) Phase-1 risk mitigation experiment. Phase-1 experiments are performed during docking missions of the U.S. Space Shuttle to the Russian Space Station Mir. The purpose of the experiment is to demonstrate the use of photogrammetric techniques for determination of structural dynamic mode parameters of solar arrays and other spacecraft appendages. Photogrammetric techniques are a low cost alternative to appendage mounted accelerometers for the ISS program. The objective of the first flight of PASDE, on STS-74 in November 1995, was to obtain video images of Mir Kvant-2 solar array response to various structural dynamic excitation events. More than 113 minutes of high quality structural response video data was collected during the mission. The PASDE experiment hardware consisted of three instruments each containing two video cameras, two video tape recorders, a modified video signal time inserter, and associated avionics boxes. The instruments were designed, fabricated, and tested at the NASA Langley Research Center in eight months. The flight hardware was integrated into standard Hitchhiker canisters at the NASA Goddard Space Flight Center and then installed into the Space Shuttle cargo bay in locations selected to achieve good video coverage and photogrammetric geometry.

  15. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Solera, J.; Magallon, M.; Martin-Villar, J.

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

  16. Payload Flight Assignments: NASA Mixed Fleet

    NASA Technical Reports Server (NTRS)

    Parker, Robert A. R.

    1997-01-01

    This manifest summarizes the missions planned by NASA for the Space Shuttle and Expendable Launch Vehicles (ELV's) as of the date of publication. Space Shuttle and ELV missions are shown through calendar year 2003. Space Shuttle missions for calendar years 2002-2003 are under review pending the resolution of details in the assembly sequence of the International Space Station (ISS).

  17. Heteroleptic tin(II) initiators for the ring-opening (co)polymerization of lactide and trimethylene carbonate: mechanistic insights from experiments and computations.

    PubMed

    Wang, Lingfang; Kefalidis, Christos E; Sinbandhit, Sourisak; Dorcet, Vincent; Carpentier, Jean-François; Maron, Laurent; Sarazin, Yann

    2013-09-27

    The tin(II) complexes {LO(x)}Sn(X) ({LO(x)}(-) =aminophenolate ancillary) containing amido (1-4), chloro (5), or lactyl (6) coligands (X) promote the ring-opening polymerization (ROP) of cyclic esters. Complex 6, which models the first insertion of L-lactide, initiates the living ROP of L-LA on its own, but the amido derivatives 1-4 require the addition of alcohol to do so. Upon addition of one to ten equivalents of iPrOH, precatalysts 1-4 promote the ROP of trimethylene carbonate (TMC); yet, hardly any activity is observed if tert-butyl (R)-lactate is used instead of iPrOH. Strong inhibition of the reactivity of TMC is also detected for the simultaneous copolymerization of L-LA and TMC, or for the block copolymerization of TMC after that of L-LA. Experimental and computational data for the {LO(x)}Sn(OR)complexes (OR=lactyl or lactidyl) replicating the active species during the tin(II)-mediated ROP of L-LA demonstrate that the formation of a five-membered chelate is largely favored over that of an eight-membered one, and that it constitutes the resting state of the catalyst during this (co)polymerization. Comprehensive DFT calculations show that, out of the four possible monomer insertion sequences during simultaneous copolymerization of L-LA and TMC: 1) TMC then TMC, 2) TMC then L-LA, 3) L-LA then L-LA, and 4) L-LA then TMC, the first three are possible. By contrast, insertion of L-LA followed by that of TMC (i.e., insertion sequence 4) is endothermic by +1.1 kcal mol(-1), which compares unfavorably with consecutive insertions of two L-LA units (i.e., insertion sequence 3) (-10.2 kcal mol(-1)). The copolymerization of L-LA and TMC thus proceeds under thermodynamic control. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Disruption of tetR type regulator adeN by mobile genetic element confers elevated virulence in Acinetobacter baumannii.

    PubMed

    Saranathan, Rajagopalan; Pagal, Sudhakar; Sawant, Ajit R; Tomar, Archana; Madhangi, M; Sah, Suresh; Satti, Annapurna; Arunkumar, K P; Prashanth, K

    2017-10-03

    Acinetobacter baumannii is an important human pathogen and considered as a major threat due to its extreme drug resistance. In this study, the genome of a hyper-virulent MDR strain PKAB07 of A. baumannii isolated from an Indian patient was sequenced and analyzed to understand its mechanisms of virulence, resistance and evolution. Comparative genome analysis of PKAB07 revealed virulence and resistance related genes scattered throughout the genome, instead of being organized as an island, indicating the highly mosaic nature of the genome. Many intermittent horizontal gene transfer events, insertion sequence (IS) element insertions identified were augmenting resistance machinery and elevating the SNP densities in A. baumannii eventually aiding in their swift evolution. ISAba1, the most widely distributed insertion sequence in A. baumannii was found in multiple sites in PKAB07. Out of many ISAba1 insertions, we identified novel insertions in 9 different genes wherein insertional inactivation of adeN (tetR type regulator) was significant. To assess the significance of this disruption in A. baumannii, adeN mutant and complement strains were constructed in A. baumannii ATCC 17978 strain and studied. Biofilm levels were abrogated in the adeN knockout when compared with the wild type and complemented strain of adeN knockout. Virulence of the adeN knockout mutant strain was observed to be high, which was validated by in vitro experiments and Galleria mellonella infection model. The overexpression of adeJ, a major component of AdeIJK efflux pump observed in adeN knockout strain could be the possible reason for the elevated virulence in adeN mutant and PKB07 strain. Knocking out of adeN in ATCC strain led to increased resistance and virulence at par with the PKAB07. Disruption of tetR type regulator adeN by ISAba1 consequently has led to elevated virulence in this pathogen.

  19. Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

    PubMed

    Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

    2017-12-01

    Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

  20. Sliding over the Blocks in Enzyme-Free RNA Copying – One-Pot Primer Extension in Ice

    PubMed Central

    Löffler, Philipp M. G.; Groen, Joost; Dörr, Mark; Monnard, Pierre-Alain

    2013-01-01

    Template-directed polymerization of RNA in the absence of enzymes is the basis for an information transfer in the ‘RNA-world’ hypothesis and in novel nucleic acid based technology. Previous investigations established that only cytidine rich strands are efficient templates in bulk aqueous solutions while a few specific sequences completely block the extension of hybridized primers. We show that a eutectic water/ice system can support Pb2+/Mg2+-ion catalyzed extension of a primer across such sequences, i.e. AA, AU and AG, in a one-pot synthesis. Using mixtures of imidazole activated nucleotide 5′-monophosphates, the two first “blocking” residues could be passed during template-directed polymerization, i.e., formation of triply extended products containing a high fraction of faithful copies was demonstrated. Across the AG sequence, a mismatch sequence was formed in similar amounts to the correct product due to U·G wobble pairing. Thus, the template-directed extension occurs both across pyrimidine and purine rich sequences and insertions of pyrimidines did not inhibit the subsequent insertions. Products were mainly formed with 2′-5′-phosphodiester linkages, however, the abundance of 3′–5′-linkages was higher than previously reported for pyrimidine insertions. When enzyme-free, template-directed RNA polymerization is performed in a eutectic water ice environment, various intrinsic reaction limitations observed in bulk solution can then be overcome. PMID:24058695

  1. Isolation and molecular characterization of dTnp1, a mobile and defective transposable element of Nicotiana plumbaginifolia.

    PubMed

    Meyer, C; Pouteau, S; Rouzé, P; Caboche, M

    1994-01-01

    By Northern blot analysis of nitrate reductase-deficient mutants of Nicotiana plumbaginifolia, we identified a mutant (mutant D65), obtained after gamma-ray irradiation of protoplasts, which contained an insertion sequence in the nitrate reductase (NR) mRNA. This insertion sequence was localized by polymerase chain reaction (PCR) in the first exon of NR and was also shown to be present in the NR gene. The mutant gene contained a 565 bp insertion sequence that exhibits the sequence characteristics of a transposable element, which was thus named dTnp1. The dTnp1 element has 14 bp terminal inverted repeats and is flanked by an 8-bp target site duplication generated upon transposition. These inverted repeats have significant sequence homology with those of other transposable elements. Judging by its size and the absence of a long open reading frame, dTnp1 appears to represent a defective, although mobile, transposable element. The octamer motif TTTAGGCC was found several times in direct orientation near the 5' and 3' ends of dTnp1 together with a perfect palindrome located after the 5' inverted repeat. Southern blot analysis using an internal probe of dTnp1 suggested that this element occurs as a single copy in the genome of N. plumbaginifolia. It is also present in N. tabacum, but absent in tomato or petunia. The dTnp1 element is therefore of potential use for gene tagging in Nicotiana species.

  2. Read count-based method for high-throughput allelic genotyping of transposable elements and structural variants.

    PubMed

    Kuhn, Alexandre; Ong, Yao Min; Quake, Stephen R; Burkholder, William F

    2015-07-08

    Like other structural variants, transposable element insertions can be highly polymorphic across individuals. Their functional impact, however, remains poorly understood. Current genome-wide approaches for genotyping insertion-site polymorphisms based on targeted or whole-genome sequencing remain very expensive and can lack accuracy, hence new large-scale genotyping methods are needed. We describe a high-throughput method for genotyping transposable element insertions and other types of structural variants that can be assayed by breakpoint PCR. The method relies on next-generation sequencing of multiplex, site-specific PCR amplification products and read count-based genotype calls. We show that this method is flexible, efficient (it does not require rounds of optimization), cost-effective and highly accurate. This method can benefit a wide range of applications from the routine genotyping of animal and plant populations to the functional study of structural variants in humans.

  3. Investigating Delamination Migration in Composite Tape Laminates

    NASA Technical Reports Server (NTRS)

    Ratcliffe, James G.; DeCarvalho, Nelson V.

    2014-01-01

    A modification to a recently developed test specimen designed to investigate migration of a delamination between neighboring ply interfaces in tape laminates is presented. The specimen is a cross-ply laminated beam consisting of 40 plies with a polytetrafluoroethylene insert spanning part way along its length. The insert is located between a lower 0-degree ply (specimen length direction) and a stack of four 90-degree plies (specimen width direction). The modification involved a stacking sequence that promotes stable delamination growth prior to migration, and included a relocation of the insert from the specimen midplane to the interface between plies 14 and 15. Specimens were clamped at both ends onto a rigid baseplate and loaded on their upper surface via a piano hinge assembly, resulting in a predominantly flexural loading condition. Tests were conducted with the load-application point positioned at various locations along a specimen's span. This position affected the sequence of damage events during a test.

  4. In and out of the rRNA genes: characterization of Pokey elements in the sequenced Daphnia genome

    PubMed Central

    2013-01-01

    Background Only a few transposable elements are known to exhibit site-specific insertion patterns, including the well-studied R-element retrotransposons that insert into specific sites within the multigene rDNA. The only known rDNA-specific DNA transposon, Pokey (superfamily: piggyBac) is found in the freshwater microcrustacean, Daphnia pulex. Here, we present a genome-wide analysis of Pokey based on the recently completed whole genome sequencing project for D. pulex. Results Phylogenetic analysis of Pokey elements recovered from the genome sequence revealed the presence of four lineages corresponding to two divergent autonomous families and two related lineages of non-autonomous miniature inverted repeat transposable elements (MITEs). The MITEs are also found at the same 28S rRNA gene insertion site as the Pokey elements, and appear to have arisen as deletion derivatives of autonomous elements. Several copies of the full-length Pokey elements may be capable of producing an active transposase. Surprisingly, both families of Pokey possess a series of 200 bp repeats upstream of the transposase that is derived from the rDNA intergenic spacer (IGS). The IGS sequences within the Pokey elements appear to be evolving in concert with the rDNA units. Finally, analysis of the insertion sites of Pokey elements outside of rDNA showed a target preference for sites similar to the specific sequence that is targeted within rDNA. Conclusions Based on the target site preference of Pokey elements and the concerted evolution of a segment of the element with the rDNA unit, we propose an evolutionary path by which the ancestors of Pokey elements have invaded the rDNA niche. We discuss how specificity for the rDNA unit may have evolved and how this specificity has played a role in the long-term survival of these elements in the subgenus Daphnia. PMID:24059783

  5. A LINE-1 Insertion in DLX6 Is Responsible for Cleft Palate and Mandibular Abnormalities in a Canine Model of Pierre Robin Sequence

    PubMed Central

    Wolf, Zena T.; Leslie, Elizabeth J.; Arzi, Boaz; Jayashankar, Kartika; Karmi, Nili; Jia, Zhonglin; Rowland, Douglas J.; Young, Amy; Safra, Noa; Sliskovic, Saundra; Murray, Jeffrey C.; Wade, Claire M.; Bannasch, Danika L.

    2014-01-01

    Cleft palate (CP) is one of the most commonly occurring craniofacial birth defects in humans. In order to study cleft palate in a naturally occurring model system, we utilized the Nova Scotia Duck Tolling Retriever (NSDTR) dog breed. Micro-computed tomography analysis of CP NSDTR craniofacial structures revealed that these dogs exhibit defects similar to those observed in a recognizable subgroup of humans with CP: Pierre Robin Sequence (PRS). We refer to this phenotype in NSDTRs as CP1. Individuals with PRS have a triad of birth defects: shortened mandible, posteriorly placed tongue, and cleft palate. A genome-wide association study in 14 CP NSDTRs and 72 unaffected NSDTRs identified a significantly associated region on canine chromosome 14 (24.2 Mb–29.3 Mb; praw = 4.64×10−15). Sequencing of two regional candidate homeobox genes in NSDTRs, distal-less homeobox 5 (DLX5) and distal-less homeobox 6 (DLX6), identified a 2.1 kb LINE-1 insertion within DLX6 in CP1 NSDTRs. The LINE-1 insertion is predicted to insert a premature stop codon within the homeodomain of DLX6. This prompted the sequencing of DLX5 and DLX6 in a human cohort with CP, where a missense mutation within the highly conserved DLX5 homeobox of a patient with PRS was identified. This suggests the involvement of DLX5 in the development of PRS. These results demonstrate the power of the canine animal model as a genetically tractable approach to understanding naturally occurring craniofacial birth defects in humans. PMID:24699068

  6. Distinct Bacteriophages Encoding Panton-Valentine Leukocidin (PVL) among International Methicillin-Resistant Staphylococcus aureus Clones Harboring PVL▿

    PubMed Central

    Boakes, E.; Kearns, A. M.; Ganner, M.; Perry, C.; Hill, R. L.; Ellington, M. J.

    2011-01-01

    Genetically diverse community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) can harbor a bacteriophage encoding Panton-Valentine leukocidin (PVL) lysogenized into its chromosome (prophage). Six PVL phages (ΦPVL, Φ108PVL, ΦSLT, ΦSa2MW, ΦSa2USA, and ΦSa2958) are known, and single-nucleotide polymorphisms (SNPs) in the PVL genes have been reported. We sought to determine the distribution of lysogenized PVL phages among MRSA strains with PVL (PVL-MRSA strains), the PVL gene sequences, and the chromosomal phage insertion sites in 114 isolates comprising nine clones of PVL-MRSA that were selected for maximal underlying genetic diversity. The six PVL phages were identified by PCR; ΦSa2USA was present in the highest number of different lineages (multilocus sequence type clonal complex 1 [CC1], CC5, CC8, and sequence type 93 [ST93]) (n = 37 isolates). Analysis of 92 isolates confirmed that PVL phages inserted into the same chromosomal insertion locus in CC22, -30, and -80 but in a different locus in isolates of CC1, -5, -8, -59, and -88 and ST93 (and CC22 in two isolates). Within the two different loci, specific attachment motifs were found in all cases, although some limited inter- and intralineage sequence variation occurred. Overall, lineage-specific relationships between the PVL phage, the genes that encode the toxin, and the position at which the phage inserts into the host chromosome were identified. These analyses provide important insights into the microepidemiology of PVL-MRSA, will prove a valuable adjunct in outbreak investigation, and may help predict the emergence of new strains. PMID:21106787

  7. Structural diversity of domain superfamilies in the CATH database.

    PubMed

    Reeves, Gabrielle A; Dallman, Timothy J; Redfern, Oliver C; Akpor, Adrian; Orengo, Christine A

    2006-07-14

    The CATH database of domain structures has been used to explore the structural variation of homologous domains in 294 well populated domain structure superfamilies, each containing at least three sequence diverse relatives. Our analyses confirm some previously detected trends relating sequence divergence to structural variation but for a much larger dataset and in some superfamilies the new data reveal exceptional structural variation. Use of a new algorithm (2DSEC) to analyse variability in secondary structure compositions across a superfamily sheds new light on how structures evolve. 2DSEC detects inserted secondary structures that embellish the core of conserved secondary structures found throughout the superfamily. Analysis showed that for 56% of highly populated superfamilies (>9 sequence diverse relatives), there are twofold or more increases in the numbers of secondary structures in some relatives. In some families fivefold increases occur, sometimes modifying the fold of the domain. Manual inspection of secondary structure insertions or embellishments in 48 particularly variable superfamilies revealed that although these insertions were usually discontiguous in the sequence they were often co-located in 3D resulting in a larger structural motif that often modified the geometry of the active site or the surface conformation promoting diverse domain partnerships and protein interactions. These observations, supported by automatic analysis of all well populated CATH families, suggest that accretion of small secondary structure insertions may provide a simple mechanism for evolving new functions in diverse relatives. Some layered domain architectures (e.g. mainly-beta and alpha-beta sandwiches) that recur highly in the genomes more frequently exploit these types of embellishments to modify function. In these architectures, aggregation occurs most often at the edges, top or bottom of the beta-sheets. Information on structural variability across domain superfamilies has been made available through the CATH Dictionary of Homologous Structures (DHS).

  8. Genetic Control of Plant Root Colonization by the Biocontrol agent, Pseudomonas fluorescens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cole, Benjamin J.; Fletcher, Meghan; Waters, Jordan

    Plant growth promoting rhizobacteria (PGPR) are a critical component of plant root ecosystems. PGPR promote plant growth by solubilizing inaccessible minerals, suppressing pathogenic microorganisms in the soil, and directly stimulating growth through hormone synthesis. Pseudomonas fluorescens is a well-established PGPR isolated from wheat roots that can also colonize the root system of the model plant, Arabidopsis thaliana. We have created barcoded transposon insertion mutant libraries suitable for genome-wide transposon-mediated mutagenesis followed by sequencing (TnSeq). These libraries consist of over 105 independent insertions, collectively providing loss-of-function mutants for nearly all genes in the P.fluorescens genome. Each insertion mutant can be unambiguouslymore » identified by a randomized 20 nucleotide sequence (barcode) engineered into the transposon sequence. We used these libraries in a gnotobiotic assay to examine the colonization ability of P.fluorescens on A.thaliana roots. Taking advantage of the ability to distinguish individual colonization events using barcode sequences, we assessed the timing and microbial concentration dependence of colonization of the rhizoplane niche. These data provide direct insight into the dynamics of plant root colonization in an in vivo system and define baseline parameters for the systematic identification of the bacterial genes and molecular pathways using TnSeq assays. Having determined parameters that facilitate potential colonization of roots by thousands of independent insertion mutants in a single assay, we are currently establishing a genome-wide functional map of genes required for root colonization in P.fluorescens. Importantly, the approach developed and optimized here for P.fluorescens>A.thaliana colonization will be applicable to a wide range of plant-microbe interactions, including biofuel feedstock plants and microbes known or hypothesized to impact on biofuel-relevant traits including biomass productivity and pathogen resistance.« less

  9. Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid

    PubMed Central

    Aboklaish, Ali F.; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I.; Spiller, O. Brad

    2015-01-01

    While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. PMID:25444567

  10. Random insertion and gene disruption via transposon mutagenesis of Ureaplasma parvum using a mini-transposon plasmid.

    PubMed

    Aboklaish, Ali F; Dordet-Frisoni, Emilie; Citti, Christine; Toleman, Mark A; Glass, John I; Spiller, O Brad

    2014-11-01

    While transposon mutagenesis has been successfully used for Mycoplasma spp. to disrupt and determine non-essential genes, previous attempts with Ureaplasma spp. have been unsuccessful. Using a polyethylene glycol-transformation enhancing protocol, we were able to transform three separate serovars of Ureaplasma parvum with a Tn4001-based mini-transposon plasmid containing a gentamicin resistance selection marker. Despite the large degree of homology between Ureaplasma parvum and Ureaplasma urealyticum, all attempts to transform the latter in parallel failed, with the exception of a single clinical U. urealyticum isolate. PCR probing and sequencing were used to confirm transposon insertion into the bacterial genome and identify disrupted genes. Transformation of prototype serovar 3 consistently resulted in transfer only of sequence between the mini-transposon inverted repeats, but some strains showed additional sequence transfer. Transposon insertion occurred randomly in the genome resulting in unique disruption of genes UU047, UU390, UU440, UU450, UU520, UU526, UU582 for single clones from a panel of screened clones. An intergenic insertion between genes UU187 and UU188 was also characterised. Two phenotypic alterations were observed in the mutated strains: Disruption of a DEAD-box RNA helicase (UU582) altered growth kinetics, while the U. urealyticum strain lost resistance to serum attack coincident with disruption of gene UUR10_137 and loss of expression of a 41 kDa protein. Transposon mutagenesis was used successfully to insert single copies of a mini-transposon into the genome and disrupt genes leading to phenotypic changes in Ureaplasma parvum strains. This method can now be used to deliver exogenous genes for expression and determine essential genes for Ureaplasma parvum replication in culture and experimental models. Copyright © 2014 Elsevier GmbH. All rights reserved.

  11. Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

    PubMed

    Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

    2012-08-01

    Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

  12. Public antibodies to malaria antigens generated by two LAIR1 insertion modalities.

    PubMed

    Pieper, Kathrin; Tan, Joshua; Piccoli, Luca; Foglierini, Mathilde; Barbieri, Sonia; Chen, Yiwei; Silacci-Fregni, Chiara; Wolf, Tobias; Jarrossay, David; Anderle, Marica; Abdi, Abdirahman; Ndungu, Francis M; Doumbo, Ogobara K; Traore, Boubacar; Tran, Tuan M; Jongo, Said; Zenklusen, Isabelle; Crompton, Peter D; Daubenberger, Claudia; Bull, Peter C; Sallusto, Federica; Lanzavecchia, Antonio

    2017-08-31

    In two previously described donors, the extracellular domain of LAIR1, a collagen-binding inhibitory receptor encoded on chromosome 19 (ref. 1), was inserted between the V and DJ segments of an antibody. This insertion generated, through somatic mutations, broadly reactive antibodies against RIFINs, a type of variant antigen expressed on the surface of Plasmodium falciparum-infected erythrocytes. To investigate how frequently such antibodies are produced in response to malaria infection, we screened plasma from two large cohorts of individuals living in malaria-endemic regions. Here we report that 5-10% of malaria-exposed individuals, but none of the European blood donors tested, have high levels of LAIR1-containing antibodies that dominate the response to infected erythrocytes without conferring enhanced protection against febrile malaria. By analysing the antibody-producing B cell clones at the protein, cDNA and gDNA levels, we characterized additional LAIR1 insertions between the V and DJ segments and discovered a second insertion modality whereby the LAIR1 exon encoding the extracellular domain and flanking intronic sequences are inserted into the switch region. By exon shuffling, this mechanism leads to the production of bispecific antibodies in which the LAIR1 domain is precisely positioned at the elbow between the VH and CH1 domains. Additionally, in one donor the genomic DNA encoding the VH and CH1 domains was deleted, leading to the production of a camel-like LAIR1-containing antibody. Sequencing of the switch regions of memory B cells from European blood donors revealed frequent templated inserts originating from transcribed genes that, in rare cases, comprised exons with orientations and frames compatible with expression. These results reveal different modalities of LAIR1 insertion that lead to public and dominant antibodies against infected erythrocytes and suggest that insertion of templated DNA represents an additional mechanism of antibody diversification that can be selected in the immune response against pathogens and exploited for B cell engineering.

  13. MR Performance Comparison of a PET/MR System Before and After SiPM-Based Time-of-Flight PET Detector Insertion

    NASA Astrophysics Data System (ADS)

    Khalighi, Mohammad Mehdi; Delso, Gaspar; Maramraju, Sri Harsha; Deller, Timothy W.; Levin, Craig S.; Glover, Gary H.

    2016-10-01

    A silicon photomultiplier (SiPM)-based time-of-flight capable PET detector has been integrated with a 70 cm wide-bore 3T MR scanner for simultaneous whole-body imaging (MR750w, GE Healthcare, Waukesha, WI). After insertion of the PET detector, the final PET/MR bore is 60 cm wide (SIGNA PET/MR, GE Healthcare, Waukesha, WI). The MR performance was compared before and after the PET ring insertion. B0 homogeneity, B1+ uniformity of the body coil along with peak B1+, coherent noise, and FBIRN (Function Biomedical Informatics Research Network) tests are used to compare the MR performance. It is shown that B0 homogeneity and coherent noise have not changed according to the system specifications. Peak B1+ is increased by 33% and B1+ inhomogeneity is increased by 4% after PET ring insertion due to a smaller diameter body coil design. The FBIRN test shows similar temporal stability before and after PET ring insertion. Due to a smaller body coil on the PET/MR system, the signal fluctuation to noise ratio (SFNR) and SNR for body receive coil, are improved by 40% and 160% for Echo Planar Imaging (EPI) and spiral sequences respectively. Comparison using RF- and gradient-intensive clinical sequences shows inserting the PET detectors into the wide-bore MRI has not compromised the MR image quality according to these tests.

  14. International Space Station environmental microbiome - microbial inventories of ISS filter debris.

    PubMed

    Venkateswaran, Kasthuri; Vaishampayan, Parag; Cisneros, Jessica; Pierson, Duane L; Rogers, Scott O; Perry, Jay

    2014-01-01

    Despite an expanding array of molecular approaches for detecting microorganisms in a given sample, rapid and robust means of assessing the differential viability of the microbial cells, as a function of phylogenetic lineage, remain elusive. A propidium monoazide (PMA) treatment coupled with downstream quantitative polymerase chain reaction (qPCR) and pyrosequencing analyses was carried out to better understand the frequency, diversity, and distribution of viable microorganisms associated with debris collected from the crew quarters of the International Space Station (ISS). The cultured bacterial counts were more in the ISS samples than cultured fungal population. The rapid molecular analyses targeted to estimate viable population exhibited 5-fold increase in bacterial (qPCR-PMA assay) and 25-fold increase in microbial (adenosine triphosphate assay) burden than the cultured bacterial population. The ribosomal nucleic acid-based identification of cultivated strains revealed the presence of only four to eight bacterial species in the ISS samples, however, the viable bacterial diversity detected by the PMA-pyrosequencing method was far more diverse (12 to 23 bacterial taxa) with the majority consisting of members of actinobacterial genera (Propionibacterium, Corynebacterium) and Staphylococcus. Sample fractions not treated with PMA (inclusive of both live and dead cells) yielded a great abundance of highly diverse bacterial (94 to 118 taxa) and fungal lineages (41 taxa). Even though deep sequencing capability of the molecular analysis widened the understanding about the microbial diversity, the cultivation assay also proved to be essential since some of the spore-forming microorganisms were detected only by the culture-based method. Presented here are the findings of the first comprehensive effort to assess the viability of microbial cells associated with ISS surfaces, and correlate differential viability with phylogenetic affiliation.

  15. Evaluating Documents: The Case of Patient Package Inserts. Technical Report No. 2.

    ERIC Educational Resources Information Center

    Krug, Robert E.

    To illustrate the types of factors that must be considered in evaluating public documents, this paper analyzes a number of possible outcomes resulting from one type of document, the patient package insert (PPI) designed to provide consumers of prescription drugs with information about the drugs. It first outlines the intended sequence for a PPI:…

  16. Comparative sequence analysis revealed altered chromosomal organization and a novel insertion sequence encoding DNA modification and potentially stress-related functions in an Escherichia coli O157:H7 foodborne isolate

    USDA-ARS?s Scientific Manuscript database

    We recently described the complete genome of enterohemorrhagic Escherichia coli (EHEC) O157:H7 strain NADC 6564, an isolate of strain 86-24 linked to the 1986 disease outbreak. In the current study, we compared the chromosomal sequence of NADC 6564 to the well-characterized chromosomal sequences of ...

  17. Unlocking Short Read Sequencing for Metagenomics

    DOE PAGES

    Rodrigue, Sébastien; Materna, Arne C.; Timberlake, Sonia C.; ...

    2010-07-28

    We describe an experimental and computational pipeline yielding millions of reads that can exceed 200 bp with quality scores approaching that of traditional Sanger sequencing. The method combines an automatable gel-less library construction step with paired-end sequencing on a short-read instrument. With appropriately sized library inserts, mate-pair sequences can overlap, and we describe the SHERA software package that joins them to form a longer composite read.

  18. Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12.

    PubMed

    Anton, Brian P; Mongodin, Emmanuel F; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R; Roberts, Richard J; Raleigh, Elisabeth A

    2015-01-01

    We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems.

  19. Complete Genome Sequence of ER2796, a DNA Methyltransferase-Deficient Strain of Escherichia coli K-12

    PubMed Central

    Anton, Brian P.; Mongodin, Emmanuel F.; Agrawal, Sonia; Fomenkov, Alexey; Byrd, Devon R.; Roberts, Richard J.; Raleigh, Elisabeth A.

    2015-01-01

    We report the complete sequence of ER2796, a laboratory strain of Escherichia coli K-12 that is completely defective in DNA methylation. Because of its lack of any native methylation, it is extremely useful as a host into which heterologous DNA methyltransferase genes can be cloned and the recognition sequences of their products deduced by Pacific Biosciences Single-Molecule Real Time (SMRT) sequencing. The genome was itself sequenced from a long-insert library using the SMRT platform, resulting in a single closed contig devoid of methylated bases. Comparison with K-12 MG1655, the first E. coli K-12 strain to be sequenced, shows an essentially co-linear relationship with no major rearrangements despite many generations of laboratory manipulation. The comparison revealed a total of 41 insertions and deletions, and 228 single base pair substitutions. In addition, the long-read approach facilitated the surprising discovery of four gene conversion events, three involving rRNA operons and one between two cryptic prophages. Such events thus contribute both to genomic homogenization and to bacteriophage diversification. As one of relatively few laboratory strains of E. coli to be sequenced, the genome also reveals the sequence changes underlying a number of classical mutant alleles including those affecting the various native DNA methylation systems. PMID:26010885

  20. Simultaneous message framing and error detection

    NASA Technical Reports Server (NTRS)

    Frey, A. H., Jr.

    1968-01-01

    Circuitry simultaneously inserts message framing information and detects noise errors in binary code data transmissions. Separate message groups are framed without requiring both framing bits and error-checking bits, and predetermined message sequence are separated from other message sequences without being hampered by intervening noise.

  1. Laboratory racks are installed in the MPLM Leonardo

    NASA Technical Reports Server (NTRS)

    2000-01-01

    In the Space Station Processing Facility, the Rack Insertion Unit lifts another laboratory rack to the Multi-Purpose Logistics Module Leonardo, in the background. The MPLM is the first of three such pressurized modules that will serve as the International Space Station's '''moving vans,''' carrying laboratory racks filled with equipment, experiments and supplies to and from the International Space Station aboard the Space Shuttle. Leonardo will be launched for the first time March 1, 2001, on Shuttle mission STS-102. On that flight, Leonardo will be filled with equipment and supplies to outfit the U.S. laboratory module, being carried to the ISS on the Jan. 19, 2001, launch of STS-98.

  2. Mobile element biology – new possibilities with high-throughput sequencing

    PubMed Central

    Xing, Jinchuan; Witherspoon, David J.; Jorde, Lynn B.

    2014-01-01

    Mobile elements compose more than half of the human genome, but until recently their large-scale detection was time-consuming and challenging. With the development of new high-throughput sequencing technologies, the complete spectrum of mobile element variation in humans can now be identified and analyzed. Thousands of new mobile element insertions have been discovered, yielding new insights into mobile element biology, evolution, and genomic variation. We review several high-throughput methods, with an emphasis on techniques that specifically target mobile element insertions in humans, and we highlight recent applications of these methods in evolutionary studies and in the analysis of somatic alterations in human cancers. PMID:23312846

  3. Characterization of ROP18 alleles in human toxoplasmosis.

    PubMed

    Sánchez, Víctor; de-la-Torre, Alejandra; Gómez-Marín, Jorge Enrique

    2014-04-01

    The role of the virulent gene ROP18 polymorphisms is not known in human toxoplasmosis. A total of 320 clinical samples were analyzed. In samples positive for ROP18 gene, we determined by an allele specific PCR, if patients got the upstream insertion positive ROP18 sequence Toxoplasma strain (mouse avirulent strain) or the upstream insertion negative ROP18 sequence Toxoplasma strain (mouse virulent strain). We designed an ELISA assay for antibodies against ROP18 derived peptides from the three major clonal lineages of Toxoplasma. 20 clinical samples were of quality for ROP18 allele analysis. In patients with ocular toxoplasmosis, a higher inflammatory reaction on eye was associated to a PCR negative result for the upstream region of ROP18. 23.3%, 33% and 16.6% of serums from individuals with ocular toxoplasmosis were positive for type I, type II and type III ROP18 derived peptides, respectively but this assay was affected by cross reaction. The absence of Toxoplasma ROP18 promoter insertion sequence in ocular toxoplasmosis was correlated with severe ocular inflammatory response. Determination of antibodies against ROP18 protein was not useful for serotyping in human toxoplasmosis. © 2013.

  4. Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    PubMed Central

    2011-01-01

    Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

  5. Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

    PubMed

    Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

    2016-02-01

    The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

  6. Bacterial DNA of Ocean and Land on the Surface of the International Space Station.

    NASA Astrophysics Data System (ADS)

    Grebennikova, Tatiana

    A.V. Syroeshkin2, T.V. Grebennikova1, E.V. Shubralova3, V.A. Shuvalov3, O.S. Tsygankov4, V.B. Lapshin2 1D. I. Ivanovsky Virology Institute, Moscow, Russia 2 Academician E. K. Fedorov Institute of Applied Geophysics, Moscow, Russia 3S.P. Korolev Rocket and Space Corporation «Energia» Korolev, Russia 4Central Research Institute of Machine Building, Korolev, Russia Existence of biological molecules as markers of microorganisms in the space environment has always attracted attention of researchers. There is great attention to the search for extraterrestrial life forms [Nicholson W.L. 2009, Kawaguchi Y. et al 2013], and as well as the coping mechanisms of living organisms in the interplanetary space [Hotchin J. et al 1965, Baranov V.M. 2009, Horneck G. et al 2010]. Experiments on American and Japanese segments of the International Space Station (ISS) over the different nature of resistance during prolonged stay in space were conducted [Scalzi G et al 2012, Wassmann M. et al 2012]. As a result of these experiments confirmed the possibility of preserving the viability of organisms in an open space for a long time. Consequence, became interested in the transfer of living matter from the stratosphere to near-Earth space [Smith D.J. 2013]. We hypothesized that viable forms, or at least, intact DNA can be transferred to the orbit of the ISS with the ascending branch of the global electric circuit. Samples of cosmic dust collected from the surface of the window of the ISS during the exit of an astronaut in space. Samples (washes with material of tampons and tampons) which were in vacuo, were analyzed for the presence of bacterial DNA by nested PCR using primers specific DNA genus Mycobacterium, the DNA of the strain of the genus Bacillus anthracis and DNA encoding the bacterial 16S ribosomal RNA after transportation of the samples to Earth. The results of amplification, followed by sequencing and phylogenetic analysis showed the presence in samples of cosmic dust DNA representatives bacteria of the genus Mycobacteria and extreme bacteria of the genus Delftia family Comamonadaceae order Burkholderiales. It is shown that the DNA sequence of one of the bacteria of the genus Mycobacteria genetically similar to that previously DNA sequence of bacteria observed in sea surface microlayer Barents Sea coast. The presence of representatives of the DNA of wild terrestrial and marine genera of bacteria on the surface of the ISS indicates their possible transfer from the stratosphere into the ionosphere with the ascending branch of the global electric circuit.

  7. Molecular Population Genetics of the Alcohol Dehydrogenase Gene Region of DROSOPHILA MELANOGASTER

    PubMed Central

    Aquadro, Charles F.; Desse, Susan F.; Bland, Molly M.; Langley, Charles H.; Laurie-Ahlberg, Cathy C.

    1986-01-01

    Variation in the DNA restriction map of a 13-kb region of chromosome II including the alcohol dehydrogenase structural gene (Adh) was examined in Drosophila melanogaster from natural populations. Detailed analysis of 48 D. melanogaster lines representing four eastern United States populations revealed extensive DNA sequence variation due to base substitutions, insertions and deletions. Cloning of this region from several lines allowed characterization of length variation as due to unique sequence insertions or deletions [nine sizes; 21–200 base pairs (bp)] or transposable element insertions (several sizes, 340 bp to 10.2 kb, representing four different elements). Despite this extensive variation in sequences flanking the Adh gene, only one length polymorphism is clearly associated with altered Adh expression (a copia element approximately 250 bp 5' to the distal transcript start site). Nonetheless, the frequency spectra of transposable elements within and between Drosophila species suggests they are slightly deleterious. Strong nonrandom associations are observed among Adh region sequence variants, ADH allozyme (Fast vs. Slow), ADH enzyme activity and the chromosome inversion ln(2L) t. Phylogenetic analysis of restriction map haplotypes suggest that the major twofold component of ADH activity variation (high vs. low, typical of Fast and Slow allozymes, respectively) is due to sequence variation tightly linked to and possibly distinct from that underlying the allozyme difference. The patterns of nucleotide and haplotype variation for Fast and Slow allozyme lines are consistent with the recent increase in frequency and spread of the Fast haplotype associated with high ADH activity. These data emphasize the important role of evolutionary history and strong nonrandom associations among tightly linked sequence variation as determinants of the patterns of variation observed in natural populations. PMID:3026893

  8. A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, O.; Masters, C.; Lewis, M.B.

    1994-09-01

    In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

  9. Sequencing to Station in 12 Months (Targeting Orbital 5 Launch, March 30th)

    NASA Technical Reports Server (NTRS)

    Smith, David J.; Burton, Aaron Steven

    2015-01-01

    The Biomolecule Sequencer is a Commercial Off-The-Shelf device developed by Oxford Nanopore Technologies and implements a method of DNA sequencing unlike any other current sequencers. The device measures changes in electrical current through a nanopore depending on the sequence of the DNA strand that is passing through it. Since the technology is built on nanometer-scale ion pores, the hardware itself is exceptionally small (3 x 1 x 58 inches), lightweight (less than 120 grams with USB cable), and powered only by a USB connection. The sequencing device is permanent, while the flow cells, to which the samples are added, are periodically replaced. The goal of our upcoming technology demonstration on ISS is to provide evidence that DNA sequencing in space is possible, which holds the exciting potential to enable the identification of microorganisms, monitor changes in microbes and humans in response to spaceflight, and possibly aid in the detection of DNA-based life elsewhere in the universe.

  10. Impact of the excision of an ancient repeat insertion on Rickettsia conorii guanylate kinase activity.

    PubMed

    Abergel, Chantal; Blanc, Guillaume; Monchois, Vincent; Renesto, Patricia; Sigoillot, Cécile; Ogata, Hiroyuki; Raoult, Didier; Claverie, Jean-Michel

    2006-11-01

    The genomic sequencing of Rickettsia conorii revealed a new family of Rickettsia-specific palindromic elements (RPEs) capable of in-frame insertion in preexisting open reading frames (ORFs). Many of these altered ORFs correspond to proteins with well-characterized or essential functions in other microorganisms. Previous experiments indicated that RPE-containing genes are normally transcribed and that no excision of the repeat occurs at the mRNA level. Using mass spectrometry, we now confirmed the retention of the RPE-derived amino acid residues in 4 proteins successfully expressed in Escherichia coli, raising the general question of the consequences of this common insertion event on the fitness of Rickettsia enzymes. The predicted guanylate kinase activity of the R. conorii gmk gene product was measured both on the RPE-containing and RPE-excised recombinant proteins. We show that the 2 proteins are active but exhibit substantial differences in their affinity for adenosine triphosphate, guanosine monophosphate, and catalytic constants. The distribution of the RPEgmk insert among Rickettsia species indicates that the insertion event is ancient and occurred after the divergence of Rickettsia felis and R. conorii but before that of Rickettsia helvetica and R. conorii. We found no evidence that the gmk gene fixed adaptive changes to compensate the RPE peptide insertion. Furthermore, the analysis of the rates of divergence in 23 RPE-containing genes indicates that coding RPE repeats tend to evolve under weak selective constraint, at a rate similar to intergenic noncoding RPE sequences. Altogether, these results suggest that the insertion of RPE-encoded "selfish peptides," although respecting the original fold and activity of the host proteins, might be slightly detrimental to the enzyme efficiency within limits tolerable for slow-growing intracellular parasites such as Rickettsia.

  11. Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB

    PubMed Central

    Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

    2012-01-01

    The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB. PMID:23250441

  12. Transmembrane insertion of twin-arginine signal peptides is driven by TatC and regulated by TatB.

    PubMed

    Fröbel, Julia; Rose, Patrick; Lausberg, Frank; Blümmel, Anne-Sophie; Freudl, Roland; Müller, Matthias

    2012-01-01

    The twin-arginine translocation (Tat) pathway of bacteria and plant chloroplasts mediates the transmembrane transport of folded proteins, which harbour signal sequences with a conserved twin-arginine motif. Many Tat translocases comprise the three membrane proteins TatA, TatB and TatC. TatC was previously shown to be involved in recognizing twin-arginine signal peptides. Here we show that beyond recognition, TatC mediates the transmembrane insertion of a twin-arginine signal sequence, thereby translocating the signal sequence cleavage site across the bilayer. In the absence of TatB, this can lead to the removal of the signal sequence even from a translocation-incompetent substrate. Hence interaction of twin-arginine signal peptides with TatB counteracts their premature cleavage uncoupled from translocation. This capacity of TatB is not shared by the homologous TatA protein. Collectively our results suggest that TatC is an insertase for twin-arginine signal peptides and that translocation-proficient signal sequence recognition requires the concerted action of TatC and TatB.

  13. Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

    PubMed

    He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

    2017-11-01

    Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

  14. A Forward Genetic Screening for Prostate Cancer Progression Genes

    DTIC Science & Technology

    2012-10-01

    sequence  reads. For verifying  the  prevalence of insertions in tumors, PCR was  performed on  genomic  DNA corresponding to 15 insertional mutations using...and has been utilized with great effect in many organisms, from the bacterium to the fruit fly Drosophila melanogaster [1,2]. The Sleeping Beauty (SB...TX SL JC TN. References 1. Cooley L, Kelley R, Spradling A (1988) Insertional mutagenesis of the Drosophila genome with single P elements. Science

  15. Mapping sequence performed during the STS-114 R-Bar Pitch Maneuver.

    NASA Image and Video Library

    2005-07-28

    ISS011-E-11048 (28 July 2005) --- The crew cabin of the Space Shuttle Discovery was photographed by the crewmembers of the International Space Station as the two spacecraft approached each other for docking on July 28, 2005. The Expedition 12 crewmembers onboard the orbital outpost took a battery of survey photographs of the Shuttle thermal protection system.

  16. Improved Protocols for Illumina Sequencing

    PubMed Central

    Bronner, Iraad F.; Quail, Michael A.; Turner, Daniel J.; Swerdlow, Harold

    2013-01-01

    In this unit, we describe a set of improvements we have made to the standard Illumina protocols to make the sequencing process more reliable in a high-throughput environment, reduce amplification bias, narrow the distribution of insert sizes, and reliably obtain high yields of data. PMID:19582764

  17. Sequencing cDNAs: An Introduction to DNA Sequence Analysis in the Undergraduate Molecular Genetics Course.

    ERIC Educational Resources Information Center

    Galewsky, Samuel

    2000-01-01

    Introduces a series of molecular genetics laboratories where students pick a single colony from a Drosophila melanogester embryo cDNA library and purify the plasmid, then analyze the insert through restriction digests and gel electrophoresis. (Author/YDS)

  18. Optimized scheduling technique of null subcarriers for peak power control in 3GPP LTE downlink.

    PubMed

    Cho, Soobum; Park, Sang Kyu

    2014-01-01

    Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system.

  19. Optimized Scheduling Technique of Null Subcarriers for Peak Power Control in 3GPP LTE Downlink

    PubMed Central

    Park, Sang Kyu

    2014-01-01

    Orthogonal frequency division multiple access (OFDMA) is a key multiple access technique for the long term evolution (LTE) downlink. However, high peak-to-average power ratio (PAPR) can cause the degradation of power efficiency. The well-known PAPR reduction technique, dummy sequence insertion (DSI), can be a realistic solution because of its structural simplicity. However, the large usage of subcarriers for the dummy sequences may decrease the transmitted data rate in the DSI scheme. In this paper, a novel DSI scheme is applied to the LTE system. Firstly, we obtain the null subcarriers in single-input single-output (SISO) and multiple-input multiple-output (MIMO) systems, respectively; then, optimized dummy sequences are inserted into the obtained null subcarrier. Simulation results show that Walsh-Hadamard transform (WHT) sequence is the best for the dummy sequence and the ratio of 16 to 20 for the WHT and randomly generated sequences has the maximum PAPR reduction performance. The number of near optimal iteration is derived to prevent exhausted iterations. It is also shown that there is no bit error rate (BER) degradation with the proposed technique in LTE downlink system. PMID:24883376

  20. Assessment of sequence dependent geometric distortion in contrast-enhanced MR images employed in stereotactic radiosurgery treatment planning.

    PubMed

    Pappas, Eleftherios P; Seimenis, Ioannis; Dellios, Dimitrios; Kollias, Georgios; Lampropoulos, Kostas I; Karaiskos, Pantelis

    2018-06-25

    This work focuses on MR-related sequence dependent geometric distortions, which are associated with B 0 inhomogeneity and patient-induced distortion (susceptibility differences and chemical shift effects), in MR images used in stereotactic radiosurgery (SRS) applications. Emphasis is put on characterizing distortion at target brain areas identified by gadolinium diethylenetriamine pentaacetic acid (Gd-DTPA) paramagnetic contrast agent uptake. A custom-made phantom for distortion detection was modified to accommodate two small cylindrical inserts, simulating small brain targets. The inserts were filled with Gd-DTPA solutions of various concentrations (0-20 mM). The phantom was scanned at 1.5 T unit using both the reversed read gradient polarity (to determine the overall distortion as reflected by the inserts centroid offset) and the field mapping (to determine B 0 inhomogeneity related distortion in the vicinity of the inserts) techniques. Post-Gd patient images involving a total of 10 brain metastases/targets were also studied using a similar methodology. For the specific imaging conditions, contrast agent presence was found to evidently affect phantom insert position, with centroid offset extending up to 0.068 mm mM -1 (0.208 ppm mM -1 ). The Gd-DTPA induced distortion in patient images was of the order of 0.5 mm for the MRI protocol used, in agreement with the phantom results. Total localization uncertainty of metastases-targets in patient images ranged from 0.35 mm to 0.87 mm, depending on target location, with an average value of 0.54 mm (2.24 ppm). This relative wide range of target localization uncertainty results from the fact that the B 0 inhomogeneity distortion vector in a specific location may add to or partly counterbalance Gd-DTPA induced distortion, thus increasing or decreasing, respectively, the total sequence dependent distortion. Although relatively small, the sequence dependent distortion in Gd-DTPA enhanced brain images can be easily taken into account for SRS treatment planning and target definition purposes by carefully inspecting both the forward and reversed polarity series.

  1. Comparison of large-insert, small-insert and pyrosequencing libraries for metagenomic analysis.

    PubMed

    Danhorn, Thomas; Young, Curtis R; DeLong, Edward F

    2012-11-01

    The development of DNA sequencing methods for characterizing microbial communities has evolved rapidly over the past decades. To evaluate more traditional, as well as newer methodologies for DNA library preparation and sequencing, we compared fosmid, short-insert shotgun and 454 pyrosequencing libraries prepared from the same metagenomic DNA samples. GC content was elevated in all fosmid libraries, compared with shotgun and 454 libraries. Taxonomic composition of the different libraries suggested that this was caused by a relative underrepresentation of dominant taxonomic groups with low GC content, notably Prochlorales and the SAR11 cluster, in fosmid libraries. While these abundant taxa had a large impact on library representation, we also observed a positive correlation between taxon GC content and fosmid library representation in other low-GC taxa, suggesting a general trend. Analysis of gene category representation in different libraries indicated that the functional composition of a library was largely a reflection of its taxonomic composition, and no additional systematic biases against particular functional categories were detected at the level of sequencing depth in our samples. Another important but less predictable factor influencing the apparent taxonomic and functional library composition was the read length afforded by the different sequencing technologies. Our comparisons and analyses provide a detailed perspective on the influence of library type on the recovery of microbial taxa in metagenomic libraries and underscore the different uses and utilities of more traditional, as well as contemporary 'next-generation' DNA library construction and sequencing technologies for exploring the genomics of the natural microbial world.

  2. Molecular analysis of a chromosome-carried erm(B) gene and its flanking insertion points in Lactobacillus johnsonii G41.

    PubMed

    Flórez, Ana Belén; Ammor, Mohammed Salim; Delgado, Susana; Mayo, Baltasar

    2006-12-01

    An erm(B) gene carried on the Lactobacillus johnsonii G41 chromosome and the upstream and downstream regions were fully sequenced. Apparently, a 1,495-bp segment of pRE25 from Enterococcus faecalis carrying the erm(B) gene became inserted, by an unknown mechanism, into the L. johnsonii chromosome.

  3. Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

    PubMed

    Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

    2014-04-09

    West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

  4. Generation of West Nile Virus Infectious Clones Containing Amino Acid Insertions Between Capsid and Capsid Anchor

    PubMed Central

    Vandergaast, Rianna; Hoover, Lisa I.; Zheng, Kang; Fredericksen, Brenda L.

    2014-01-01

    West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3’ untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints. PMID:24721788

  5. Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448

    PubMed Central

    Li, Bin; Pacey, Marissa P.

    2017-01-01

    We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308

  6. Evaluation of second-generation sequencing of 19 dilated cardiomyopathy genes for clinical applications.

    PubMed

    Gowrisankar, Sivakumar; Lerner-Ellis, Jordan P; Cox, Stephanie; White, Emily T; Manion, Megan; LeVan, Kevin; Liu, Jonathan; Farwell, Lisa M; Iartchouk, Oleg; Rehm, Heidi L; Funke, Birgit H

    2010-11-01

    Medical sequencing for diseases with locus and allelic heterogeneities has been limited by the high cost and low throughput of traditional sequencing technologies. "Second-generation" sequencing (SGS) technologies allow the parallel processing of a large number of genes and, therefore, offer great promise for medical sequencing; however, their use in clinical laboratories is still in its infancy. Our laboratory offers clinical resequencing for dilated cardiomyopathy (DCM) using an array-based platform that interrogates 19 of more than 30 genes known to cause DCM. We explored both the feasibility and cost effectiveness of using PCR amplification followed by SGS technology for sequencing these 19 genes in a set of five samples enriched for known sequence alterations (109 unique substitutions and 27 insertions and deletions). While the analytical sensitivity for substitutions was comparable to that of the DCM array (98%), SGS technology performed better than the DCM array for insertions and deletions (90.6% versus 58%). Overall, SGS performed substantially better than did the current array-based testing platform; however, the operational cost and projected turnaround time do not meet our current standards. Therefore, efficient capture methods and/or sample pooling strategies that shorten the turnaround time and decrease reagent and labor costs are needed before implementing this platform into routine clinical applications.

  7. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS1[OPEN

    PubMed Central

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 (HSP70-1) inserts in Nicotiana benthamiana and maize (Zea mays). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70, silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. PMID:29127260

  8. A single gene mutation that increases maize seed weight

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giroux, M.J.; Shaw, J.; Hannah, L.C.

    1996-06-11

    The maize endosperm-specific gene shrunken2 (Sh2) encodes the large subunit of the heterotetrameric starch synthetic enzyme adenosine diphosphoglucose pyrophosphorylase (AGP; EC 2.7.7.27). Here we exploit an in vivo, site-specific mutagenesis system to create short insertion mutations in a region of the gene known to be involved in the allosteric regulation of AGP. The site-specific mutagen is the transposable element dissociation (Ds). Approximately one-third (8 of 23) of the germinal revertants sequenced restored the wild-type sequence, whereas the remaining revertants contained insertions of 3 or 6 bp. All revertants retained the original reading frame 3 feet to the insertion site andmore » involved the addition of tyrosine and/or serine. Each insertion revertant reduced total AGP activity and the amount of the SH2 protein. The revertant containing additional tyrosine and serine residues increased seed weight 11-18% without increasing or decreasing the percentage of starch. Other insertion revertants lacking an additional serine reduced seed weight. Reduced sensitivity to phosphate, a long-known inhibitor of AGP, was found in the high seed-weight revertant. This alteration is likely universally important since insertion of tyrosine and serine in the potato large subunit of AGP at the comparable position and expression in Escherichia coli also led to a phosphate-insensitive enzyme. These results show that single gene mutations giving rise to increased seed weight, and therefore perhaps yield, are clearly possible in a plant with a long history of intensive and successful breeding efforts. 20 refs., 5 figs., 5 tabs.« less

  9. Cercosporin-deficient mutants by plasmid tagging in the asexual fungus Cercospora nicotianae.

    PubMed

    Chung, K-R; Ehrenshaft, M; Wetzel, D K; Daub, M E

    2003-11-01

    We have successfully adapted plasmid insertion and restriction enzyme-mediated integration (REMI) to produce cercosporin toxin-deficient mutants in the asexual phytopathogenic fungus Cercospora nicotianae. The use of pre-linearized plasmid or restriction enzymes in the transformation procedure significantly decreased the transformation frequency, but promoted a complicated and undefined mode of plasmid integration that leads to mutations in the C. nicotianae genome. Vector DNA generally integrated in multiple copies, and no increase in single-copy insertion was observed when enzymes were added to the transformation mixture. Out of 1873 transformants tested, 39 putative cercosporin toxin biosynthesis ( ctb) mutants were recovered that showed altered levels of cercosporin production. Seven ctb mutants were recovered using pre-linearized plasmids without the addition of enzymes, and these were considered to be non-REMI mutants. The correlation between a specific insertion and a mutant phenotype was confirmed using rescued plasmids as gene disruption vectors in the wild-type strain. Six out of fifteen rescued plasmids tested yielded cercosporin-deficient transformants when re-introduced into the wild-type strain, suggesting a link between the insertion site and the cercosporin-deficient phenotype. Sequence analysis of a fragment flanking the insert site recovered from one insertion mutant showed it to be disrupted in sequences with high homology to the acyl transferase domain of polyketide synthases from other fungi. Disruption of this polyketide synthase gene ( CTB1) using a rescued plasmid resulted in mutants that were defective in cercosporin production. Thus, we provide the first molecular evidence that cercosporin is synthesized via a polyketide pathway as previously hypothesized.

  10. Microbial Diversity Aboard Spacecraft: Evaluation of the International Space Station

    NASA Technical Reports Server (NTRS)

    Castro, Victoria A.; Thrasher, Adrianna N.; Healy, Mimi; Ott, C. Mark; Pierson, Duane L.

    2003-01-01

    An evaluation of the microbial flora from air, water, and surface samples provided a baseline of microbial diversity onboard the International Space Station (ISS) to gain insight into bacterial and fungal contamination during the initial stages of construction and habitation. Using 16S genetic sequencing and rep-PeR, 63 bacterial strains were isolated for identification and fingerprinted for microbial tracking. The use of these molecular tools allowed for the identification of bacteria not previously identified using automated biochemical analysis and provided a clear indication of the source of several ISS contaminants. Fungal and bacterial data acquired during monitoring do not suggest there is a current microbial hazard to the spacecraft, nor does any trend indicate a potential health risk. Previous spacecraft environmental analysis indicated that microbial contamination will increase with time and require continued surveillance.

  11. Mapping Ribonucleotides Incorporated into DNA by Hydrolytic End-Sequencing.

    PubMed

    Orebaugh, Clinton D; Lujan, Scott A; Burkholder, Adam B; Clausen, Anders R; Kunkel, Thomas A

    2018-01-01

    Ribonucleotides embedded within DNA render the DNA sensitive to the formation of single-stranded breaks under alkali conditions. Here, we describe a next-generation sequencing method called hydrolytic end sequencing (HydEn-seq) to map ribonucleotides inserted into the genome of Saccharomyce cerevisiae strains deficient in ribonucleotide excision repair. We use this method to map several genomic features in wild-type and replicase variant yeast strains.

  12. Sexual satisfaction and quality of life in major depressive disorder before and after treatment with citalopram in the STAR*D study.

    PubMed

    Ishak, Waguih William; Christensen, Scott; Sayer, Gregory; Ha, Khanh; Li, Ning; Miller, Jamie; Nguyen, Jaidyn Mai; Cohen, Robert M

    2013-03-01

    Major depressive disorder (MDD) patients often experience impaired sexual satisfaction (ISS) and poor quality of life (QOL). Selective serotonin reuptake inhibitors (SSRIs), the first-line treatment for MDD, can cause sexual dysfunction, potentially worsening ISS and QOL. This study examined the impact of MDD and the SSRI citalopram on sexual satisfaction and QOL in level 1 of the Sequenced Treatment Alternatives to Relieve Depression (STAR*D) trial (July 2001-September 2006). A retrospective analysis was conducted of the change in sexual satisfaction, as measured by item 9 of the Quality of Life Enjoyment and Satisfaction Questionnaire, the primary outcome measure, in 2,280 patients with DSM-IV-TR-defined MDD who were treated with citalopram for 12 weeks. The Quick Inventory of Depressive Symptomatology-Self Report was used to evaluate the impact of depression ratings on impaired sexual satisfaction and on QOL. Impaired sexual satisfaction was present in 64.3% of MDD patients at pretreatment, but that percentage declined to 47.1% at posttreatment with citalopram (P < .0001). Those who achieved remission had less ISS and better QOL. The prevalence of ISS in remitters was 21.2% versus 61.3% in nonremitters (P < 10(-8)). The mean ± standard deviation score for remitters increased from 2.32 ± 1.16 to 3.44 ± 1.23 (P < 10(-8); Cohen d = 0.81 [large effect size]), whereas in nonremitters it increased only from 1.99 ± 1.08 to 2.19 ± 1.19 (P < 10(-8); Cohen d = 0.16). The difference between remitters and nonremitters was highly significant (P < 10(-8)). Regression analyses at pretreatment and posttreatment demonstrated significant associations between depressive symptoms and ISS (P < .0001) and between ISS and lower QOL (P < .0001) as well as an association between citalopram and increased probability of ISS and a poorer QOL in patients who continue to have moderate-to-severe depression. A majority of MDD patients have impaired sexual satisfaction, a symptom associated with poor QOL. Despite the sexual side effects of the SSR citalopram, treating depression to full remission was associated with improvements in sexual satisfaction and QOL. ClinicalTrials.gov identifier: NCT00021528. © Copyright 2013 Physicians Postgraduate Press, Inc.

  13. Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

    PubMed

    Lam, Kathy N; Charles, Trevor C

    2015-01-01

    Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

  14. pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

    PubMed

    Gu, Jingsong; Ye, Chunjiang

    2011-03-01

    A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

  15. Endogenous Retrovirus EAV-HP Linked to Blue Egg Phenotype in Mapuche Fowl

    PubMed Central

    Alcalde, José A.; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

    2013-01-01

    Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation. PMID:23990950

  16. Endogenous retrovirus EAV-HP linked to blue egg phenotype in Mapuche fowl.

    PubMed

    Wragg, David; Mwacharo, Joram M; Alcalde, José A; Wang, Chen; Han, Jian-Lin; Gongora, Jaime; Gourichon, David; Tixier-Boichard, Michèle; Hanotte, Olivier

    2013-01-01

    Oocyan or blue/green eggshell colour is an autosomal dominant trait found in native chickens (Mapuche fowl) of Chile and in some of their descendants in European and North American modern breeds. We report here the identification of an endogenous avian retroviral (EAV-HP) insertion in oocyan Mapuche fowl and European breeds. Sequencing data reveals 100% retroviral identity between the Mapuche and European insertions. Quantitative real-time PCR analysis of European oocyan chicken indicates over-expression of the SLCO1B3 gene (P<0.05) in the shell gland and oviduct. Predicted transcription factor binding sites in the long terminal repeats (LTR) indicate AhR/Ar, a modulator of oestrogen, as a possible promoter/enhancer leading to reproductive tissue-specific over-expression of the SLCO1B3 gene. Analysis of all jungle fowl species Gallus sp. supports the retroviral insertion to be a post-domestication event, while identical LTR sequences within domestic chickens are in agreement with a recent de novo mutation.

  17. Human MLH1 suppresses the insertion of telomeric sequences at intra-chromosomal sites in telomerase-expressing cells

    PubMed Central

    Jia, Pingping; Chastain, Megan; Zou, Ying; Her, Chengtao

    2017-01-01

    Abstract Aberrant formation of interstitial telomeric sequences (ITSs) promotes genome instabilities. However, it is unclear how aberrant ITS formation is suppressed in human cells. Here, we report that MLH1, a key protein involved in mismatch repair (MMR), suppresses telomeric sequence insertion (TSI) at intra-chromosomal regions. The frequency of TSI can be elevated by double-strand break (DSB) inducer and abolished by ATM/ATR inhibition. Suppression of TSI requires MLH1 recruitment to DSBs, indicating that MLH1's role in DSB response/repair is important for suppressing TSI. Moreover, TSI requires telomerase activity but is independent of the functional status of p53 and Rb. Lastly, we show that TSI is associated with chromosome instabilities including chromosome loss, micronuclei formation and chromosome breakage that are further elevated by replication stress. Our studies uncover a novel link between MLH1, telomerase, telomere and genome stability. PMID:28180301

  18. Genetic variability in Melipona quinquefasciata (Hymenoptera, Apidae, Meliponini) from northeastern Brazil determined using the first internal transcribed spacer (ITS1).

    PubMed

    Pereira, J O P; Freitas, B M; Jorge, D M M; Torres, D C; Soares, C E A; Grangeiro, T B

    2009-01-01

    Melipona quinquefasciata is a ground-nesting South American stingless bee whose geographic distribution was believed to comprise only the central and southern states of Brazil. We obtained partial sequences (about 500-570 bp) of first internal transcribed spacer (ITS1) nuclear ribosomal DNA from Melipona specimens putatively identified as M. quinquefasciata collected from different localities in northeastern Brazil. To confirm the taxonomic identity of the northeastern samples, specimens from the state of Goiás (Central region of Brazil) were included for comparison. All sequences were deposited in GenBank (accession numbers EU073751-EU073759). The mean nucleotide divergence (excluding sites with insertions/deletions) in the ITS1 sequences was only 1.4%, ranging from 0 to 4.1%. When the sites with insertions/deletions were also taken into account, sequence divergences varied from 0 to 5.3%. In all pairwise comparisons, the ITS1 sequence from the specimens collected in Goiás was most divergent compared to the ITS1 sequences of the bees from the other locations. However, neighbor-joining phylogenetic analysis showed that all ITS1 sequences from northeastern specimens along with the sample of Goiás were resolved in a single clade with a bootstrap support of 100%. The ITS1 sequencing data thus support the occurrence of M. quinquefasciata in northeast Brazil.

  19. Predicting Free Recalls

    ERIC Educational Resources Information Center

    Laming, Donald

    2006-01-01

    This article reports some calculations on free-recall data from B. Murdock and J. Metcalfe (1978), with vocal rehearsal during the presentation of a list. Given the sequence of vocalizations, with the stimuli inserted in their proper places, it is possible to predict the subsequent sequence of recalls--the predictions taking the form of a…

  20. Mapping sequence performed during the STS-116 R-Bar Pitch Maneuver.

    NASA Image and Video Library

    2006-12-11

    ISS014-E-09232 (11 Dec. 2006) --- This view of the nose and part of the crew cabin of Space Shuttle Discovery was provided by an Expedition 14 crewmember during a back-flip performed by the approaching STS-116 crew to the International Space Station. The Ku-band antenna, very instrumental in communications operations, is visible on the port side of the orbiter.

  1. Post-Flight Microbial Analysis of Samples from the International Space Station Water Recovery System and Oxygen Generation System

    NASA Technical Reports Server (NTRS)

    Birmele, Michele N.

    2011-01-01

    The Regenerative, Environmental Control and Life Support System (ECLSS) on the International Space Station (ISS) includes the the Water Recovery System (WRS) and the Oxygen Generation System (OGS). The WRS consists of a Urine Processor Assembly (UPA) and Water Processor Assembly (WPA). This report describes microbial characterization of wastewater and surface samples collected from the WRS and OGS subsystems, returned to KSC, JSC, and MSFC on consecutive shuttle flights (STS-129 and STS-130) in 2009-10. STS-129 returned two filters that contained fluid samples from the WPA Waste Tank Orbital Recovery Unit (ORU), one from the waste tank and the other from the ISS humidity condensate. Direct count by microscopic enumeration revealed 8.38 x 104 cells per mL in the humidity condensate sample, but none of those cells were recoverable on solid agar media. In contrast, 3.32 x lOs cells per mL were measured from a surface swab of the WRS waste tank, including viable bacteria and fungi recovered after S12 days of incubation on solid agar media. Based on rDNA sequencing and phenotypic characterization, a fungus recovered from the filter was determined to be Lecythophora mutabilis. The bacterial isolate was identified by rDNA sequence data to be Methylobacterium radiotolerans. Additional UPA subsystem samples were returned on STS-130 for analysis. Both liquid and solid samples were collected from the Russian urine container (EDV), Distillation Assembly (DA) and Recycle Filter Tank Assembly (RFTA) for post-flight analysis. The bacterium Pseudomonas aeruginosa and fungus Chaetomium brasiliense were isolated from the EDV samples. No viable bacteria or fungi were recovered from RFTA brine samples (N= 6), but multiple samples (N = 11) from the DA and RFTA were found to contain fungal and bacterial cells. Many recovered cells have been identified to genus by rDNA sequencing and carbon source utilization profiling (BiOLOG Gen III). The presence of viable bacteria and fungi from WRS and OGS subsystems demonstrates the need for continued monitoring of ECLSS during future ISS operations and investigation of advanced antimicrobial controls.

  2. Tandem Fusion of Hepatitis B Core Antigen Allows Assembly of Virus-Like Particles in Bacteria and Plants with Enhanced Capacity to Accommodate Foreign Proteins

    PubMed Central

    Peyret, Hadrien; Gehin, Annick; Thuenemann, Eva C.; Blond, Donatienne; El Turabi, Aadil; Beales, Lucy; Clarke, Dean; Gilbert, Robert J. C.; Fry, Elizabeth E.; Stuart, David I.; Holmes, Kris; Stonehouse, Nicola J.; Whelan, Mike; Rosenberg, William; Lomonossoff, George P.; Rowlands, David J.

    2015-01-01

    The core protein of the hepatitis B virus, HBcAg, assembles into highly immunogenic virus-like particles (HBc VLPs) when expressed in a variety of heterologous systems. Specifically, the major insertion region (MIR) on the HBcAg protein allows the insertion of foreign sequences, which are then exposed on the tips of surface spike structures on the outside of the assembled particle. Here, we present a novel strategy which aids the display of whole proteins on the surface of HBc particles. This strategy, named tandem core, is based on the production of the HBcAg dimer as a single polypeptide chain by tandem fusion of two HBcAg open reading frames. This allows the insertion of large heterologous sequences in only one of the two MIRs in each spike, without compromising VLP formation. We present the use of tandem core technology in both plant and bacterial expression systems. The results show that tandem core particles can be produced with unmodified MIRs, or with one MIR in each tandem dimer modified to contain the entire sequence of GFP or of a camelid nanobody. Both inserted proteins are correctly folded and the nanobody fused to the surface of the tandem core particle (which we name tandibody) retains the ability to bind to its cognate antigen. This technology paves the way for the display of natively folded proteins on the surface of HBc particles either through direct fusion or through non-covalent attachment via a nanobody. PMID:25830365

  3. Sequence Analysis and Characterization of Active Human Alu Subfamilies Based on the 1000 Genomes Pilot Project.

    PubMed

    Konkel, Miriam K; Walker, Jerilyn A; Hotard, Ashley B; Ranck, Megan C; Fontenot, Catherine C; Storer, Jessica; Stewart, Chip; Marth, Gabor T; Batzer, Mark A

    2015-08-29

    The goal of the 1000 Genomes Consortium is to characterize human genome structural variation (SV), including forms of copy number variations such as deletions, duplications, and insertions. Mobile element insertions, particularly Alu elements, are major contributors to genomic SV among humans. During the pilot phase of the project we experimentally validated 645 (611 intergenic and 34 exon targeted) polymorphic "young" Alu insertion events, absent from the human reference genome. Here, we report high resolution sequencing of 343 (322 unique) recent Alu insertion events, along with their respective target site duplications, precise genomic breakpoint coordinates, subfamily assignment, percent divergence, and estimated A-rich tail lengths. All the sequenced Alu loci were derived from the AluY lineage with no evidence of retrotransposition activity involving older Alu families (e.g., AluJ and AluS). AluYa5 is currently the most active Alu subfamily in the human lineage, followed by AluYb8, and many others including three newly identified subfamilies we have termed AluYb7a3, AluYb8b1, and AluYa4a1. This report provides the structural details of 322 unique Alu variants from individual human genomes collectively adding about 100 kb of genomic variation. Many Alu subfamilies are currently active in human populations, including a surprising level of AluY retrotransposition. Human Alu subfamilies exhibit continuous evolution with potential drivers sprouting new Alu lineages. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. Short interspersed elements (SINEs) are a major source of canine genomic diversity.

    PubMed

    Wang, Wei; Kirkness, Ewen F

    2005-12-01

    SINEs are retrotransposons that have enjoyed remarkable reproductive success during the course of mammalian evolution, and have played a major role in shaping mammalian genomes. Previously, an analysis of survey-sequence data from an individual dog (a poodle) indicated that canine genomes harbor a high frequency of alleles that differ only by the absence or presence of a SINEC_Cf repeat. Comparison of this survey-sequence data with a draft genome sequence of a distinct dog (a boxer) has confirmed this prediction, and revealed the chromosomal coordinates for >10,000 loci that are bimorphic for SINEC_Cf insertions. Analysis of SINE insertion sites from the genomes of nine additional dogs indicates that 3%-5% are absent from either the poodle or boxer genome sequences--suggesting that an additional 10,000 bimorphic loci could be readily identified in the general dog population. We describe a methodology that can be used to identify these loci, and could be adapted to exploit these bimorphic loci for genotyping purposes. Approximately half of all annotated canine genes contain SINEC_Cf repeats, and these elements are occasionally transcribed. When transcribed in the antisense orientation, they provide splice acceptor sites that can result in incorporation of novel exons. The high frequency of bimorphic SINE insertions in the dog population is predicted to provide numerous examples of allele-specific transcription patterns that will be valuable for the study of differential gene expression among multiple dog breeds.

  5. Widespread and evolutionary analysis of a MITE family Monkey King in Brassicaceae.

    PubMed

    Dai, Shutao; Hou, Jinna; Long, Yan; Wang, Jing; Li, Cong; Xiao, Qinqin; Jiang, Xiaoxue; Zou, Xiaoxiao; Zou, Jun; Meng, Jinling

    2015-06-19

    Miniature inverted repeat transposable elements (MITEs) are important components of eukaryotic genomes, with hundreds of families and many copies, which may play important roles in gene regulation and genome evolution. However, few studies have investigated the molecular mechanisms involved. In our previous study, a Tourist-like MITE, Monkey King, was identified from the promoter region of a flowering time gene, BnFLC.A10, in Brassica napus. Based on this MITE, the characteristics and potential roles on gene regulation of the MITE family were analyzed in Brassicaceae. The characteristics of the Tourist-like MITE family Monkey King in Brassicaceae, including its distribution, copies and insertion sites in the genomes of major Brassicaceae species were analyzed in this study. Monkey King was actively amplified in Brassica after divergence from Arabidopsis, which was indicated by the prompt increase in copy number and by phylogenetic analysis. The genomic variations caused by Monkey King insertions, both intra- and inter-species in Brassica, were traced by PCR amplification. Genomic sequence analysis showed that most complete Monkey King elements are located in gene-rich regions, less than 3kb from genes, in both the B. rapa and A. thaliana genomes. Sixty-seven Brassica expressed sequence tags carrying Monkey King fragments were also identified from the NCBI database. Bisulfite sequencing identified specific DNA methylation of cytosine residues in the Monkey King sequence. A fragment containing putative TATA-box motifs in the MITE sequence could bind with nuclear protein(s) extracted from leaves of B. napus plants. A Monkey King-related microRNA, bna-miR6031, was identified in the microRNA database. In transgenic A. thaliana, when the Monkey King element was inserted upstream of 35S promoter, the promoter activity was weakened. Monkey King, a Brassicaceae Tourist-like MITE family, has amplified relatively recently and has induced intra- and inter-species genomic variations in Brassica. Monkey King elements are most abundant in the vicinity of genes and may have a substantial effect on genome-wide gene regulation in Brassicaceae. Monkey King insertions potentially regulate gene expression and genome evolution through epigenetic modification and new regulatory motif production.

  6. Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

    PubMed

    Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

    2017-12-01

    A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

  7. Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

    PubMed Central

    Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

    2006-01-01

    Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

  8. A surprisingly large RNase P RNA in Candida glabrata

    PubMed Central

    KACHOURI, RYM; STRIBINSKIS, VILIUS; ZHU, YANGLONG; RAMOS, KENNETH S.; WESTHOF, ERIC; LI, YONG

    2005-01-01

    We have found an extremely large ribonuclease P (RNase P) RNA (RPR1) in the human pathogen Candida glabrata and verified that this molecule is expressed and present in the active enzyme complex of this hemiascomycete yeast. A structural alignment of the C. glabrata sequence with 36 other hemiascomycete RNase P RNAs (abbreviated as P RNAs) allows us to characterize the types of insertions. In addition, 15 P RNA sequences were newly characterized by searching in the recently sequenced genomes Candida albicans, C. glabrata, Debaryomyces hansenii, Eremothecium gossypii, Kluyveromyces lactis, Kluyveromyces waltii, Naumovia castellii, Saccharomyces kudriavzevii, Saccharomyces mikatae, and Yarrowia lipolytica; and by PCR amplification for other Candida species (Candida guilliermondii, Candida krusei, Candida parapsilosis, Candida stellatoidea, and Candida tropicalis). The phylogenetic comparative analysis identifies a hemiascomycete secondary structure consensus that presents a conserved core in all species with variable insertions or deletions. The most significant variability is found in C. glabrata P RNA in which three insertions exceeding in total 700 nt are present in the Specificity domain. This P RNA is more than twice the length of any other homologous P RNAs known in the three domains of life and is eight times the size of the smallest. RNase P RNA, therefore, represents one of the most diversified noncoding RNAs in terms of size variation and structural diversity. PMID:15987816

  9. On-orbit operations and offline data processing of CALET onboard the ISS

    NASA Astrophysics Data System (ADS)

    Asaoka, Y.; Ozawa, S.; Torii, S.; Adriani, O.; Akaike, Y.; Asano, K.; Bagliesi, M. G.; Bigongiari, G.; Binns, W. R.; Bonechi, S.; Bongi, M.; Brogi, P.; Buckley, J. H.; Cannady, N.; Castellini, G.; Checchia, C.; Cherry, M. L.; Collazuol, G.; Di Felice, V.; Ebisawa, K.; Fuke, H.; Guzik, T. G.; Hams, T.; Hareyama, M.; Hasebe, N.; Hibino, K.; Ichimura, M.; Ioka, K.; Ishizaki, W.; Israel, M. H.; Javaid, A.; Kasahara, K.; Kataoka, J.; Kataoka, R.; Katayose, Y.; Kato, C.; Kawanaka, N.; Kawakubo, Y.; Krawczynski, H. S.; Krizmanic, J. F.; Kuramata, S.; Lomtadze, T.; Maestro, P.; Marrocchesi, P. S.; Messineo, A. M.; Mitchell, J. W.; Miyake, S.; Mizutani, K.; Moiseev, A. A.; Mori, K.; Mori, M.; Mori, N.; Motz, H. M.; Munakata, K.; Murakami, H.; Nakahira, S.; Nishimura, J.; de Nolfo, G. A.; Okuno, S.; Ormes, J. F.; Pacini, L.; Palma, F.; Papini, P.; Penacchioni, A. V.; Rauch, B. F.; Ricciarini, S. B.; Sakai, K.; Sakamoto, T.; Sasaki, M.; Shimizu, Y.; Shiomi, A.; Sparvoli, R.; Spillantini, P.; Stolzi, F.; Takahashi, I.; Takayanagi, M.; Takita, M.; Tamura, T.; Tateyama, N.; Terasawa, T.; Tomida, H.; Tsunesada, Y.; Uchihori, Y.; Ueno, S.; Vannuccini, E.; Wefel, J. P.; Yamaoka, K.; Yanagita, S.; Yoshida, A.; Yoshida, K.; Yuda, T.

    2018-07-01

    The CALorimetric Electron Telescope (CALET), launched for installation on the International Space Station (ISS) in August, 2015, has been accumulating scientific data since October, 2015. CALET is intended to perform long-duration observations of high-energy cosmic rays onboard the ISS. CALET directly measures the cosmic-ray electron spectrum in the energy range of 1 GeV to 20 TeV with a 2% energy resolution above 30 GeV. In addition, the instrument can measure the spectrum of gamma rays well into the TeV range, and the spectra of protons and nuclei up to a PeV. In order to operate the CALET onboard ISS, JAXA Ground Support Equipment (JAXA-GSE) and the Waseda CALET Operations Center (WCOC) have been established at JAXA and Waseda University, respectively. Scientific operations using CALET are planned at WCOC, taking into account orbital variations of geomagnetic rigidity cutoff. Scheduled command sequences are used to control the CALET observation modes on orbit. Calibration data acquisition by, for example, recording pedestal and penetrating particle events, a low-energy electron trigger mode operating at high geomagnetic latitude, a low-energy gamma-ray trigger mode operating at low geomagnetic latitude, and an ultra heavy trigger mode, are scheduled around the ISS orbit while maintaining maximum exposure to high-energy electrons and other high-energy shower events by always having the high-energy trigger mode active. The WCOC also prepares and distributes CALET flight data to collaborators in Italy and the United States. As of August 31, 2017, the total observation time is 689 days with a live time fraction of the total time of ∼ 84%. Nearly 450 million events are collected with a high-energy (E > 10 GeV) trigger. In addition, calibration data acquisition and low-energy trigger modes, as well as an ultra-heavy trigger mode, are consistently scheduled around the ISS orbit. By combining all operation modes with the excellent-quality on-orbit data collected thus far, it is expected that a five-year observation period will provide a wealth of new and interesting results.

  10. A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Langlois, S.; Kastelein, J.J.; Hayden, M.R.

    1989-02-01

    Lipoprotein lipase is an important enzyme involved in triacylglycerol metabolism. Primary LPL deficiency is a genetic disorder that is usually manifested by a severe elevation in triacylglycerol levels. The authors have used a recently isolated LPL cDNA clone to study 15 probands from 11 families with this inherited disorder. Surprisingly, 7 of the probands from 4 families, of different ancestries, had a similar insertion in their LPL gene. In contrast to other human genetic disorders, where insertions are rare causes of mutation, this insertion accounts for a significant proportion of the alleles causing LPL deficiency. Detailed restriction mapping of themore » insertion revealed that it was unlikely to be a duplication of neighboring DNA and that it was not similar to the consensus sequence of human L1 repetitive elements. This suggests that there must be other mechanisms of insertional mutagenesis in human genetic disease besides transposition of mobile L1 repetitive elements.« less

  11. Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

    PubMed

    van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

    2012-07-01

    Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

  12. Engineering RNA phage MS2 virus-like particles for peptide display

    NASA Astrophysics Data System (ADS)

    Jordan, Sheldon Keith

    Phage display is a powerful and versatile technology that enables the selection of novel binding functions from large populations of randomly generated peptide sequences. Random sequences are genetically fused to a viral structural protein to produce complex peptide libraries. From a sufficiently complex library, phage bearing peptides with practically any desired binding activity can be physically isolated by affinity selection, and, since each particle carries in its genome the genetic information for its own replication, the selectants can be amplified by infection of bacteria. For certain applications however, existing phage display platforms have limitations. One such area is in the field of vaccine development, where the goal is to identify relevant epitopes by affinity-selection against an antibody target, and then to utilize them as immunogens to elicit a desired antibody response. Today, affinity selection is usually conducted using display on filamentous phages like M13. This technology provides an efficient means for epitope identification, but, because filamentous phages do not display peptides in the high-density, multivalent arrays the immune system prefers to recognize, they generally make poor immunogens and are typically useless as vaccines. This makes it necessary to confer immunogenicity by conjugating synthetic versions of the peptides to more immunogenic carriers. Unfortunately, when introduced into these new structural environments, the epitopes often fail to elicit relevant antibody responses. Thus, it would be advantageous to combine the epitope selection and immunogen functions into a single platform where the structural constraints present during affinity selection can be preserved during immunization. This dissertation describes efforts to develop a peptide display system based on the virus-like particles (VLPs) of bacteriophage MS2. Phage display technologies rely on (1) the identification of a site in a viral structural protein that is present on the surface of the virus particle and can accept foreign sequence insertions without disruption of protein folding and viral particle assembly, and (2) on the encapsidation of nucleic acid sequences encoding both the VLP and the peptide it displays. The experiments described here are aimed at satisfying the first of these two requirements by engineering efficient peptide display at two different sites in MS2 coat protein. First, we evaluated the suitability of the N-terminus of MS2 coat for peptide insertions. It was observed that random N-terminal 10-mer fusions generally disrupted protein folding and VLP assembly, but by bracketing the foreign sequences with certain specific dipeptides, these defects could be suppressed. Next, the suitability of a coat protein surface loop for foreign sequence insertion was tested. Specifically, random sequence peptides were inserted into the N-terminal-most AB-loop of a coat protein single-chain dimer. Again we found that efficient display required the presence of appropriate dipeptides bracketing the peptide insertion. Finally, it was shown that an N-terminal fusion that tended to interfere specifically with capsid assembly could be efficiently incorporated into mosaic particles when co-expressed with wild-type coat protein.

  13. A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

    PubMed Central

    Macé, Matthias; Crouau-Roy, Brigitte

    2008-01-01

    Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia). There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants). This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes) which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science. PMID:18925953

  14. Traceless splicing enabled by substrate-induced activation of the Nostoc punctiforme Npu DnaE intein after mutation of a catalytic cysteine to serine.

    PubMed

    Cheriyan, Manoj; Chan, Siu-Hong; Perler, Francine

    2014-12-12

    Inteins self-catalytically cleave out of precursor proteins while ligating the surrounding extein fragments with a native peptide bond. Much attention has been lavished on these molecular marvels with the hope of understanding and harnessing their chemistry for novel biochemical transformations including coupling peptides from synthetic or biological origins and controlling protein function. Despite an abundance of powerful applications, the use of inteins is still hampered by limitations in our understanding of their specificity (defined as flanking sequences that permit splicing) and the challenge of inserting inteins into target proteins. We examined the frequently used Nostoc punctiforme Npu DnaE intein after the C-extein cysteine nucleophile (Cys+1) was mutated to serine or threonine. Previous studies demonstrated reduced rates and/or splicing yields with the Npu DnaE intein after mutation of Cys+1 to Ser+1. In this study, genetic selection identified extein sequences with Ser+1 that enabled the Npu DnaE intein to splice with only a 5-fold reduction in rate compared to the wild-type Cys+1 intein and without mutation of the intein itself to activate Ser+1 as a nucleophile. Three different proteins spliced efficiently after insertion of the intein flanked by the selected sequences. We then used this selected specificity to achieve traceless splicing in a targeted enzyme at a location predicted by primary sequence similarity to only the selected C-extein sequence. This study highlights the latent catalytic potential of the Npu DnaE intein to splice with an alternative nucleophile and enables broader intein utility by increasing insertion site choices. Copyright © 2014. Published by Elsevier Ltd.

  15. The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

    PubMed Central

    Burke, W D; Calalang, C C; Eickbush, T H

    1987-01-01

    Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

  16. Contamination of sequence databases with adaptor sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

    Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

  17. LoRTE: Detecting transposon-induced genomic variants using low coverage PacBio long read sequences.

    PubMed

    Disdero, Eric; Filée, Jonathan

    2017-01-01

    Population genomic analysis of transposable elements has greatly benefited from recent advances of sequencing technologies. However, the short size of the reads and the propensity of transposable elements to nest in highly repeated regions of genomes limits the efficiency of bioinformatic tools when Illumina or 454 technologies are used. Fortunately, long read sequencing technologies generating read length that may span the entire length of full transposons are now available. However, existing TE population genomic softwares were not designed to handle long reads and the development of new dedicated tools is needed. LoRTE is the first tool able to use PacBio long read sequences to identify transposon deletions and insertions between a reference genome and genomes of different strains or populations. Tested against simulated and genuine Drosophila melanogaster PacBio datasets, LoRTE appears to be a reliable and broadly applicable tool to study the dynamic and evolutionary impact of transposable elements using low coverage, long read sequences. LoRTE is an efficient and accurate tool to identify structural genomic variants caused by TE insertion or deletion. LoRTE is available for download at http://www.egce.cnrs-gif.fr/?p=6422.

  18. Flanking sequence determination and event-specific detection of genetically modified wheat B73-6-1.

    PubMed

    Xu, Junyi; Cao, Jijuan; Cao, Dongmei; Zhao, Tongtong; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

    2013-05-01

    In order to establish a specific identification method for genetically modified (GM) wheat, exogenous insert DNA and flanking sequence between exogenous fragment and recombinant chromosome of GM wheat B73-6-1 were successfully acquired by means of conventional polymerase chain reaction (PCR) and thermal asymmetric interlaced (TAIL)-PCR strategies. Newly acquired exogenous fragment covered the full-length sequence of transformed genes such as transformed plasmid and corresponding functional genes including marker uidA, herbicide-resistant bar, ubiquitin promoter, and high-molecular-weight gluten subunit. The flanking sequence between insert DNA revealed high similarity with Triticum turgidum A gene (GenBank: AY494981.1). A specific PCR detection method for GM wheat B73-6-1 was established on the basis of primers designed according to the flanking sequence. This specific PCR method was validated by GM wheat, GM corn, GM soybean, GM rice, and non-GM wheat. The specifically amplified target band was observed only in GM wheat B73-6-1. This method is of high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of GM wheat B73-6-1.

  19. Sequence of rat alpha- and gamma-casein mRNAs: evolutionary comparison of the calcium-dependent rat casein multigene family.

    PubMed Central

    Hobbs, A A; Rosen, J M

    1982-01-01

    The complete sequences of rat alpha- and gamma-casein mRNAs have been determined. The 1402-nucleotide alpha- and 864-nucleotide gamma-casein mRNAs both encode 15 amino acid signal peptides and mature proteins of 269 and 164 residues, respectively. Considerable homology between the 5' non-coding regions, and the regions encoding the signal peptides and the phosphorylation sites, in these mRNAs as compared to several other rodent casein mRNAs, was observed. Significant homology was also detected between rat alpha- and bovine alpha s1-casein. Comparison of the rodent and bovine sequences suggests that the caseins evolved at about the time of the appearance of the primitive mammals. This may have occurred by intragenic duplication of a nucleotide sequence encoding a primitive phosphorylation site, -(Ser)n-Glu-Glu-, and intergenic duplication resulting in the small casein multigene family. A unique feature of the rat alpha-casein sequence is an insertion in the coding region containing 10 repeated elements of 18 nucleotides each. This insertion appears to have occurred 7-12 million years ago, just prior to the divergence of rat and mouse. Images PMID:6298707

  20. Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120.

    PubMed

    deCamp, Allan C; Rolland, Morgane; Edlefsen, Paul T; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A; Fiore-Gartland, Andrew J; Juraska, Michal; Carpp, Lindsay N; Karuna, Shelly T; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z; Gottardo, Raphael; Koup, Richard A; Bailer, Robert; Mascola, John R; Graham, Barney S; Roederer, Mario; O'Connell, Robert J; Michael, Nelson L; Robb, Merlin L; Adams, Elizabeth; D'Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E; Frahm, Nicole; Tomaras, Georgia D; McElrath, M Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E; Hammer, Scott M; Kim, Jerome H; Mullins, James I; Gilbert, Peter B

    2017-01-01

    Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector.

  1. Sieve analysis of breakthrough HIV-1 sequences in HVTN 505 identifies vaccine pressure targeting the CD4 binding site of Env-gp120

    PubMed Central

    Edlefsen, Paul T.; Sanders-Buell, Eric; Hall, Breana; Magaret, Craig A.; Fiore-Gartland, Andrew J.; Juraska, Michal; Carpp, Lindsay N.; Karuna, Shelly T.; Bose, Meera; LePore, Steven; Miller, Shana; O'Sullivan, Annemarie; Poltavee, Kultida; Bai, Hongjun; Dommaraju, Kalpana; Zhao, Hong; Wong, Kim; Chen, Lennie; Ahmed, Hasan; Goodman, Derrick; Tay, Matthew Z.; Gottardo, Raphael; Koup, Richard A.; Bailer, Robert; Mascola, John R.; Graham, Barney S.; Roederer, Mario; O’Connell, Robert J.; Michael, Nelson L.; Robb, Merlin L.; Adams, Elizabeth; D’Souza, Patricia; Kublin, James; Corey, Lawrence; Geraghty, Daniel E.; Frahm, Nicole; Tomaras, Georgia D.; McElrath, M. Juliana; Frenkel, Lisa; Styrchak, Sheila; Tovanabutra, Sodsai; Sobieszczyk, Magdalena E.; Hammer, Scott M.; Kim, Jerome H.; Mullins, James I.; Gilbert, Peter B.

    2017-01-01

    Although the HVTN 505 DNA/recombinant adenovirus type 5 vector HIV-1 vaccine trial showed no overall efficacy, analysis of breakthrough HIV-1 sequences in participants can help determine whether vaccine-induced immune responses impacted viruses that caused infection. We analyzed 480 HIV-1 genomes sampled from 27 vaccine and 20 placebo recipients and found that intra-host HIV-1 diversity was significantly lower in vaccine recipients (P ≤ 0.04, Q-values ≤ 0.09) in Gag, Pol, Vif and envelope glycoprotein gp120 (Env-gp120). Furthermore, Env-gp120 sequences from vaccine recipients were significantly more distant from the subtype B vaccine insert than sequences from placebo recipients (P = 0.01, Q-value = 0.12). These vaccine effects were associated with signatures mapping to CD4 binding site and CD4-induced monoclonal antibody footprints. These results suggest either (i) no vaccine efficacy to block acquisition of any viral genotype but vaccine-accelerated Env evolution post-acquisition; or (ii) vaccine efficacy against HIV-1s with Env sequences closest to the vaccine insert combined with increased acquisition due to other factors, potentially including the vaccine vector. PMID:29149197

  2. Genome Sequence of Lactobacillus delbrueckii subsp. lactis CNRZ327, a Dairy Bacterium with Anti-Inflammatory Properties.

    PubMed

    El Kafsi, Hela; Binesse, Johan; Loux, Valentin; Buratti, Julien; Boudebbouze, Samira; Dervyn, Rozenn; Hammani, Amal; Maguin, Emmanuelle; van de Guchte, Maarten

    2014-07-17

    Lactobacillus delbrueckii subsp. lactis CNRZ327 is a dairy bacterium with anti-inflammatory properties both in vitro and in vivo. Here, we report the genome sequence of this bacterium, which appears to contain no less than 215 insertion sequence (IS) elements, an exceptionally high number regarding the small genome size of the strain. Copyright © 2014 El Kafsi et al.

  3. Designing robust watermark barcodes for multiplex long-read sequencing.

    PubMed

    Ezpeleta, Joaquín; Krsticevic, Flavia J; Bulacio, Pilar; Tapia, Elizabeth

    2017-03-15

    To attain acceptable sample misassignment rates, current approaches to multiplex single-molecule real-time sequencing require upstream quality improvement, which is obtained from multiple passes over the sequenced insert and significantly reduces the effective read length. In order to fully exploit the raw read length on multiplex applications, robust barcodes capable of dealing with the full single-pass error rates are needed. We present a method for designing sequencing barcodes that can withstand a large number of insertion, deletion and substitution errors and are suitable for use in multiplex single-molecule real-time sequencing. The manuscript focuses on the design of barcodes for full-length single-pass reads, impaired by challenging error rates in the order of 11%. The proposed barcodes can multiplex hundreds or thousands of samples while achieving sample misassignment probabilities as low as 10-7 under the above conditions, and are designed to be compatible with chemical constraints imposed by the sequencing process. Software tools for constructing watermark barcode sets and demultiplexing barcoded reads, together with example sets of barcodes and synthetic barcoded reads, are freely available at www.cifasis-conicet.gov.ar/ezpeleta/NS-watermark . ezpeleta@cifasis-conicet.gov.ar. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  4. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle.

    PubMed

    He, Y L; Wu, Y H; Quan, F S; Liu, Y G; Zhang, Y

    2013-09-04

    To better understand the function of the myostatin gene and its promoter region in bovine, we amplified and sequenced the myostatin gene and promoter from the blood of Qinchuan and Red Angus cattle by using polymerase chain reaction. The sequences of Qinchuan and Red Angus cattle were compared with those of other cattle breeds available in GenBank. Exon splice sites were confirmed by mRNA sequencing. Compared to the published sequence (GenBank accession No. AF320998), 69 single nucleotide polymorphisms (SNPs) were identified in the Qinchuan myostatin gene, only one of which was an insertion mutation in Qinchuan cattle. There was a 16-bp insertion in the first 705-bp intron in 3 Qinchuan cattle. A total of 7 SNPs were identified in exon 3, in which the mutation occurred in the third base of the codon and was synonymous. On comparing the Qinchuan myostatin gene sequence to that of Red Angus cattle, a total of 50 SNPs were identified in the first and third exons. In addition, there were 18 SNPs identified in the Qinchuan cattle promoter region compared with those of other cattle compared to the Red Angus cattle myostatin promoter region. breeds (GenBank accession No. AF348479), but only 14 SNPs when compared to the Red Angus cattle myostatin promoter region.

  5. De novo insertion of an intron into the mammalian sex determining gene, SRY

    PubMed Central

    O’Neill, Rachel J. Waugh; Brennan, Francine E.; Delbridge, Margaret L.; Crozier, Ross H.; Graves, Jennifer A. Marshall

    1998-01-01

    Two theories have been proposed to explain the evolution of introns within eukaryotic genes. The introns early theory, or “exon theory of genes,” proposes that introns are ancient and that recombination within introns provided new exon structure, and thus new genes. The introns late theory, or “insertional theory of introns,” proposes that ancient genes existed as uninterrupted exons and that introns have been introduced during the course of evolution. There is still controversy as to how intron–exon structure evolved and whether the majority of introns are ancient or novel. Although there is extensive evidence in support of the introns early theory, phylogenetic comparisons of several genes indicate recent gain and loss of introns within these genes. However, no example has been shown of a protein coding gene, intronless in its ancestral form, which has acquired an intron in a derived form. The mammalian sex determining gene, SRY, is intronless in all mammals studied to date, as is the gene from which it recently evolved. However, we report here comparisons of genomic and cDNA sequences that now provide evidence of a de novo insertion of an intron into the SRY gene of dasyurid marsupials. This recently (approximately 45 million years ago) inserted sequence is not homologous with known transposable elements. Our data demonstrate that introns may be inserted as spliced units within a developmentally crucial gene without disrupting its function. PMID:9465071

  6. Genome-Wide Transposon Mutagenesis in Pathogenic Leptospira Species▿ ‡

    PubMed Central

    Murray, Gerald L.; Morel, Viviane; Cerqueira, Gustavo M.; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I.; Dellagostin, Odir A.; Bulach, Dieter M.; Sermswan, Rasana W.; Adler, Ben; Picardeau, Mathieu

    2009-01-01

    Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans. PMID:19047402

  7. Genome-wide transposon mutagenesis in pathogenic Leptospira species.

    PubMed

    Murray, Gerald L; Morel, Viviane; Cerqueira, Gustavo M; Croda, Julio; Srikram, Amporn; Henry, Rebekah; Ko, Albert I; Dellagostin, Odir A; Bulach, Dieter M; Sermswan, Rasana W; Adler, Ben; Picardeau, Mathieu

    2009-02-01

    Leptospira interrogans is the most common cause of leptospirosis in humans and animals. Genetic analysis of L. interrogans has been severely hindered by a lack of tools for genetic manipulation. Recently we developed the mariner-based transposon Himar1 to generate the first defined mutants in L. interrogans. In this study, a total of 929 independent transposon mutants were obtained and the location of insertion determined. Of these mutants, 721 were located in the protein coding regions of 551 different genes. While sequence analysis of transposon insertion sites indicated that transposition occurred in an essentially random fashion in the genome, 25 unique transposon mutants were found to exhibit insertions into genes encoding 16S or 23S rRNAs, suggesting these genes are insertional hot spots in the L. interrogans genome. In contrast, loci containing notionally essential genes involved in lipopolysaccharide and heme biosynthesis showed few transposon insertions. The effect of gene disruption on the virulence of a selected set of defined mutants was investigated using the hamster model of leptospirosis. Two attenuated mutants with disruptions in hypothetical genes were identified, thus validating the use of transposon mutagenesis for the identification of novel virulence factors in L. interrogans. This library provides a valuable resource for the study of gene function in L. interrogans. Combined with the genome sequences of L. interrogans, this provides an opportunity to investigate genes that contribute to pathogenesis and will provide a better understanding of the biology of L. interrogans.

  8. An Improved Brome mosaic virus Silencing Vector: Greater Insert Stability and More Extensive VIGS.

    PubMed

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  9. Protective Socket For Integrated Circuits

    NASA Technical Reports Server (NTRS)

    Wilkinson, Chris; Henegar, Greg

    1988-01-01

    Socket for intergrated circuits (IC's) protects from excessive voltages and currents or from application of voltages and currents in wrong sequence during insertion or removal. Contains built-in switch that opens as IC removed, disconnecting leads from signals and power. Also protects other components on circuit board from transients produced by insertion and removal of IC. Makes unnecessary to turn off power to entire circuit board so other circuits on board continue to function.

  10. Going, going, gone: predicting the fate of genomic insertions in plant RNA viruses.

    PubMed

    Willemsen, Anouk; Carrasco, José L; Elena, Santiago F; Zwart, Mark P

    2018-05-10

    Horizontal gene transfer is common among viruses, while they also have highly compact genomes and tend to lose artificial genomic insertions rapidly. Understanding the stability of genomic insertions in viral genomes is therefore relevant for explaining and predicting their evolutionary patterns. Here, we revisit a large body of experimental research on a plant RNA virus, tobacco etch potyvirus (TEV), to identify the patterns underlying the stability of a range of homologous and heterologous insertions in the viral genome. We obtained a wide range of estimates for the recombination rate-the rate at which deletions removing the insertion occur-and these appeared to be independent of the type of insertion and its location. Of the factors we considered, recombination rate was the best predictor of insertion stability, although we could not identify the specific sequence characteristics that would help predict insertion instability. We also considered experimentally the possibility that functional insertions lead to higher mutational robustness through increased redundancy. However, our observations suggest that both functional and non-functional increases in genome size decreased the mutational robustness. Our results therefore demonstrate the importance of recombination rates for predicting the long-term stability and evolution of viral RNA genomes and suggest that there are unexpected drawbacks to increases in genome size for mutational robustness.

  11. Using SINEs to probe ancient explosive speciation: "hidden" radiation of African cichlids?

    PubMed

    Terai, Yohey; Takahashi, Kazuhiko; Nishida, Mutsumi; Sato, Tetsu; Okada, Norihiro

    2003-06-01

    Cichlid fishes of the east African Great Lakes represent a paradigm of adaptive radiation. We conducted a phylogenetic analysis of cichlids including pan-African and west African species by using insertion patterns of short interspersed elements (SINEs) at orthologous loci. The monophyly of the east African cichlids was consistently supported by seven independent insertions of SINE sequences that are uniquely shared by these species. In addition, data from four other loci indicated that the genera Tilapia (pan-African) and Steatocranus (west African) are the closest relatives to east African cichlids. However, relationships among Tilapia, Steatocranus, and the east African clade were ambiguous because of incongruencies among topologies suggested by insertion patterns of SINEs at six other loci. One plausible explanation for this phenomenon is incomplete lineage sorting of alleles containing or missing a SINE insertion at these loci during ancestral speciation. Such incomplete sorting may have taken place earlier than 14 MYA, followed by random and stochastic fixation of the alleles in subsequent lineages. These observations prompted us to consider the possibility that cichlid speciation occurred at an accelerated rate during this period when the African Great Lakes did not exist. The SINE method could be useful for detecting ancient exclusive speciation events that tend to remain hidden during conventional sequence analyses because of accumulated point mutations.

  12. Alignment efficiency and discomfort of three orthodontic archwire sequences: a randomized clinical trial.

    PubMed

    Ong, Emily; Ho, Christopher; Miles, Peter

    2011-03-01

    To compare the efficiency of orthodontic archwire sequences produced by three manufacturers. Prospective, randomized clinical trial with three parallel groups. Private orthodontic practice in Caloundra, QLD, Australia. One hundred and thirty-two consecutive patients were randomized to one of three archwire sequence groups: (i) 3M Unitek, 0·014 inch Nitinol, 0·017 inch × 0·017 inch heat activated Ni-Ti; (ii) GAC international, 0·014 inch Sentalloy, 0·016 × 0·022 inch Bioforce; and (iii) Ormco corporation, 0·014 inch Damon Copper Ni-Ti, 0·014 × 0·025 inch Damon Copper Ni-Ti. All patients received 0·018 × 0·025 inch slot Victory Series™ brackets. Mandibular impressions were taken before the insertion of each archwire. Patients completed discomfort surveys according to a seven-point Likert Scale at 4 h, 24 h, 3 days and 7 days after the insertion of each archwire. Efficiency was measured by time required to reach the working archwire, mandibular anterior alignment and level of discomfort. No significant differences were found in the reduction of irregularity between the archwire sequences at any time-point (T1: P = 0·12; T2: P = 0·06; T3: P = 0·21) or in the time to reach the working archwire (P = 0·28). No significant differences were found in the overall discomfort scores between the archwire sequences (4 h: P = 0·30; 24 h: P = 0·18; 3 days: P = 0·53; 7 days: P = 0·47). When the time-points were analysed individually, the 3M Unitek archwire sequence induced significantly less discomfort than GAC and Ormco archwires 24 h after the insertion of the third archwire (P = 0·02). This could possibly be attributed to the progression in archwire material and archform. The archwire sequences were similar in alignment efficiency and overall discomfort. Progression in archwire dimension and archform may contribute to discomfort levels. This study provides clinical justification for three common archwire sequences in 0·018 × 0·025 inch slot brackets.

  13. Room-Temperature C-H Functionalization Sequence under Benchtop Conditions for the Undergraduate Chemistry Laboratory

    ERIC Educational Resources Information Center

    Chen, Shuming

    2018-01-01

    An iridium(III)-mediated C-H functionalization sequence involving a concerted cyclometalation-deprotonation/migratory insertion pathway is reported for the undergraduate chemistry laboratory. The air- and water-stable iridacycle intermediates are readily isolated and characterized by NMR spectroscopy. Both steps of the experiment are performed at…

  14. Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

    Treesearch

    S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

    2006-01-01

    We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

  15. Lineage-specific genomics: Frequent birth and death in the human genome: The human genome contains many lineage-specific elements created by both sequence and functional turnover.

    PubMed

    Young, Robert S

    2016-07-01

    Frequent evolutionary birth and death events have created a large quantity of biologically important, lineage-specific DNA within mammalian genomes. The birth and death of DNA sequences is so frequent that the total number of these insertions and deletions in the human population remains unknown, although there are differences between these groups, e.g. transposable elements contribute predominantly to sequence insertion. Functional turnover - where the activity of a locus is specific to one lineage, but the underlying DNA remains conserved - can also drive birth and death. However, this does not appear to be a major driver of divergent transcriptional regulation. Both sequence and functional turnover have contributed to the birth and death of thousands of functional promoters in the human and mouse genomes. These findings reveal the pervasive nature of evolutionary birth and death and suggest that lineage-specific regions may play an important but previously underappreciated role in human biology and disease. © 2016 The Authors BioEssays Published by WILEY Periodicals, Inc.

  16. Identification and Characterization of Domesticated Bacterial Transposases

    PubMed Central

    Gallie, Jenna; Rainey, Paul B.

    2017-01-01

    Abstract Selfish genetic elements, such as insertion sequences and transposons are found in most genomes. Transposons are usually identifiable by their high copy number within genomes. In contrast, REP-associated tyrosine transposases (RAYTs), a recently described class of bacterial transposase, are typically present at just one copy per genome. This suggests that RAYTs no longer copy themselves and thus they no longer function as a typical transposase. Motivated by this possibility we interrogated thousands of fully sequenced bacterial genomes in order to determine patterns of RAYT diversity, their distribution across chromosomes and accessory elements, and rate of duplication. RAYTs encompass exceptional diversity and are divisible into at least five distinct groups. They possess features more similar to housekeeping genes than insertion sequences, are predominantly vertically transmitted and have persisted through evolutionary time to the point where they are now found in 24% of all species for which at least one fully sequenced genome is available. Overall, the genomic distribution of RAYTs suggests that they have been coopted by host genomes to perform a function that benefits the host cell. PMID:28910967

  17. Genetic dissection of quantitative trait locus for ethanol sensitivity in long- and short-sleep mice.

    PubMed

    Bennett, B; Carosone-Link, P; Beeson, M; Gordon, L; Phares-Zook, N; Johnson, T E

    2008-08-01

    Interval-specific congenic strains (ISCS) allow fine mapping of a quantitative trait locus (QTL), narrowing its confidence interval by an order of magnitude or more. In earlier work, we mapped four QTL specifying differential ethanol sensitivity, assessed by loss of righting reflex because of ethanol (LORE), in the inbred long-sleep (ILS) and inbred short-sleep (ISS) strains, accounting for approximately 50% of the genetic variance for this trait. Subsequently, we generated reciprocal congenic strains in which each full QTL interval from ILS was bred onto the ISS background and vice versa. An earlier paper reported construction and results of the ISCS on the ISS background; here, we describe this process and report results on the ILS background. We developed multiple ISCS for each Lore QTL in which the QTL interval was broken into a number of smaller intervals. For each of the four QTL regions (chromosomes 1, 2, 11 and 15), we were successful in reducing the intervals significantly. Multiple, positive strains were overlapped to generate a single, reduced interval. Subsequently, this reduced region was overlaid on previous reductions from the ISS background congenics, resulting in substantial reductions in all QTL regions by approximately 75% from the initial mapping study. Genes with sequence or expression polymorphisms in the reduced intervals are potential candidates; evidence for these is presented. Genetic background effects can be important in detection of single QTL; combining this information with the generation of congenics on both backgrounds, as described here, is a powerful approach for fine mapping QTL.

  18. Earth Observations taken by the Expedition 31 Crew

    NASA Image and Video Library

    2012-06-02

    ISS031-E-83747 (2 June 2012) --- Downlinked from the International Space Station this still image -– part of a series from a mounted, automated, twilight session -- when viewed in sequence shows the flame ring associated with wild fires in the Southwest move from bottom to top-center framed at a distance by the bright urban areas of Tucson, Phoenix, El Paso-Las Cruces, and finally Albuquerque (mostly under cloud).

  19. Earth Observations taken by the Expedition 31 Crew

    NASA Image and Video Library

    2012-06-02

    ISS031-E-83789 (2 June 2012) --- Downlinked from the International Space Station this still image – part of a series from a mounted, automated, twilight session -- when viewed in sequence shows the flame ring associated with wild fires in the Southwest move from bottom to top-center framed at a distance by the bright urban areas of Tucson, Phoenix, El Paso-Las Cruces, and finally Albuquerque (mostly under cloud).

  20. Results from Testing Crew-Controlled Surface Telerobotics on the International Space Station

    NASA Technical Reports Server (NTRS)

    Bualat, Maria; Schreckenghost, Debra; Pacis, Estrellina; Fong, Terrence; Kalar, Donald; Beutter, Brent

    2014-01-01

    During Summer 2013, the Intelligent Robotics Group at NASA Ames Research Center conducted a series of tests to examine how astronauts in the International Space Station (ISS) can remotely operate a planetary rover. The tests simulated portions of a proposed lunar mission, in which an astronaut in lunar orbit would remotely operate a planetary rover to deploy a radio telescope on the lunar far side. Over the course of Expedition 36, three ISS astronauts remotely operated the NASA "K10" planetary rover in an analogue lunar terrain located at the NASA Ames Research Center in California. The astronauts used a "Space Station Computer" (crew laptop), a combination of supervisory control (command sequencing) and manual control (discrete commanding), and Ku-band data communications to command and monitor K10 for 11 hours. In this paper, we present and analyze test results, summarize user feedback, and describe directions for future research.

  1. The potential of 1018 ISS adjuvant in hepatitis B vaccines: HEPLISAV™ review.

    PubMed

    Eng, Nelson F; Bhardwaj, Nitin; Mulligan, Rebecca; Diaz-Mitoma, Francisco

    2013-08-01

    Hepatitis B (HBV) virus infects the liver, and upon chronic infection, can cause liver cirrhosis and hepatocellular carcinoma. Despite universal vaccination programs against the virus, HBV still affects over 2 billion people worldwide, with over 240 million developing a chronic infection. While current alum-adjuvanted vaccines have shown efficacy in promoting seroprotection in healthy adults, 5-10% of immune-competent populations fail to achieve long-lasting seroprotection from these formulations. Furthermore, a large proportion of immunocompromised patients fail to achieve seroprotective antibody titers after receiving these vaccines. A novel vaccine candidate, HEPLISAV™, uses immunostimulatory sequences (ISS), in its formulation that helps induce a robust humoral and cell mediated immunity against HBV. In Phase III clinical trials, HEPLISAV™ has been shown to elicit seroprotective antibody titers with fewer immunizations. Similar safety profiles are demonstrated when compared with current HBV vaccines. For these reasons, HEPLISAV™ is an attractive vaccine to combat this global disease.

  2. 400mm Mapping Sequence performed during the STS-119 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2008-03-17

    ISS018-E-040791 (17 March 2009) --- Backdropped by a blanket of clouds, Space Shuttle Discovery is featured in this image photographed by an Expedition 18 crewmember on the International Space Station during rendezvous and docking operations. Before docking with the station, astronaut Lee Archambault, STS-119 commander, flew the shuttle through a Rendezvous Pitch Maneuver or basically a backflip to allow the space station crew a good view of Discovery's heat shield. Using digital still cameras equipped with both 400 and 800 millimeter lenses, the ISS crewmembers took a number of photos of the shuttle's thermal protection system and sent them down to teams on the ground for analysis. A 400 millimeter lens was used for this image. Docking occurred at 4:20 p.m. (CDT) on March 17, 2009. The final pair of power-generating solar array wings and the S6 truss segment are visible in Discovery?s cargo bay.

  3. 400mm Mapping Sequence performed during the STS-119 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2008-03-17

    ISS018-E-040792 (17 March 2009) --- Backdropped by a blanket of clouds, Space Shuttle Discovery is featured in this image photographed by an Expedition 18 crewmember on the International Space Station during rendezvous and docking operations. Before docking with the station, astronaut Lee Archambault, STS-119 commander, flew the shuttle through a Rendezvous Pitch Maneuver or basically a backflip to allow the space station crew a good view of Discovery's heat shield. Using digital still cameras equipped with both 400 and 800 millimeter lenses, the ISS crewmembers took a number of photos of the shuttle's thermal protection system and sent them down to teams on the ground for analysis. A 400 millimeter lens was used for this image. Docking occurred at 4:20 p.m. (CDT) on March 17, 2009. The final pair of power-generating solar array wings and the S6 truss segment are visible in Discovery?s cargo bay.

  4. 400mm Mapping Sequence performed during the STS-119 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2008-03-17

    ISS018-E-040790 (17 March 2009) --- Backdropped by the blackness of space, Space Shuttle Discovery is featured in this image photographed by an Expedition 18 crewmember on the International Space Station during rendezvous and docking operations. Before docking with the station, astronaut Lee Archambault, STS-119 commander, flew the shuttle through a Rendezvous Pitch Maneuver or basically a backflip to allow the space station crew a good view of Discovery's heat shield. Using digital still cameras equipped with both 400 and 800 millimeter lenses, the ISS crewmembers took a number of photos of the shuttle's thermal protection system and sent them down to teams on the ground for analysis. A 400 millimeter lens was used for this image. Docking occurred at 4:20 p.m. (CDT) on March 17, 2009. The final pair of power-generating solar array wings and the S6 truss segment are visible in Discovery?s cargo bay.

  5. 400mm Mapping Sequence performed during the STS-119 R-Bar Pitch Maneuver

    NASA Image and Video Library

    2008-03-17

    ISS018-E-040789 (17 March 2009) --- Backdropped by the blackness of space, Space Shuttle Discovery is featured in this image photographed by an Expedition 18 crewmember on the International Space Station during rendezvous and docking operations. Before docking with the station, astronaut Lee Archambault, STS-119 commander, flew the shuttle through a Rendezvous Pitch Maneuver or basically a backflip to allow the space station crew a good view of Discovery's heat shield. Using digital still cameras equipped with both 400 and 800 millimeter lenses, the ISS crewmembers took a number of photos of the shuttle's thermal protection system and sent them down to teams on the ground for analysis. A 400 millimeter lens was used for this image. Docking occurred at 4:20 p.m. (CDT) on March 17, 2009. The final pair of power-generating solar array wings and the S6 truss segment are visible in Discovery’s cargo bay.

  6. The GEOFLOW experiment missions in the Fluid Science Laboratory on ISS

    NASA Astrophysics Data System (ADS)

    Picker, Gerold; Carpy, Rodrigo; Fabritius, Gerd; Dettmann, Jan; Minster, Olivier; Winter, Josef; Ranebo, Hans; Dewandre, Thierry; Castiglione, Luigi; Mazzoni, Stefano; Egbers, Christoph; Futterer, Birgit

    The GEOFLOW I experiment has been successfully performed on the International Space Sta-tion (ISS) in 2008 in the Columbus module in order to study the stability, pattern formation and transition to turbulence in a viscous incompressible fluid layer enclosed in two concentric co-rotating spheres subject to a radial temperature gradient and a radial volumetric force field. The objective of the study is the experimental investigation of large scale astrophysical and geophysical phenomena in spherical geometry stipulated by rotation, thermal convections and radial gravity fields. These systems include earth outer core or mantle convection, differen-tial rotation effects in the sun, atmosphere of gas planets as well as a variety of engineering applications. The GEOFLOW I experimental instrument consists of an experiment insert for operation in the Fluid Science Laboratory, which is part of the Columbus Module of the ISS. It was first launched in February 2008 together with Columbus Module on STS 122, operated periodically for 9 month and returned to ground after 14 month on orbit with STS 119. The primary objective was the experimental modelling of outer earth core convection flow. In order to allow for variations of the characteristic scaling for different physical phenomena, the experiment was designed and qualified for a total of nine flights to the ISS, with ground refurbishment and geometrical or fluid modification after each mission. The second mission of GEOFLOW (II) is currently under preparation in terms of hardware refurbishment and modification, as well as science parameter development in order to allow use of a new experimental model fluid with a strongly temperature dependent viscosity, a adaptation of the experimental thermal parameter range in order to provide a representative model for earth mantle convection. The GEOFLOW II instrument is foreseen to be launched with the second mission of the Eu-ropean Automated Transfer Vehicle (ATV). The flight to ISS is planned on ATV 2 "Johannes-Kepler" and foreseen for launch with Ariane 5 in November / December 2010. The objective of the presentation is to give an overview on the Geoflow instrument, its scien-tific performances, the experimental procedures with particular focus on the evolution of the instrument and experiment from its first mission to the second mission. The GEOFLOW project is funded by ESA/ESTEC for the industrial activities and the support of the GEOFLOW science topical team and by German Aerospace Center DLR for the ground based research at BTU Cottbus/Germany. The flight hardware was developed and built by an industrial team led by ASTRIUM Space Transportation Friedrichshafen/Germany.

  7. Investigation of detection conditions of captured microbes in space with PCR Microbes capture experiment on ISS proposed in "Tanpopo" mission

    NASA Astrophysics Data System (ADS)

    Kawaguchi, Yuko; Sugino, Tomohiro; Yang, Yinjie; Yoshimura, Yoshitaka; Tsuji, Takashi; Kobayashi, Kensei; Tabata, Makoto; Hashimoto, Hirofumi; Mita, Hajime; Imai, Eiichi; Kawai, Hideyuki; Okudaira, Kyoko; Hasegawa, Sunao; Yamashita, Masamichi; Yano, Hajime; Yokobori, Shin-Ichi; Yamagishi, Akihiko

    Terrestrial life may fly off into outer space by volcanic eruption meteorological impacts, and so on. Microbes have been collected from high altitude up to 70 km since 1936 [1]. We also isolated microbes at high altitude up to 35 km using an airplane and balloons [2, 3]. The two isolates of these microbes are new species, one of which shows higher UV ray tolerance than Deinococcus radiodurans [2, 3]. On the other hand, there is a hypothesis on the origin of terrestrial life called panspermia [4, 5], in which terrestrial life is thought to have come from space (or astronomical bodies other than Earth). This hypothesis suggests that life may migrate between Earth and other planets. If microbes were to exist at the high altitude of low earth orbit (400 km), it would endorse the possibility of interplanetary migration of terrestrial lifeWe proposed, the Tanpopo mission to examine interplanetary migration of microbes and organic compounds on Japan Experimental Module (JEM) of the International Space Station (ISS). We will capture micro-particles including microbes and micro-meteoroids at the altitude of ISS orbit (400 km) with ultra low-density aerogel exposed to space for a given period of time. After retreaving the aerogel, we will investigate captured micro particles and tracks followed by microbiological, organic chemical and mineralogical analyses.Captured particles will be analyzed after the initial curation of the aerogel and tracks. Particles potentially containing microbes will be used for PCR amplification of small subunit (ss) rRNA gene followed by DNA sequencing. Comparision between the determined sequences and known ss rRNA gene sequences of terrestrial organisms will suggest the origin and properties of the organism.The density of microbes at the ISS altitude might be quite low, and microbe cell number on each captured particle may be quite limited. Therefore, it is necessary to establish the effective PCR procedure for quite small amount of DNA template in the presence of other materials such as clay and aerogel.We will report current status of the PCR identification of microbes from test samples. The PCR conditions to amplify ss rRNA gene from quite small number of cells and quite low concentration of genomic DNA with/without clay and aerogel are examined. References. [1] Y. Yang et al. (2009) Biol. Sci. in Space, 23, 151-163[2] Y. Yang et al. (2009) Int. J. Syst. Evol. Microbiol, 59, 1862-1866[3] Y. Yang et al. (2010) Int. J. Syst. Evol. Microbiol, (in press)[4] S. Arrhenius (1908) Worlds in the Making-the Evolution of the Universe. Harper and Brothers Publishers.[5] F. Crick (1981) Life Itself. Simon Schuster.

  8. Haplotype estimation using sequencing reads.

    PubMed

    Delaneau, Olivier; Howie, Bryan; Cox, Anthony J; Zagury, Jean-François; Marchini, Jonathan

    2013-10-03

    High-throughput sequencing technologies produce short sequence reads that can contain phase information if they span two or more heterozygote genotypes. This information is not routinely used by current methods that infer haplotypes from genotype data. We have extended the SHAPEIT2 method to use phase-informative sequencing reads to improve phasing accuracy. Our model incorporates the read information in a probabilistic model through base quality scores within each read. The method is primarily designed for high-coverage sequence data or data sets that already have genotypes called. One important application is phasing of single samples sequenced at high coverage for use in medical sequencing and studies of rare diseases. Our method can also use existing panels of reference haplotypes. We tested the method by using a mother-father-child trio sequenced at high-coverage by Illumina together with the low-coverage sequence data from the 1000 Genomes Project (1000GP). We found that use of phase-informative reads increases the mean distance between switch errors by 22% from 274.4 kb to 328.6 kb. We also used male chromosome X haplotypes from the 1000GP samples to simulate sequencing reads with varying insert size, read length, and base error rate. When using short 100 bp paired-end reads, we found that using mixtures of insert sizes produced the best results. When using longer reads with high error rates (5-20 kb read with 4%-15% error per base), phasing performance was substantially improved. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Recurrence, submicroscopic complexity, and potential clinical relevance of copy gains detected by array CGH that are shown to be unbalanced insertions by FISH.

    PubMed

    Neill, Nicholas J; Ballif, Blake C; Lamb, Allen N; Parikh, Sumit; Ravnan, J Britt; Schultz, Roger A; Torchia, Beth S; Rosenfeld, Jill A; Shaffer, Lisa G

    2011-04-01

    Insertions occur when a segment of one chromosome is translocated and inserted into a new region of the same chromosome or a non-homologous chromosome. We report 71 cases with unbalanced insertions identified using array CGH and FISH in 4909 cases referred to our laboratory for array CGH and found to have copy-number abnormalities. Although the majority of insertions were non-recurrent, several recurrent unbalanced insertions were detected, including three der(Y)ins(Y;18)(q?11.2;p11.32p11.32)pat inherited from parents carrying an unbalanced insertion. The clinical significance of these recurrent rearrangements is unclear, although the small size, limited gene content, and inheritance pattern of each suggests that the phenotypic consequences may be benign. Cryptic, submicroscopic duplications were observed at or near the insertion sites in two patients, further confounding the clinical interpretation of these insertions. Using FISH, linear amplification, and array CGH, we identified a 126-kb duplicated region from 19p13.3 inserted into MECP2 at Xq28 in a patient with symptoms of Rett syndrome. Our results demonstrate that although the interpretation of most non-recurrent insertions is unclear without high-resolution insertion site characterization, the potential for an otherwise benign duplication to result in a clinically relevant outcome through the disruption of a gene necessitates the use of FISH to determine whether copy-number gains detected by array CGH represent tandem duplications or unbalanced insertions. Further follow-up testing using techniques such as linear amplification or sequencing should be used to determine gene involvement at the insertion site after FISH has identified the presence of an insertion.

  10. P-Element Insertion Alleles of Essential Genes on the Third Chromosome of Drosophila Melanogaster: Correlation of Physical and Cytogenetic Maps in Chromosomal Region 86e-87f

    PubMed Central

    Deak, P.; Omar, M. M.; Saunders, RDC.; Pal, M.; Komonyi, O.; Szidonya, J.; Maroy, P.; Zhang, Y.; Ashburner, M.; Benos, P.; Savakis, C.; Siden-Kiamos, I.; Louis, C.; Bolshakov, V. N.; Kafatos, F. C.; Madueno, E.; Modolell, J.; Glover, D. M.

    1997-01-01

    We have established a collection of 2460 lethal or semi-lethal mutant lines using a procedure thought to insert single P elements into vital genes on the third chromosome of Drosophila melanogaster. More than 1200 randomly selected lines were examined by in situ hybridization and 90% found to contain single insertions at sites that mark 89% of all lettered subdivisions of the Bridges' map. A set of chromosomal deficiencies that collectively uncover ~25% of the euchromatin of chromosome 3 reveal lethal mutations in 468 lines corresponding to 145 complementation groups. We undertook a detailed analysis of the cytogenetic interval 86E-87F and identified 87 P-element-induced mutations falling into 38 complementation groups, 16 of which correspond to previously known genes. Twenty-one of these 38 complementation groups have at least one allele that has a P-element insertion at a position consistent with the cytogenetics of the locus. We have rescued P elements and flanking chromosomal sequences from the 86E-87F region in 35 lines with either lethal or genetically silent P insertions, and used these as probes to identify cosmids and P1 clones from the Drosophila genome projects. This has tied together the physical and genetic maps and has linked 44 previously identified cosmid contigs into seven ``supercontigs'' that span the interval. STS data for sequences flanking one side of the P-element insertions in 49 lines has identified insertions in the αγ element at 87C, two known transposable elements, and the open reading frames of seven putative single copy genes. These correspond to five known genes in this interval, and two genes identified by the homology of their predicted products to known proteins from other organisms. PMID:9409831

  11. Diversity of Shiga Toxin-Producing Escherichia coli (STEC) O26:H11 Strains Examined via stx Subtypes and Insertion Sites of Stx and EspK Bacteriophages

    PubMed Central

    Bonanno, Ludivine; Loukiadis, Estelle; Mariani-Kurkdjian, Patricia; Oswald, Eric; Garnier, Lucille; Michel, Valérie

    2015-01-01

    Shiga toxin-producing Escherichia coli (STEC) is a food-borne pathogen that may be responsible for severe human infections. Only a limited number of serotypes, including O26:H11, are involved in the majority of serious cases and outbreaks. The main virulence factors, Shiga toxins (Stx), are encoded by bacteriophages. Seventy-four STEC O26:H11 strains of various origins (including human, dairy, and cattle) were characterized for their stx subtypes and Stx phage chromosomal insertion sites. The majority of food and cattle strains possessed the stx1a subtype, while human strains carried mainly stx1a or stx2a. The wrbA and yehV genes were the main Stx phage insertion sites in STEC O26:H11, followed distantly by yecE and sbcB. Interestingly, the occurrence of Stx phages inserted in the yecE gene was low in dairy strains. In most of the 29 stx-negative E. coli O26:H11 strains also studied here, these bacterial insertion sites were vacant. Multilocus sequence typing of 20 stx-positive or stx-negative E. coli O26:H11 strains showed that they were distributed into two phylogenetic groups defined by sequence type 21 (ST21) and ST29. Finally, an EspK-carrying phage was found inserted in the ssrA gene in the majority of the STEC O26:H11 strains but in only a minority of the stx-negative E. coli O26:H11 strains. The differences in the stx subtypes and Stx phage insertion sites observed in STEC O26:H11 according to their origin might reflect that strains circulating in cattle and foods are clonally distinct from those isolated from human patients. PMID:25819955

  12. Dynamics and Differential Proliferation of Transposable Elements During the Evolution of the B and A Genomes of Wheat

    PubMed Central

    Charles, Mathieu; Belcram, Harry; Just, Jérémy; Huneau, Cécile; Viollet, Agnès; Couloux, Arnaud; Segurens, Béatrice; Carter, Meredith; Huteau, Virginie; Coriton, Olivier; Appels, Rudi; Samain, Sylvie; Chalhoub, Boulos

    2008-01-01

    Transposable elements (TEs) constitute >80% of the wheat genome but their dynamics and contribution to size variation and evolution of wheat genomes (Triticum and Aegilops species) remain unexplored. In this study, 10 genomic regions have been sequenced from wheat chromosome 3B and used to constitute, along with all publicly available genomic sequences of wheat, 1.98 Mb of sequence (from 13 BAC clones) of the wheat B genome and 3.63 Mb of sequence (from 19 BAC clones) of the wheat A genome. Analysis of TE sequence proportions (as percentages), ratios of complete to truncated copies, and estimation of insertion dates of class I retrotransposons showed that specific types of TEs have undergone waves of differential proliferation in the B and A genomes of wheat. While both genomes show similar rates and relatively ancient proliferation periods for the Athila retrotransposons, the Copia retrotransposons proliferated more recently in the A genome whereas Gypsy retrotransposon proliferation is more recent in the B genome. It was possible to estimate for the first time the proliferation periods of the abundant CACTA class II DNA transposons, relative to that of the three main retrotransposon superfamilies. Proliferation of these TEs started prior to and overlapped with that of the Athila retrotransposons in both genomes. However, they also proliferated during the same periods as Gypsy and Copia retrotransposons in the A genome, but not in the B genome. As estimated from their insertion dates and confirmed by PCR-based tracing analysis, the majority of differential proliferation of TEs in B and A genomes of wheat (87 and 83%, respectively), leading to rapid sequence divergence, occurred prior to the allotetraploidization event that brought them together in Triticum turgidum and Triticum aestivum, <0.5 million years ago. More importantly, the allotetraploidization event appears to have neither enhanced nor repressed retrotranspositions. We discuss the apparent proliferation of TEs as resulting from their insertion, removal, and/or combinations of both evolutionary forces. PMID:18780739

  13. ISS And Space Environment Interactions Without Operating Plasma Contactor

    NASA Technical Reports Server (NTRS)

    Carruth, M. R., Jr.; Ferguson, Dale; Suggs,Rob; McCollum, Matt

    2001-01-01

    The International Space Station (ISS) will be the largest, highest power spacecraft placed in orbit. Because of this the design of the electrical power system diverged markedly from previous systems. The solar arrays will operate at 160 V and the power distribution voltage will be 120 V. The structure is grounded to the negative side of the solar arrays so under the right circumstances it is possible to drive the ISS potential very negative. A plasma contactor has been added to the ISS to provide control of the ISS structure potential relative to the ambient plasma. The ISS requirement is that the ISS structure not be greater than 40 V positive or negative of local plasma. What are the ramifications of operating large structures with such high voltage power systems? The application of a plasma contactor on ISS controls the potential between the structure and the local plasma, preventing degrading effects. It is conceivable that there can be situations where the plasma contactor might be non-functional. This might be due to lack of power, the need to turn it off during some of the build-up sequences, the loss of functionality for both plasma contactors before a replacement can be installed, similar circumstances. A study was undertaken to understand how important it is to have the contactor functioning and how long it might be off before unacceptable degradation to ISS could occur. The details of interaction effects on spacecraft have not been addressed until driven by design. This was true for ISS. If the structure is allowed to float highly negative impinging ions can sputter exposed conductors which can degrade the primary surface and also generate contamination due to the sputtered material. Arcing has been known to occur on solar arrays that float negative of the ambient plasma. This can also generate electromagnetic interference and voltage transients. Much of the ISS structure and pressure module surfaces exposed to space is anodized aluminum. The anodization thickness is very thin to provide the required solar absorptance and emittance. For conditions where ISS structure can charge negative a large percentage of the array voltage, the dielectric strength of this layer is low, and dielectric breakdown (arcing) can occur. The energy stored capacitively in the structure can be delivered to the arc. The mechanisms by which this energy is delivered and how much of the energy is available hasn't been fully quantified. Questions have been raised regarding the possibility of whether a sustained arc might result due to current collected by the solar arrays from local plasma. It was postulated that even if dielectric breakdown didn't occur, impacts due to micrometeoroids and space debris could penetrate thin layers of dielectric on ISS and initiate an arc due to the coupling provided by the dense local plasma produced by the impact. This was proven in experiments conducted jointly by MSFC and Auburn University. A target chamber with a simulated ionospheric plasma and a biased, anodized aluminum plate and a 1-microfarad capacitor was used. The plate was then impacted by 75-micron particles accelerated to orbital velocity. Arc discharges were sustained for higher voltages but a threshold appears below which no discharge was initiated. Most items without an exposed power system will float electrically near the local plasma potential. This is true of the Space Shuttle, an Astronaut on EVA, and similar items. The structure of ISS might be at a large negative voltage. Therefore, capacitively stored energy can be transferred during docking, installing external boxes and equipment and Astronaut contact with ISS structure. The circumstances of when this can happen and the resulting effects are evaluated in this study. Also, a crewmember on EVA might be in the vicinity of an arc. All safety aspects of such an encounter including charging, molten particles from the arc site and EMI have been evaluated. This paper will report on the total results of this study focussed on the 4A configuration, scheduled to be complete in November, 2000. Interactions such as arcing, debris induced arcs, sustained arcs, sputtering, contamination from sputtering and arcing, docking interactions and Astronaut safety issues will all be addressed.

  14. Final technical report for: Insertional Mutagenesis of Brachypodium distachyon DE-AI02-07ER64452

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    John, Vogel P.

    Several bioenergy grasses are poised to become a major source of energy in the United States. Despite their increasing importance, we know little about the basic biology underlying the traits that control the utility of grasses as energy crops. Better knowledge of grass biology (e.g. identification of the genes that control cell wall composition, plant architecture, cell size, cell division, reproduction, nutrient uptake, carbon flux, etc.) could be used to design rational strategies for crop improvement and shorten the time required to domesticate these species. The use of an appropriate model system is an efficient way to gain this knowledge.more » Brachypodium distachyon is a small annual grass with all the attributes needed to be a modern model organism including simple growth requirements, fast generation time, small stature, small genome size and self-fertility. These attributes led to the recommendation in the DOE’s “Breaking the Biological Barriers to Cellulosic Ethanol: A Joint Research Agenda” report to propose developing and using B. distachyon as a model for energy crops to accelerate their domestication. Strategic investments (e.g. genome sequencing) in B. distachyon by the DOE are now bearing fruit and B. distachyon is being used as a model grass by hundreds of laboratories worldwide. Sequence indexed insertional mutants are an extremely powerful tool for both forward and reverse genetics. They allow researchers to order mutants in any gene tagged in the collection by simply emailing a request. The goal of this project was to create a collection of sequence indexed insertional mutants (T-DNA lines) for the model grass Brachypodium distachyon in order to facilitate research by the scientific community. During the course of this grant we created a collection of 23,649 B. distachyon T-DNA lines and identified 26,112 unique insertion sites. The collection can be queried through the project website (http://jgi.doe.gov/our-science/science-programs/plant-genomics/brachypodium/brachypodium-t-dna-collection/) and through the Phytozome genome browser (http://phytozome.jgi.doe.gov/pz/portal.html). The collection has been heavily utilized by the research community and, as of October 23, 2015, 223 orders for 12,069 seeds packets have been filled. In addition to creating this resource, we also optimized methods for transformation and sequencing DNA flanking insertion sites.« less

  15. DNA sequence analysis of ARS elements from chromosome III of Saccharomyces cerevisiae: identification of a new conserved sequence.

    PubMed Central

    Palzkill, T G; Oliver, S G; Newlon, C S

    1986-01-01

    Four fragments of Saccharomyces cerevisiae chromosome III DNA which carry ARS elements have been sequenced. Each fragment contains multiple copies of sequences that have at least 10 out of 11 bases of homology to a previously reported 11 bp core consensus sequence. A survey of these new ARS sequences and previously reported sequences revealed the presence of an additional 11 bp conserved element located on the 3' side of the T-rich strand of the core consensus. Subcloning analysis as well as deletion and transposon insertion mutagenesis of ARS fragments support a role for 3' conserved sequence in promoting ARS activity. PMID:3529036

  16. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2008-06-24

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  17. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S; Cabantous, Stephanie

    2013-02-12

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  18. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2011-06-14

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  19. Circular permutant GFP insertion folding reporters

    DOEpatents

    Waldo, Geoffrey S.; Cabantous, Stephanie

    2013-04-16

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  20. Intracisternal A-Particle Element Transposition into the Murine β-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for β-Glucuronidase Deficiency in the C3H Mouse†

    PubMed Central

    Gwynn, Babette; Lueders, Kira; Sands, Mark S.; Birkenmeier, Edward H.

    1998-01-01

    The severity of human mucopolysaccharidosis type VII (MPS VII), or Sly syndrome, depends on the relative activity of the enzyme β-glucuronidase. Loss of β-glucuronidase activity can cause hydrops fetalis, with in utero or postnatal death of the patient. In this report, we show that β-glucuronidase activity is not detectable by a standard fluorometric assay in C3H/HeOuJ (C3H) mice homozygous for a new mutation, gusmps2J. These gusmps2J/gusmps2J mice are born and survive much longer than the previously characterized β-glucuronidase-null B6.C-H-2bm1/ByBir-gusmps (gusmps/gusmps) mice. Northern blot analysis of liver from gusmps2J/gusmps2J mice demonstrates a 750-bp reduction in size of β-glucuronidase mRNA. A 5.4-kb insertion in the Gus-sh nucleotide sequence from these mice was localized by Southern blot analysis to intron 8. The ends of the inserted sequences were cloned by inverse PCR and revealed an intracisternal A-particle (IAP) element inserted near the 3′ end of the intron. The sequence of the long terminal repeat (LTR) regions of the IAP most closely matches that of a composite LTR found in transposed IAPs previously identified in the C3H strain. The inserted IAP may contribute to diminished β-glucuronidase activity either by interfering with transcription or by destabilizing the message. The resulting phenotype is much less severe than that previously described in the gusmps/gusmps mouse and provides an opportunity to study MPS VII on a genetic background that clearly modulates disease severity. PMID:9774663

Top