Lentivirus mediated RNA interference of EMMPRIN (CD147) gene inhibits the proliferation, matrigel invasion and tumor formation of breast cancer cells.

PubMed

Yang, Jing; Wang, Rong; Li, Hongjiang; Lv, Qing; Meng, Wentong; Yang, Xiaoqin

2016-07-08

Overexpression of extracellular matrix metalloproteinase inducer (EMMPRIN) or cluster of differentiation 147 (CD147), a glycoprotein enriched on the plasma membrane of tumor cells, promotes proliferation, invasion, metastasis, and survival of malignant tumor cells. In this study, we sought to examine the expression of EMMPRIN in breast tumors, and to identify the potential roles of EMMPRIN on breast cancer cells. EMMPRIN expression in breast cancer tissues was assessed by immunohistochemistry. We used a lentivirus vector-based RNA interference (RNAi) approach expressing short hairpin RNA (shRNA) to knockdown EMMPRIN gene in breast cancer cell lines MDA-MB-231 and MCF-7. In vitro, Cell proliferative, invasive potential were determined by Cell Counting Kit (CCK-8), cell cycle analysis and matrigel invasion assay, respectively. In vivo, tumorigenicity was monitored by inoculating tumor cells into breast fat pad of female nude mice. EMMPRIN was over-expressed in breast tumors and breast cancer cell lines. Down-regulation of EMMPRIN by lentivirus vector-based RNAi led to decreased cell proliferative, decreased matrigel invasion in vitro, and attenuated tumor formation in vivo. High expression of EMMPRIN plays a crucial role in breast cancer cell proliferation, matrigel invasion and tumor formation.

Gene silencing efficiency and INF-β induction effects of splicing miRNA 155-based artificial miRNA with pre-miRNA stem-loop structures.

PubMed

Sin, Onsam; Mabiala, Prudence; Liu, Ye; Sun, Ying; Hu, Tao; Liu, Qingzhen; Guo, Deyin

2012-02-01

Artificial microRNA (miRNA) expression vectors have been developed and used for RNA interference. The secondary structure of artificial miRNA is important for RNA interference efficacy. We designed two groups of six artificial splicing miRNA 155-based miRNAs (SM155-based miRNAs) with the same target in the coding region or 3' UTR of a target gene and studied their RNA silencing efficiency and interferon β (IFN-β) induction effects. SM155-based miRNA with a mismatch at the +1 position and a bulge at the +11, +12 positions in a miRNA precursor stem-loop structure showed the highest gene silencing efficiency and lowest IFN-β induction effect (increased IFN-β mRNA level by 10% in both target cases), regardless of the specificity of the target sequence, suggesting that pSM155-based miRNA with this design could be a valuable miRNA expression vector.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

Zinc Finger Protein Designed to Target 2-Long Terminal Repeat Junctions Interferes with Human Immunodeficiency Virus Integration

PubMed Central

Sakkhachornphop, Supachai; Barbas, Carlos F.; Keawvichit, Rassamee; Wongworapat, Kanlaya

2012-01-01

Abstract Integration of the human immunodeficiency virus type 1 (HIV-1) genome into the host chromosome is a vital step in the HIV life cycle. The highly conserved cytosine–adenine (CA) dinucleotide sequence immediately upstream of the cleavage site is crucial for integrase (IN) activity. As this viral enzyme has an important role early in the HIV-1 replication cycle, interference with the IN substrate has become an attractive strategy for therapeutic intervention. We demonstrated that a designed zinc finger protein (ZFP) fused to green fluorescent protein (GFP) targets the 2-long terminal repeat (2-LTR) circle junctions of HIV-1 DNA with nanomolar affinity. We report now that 2LTRZFP-GFP stably transduced into 293T cells interfered with the expression of vesicular stomatitis virus glycoprotein (VSV-G)-pseudotyped lentiviral red fluorescent protein (RFP), as shown by the suppression of RFP expression. We also used a third-generation lentiviral vector and pCEP4 expression vector to deliver the 2LTRZFP-GFP transgene into human T-lymphocytic cells, and a stable cell line for long-term expression studies was selected for HIV-1 challenge. HIV-1 integration and replication were inhibited as measured by Alu-gag real-time PCR and p24 antigen assay. In addition, the molecular activity of 2LTRZFP-GFP was evaluated in peripheral blood mononuclear cells. The results were confirmed by Alu-gag real-time PCR for integration interference. We suggest that the expression of 2LTRZFP-GFP limited viral integration on intracellular immunization, and that it has potential for use in HIV gene therapy in the future. PMID:22429108

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

PubMed Central

Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

2004-01-01

Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

PubMed

Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

2014-04-20

A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Downregulation of mouse CCR3 by lentiviral shRNA inhibits proliferation and induces apoptosis of mouse eosinophils.

PubMed

Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui

2017-02-01

RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.

Suppression of the Epidermal Growth Factor-like Domain 7 and Inhibition of Migration and Epithelial-Mesenchymal Transition in Human Pancreatic Cancer PANC-1 Cells.

PubMed

Wang, Yun-Liang; Dong, Feng-Lin; Yang, Jian; Li, Zhi; Zhi, Qiao-Ming; Zhao, Xin; Yang, Yong; Li, De-Chun; Shen, Xiao-Chun; Zhou, Jin

2015-01-01

Epidermal growth factor-like domain multiple 7 (EGFL7), a secreted protein specifically expressed by endothelial cells during embryogenesis, recently was identified as a critical gene in tumor metastasis. Epithelial-mesenchymal transition (EMT) was found to be closely related with tumor progression. Accordingly, it is important to investigate the migration and EMT change after knock-down of EGFL7 gene expression in human pancreatic cancer cells. EGFL7 expression was firstly testified in 4 pancreatic cancer cell lines by real-time polymerase chain reaction (Real-time PCR) and western blot, and the highest expression of EGFL7 was found in PANC-1 cell line. Then, PANC-1 cells transfected with small interference RNA (siRNA) of EGFL7 using plasmid vector were named si-PANC-1, while transfected with negative control plasmid vector were called NC-PANC-1. Transwell assay was used to analyze the migration of PANC-1 cells. Real-time PCR and western blotting were used to detect the expression change of EGFL7 gene, EMT markers like E-Cadherin, N-Cadherin, Vimentin, Fibronectin and transcription factors like snail, slug in PANC-1, NC- PANC-1, and si-PANC-1 cells, respectively. After successful plasmid transfection, EGFL7 gene were dramatically knock-down by RNA interference in si-PANC-1 group. Meanwhile, migration ability decreased significantly, compared with PANC-1 and NC-PANC-1 group. Meanwhile, the expression of epithelial phenotype marker E-Cadherin increased and that of mesenchymal phenotype markers N-Cadherin, Vimentin, Fibronectin dramatically decreased in si-PANC-1 group, indicating a reversion of EMT. Also, transcription factors snail and slug decreased significantly after RNA interference. Current study suggested that highly-expressed EGFL7 promotes migration of PANC-1 cells and acts through transcription factors snail and slug to induce EMT, and further study is needed to confirm this issue.

Maternally derived antibodies in commercial broiler chickens did not significantly interfere with protection of Newcastle disease virus vectored infectious laryngotracheitis vaccines

USDA-ARS?s Scientific Manuscript database

Newcastle disease virus (NDV) recombinants expressing the infectious laryngotracheitis virus (ILTV) glycoproteins B and D have previously been demonstrated to confer complete clinical protection against virulent ILTV and NDV challenges in naive chickens. However, there was a general concern that the...

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

The effect of Pokemon on bladder cancer epithelial-mesenchymal transition.

PubMed

Guo, Changcheng; Zhu, Kai; Sun, Wei; Yang, Bin; Gu, Wenyu; Luo, Jun; Peng, Bo; Zheng, Junhua

2014-01-24

This study aimed at detecting Pokemon expression in bladder cancer cell and investigating the relationship between Pokemon and epithelial-mesenchymal transition. Furthermore, we investigated the functions of Pokemon in the carcinogenesis and development of bladder cancer. This study was also designed to observe the inhibitory effects of siRNA expression vector on Pokemon in bladder cancer cell. The siRNA expression vectors which were constructed to express a short hairpin RNA against Pokemon were transfected to the bladder cancer cells T24 with a liposome. Levels of Pokemon, E-cadherin and β-catenin mRNA and protein were examined by real-time quantitative-fluorescent PCR and Western blot analysis, respectively. The effects of Pokemon silencing on epithelial-mesenchymal transition of T24 cells were evaluated with wound-healing assay. Pokemon was strongly inhibited by siRNA treatment, especially siRNA3 treatment group, as it was reflected by Western blot and real-time PCR. The gene and protein of E-cadherin expression level showed increased markedly after Pokemon was inhibited by RNA interference. While there were no differences in the levels of gene and protein of β-catenin among five groups. The bladder cancer cell after Pokemon siRNA interference showed a significantly reduced wound-closing efficiency at 6, 12 and 24h. Our findings suggest Pokemon may inhibit the expression of E-cadherin. The low expression of E-cadherin lead to increasing the phenotype and apical-base polarity of epithelial cells. These changes of cells may result in the recurrence and progression of bladder cancer at last. Copyright © 2013 Elsevier Inc. All rights reserved.

Expression of RNA interference triggers from an oncolytic herpes simplex virus results in specific silencing in tumour cells in vitro and tumours in vivo

PubMed Central

2010-01-01

Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854

Trojan Horse Strategy for Non-invasive Interference of Clock Gene in the Oyster Crassostrea gigas.

PubMed

Payton, Laura; Perrigault, Mickael; Bourdineaud, Jean-Paul; Marcel, Anjara; Massabuau, Jean-Charles; Tran, Damien

2017-08-01

RNA interference is a powerful method to inhibit specific gene expression. Recently, silencing target genes by feeding has been successfully carried out in nematodes, insects, and small aquatic organisms. A non-invasive feeding-based RNA interference is reported here for the first time in a mollusk bivalve, the pacific oyster Crassostrea gigas. In this Trojan horse strategy, the unicellular alga Heterocapsa triquetra is the food supply used as a vector to feed oysters with Escherichia coli strain HT115 engineered to express the double-stranded RNA targeting gene. To test the efficacy of the method, the Clock gene, a central gene of the circadian clock, was targeted for knockout. Results demonstrated specific and systemic efficiency of the Trojan horse strategy in reducing Clock mRNA abundance. Consequences of Clock disruption were observed in Clock-related genes (Bmal, Tim1, Per, Cry1, Cry2, Rev.-erb, and Ror) and triploid oysters were more sensitive than diploid to the interference. This non-invasive approach shows an involvement of the circadian clock in oyster bioaccumulation of toxins produced by the harmful alga Alexandrium minutum.

Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

PubMed

Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

2014-01-01

HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

Expression of CD154 by a Simian Immunodeficiency Virus Vector Induces Only Transitory Changes in Rhesus Macaques

PubMed Central

Hodara, Vida L.; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.

2005-01-01

Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that expressed CD154. We found that this recombinant vector directed the expression of CD154 on the surface of infected CD4+ T cells and that expression of CD154 resulted in activation of B cells present in the same cultures. Experimental infection of rhesus macaques resulted in very low viral loads for the CD154-expressing virus and the control virus, indicating that expression of CD154 did not result in increased viral replication. Analyses of the anti-SIV immune responses and the phenotype of lymphocytes in blood and lymphoid tissues showed changes that occurred during the acute phase of infection only in animals infected with the CD154-expressing SIV, but that became indistinguishable from those seen in animals infected with the control virus at later time points. We conclude that the level of expression of CD154 in itself is not responsible for affecting the immune response to an attenuated virus. Considering that the CD154-expressing SIV vector and the virus control did not carry an active nef gene, our results suggest that, in CD4+ T cells infected with wild-type virus, Nef is the viral factor that interferes with the immune mechanisms that regulate expression of CD154. PMID:15795254

Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

PubMed

Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

2018-04-01

Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

Tripartite polyionic complex (PIC) micelles as non-viral vectors for mesenchymal stem cell siRNA transfection.

PubMed

Raisin, Sophie; Morille, Marie; Bony, Claire; Noël, Danièle; Devoisselle, Jean-Marie; Belamie, Emmanuel

2017-08-22

In the context of regenerative medicine, the use of RNA interference mechanisms has already proven its efficiency in targeting specific gene expression with the aim of enhancing, accelerating or, more generally, directing stem cell differentiation. However, achievement of good transfection levels requires the use of a gene vector. For in vivo applications, synthetic vectors are an interesting option to avoid possible issues associated with viral vectors (safety, production costs, etc.). Herein, we report on the design of tripartite polyionic complex micelles as original non-viral polymeric vectors suited for mesenchymal stem cell transfection with siRNA. Three micelle formulations were designed to exhibit pH-triggered disassembly in an acidic pH range comparable to that of endosomes. One formulation was selected as the most promising with the highest siRNA loading capacity while clearly maintaining pH-triggered disassembly properties. A thorough investigation of the internalization pathway of micelles into cells with tagged siRNA was made before showing an efficient inhibition of Runx2 expression in primary bone marrow-derived stem cells. This work evidenced PIC micelles as promising synthetic vectors that allow efficient MSC transfection and control over their behavior, from the perspective of their clinical use.

Genetic approaches to interfere with malaria transmission by vector mosquitoes

PubMed Central

Wang, Sibao; Jacobs-Lorena, Marcelo

2013-01-01

Malaria remains one of the world’s most devastating diseases, causing over one million deaths every year. The most vulnerable stages of Plasmodium development in the vector mosquito occur in the midgut lumen, making the midgut a prime target for intervention. Mosquito transgenesis and paratransgenesis are two novel strategies that aim at rendering the vector incapable of sustaining Plasmodium development. Mosquito transgenesis involves direct genetic engineering of the mosquito itself for delivery of anti-Plasmodium effector molecules. Conversely, paratransgenesis involves the genetic modification of mosquito symbionts for expression of anti-pathogen effector molecules. Here we consider both genetic manipulation strategies for rendering mosquitoes refractory to Plasmodium infection, and discuss challenges for the translation of laboratory findings to field applications. PMID:23395485

A tetravalent alphavirus-vector based Dengue vaccine provides effective immunity in an early life mouse model

PubMed Central

Khalil, Syed Muaz; Tonkin, Daniel R.; Mattocks, Melissa D.; Snead, Andrew T.; Johnston, Robert E.; White, Laura J.

2014-01-01

Dengue viruses (DENV1-4) cause 390 million clinical infections every year, several hundred thousand of which progress to severe hemorrhagic and shock syndromes. Preexisting immunity resulting from a previous DENV infection is the major risk factor for severe dengue during secondary heterologous infections. During primary infections in infants, maternal antibodies pose an analogous risk. At the same time, maternal antibodies are likely to prevent induction of endogenous anti-DENV antibodies in response to current live, attenuated virus (LAV) vaccine candidates. Any effective early life dengue vaccine has to overcome maternal antibody interference (leading to ineffective vaccination) and poor induction of antibody responses (increasing the risk of severe dengue disease upon primary infection). In a previous study, we demonstrated that a non-propagating Venezuelan equine encephalitis virus replicon expression vector (VRP), expressing the ectodomain of DENV E protein (E85), overcomes maternal interference in a BALB/c mouse model. We report here that a single immunization with a tetravalent VRP vaccine induced NAb and T-cell responses to each serotype at a level equivalent to the monovalent vaccine components, suggesting that this vaccine modality can overcome serotype interference. Furthermore, neonatal immunization was durable and could be boosted later in life to further increase NAb and T-cell responses. Although the neonatal immune response was lower in magnitude than responses in adult BALB/c mice, we demonstrate that VRP vaccines generated protective immunity from a lethal challenge after a single neonatal immunization. In summary, VRP vaccines expressing DENV antigens were immunogenic and protective in neonates, and hence are promising candidates for safe and effective vaccination in early life. PMID:24882043

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method.

PubMed

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-03-04

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications.

A Real-Time Interference Monitoring Technique for GNSS Based on a Twin Support Vector Machine Method

PubMed Central

Li, Wutao; Huang, Zhigang; Lang, Rongling; Qin, Honglei; Zhou, Kai; Cao, Yongbin

2016-01-01

Interferences can severely degrade the performance of Global Navigation Satellite System (GNSS) receivers. As the first step of GNSS any anti-interference measures, interference monitoring for GNSS is extremely essential and necessary. Since interference monitoring can be considered as a classification problem, a real-time interference monitoring technique based on Twin Support Vector Machine (TWSVM) is proposed in this paper. A TWSVM model is established, and TWSVM is solved by the Least Squares Twin Support Vector Machine (LSTWSVM) algorithm. The interference monitoring indicators are analyzed to extract features from the interfered GNSS signals. The experimental results show that the chosen observations can be used as the interference monitoring indicators. The interference monitoring performance of the proposed method is verified by using GPS L1 C/A code signal and being compared with that of standard SVM. The experimental results indicate that the TWSVM-based interference monitoring is much faster than the conventional SVM. Furthermore, the training time of TWSVM is on millisecond (ms) level and the monitoring time is on microsecond (μs) level, which make the proposed approach usable in practical interference monitoring applications. PMID:26959020

Classical reconstruction of interference patterns of position-wave-vector-entangled photon pairs by the time-reversal method

NASA Astrophysics Data System (ADS)

Ogawa, Kazuhisa; Kobayashi, Hirokazu; Tomita, Akihisa

2018-02-01

The quantum interference of entangled photons forms a key phenomenon underlying various quantum-optical technologies. It is known that the quantum interference patterns of entangled photon pairs can be reconstructed classically by the time-reversal method; however, the time-reversal method has been applied only to time-frequency-entangled two-photon systems in previous experiments. Here, we apply the time-reversal method to the position-wave-vector-entangled two-photon systems: the two-photon Young interferometer and the two-photon beam focusing system. We experimentally demonstrate that the time-reversed systems classically reconstruct the same interference patterns as the position-wave-vector-entangled two-photon systems.

Establishment of conditional vectors for hairpin siRNA knockdowns

PubMed Central

Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

2003-01-01

Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

In vivo reduction or blockade of interleukin-1β in primary osteoarthritis influences expression of mediators implicated in pathogenesis

PubMed Central

Santangelo, K. S.; Nuovo, G. J.; Bertone, A. L.

2012-01-01

Summary Objective Diminish interleukin-1β (IL-1β) signaling in a model of primary osteoarthritis by RNA interference-based transcript reduction or receptor blockade, and quantify changes incurred on transcript expression of additional mediators. Methods Knees of Hartley guinea pigs were collected at 120 and 180 days of age following injection with viral vectors (N=4/treatment group/date) at 60 days. Two groups received either adeno-associated viral serotype 5 vector containing a knockdown sequence (TV), or adenoviral vector encoding for IL-1 receptor antagonist protein (Ad-IRAP); treatments were contrasted with opposite knees administered corresponding vector controls. A third group evaluated TV relative to saline-only injected knees. Chondropathy and immunohistochemistry findings were compared to untreated guinea pigs. Transcript expression levels in cartilage were calculated using the comparative CT (2−ΔΔCT) method and analyzed by one-way ANOVA with pairwise comparisons using Tukey 95% confidence intervals. Results Vector transduction was confirmed at both harvest dates. TV and Ad-IRAP, relative to vector controls, significantly decreased IL-1β. Inflammatory mediators [tumor necrosis factor-α (TNF-α), interleukin-8 (IL-8), interferon-γ (IFN-γ)], and catabolic matrix metalloproteinase 13 (MMP13) were also decreased, while anabolic transforming growth factor-β1 (TGF-β1) was increased. IL-1β was also decreased by TV versus saline, with a decrease in MMP13 and increase TGF-β1; TNF-α, IL-8, and IFN-γ were transiently increased. Conclusions This work confirmed that a reduction in IL-1β signaling was accomplished by either method, resulting in decreased expression of three inflammatory mediators and one catabolic agent, and increased expression of an anabolic molecule. Thus, evidence is provided that IL-1β serves a role in vivo in spontaneous osteoarthritis and that these translational tools may provide beneficial disease modification. PMID:22935786

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs

PubMed Central

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122

HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.

PubMed

Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne

2015-01-01

Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.

Tandem SUMO fusion vectors for improving soluble protein expression and purification.

PubMed

Guerrero, Fernando; Ciragan, Annika; Iwaï, Hideo

2015-12-01

Availability of highly purified proteins in quantity is crucial for detailed biochemical and structural investigations. Fusion tags are versatile tools to facilitate efficient protein purification and to improve soluble overexpression of proteins. Various purification and fusion tags have been widely used for overexpression in Escherichia coli. However, these tags might interfere with biological functions and/or structural investigations of the protein of interest. Therefore, an additional purification step to remove fusion tags by proteolytic digestion might be required. Here, we describe a set of new vectors in which yeast SUMO (SMT3) was used as the highly specific recognition sequence of ubiquitin-like protease 1, together with other commonly used solubility enhancing proteins, such as glutathione S-transferase, maltose binding protein, thioredoxin and trigger factor for optimizing soluble expression of protein of interest. This tandem SUMO (T-SUMO) fusion system was tested for soluble expression of the C-terminal domain of TonB from different organisms and for the antiviral protein scytovirin. Copyright © 2015 Elsevier Inc. All rights reserved.

RNA Interference in Insect Vectors for Plant Viruses.

PubMed

Kanakala, Surapathrudu; Ghanim, Murad

2016-12-12

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

RNA Interference in Insect Vectors for Plant Viruses

PubMed Central

Kanakala, Surapathrudu; Ghanim, Murad

2016-01-01

Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Improved Innate and Adaptive Immunostimulation by Genetically Modified HIV-1 Protein Expressing NYVAC Vectors

PubMed Central

Quakkelaar, Esther D.; Redeker, Anke; Haddad, Elias K.; Harari, Alexandre; McCaughey, Stella Mayo; Duhen, Thomas; Filali-Mouhim, Abdelali; Goulet, Jean-Philippe; Loof, Nikki M.; Ossendorp, Ferry; Perdiguero, Beatriz; Heinen, Paul; Gomez, Carmen E.; Kibler, Karen V.; Koelle, David M.; Sékaly, Rafick P.; Sallusto, Federica; Lanzavecchia, Antonio; Pantaleo, Giuseppe; Esteban, Mariano; Tartaglia, Jim; Jacobs, Bertram L.; Melief, Cornelis J. M.

2011-01-01

Attenuated poxviruses are safe and capable of expressing foreign antigens. Poxviruses are applied in veterinary vaccination and explored as candidate vaccines for humans. However, poxviruses express multiple genes encoding proteins that interfere with components of the innate and adaptive immune response. This manuscript describes two strategies aimed to improve the immunogenicity of the highly attenuated, host-range restricted poxvirus NYVAC: deletion of the viral gene encoding type-I interferon-binding protein and development of attenuated replication-competent NYVAC. We evaluated these newly generated NYVAC mutants, encoding HIV-1 env, gag, pol and nef, for their ability to stimulate HIV-specific CD8 T-cell responses in vitro from blood mononuclear cells of HIV-infected subjects. The new vectors were evaluated and compared to the parental NYVAC vector in dendritic cells (DCs), RNA expression arrays, HIV gag expression and cross-presentation assays in vitro. Deletion of type-I interferon-binding protein enhanced expression of interferon and interferon-induced genes in DCs, and increased maturation of infected DCs. Restoration of replication competence induced activation of pathways involving antigen processing and presentation. Also, replication-competent NYVAC showed increased Gag expression in infected cells, permitting enhanced cross-presentation to HIV-specific CD8 T cells and proliferation of HIV-specific memory CD8 T-cells in vitro. The recombinant NYVAC combining both modifications induced interferon-induced genes and genes involved in antigen processing and presentation, as well as increased Gag expression. This combined replication-competent NYVAC is a promising candidate for the next generation of HIV vaccines. PMID:21347234

Identification of germline transcriptional regulatory elements in Aedes aegypti.

PubMed

Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

2014-02-04

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Identification of germline transcriptional regulatory elements in Aedes aegypti

NASA Astrophysics Data System (ADS)

Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

2014-02-01

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

XM-1 Tank EMP Susceptibility and Survivability Test Program and Plan

DTIC Science & Technology

1980-11-01

electric field vector. The Vertical EMP Electromagnetic interference (EMI) shielding Simulator ( VEMPS ) produces a non-threat- is used on cable...polarized fields in the VEMPS to determine 2.3 Oveiall Program Activity Flow 5 , bulk current waveforms on interior cabling Figure 1 (p. 8) expresses...measured. The vertically polarized VEMPS the ground, it is not readily obvious how the will be used to measure harness sheath cur- currents on the

A chitin deacetylase-like protein is a predominant constituent of tick peritrophic membrane that influences the persistence of Lyme disease pathogens within the vector.

PubMed

Kariu, Toru; Smith, Alexis; Yang, Xiuli; Pal, Utpal

2013-01-01

Ixodes scapularis is the specific arthropod vector for a number of globally prevalent infections, including Lyme disease caused by the bacterium Borrelia burgdorferi. A feeding-induced and acellular epithelial barrier, known as the peritrophic membrane (PM) is detectable in I. scapularis. However, whether or how the PM influences the persistence of major tick-borne pathogens, such as B. burgdorferi, remains largely unknown. Mass spectrometry-based proteome analyses of isolated PM from fed ticks revealed that the membrane contains a few detectable proteins, including a predominant and immunogenic 60 kDa protein with homology to arthropod chitin deacetylase (CDA), herein termed I. scapularis CDA-like protein or IsCDA. Although IsCDA is primarily expressed in the gut and induced early during tick feeding, its silencing via RNA interference failed to influence either the occurrence of the PM or spirochete persistence, suggesting a redundant role of IsCDA in tick biology and host-pathogen interaction. However, treatment of ticks with antibodies against IsCDA, one of the most predominant protein components of PM, affected B. burgdorferi survival, significantly augmenting pathogen levels within ticks but without influencing the levels of total gut bacteria. These studies suggested a preferential role of tick PM in limiting persistence of B. burgdorferi within the vector. Further understanding of the mechanisms by which vector components contribute to pathogen survival may help the development of new strategies to interfere with the infection.

Down-regulation of CD19 expression inhibits proliferation, adhesion, migration and invasion and promotes apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells.

PubMed

Wu, Junqing; Liang, Bin; Qian, Yan; Tang, Liyuan; Xing, Chongyun; Zhuang, Qiang; Shen, Zhijian; Jiang, Songfu; Yu, Kang; Feng, Jianhua

2018-05-29

The survival rate of childhood acute lymphoblastic leukemia (ALL) has increased while that of Philadelphia-positive (Ph+) ALL remains low. CD19 is a B-cell specific molecule related to the survival and proliferation of normal B cells. However, there is little information available on the effects of CD19 on the biological behavior of Ph+ ALL cells. In this study, we explored a lentiviral vector-mediated short hairpin RNA (shRNA) expression vector to stably reduce CD19 expression in Ph+ ALL cell line SUP-B15 cells and investigated the effects of CD19 downregulation on cell proliferation, apoptosis, drug sensitivity, cell adhesion, cell migration and cell invasion in vitro. CD19 mRNA and protein expression levels were inhibited significantly by CD19 shRNA. Down-regulation of CD19 could inhibit cell proliferation, adhesion, migration and invasion, and increase cell apoptosis and the efficacy of chemotherapeutic agents and imatinib in SUP-B15 cells. Moreover, we found that down-regulation of CD19 expression inhibits cell proliferation and induces apoptosis in SUP-B15 cells in a p53-dependent manner. Taken together, our results suggest that lentiviral vector-mediated RNA interference of CD19 gene may be a promising strategy in the treatment of Ph+ ALL. This article is protected by copyright. All rights reserved.

RNA Interference for improving the Outcome of Islet Transplantation

PubMed Central

Li, Feng; Mahato, Ram I

2010-01-01

Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

Assessment of Antibodies Induced by Multivalent Transmission-Blocking Malaria Vaccines.

PubMed

Menon, Vinay; Kapulu, Melissa C; Taylor, Iona; Jewell, Kerry; Li, Yuanyuan; Hill, Fergal; Long, Carole A; Miura, Kazutoyo; Biswas, Sumi

2017-01-01

A malaria transmission-blocking vaccine would be a critical tool in achieving malaria elimination and eradication. By using chimpanzee adenovirus serotype 63 and modified vaccinia virus Ankara viral vectored vaccines, we investigated whether incorporating two antigens into one vaccine would result in higher transmission-reducing activity than one antigen. We demonstrated that when Pfs25 was administered with other antigens Pfs28 or Pfs230C, either concurrently as a mixed vaccine or co-expressed as a dual-antigen vaccine, the antibody response in mice to each antigen was comparable to a monoantigen vaccine, without immunological interference. However, we found that the transmission-reducing activity (functional activity) of dual-antigen vaccines was not additive. Dual-antigen vaccines generally only elicited similar transmission-reducing activity to monoantigen vaccines and in one instance had lower transmission-reducing activity. We found that despite the lack of immunological interference of dual-antigen vaccines, they are still not as effective at blocking malaria transmission as Pfs25-IMX313, the current leading candidate for viral vectored vaccines. Pfs25-IMX313 elicited similar quality antibodies to dual-antigen vaccines, but higher antibody titers.

Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

PubMed

Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

2012-07-01

A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells.

PubMed

Patel, Devang N; Bailey, Steven R; Gresham, John K; Schuchman, David B; Shelhamer, James H; Goldstein, Barry J; Foxwell, Brian M; Stemerman, Michael B; Maranchie, Jodi K; Valente, Anthony J; Mummidi, Srinivas; Chandrasekar, Bysani

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-kappaB (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate that LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.

TLR4-NOX4-AP-1 signaling mediates lipopolysaccharide-induced CXCR6 expression in human aortic smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Devang N.; Bailey, Steven R.; Gresham, John K.

2006-09-08

CXCL16 is a transmembrane non-ELR CXC chemokine that signals via CXCR6 to induce aortic smooth muscle cell (ASMC) proliferation. While bacterial lipopolysaccharide (LPS) has been shown to stimulate CXCL16 expression in SMC, its effects on CXCR6 are not known. Here, we demonstrate that LPS upregulates CXCR6 mRNA, protein, and surface expression in human ASMC. Inhibition of TLR4 with neutralizing antibodies or specific siRNA interference blocked LPS-mediated CXCR6 expression. LPS stimulated both AP-1 (c-Fos, c-Jun) and NF-{kappa}B (p50 and p65) activation, but only inhibition of AP-1 attenuated LPS-induced CXCR6 expression. Using dominant negative expression vectors and siRNA interference, we demonstrate thatmore » LPS induces AP-1 activation via MyD88, TRAF6, ERK1/2, and JNK signaling pathways. Furthermore, the flavoprotein inhibitor diphenyleniodonium chloride significantly attenuated LPS-mediated AP-1-dependent CXCR6 expression, as did inhibition of NOX4 NADPH oxidase by siRNA. Finally, CXCR6 knockdown inhibited CXCL16-induced ASMC proliferation. These results demonstrate that LPS-TLR4-NOX4-AP-1 signaling can induce CXCR6 expression in ASMC, and suggest that the CXCL16-CXCR6 axis may be an important proinflammatory pathway in the pathogenesis of atherosclerosis.« less

Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

PubMed Central

Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

2013-01-01

RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

A surface transporter family conveys the trypanosome differentiation signal.

PubMed

Dean, Samuel; Marchetti, Rosa; Kirk, Kiaran; Matthews, Keith R

2009-05-14

Microbial pathogens use environmental cues to trigger the developmental events needed to infect mammalian hosts or transmit to disease vectors. The parasites causing African sleeping sickness respond to citrate or cis-aconitate (CCA) to initiate life-cycle development when transmitted to their tsetse fly vector. This requires hypersensitization of the parasites to CCA by exposure to low temperature, conditions encountered after tsetse fly feeding at dusk or dawn. Here we identify a carboxylate-transporter family, PAD (proteins associated with differentiation), required for perception of this differentiation signal. Consistent with predictions for the response of trypanosomes to CCA, PAD proteins are expressed on the surface of the transmission-competent 'stumpy-form' parasites in the bloodstream, and at least one member is thermoregulated, showing elevated expression and surface access at low temperature. Moreover, RNA-interference-mediated ablation of PAD expression diminishes CCA-induced differentiation and eliminates CCA hypersensitivity under cold-shock conditions. As well as being molecular transducers of the differentiation signal in these parasites, PAD proteins provide the first example of a surface marker able to discriminate the transmission stage of trypanosomes in their mammalian host.

Minimum Variance Distortionless Response Beamformer with Enhanced Nulling Level Control via Dynamic Mutated Artificial Immune System

PubMed Central

Kiong, Tiong Sieh; Salem, S. Balasem; Paw, Johnny Koh Siaw; Sankar, K. Prajindra

2014-01-01

In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals. PMID:25003136

Minimum variance distortionless response beamformer with enhanced nulling level control via dynamic mutated artificial immune system.

PubMed

Kiong, Tiong Sieh; Salem, S Balasem; Paw, Johnny Koh Siaw; Sankar, K Prajindra; Darzi, Soodabeh

2014-01-01

In smart antenna applications, the adaptive beamforming technique is used to cancel interfering signals (placing nulls) and produce or steer a strong beam toward the target signal according to the calculated weight vectors. Minimum variance distortionless response (MVDR) beamforming is capable of determining the weight vectors for beam steering; however, its nulling level on the interference sources remains unsatisfactory. Beamforming can be considered as an optimization problem, such that optimal weight vector should be obtained through computation. Hence, in this paper, a new dynamic mutated artificial immune system (DM-AIS) is proposed to enhance MVDR beamforming for controlling the null steering of interference and increase the signal to interference noise ratio (SINR) for wanted signals.

Involvement of LeMDR, an ATP-binding cassette protein gene, in shikonin transport and biosynthesis in Lithospermum erythrorhizon.

PubMed

Zhu, Yu; Lu, Gui-Hua; Bian, Zhuo-Wu; Wu, Feng-Yao; Pang, Yan-Jun; Wang, Xiao-Ming; Yang, Rong-Wu; Tang, Cheng-Yi; Qi, Jin-Liang; Yang, Yong-Hua

2017-11-13

Shikonin is a naphthoquinone secondary metabolite with important medicinal value and is found in Lithospermum erythrorhizon. Considering the limited knowledge on the membrane transport mechanism of shikonin, this study investigated such molecular mechanism. We successfully isolated an ATP-binding cassette protein gene, LeMDR, from L. erythrorhizon. LeMDR is predominantly expressed in L. erythrorhizon roots, where shikonin accumulated. Functional analysis of LeMDR by using the yeast cell expression system revealed that LeMDR is possibly involved in the shikonin efflux transport. The accumulation of shikonin is lower in yeast cells transformed with LeMDR-overexpressing vector than that with empty vector. The transgenic hairy roots of L. erythrorhizon overexpressing LeMDR (MDRO) significantly enhanced shikonin production, whereas the RNA interference of LeMDR (MDRi) displayed a reverse trend. Moreover, the mRNA expression level of LeMDR was up-regulated by treatment with shikonin and shikonin-positive regulators, methyl jasmonate and indole-3-acetic acid. There might be a relationship of mutual regulation between the expression level of LeMDR and shikonin biosynthesis. Our findings demonstrated the important role of LeMDR in transmembrane transport and biosynthesis of shikonin.

cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

PubMed

Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

2005-04-01

A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

Targeting caspase-3 as dual therapeutic benefits by RNAi facilitating brain-targeted nanoparticles in a rat model of Parkinson's disease.

PubMed

Liu, Yang; Guo, Yubo; An, Sai; Kuang, Yuyang; He, Xi; Ma, Haojun; Li, Jianfeng; Lu, Jing; Lv, Jing; Zhang, Ning; Jiang, Chen

2013-01-01

The activation of caspase-3 is an important hallmark in Parkinson's disease. It could induce neuron death by apoptosis and microglia activation by inflammation. As a result, inhibition the activation of caspase-3 would exert synergistic dual effect in brain in order to prevent the progress of Parkinson's disease. Silencing caspase-3 genes by RNA interference could inhibit the activation of caspase-3. We developed a brain-targeted gene delivery system based on non-viral gene vector, dendrigraft poly-L-lysines. A rabies virus glycoprotein peptide with 29 amino-acid linked to dendrigraft poly-L-lysines could render gene vectors the ability to get across the blood brain barrier by specific receptor mediated transcytosis. The resultant brain-targeted vector was complexed with caspase-3 short hairpin RNA coding plasmid DNA, yielding nanoparticles. In vivo imaging analysis indicated the targeted nanoparticles could accumulate in brain more efficiently than non-targeted ones. A multiple dosing regimen by weekly intravenous administration of the nanoparticles could reduce activated casapse-3 levels, significantly improve locomotor activity and rescue dopaminergic neuronal loss and in Parkinson's disease rats' brain. These results indicated the rabies virus glycoprotein peptide modified brain-targeted nanoparticles were promising gene delivery system for RNA interference to achieve anti-apoptotic and anti-inflammation synergistic therapeutic effects by down-regulation the expression and activation of caspase-3.

Preparation for a first-in-man lentivirus trial in patients with cystic fibrosis

PubMed Central

Alton, Eric W F W; Beekman, Jeffery M; Boyd, A Christopher; Brand, June; Carlon, Marianne S; Connolly, Mary M; Chan, Mario; Conlon, Sinead; Davidson, Heather E; Davies, Jane C; Davies, Lee A; Dekkers, Johanna F; Doherty, Ann; Gea-Sorli, Sabrina; Gill, Deborah R; Griesenbach, Uta; Hasegawa, Mamoru; Higgins, Tracy E; Hironaka, Takashi; Hyndman, Laura; McLachlan, Gerry; Inoue, Makoto; Hyde, Stephen C; Innes, J Alastair; Maher, Toby M; Moran, Caroline; Meng, Cuixiang; Paul-Smith, Michael C; Pringle, Ian A; Pytel, Kamila M; Rodriguez-Martinez, Andrea; Schmidt, Alexander C; Stevenson, Barbara J; Sumner-Jones, Stephanie G; Toshner, Richard; Tsugumine, Shu; Wasowicz, Marguerite W; Zhu, Jie

2017-01-01

We have recently shown that non-viral gene therapy can stabilise the decline of lung function in patients with cystic fibrosis (CF). However, the effect was modest, and more potent gene transfer agents are still required. Fuson protein (F)/Hemagglutinin/Neuraminidase protein (HN)-pseudotyped lentiviral vectors are more efficient for lung gene transfer than non-viral vectors in preclinical models. In preparation for a first-in-man CF trial using the lentiviral vector, we have undertaken key translational preclinical studies. Regulatory-compliant vectors carrying a range of promoter/enhancer elements were assessed in mice and human air–liquid interface (ALI) cultures to select the lead candidate; cystic fibrosis transmembrane conductance receptor (CFTR) expression and function were assessed in CF models using this lead candidate vector. Toxicity was assessed and ‘benchmarked’ against the leading non-viral formulation recently used in a Phase IIb clinical trial. Integration site profiles were mapped and transduction efficiency determined to inform clinical trial dose-ranging. The impact of pre-existing and acquired immunity against the vector and vector stability in several clinically relevant delivery devices was assessed. A hybrid promoter hybrid cytosine guanine dinucleotide (CpG)- free CMV enhancer/elongation factor 1 alpha promoter (hCEF) consisting of the elongation factor 1α promoter and the cytomegalovirus enhancer was most efficacious in both murine lungs and human ALI cultures (both at least 2-log orders above background). The efficacy (at least 14% of airway cells transduced), toxicity and integration site profile supports further progression towards clinical trial and pre-existing and acquired immune responses do not interfere with vector efficacy. The lead rSIV.F/HN candidate expresses functional CFTR and the vector retains 90–100% transduction efficiency in clinically relevant delivery devices. The data support the progression of the F/HN-pseudotyped lentiviral vector into a first-in-man CF trial in 2017. PMID:27852956

A New Genetic Vaccine Platform Based on an Adeno-Associated Virus Isolated from a Rhesus Macaque ▿

PubMed Central

Lin, Jianping; Calcedo, Roberto; Vandenberghe, Luk H.; Bell, Peter; Somanathan, Suryanarayan; Wilson, James M.

2009-01-01

We created a hybrid adeno-associated virus (AAV) from two related rhesus macaque isolates, called AAVrh32.33, and evaluated it as a vaccine carrier for human immunodeficiency virus type 1 (HIV-1) and type A influenza virus antigens. The goal was to overcome the limitations of vaccines based on other AAVs, which generate dysfunctional T-cell responses and are inhibited by antibodies found in human sera. Injection of a Gag-expressing AAVrh32.33 vector into mice resulted in a high-quality CD8+ T-cell response. The resulting Gag-specific T cells express multiple cytokines at high levels, including interleukin-2, with many having memory phenotypes; a subsequent boost with an adenovirus vector yielded a brisk expansion of Gag-specific T cells. A priming dose of AAVrh32.33 led to high levels of Gag antibodies, which exceed levels found after injection of adenovirus vectors. Importantly, passive transfer of pooled human immunoglobulin into mice does not interfere with the efficacy of AAVrh32.33 expressing nucleoproteins from influenza virus, as measured by protection to a lethal dose of influenza virus, which is consistent with the very low seroprevalence to this virus in humans. Studies of macaques with vectors expressing gp140 from HIV-1 (i.e., with AAVrh32.33 as the prime and simian adenovirus type 24 as the boost) demonstrated results similar to those for mice with high-level and high-quality CD8+ T-cell responses to gp140 and high-titered neutralizing antibodies to homologous HIV-1. The biology of this novel AAV hybrid suggests that it should be a preferred genetic vaccine carrier, capable of generating robust T- and B-cell responses. PMID:19812149

Aquaporin water channel AgAQP1 in the malaria vector mosquito Anopheles gambiae during blood feeding and humidity adaptation

PubMed Central

Liu, Kun; Tsujimoto, Hitoshi; Cha, Sung-Jae; Agre, Peter; Rasgon, Jason L.

2011-01-01

Altered patterns of malaria endemicity reflect, in part, changes in feeding behavior and climate adaptation of mosquito vectors. Aquaporin (AQP) water channels are found throughout nature and confer high-capacity water flow through cell membranes. The genome of the major malaria vector mosquito Anopheles gambiae contains at least seven putative AQP sequences. Anticipating that transmembrane water movements are important during the life cycle of A. gambiae, we identified and characterized the A. gambiae aquaporin 1 (AgAQP1) protein that is homologous to AQPs known in humans, Drosophila, and sap-sucking insects. When expressed in Xenopus laevis oocytes, AgAQP1 transports water but not glycerol. Similar to mammalian AQPs, water permeation of AgAQP1 is inhibited by HgCl2 and tetraethylammonium, with Tyr185 conferring tetraethylammonium sensitivity. AgAQP1 is more highly expressed in adult female A. gambiae mosquitoes than in males. Expression is high in gut, ovaries, and Malpighian tubules where immunofluorescence microscopy reveals that AgAQP1 resides in stellate cells but not principal cells. AgAQP1 expression is up-regulated in fat body and ovary by blood feeding but not by sugar feeding, and it is reduced by exposure to a dehydrating environment (42% relative humidity). RNA interference reduces AgAQP1 mRNA and protein levels. In a desiccating environment (<20% relative humidity), mosquitoes with reduced AgAQP1 protein survive significantly longer than controls. These studies support a role for AgAQP1 in water homeostasis during blood feeding and humidity adaptation of A. gambiae, a major mosquito vector of human malaria in sub-Saharan Africa. PMID:21444767

Recombinant soluble adenovirus receptor

DOEpatents

Freimuth, Paul I.

2002-01-01

Disclosed are isolated polypeptides from human CAR (coxsackievirus and adenovirus receptor) protein which bind adenovirus. Specifically disclosed are amino acid sequences which corresponds to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2. In other aspects, the disclosure relates to nucleic acid sequences encoding these domains as well as expression vectors which encode the domains and bacterial cells containing such vectors. Also disclosed is an isolated fusion protein comprised of the D1 polypeptide sequence fused to a polypeptide sequence which facilitates folding of D1 into a functional, soluble domain when expressed in bacteria. The functional D1 domain finds application for example in a therapeutic method for treating a patient infected with a virus which binds to D1, and also in a method for identifying an antiviral compound which interferes with viral attachment. Also included is a method for specifically targeting a cell for infection by a virus which binds to D1.

Nucleic acid sequences encoding D1 and D1/D2 domains of human coxsackievirus and adenovirus receptor (CAR)

DOEpatents

Freimuth, Paul I.

2010-04-06

The invention provides recombinant human CAR (coxsackievirus and adenovirus receptor) polypeptides which bind adenovirus. Specifically, polypeptides corresponding to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2 are provided. In another aspect, the invention provides nucleic acid sequences encoding these domains and expression vectors for producing the domains and bacterial cells containing such vectors. The invention also includes an isolated fusion protein comprised of the D1 polypeptide fused to a polypeptide which facilitates folding of D1 when expressed in bacteria. The functional D1 domain finds application in a therapeutic method for treating a patient infected with a CAR D1-binding virus, and also in a method for identifying an antiviral compound which interferes with viral attachment. The invention also provides a method for specifically targeting a cell for infection by a virus which binds to D1.

Paratransgenic Control of Vector Borne Diseases

PubMed Central

Hurwitz, Ivy; Fieck, Annabeth; Read, Amber; Hillesland, Heidi; Klein, Nichole; Kang, Angray; Durvasula, Ravi

2011-01-01

Conventional methodologies to control vector borne diseases with chemical pesticides are often associated with environmental toxicity, adverse effects on human health and the emergence of insect resistance. In the paratransgenic strategy, symbiotic or commensal microbes of host insects are transformed to express gene products that interfere with pathogen transmission. These genetically altered microbes are re-introduced back to the insect where expression of the engineered molecules decreases the host's ability to transmit the pathogen. We have successfully utilized this strategy to reduce carriage rates of Trypanosoma cruzi, the causative agent of Chagas disease, in the triatomine bug, Rhodnius prolixus, and are currently developing this methodology to control the transmission of Leishmania donovani by the sand fly Phlebotomus argentipes. Several effector molecules, including antimicrobial peptides and highly specific single chain antibodies, are currently being explored for their anti-parasite activities in these two systems. In preparation for eventual field use, we are actively engaged in risk assessment studies addressing the issue of horizontal gene transfer from the modified bacteria to environmental microbes. PMID:22110385

Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

PubMed

Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

2016-09-01

Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

Design and cloning strategies for constructing shRNA expression vectors

PubMed Central

McIntyre, Glen J; Fanning, Gregory C

2006-01-01

Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676

Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2 H – NbSe 2

DOE PAGES

Arguello, C. J.; Rosenthal, E. P.; Andrade, E. F.; ...

2015-01-21

We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe₂ that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe₂. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiologymore » and the interactions. In 2H-NbSe₂, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.« less

Quasiparticle interference, quasiparticle interactions, and the origin of the charge density wave in 2H-NbSe2.

PubMed

Arguello, C J; Rosenthal, E P; Andrade, E F; Jin, W; Yeh, P C; Zaki, N; Jia, S; Cava, R J; Fernandes, R M; Millis, A J; Valla, T; Osgood, R M; Pasupathy, A N

2015-01-23

We show that a small number of intentionally introduced defects can be used as a spectroscopic tool to amplify quasiparticle interference in 2H-NbSe2 that we measure by scanning tunneling spectroscopic imaging. We show, from the momentum and energy dependence of the quasiparticle interference, that Fermi surface nesting is inconsequential to charge density wave formation in 2H-NbSe2. We demonstrate that, by combining quasiparticle interference data with additional knowledge of the quasiparticle band structure from angle resolved photoemission measurements, one can extract the wave vector and energy dependence of the important electronic scattering processes thereby obtaining direct information both about the fermiology and the interactions. In 2H-NbSe2, we use this combination to confirm that the important near-Fermi-surface electronic physics is dominated by the coupling of the quasiparticles to soft mode phonons at a wave vector different from the charge density wave ordering wave vector.

Vaccine protection of chickens against antigenically diverse H5 highly pathogenic avian influenza isolates with a live HVT vector vaccine expressing the influenza hemagglutinin gene derived from a clade 2.2 avian influenza virus.

PubMed

Kapczynski, Darrell R; Esaki, Motoyuki; Dorsey, Kristi M; Jiang, Haijun; Jackwood, Mark; Moraes, Mauro; Gardin, Yannick

2015-02-25

Vaccination is an important tool in the protection of poultry against avian influenza (AI). For field use, the overwhelming majority of AI vaccines produced are inactivated whole virus formulated into an oil emulsion. However, recombinant vectored vaccines are gaining use for their ability to induce protection against heterologous isolates and ability to overcome maternal antibody interference. In these studies, we compared protection of chickens provided by a turkey herpesvirus (HVT) vector vaccine expressing the hemagglutinin (HA) gene from a clade 2.2 H5N1 strain (A/swan/Hungary/4999/2006) against homologous H5N1 as well as heterologous H5N1 and H5N2 highly pathogenic (HP) AI challenge. The results demonstrated all vaccinated birds were protected from clinical signs of disease and mortality following homologous challenge. In addition, oral and cloacal swabs taken from challenged birds demonstrated that vaccinated birds had lower incidence and titers of viral shedding compared to sham-vaccinated birds. Following heterologous H5N1 or H5N2 HPAI challenge, 80-95% of birds receiving the HVT vector AI vaccine at day of age survived challenge with fewer birds shedding virus after challenge than sham vaccinated birds. In vitro cytotoxicity analysis demonstrated that splenic T lymphocytes from HVT-vector-AI vaccinated chickens recognized MHC-matched target cells infected with H5, as well as H6, H7, or H9 AI virus. Taken together, these studies provide support for the use of HVT vector vaccines expressing HA to protect poultry against multiple lineages of HPAI, and that both humoral and cellular immunity induced by live vaccines likely contributes to protection. Published by Elsevier Ltd.

Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

PubMed

Chen, Y; Redinbaugh, M G; Michel, A P

2015-06-01

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

PubMed

Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

2013-02-01

To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

Evaluation of the reversal of multidrug resistance by MDR1 ribonucleic acid interference in a human colon cancer model using a Renilla luciferase reporter gene and coelenterazine.

PubMed

Jeon, Yong Hyun; Bae, Seon-ae; Lee, Yong Jin; Lee, You La; Lee, Sang-Woo; Yoon, Ghil-Suk; Ahn, Byeong-Cheol; Ha, Jeoung-Hee; Lee, Jaetae

2010-12-01

The reversal effect of multidrug resistance (MDR1) gene expression by adenoviral vector-mediated MDR1 ribonucleic acid interference was assessed in a human colon cancer animal model using bioluminescent imaging with Renilla luciferase (Rluc) gene and coelenterazine, a substrate for Rluc or MDR1 gene expression. A fluorescent microscopic examination demonstrated an increased green fluorescent protein signal in Ad-shMDR1- (recombinant adenovirus that coexpressed MDR1 small hairpin ribonucleic acid [shRNA] and green fluorescent protein) infected HCT-15/Rluc cells in a virus dose-dependent manner. Concurrently, with an increasing administered virus dose (0, 15, 30, 60, and 120 multiplicity of infection), Rluc activity was significantly increased in Ad-shMDR1-infected HCT-15/Rluc cells in a virus dose-dependent manner. In vivo bioluminescent imaging showed about 7.5-fold higher signal intensity in Ad-shMDR1-infected tumors than in control tumors (p < .05). Immunohistologic analysis demonstrated marked reduction of P-glycoprotein expression in infected tumor but not in control tumor. In conclusion, the reversal of MDR1 gene expression by MDR1 shRNA was successfully evaluated by bioluminescence imaging with Rluc activity using an in vivo animal model with a multidrug resistance cancer xenograft.

The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

PubMed

Grimm, Dirk

2011-10-26

For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.

PubMed

Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua

2015-01-01

To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.

Influence of sequence and size of DNA on packaging efficiency of parvovirus MVM-based vectors.

PubMed

Brandenburger, A; Coessens, E; El Bakkouri, K; Velu, T

1999-05-01

We have derived a vector from the autonomous parvovirus MVM(p), which expresses human IL-2 specifically in transformed cells (Russell et al., J. Virol 1992;66:2821-2828). Testing the therapeutic potential of these vectors in vivo requires high-titer stocks. Stocks with a titer of 10(9) can be obtained after concentration and purification (Avalosse et al., J. Virol. Methods 1996;62:179-183), but this method requires large culture volumes and cannot easily be scaled up. We wanted to increase the production of recombinant virus at the initial transfection step. Poor vector titers could be due to inadequate genome amplification or to inefficient packaging. Here we show that intracellular amplification of MVM vector genomes is not the limiting factor for vector production. Several vector genomes of different size and/or structure were amplified to an equal extent. Their amplification was also equivalent to that of a cotransfected wild-type genome. We did not observe any interference between vector and wild-type genomes at the level of DNA amplification. Despite equivalent genome amplification, vector titers varied greatly between the different genomes, presumably owing to differences in packaging efficiency. Genomes with a size close to 100% that of wild type were packaged most efficiently with loss of efficiency at lower and higher sizes. However, certain genomes of identical size showed different packaging efficiencies, illustrating the importance of the DNA sequence, and probably its structure.

Combined antitumor gene therapy with herpes simplex virus-thymidine kinase and short hairpin RNA specific for mammalian target of rapamycin.

PubMed

Woo, Ha-Na; Lee, Won Il; Kim, Ji Hyun; Ahn, Jeonghyun; Han, Jeong Hee; Lim, Sue Yeon; Lee, Won Woo; Lee, Heuiran

2015-12-01

A proof-of-concept study is presented using dual gene therapy that employed a small hairpin RNA (shRNA) specific for mammalian target of rapamycin (mTOR) and a herpes simplex virus-thymidine kinase (HSV-TK) gene to inhibit the growth of tumors. Recombinant adeno-associated virus (rAAV) vectors containing a mutant TK gene (sc39TK) were transduced into HeLa cells, and the prodrug ganciclovir (GCV) was administered to establish a suicide gene-therapy strategy. Additionally, rAAV vectors expressing an mTOR-targeted shRNA were employed to suppress mTOR-dependent tumor growth. GCV selectively induced death in tumor cells expressing TK, and the mTOR-targeted shRNA altered the cell cycle to impair tumor growth. Combining the TK-GCV system with mTOR inhibition suppressed tumor growth to a greater extent than that achieved with either treatment alone. Furthermore, HSV-TK expression and mTOR inhibition did not mutually interfere with each other. In conclusion, gene therapy that combines the TK-GCV system and mTOR inhibition shows promise as a novel strategy for cancer therapy.

Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

PubMed Central

Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

2009-01-01

Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

Transcript characteristic of myostatin in sheep fibroblasts.

PubMed

Lu, Jian; Ren, Hangxing; Sheng, Xihui; Zhang, Xiaoning; Li, Shangang; Zhao, Fuping; Zhou, Xinlei; Zhang, Li; Wei, Caihong; Ding, Jiatong; Li, Bichun; Du, Lixin

2012-08-01

Myostatin, a secreted growth factor highly expressed in skeletal muscle, negatively regulates skeletal muscle growth and differentiation. Recently, myostatin is emerged as a potential target for anti-atrophy and anti-fibrotic therapies. Therefore, to investigate the regulation of myostatin in sheep adult fibroblasts, we used the RNA interference mediated by lentiviral vector to gene silence myostatin. Simultaneously, we also had constructed the sheep myostatin overexpression vector to further explore the function of myostatin in fibroblasts. The results here demonstrated that the lentiviral vector could significantly reduce myostatin gene both at mRNA and protein level by 71% and 67%, respectively (P < 0.01). Inhibition of myostatin also resulted in a remarkable increase of activin receptor 2B (ACV2B), p21, PPARγ, leptin, C/EBPβ, and MEF2A expression, and a decrease of Akt1, CDK2, MEF2C, and Myf5 expression. Ectopic myostatin mRNA and protein were also present in the fibroblasts transfection. Furthermore, we observed that overexpression of myostatin contributed to an increase of Akt1, CDK2, Myf5 and PPARγ, and a decrease of p21, C/EBPα and leptin at the transcript level. These results suggested that myostatin positively regulated Akt1, CDK2, Myf5, leptin, and C/EBPα, but negatively regulated p21 mRNA expression in adult fibroblasts, and it also expanded our understanding of the regulation mechanism of myostatin. Moreover, the lentiviral system inactivated myostatin gene in fibroblasts would be used to generate transgenic sheep and to ameliorate muscle fibrosis and atrophy by gene therapy in the future. Copyright © 2012 Wiley Periodicals, Inc.

Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

PubMed Central

Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

2013-01-01

AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

Quantum non-Abelian hydrodynamics: Anyonic or spin-orbital entangled liquids, nonunitarity of scattering matrix and charge fractionalization

NASA Astrophysics Data System (ADS)

Pareek, Tribhuvan Prasad

2015-09-01

In this article, we develop an exact (nonadiabatic, nonperturbative) density matrix scattering theory for a two component quantum liquid which interacts or scatters off from a generic spin-dependent quantum potential. The generic spin dependent quantum potential [Eq. (1)] is a matrix potential, hence, adiabaticity criterion is ill-defined. Therefore the full matrix potential should be treated nonadiabatically. We succeed in doing so using the notion of vectorial matrices which allows us to obtain an exact analytical expression for the scattered density matrix (SDM), ϱsc [Eq. (30)]. We find that the number or charge density in scattered fluid, Tr(ϱsc), expressions in Eqs. (32) depends on nontrivial quantum interference coefficients, Qα β 0ijk, which arises due to quantum interference between spin-independent and spin-dependent scattering amplitudes and among spin-dependent scattering amplitudes. Further it is shown that Tr(ϱsc) can be expressed in a compact form [Eq. (39)] where the effect of quantum interference coefficients can be included using a vector Qαβ, which allows us to define a vector order parameterQ. Since the number density is obtained using an exact scattered density matrix, therefore, we do not need to prove that Q is non-zero. However, for sake of completeness, we make detailed mathematical analysis for the conditions under which the vector order parameterQ would be zero or nonzero. We find that in presence of spin-dependent interaction the vector order parameterQ is necessarily nonzero and is related to the commutator and anti-commutator of scattering matrix S with its dagger S† [Eq. (78)]. It is further shown that Q≠0, implies four physically equivalent conditions,i.e., spin-orbital entanglement is nonzero, non-Abelian scattering phase, i.e., matrices, scattering matrix is nonunitary and the broken time reversal symmetry for SDM. This also implies that quasi particle excitation are anyonic in nature, hence, charge fractionalization is a natural consequence. This aspect has also been discussed from the perspective of number or charge density conservation, which implies i.e., Tr(ϱ} sc) = Tr(ϱin). On the other hand Q = 0 turns out to be a mathematically forced unphysical solution in presence of spin-dependent potential or scattering which is equivalent to Abelian hydrodynamics, unitary scattering matrix, absence of spin-space entanglement and preserved time reversal symmetry. We have formulated the theory using mesoscopic language, specifically, we have considered two terminal systems connected to spin-dependent scattering region, which is equivalent to having two potential wells separated by a generic spin-dependent potential barrier. The formulation using mesoscopic language is practically useful because it leads directly to the measured quantities such as conductance and spin-polarization density in the leads, however, the presented formulation is not limited to the mesoscopic system only, its generality has been stressed at various places in this article.

User's guide to PANCOR: A panel method program for interference assessment in slotted-wall wind tunnels

NASA Technical Reports Server (NTRS)

Kemp, William B., Jr.

1990-01-01

Guidelines are presented for use of the computer program PANCOR to assess the interference due to tunnel walls and model support in a slotted wind tunnel test section at subsonic speeds. Input data requirements are described in detail and program output and general program usage are described. The program is written for effective automatic vectorization on a CDC CYBER 200 class vector processing system.

An RGD-Modified MRI-Visible Polymeric Vector for Targeted siRNA Delivery to Hepatocellular Carcinoma in Nude Mice

PubMed Central

Shen, Min; Zhu, Kangshun; Cheng, Du; Liu, Zhihao; Shan, Hong

2013-01-01

RNA interference (RNAi) has significant therapeutic promise for the genetic treatment of hepatocellular carcinoma (HCC). Targeted vectors are able to deliver small interfering RNA (siRNA) into HCC cells with high transfection efficiency and stability. The tripeptide arginine glycine aspartic acid (RGD)-modified non-viral vector, polyethylene glycol-grafted polyethylenimine functionalized with superparamagnetic iron oxide nanoparticles (RGD-PEG-g-PEI-SPION), was constructed as a magnetic resonance imaging (MRI)-visible nanocarrier for the delivery of Survivin siRNA targeting the human HCC cell line Bel-7402. The biophysical characterization of the RGD-PEG-g-PEI-SPION was performed. The RGD-modified complexes exhibited a higher transfection efficiency in transferring Survivin siRNA into Bel-7402 cells compared with a non-targeted delivery system, which resulted in more significant gene suppression at both the Survivin mRNA and protein expression levels. Then, the level of caspase-3 activation was significantly elevated, and a remarkable level of tumor cell apoptosis was induced. As a result, the tumor growth in the nude mice Bel-7402 hepatoma model was significantly inhibited. The targeting ability of the RGD-PEG-g-PEI-SPION was successfully imaged by MRI scans performed in vitro and in vivo. Our results strongly indicated that the RGD-PEG-g-PEI-SPION can potentially be used as a targeted non-viral vector for altering gene expression in the treatment of hepatocellular carcinoma and for detecting the tumor in vivo as an effective MRI probe. PMID:23922634

The effect of myostatin silencing by lentiviral-mediated RNA interference on goat fetal fibroblasts.

PubMed

Lu, Jian; Wei, Caihong; Zhang, Xiaoning; Xu, Lingyang; Zhang, Shifang; Liu, Jiasen; Cao, Jiaxue; Zhao, Fuping; Zhang, Li; Li, Bichun; Du, Lixin

2013-06-01

Myostatin is a transforming growth factor-β family member that acts as a negative regulator of skeletal muscle mass. To identify possible myostatin inhibitors that may promote muscle growth, we used RNA interference mediated by a lentiviral vector to knockdown myostatin in goat fetal fibroblast cells. We also investigated the expression changes in relevant myogenic regulatory factors (MRFs) and adipogenic regulatory factors in the absence of myostatin in goat fetal fibroblasts. Quantitative RT-PCR revealed that myostatin transcripts were significantly reduced by 75 % (P < 0.01). Western blot showed that myostatin protein expression was reduced by 95 % (P < 0.01). We also found that the mRNA expression of activin receptor IIB (ACVR2B) significantly increased by 350 % (P < 0.01), and p21 increased 172 % (P < 0.01). Furthermore, myostatin inhibition decreased Myf5 and increased MEF2C mRNA expression in goat fetal fibroblasts, suggesting that myostatin regulates MRFs differently in fibroblasts compared to muscle. In addition, the expression of adipocyte marker genes peroxisome proliferator-activated receptor (PPAR) γ and leptin, but not CCAAT/enhance-binding protein (C/EBP) α and C/EBPβ, were upregulated at the transcript level after myostatin silencing. These results suggest that we have generated a novel way to block myostatin in vitro, which could be used to improve livestock meat production and gene therapy of musculoskeletal diseases. This also suggests that myostatin plays a negative role in regulating the expression of adipogenesis related genes in goat fetal fibroblasts.

MicroRNA Silencing Improves the Tumor Specificity of Adenoviral Transgene Expression

PubMed Central

Card, Paul B.; Hogg, Richard T.; del Alcazar, Carlos Gil

2012-01-01

Adenoviral technology has been thoroughly evaluated for delivering genetic material to tumor tissue and the surrounding microenvironment. Almost any gene can be cloned into an adenovirus (Ad) vector, which when combined with strong, constitutively active promoters permit up to a million-fold amplification of the transgene in a single adenoviral particle, thus facilitating their use in cancer therapy and imaging. However, widespread infection of the liver and other non-targeted tissues by Ad vectors is a substantial problem that often results in significant liver inflammation and hepatotoxicity at doses required to achieve efficient tumor transduction. miR-122 is a highly expressed liver-specific microRNA that provides a unique opportunity for down-regulating adenoviral transgene expression in liver tissue. The binding of endogenous miRNAs to complementary miRNA targeting elements (miRTs) incorporated into the 3′ untranslated region of adenoviral transgenes interferes with message stability and/or protein translation, and miRT elements against miR-122 (miRT-122) can selectively reduce adenoviral transgene expression in the liver. Previous studies using miR-122-based regulation, with and without other types of transcriptional targeting, have yielded promising preliminary results. However, investigations to date evaluating miRT-122 elements for improving tumor specificity have used either non-tumor bearing animals or direct intratumoral injection as the mode of delivery. In the present study, we confirmed the ability of miRT-122 sequences to selectively down-regulate adenoviral luciferase expression in the liver in vitro and in vivo, and show that this strategy can improve tumor specific transgene expression in a HT1080 human fibrosarcoma model. Rapid growth and the inefficient flow of blood through tumor neovasculature often results in profound hypoxia, which provides additional opportunities for targeting solid tumors and their microenvironment using vectors incorporating hypoxia-responsive promoters to drive transgene expression. We therefore employed a combinatorial approach using miRT-122 elements with hypoxia-responsive transcriptional targeting to further improve the tumor specific expression of an adenoviral reporter gene. Results from this investigation reveal that miRT122 elements alone decrease off-target liver expression and improve tumor specificity of adenoviral vectors. Furthermore, increased tumor specificity can be achieved by combining miRT-122 elements with hypoxia-responsive promoters. PMID:22555510

RNA Interference in Infectious Tropical Diseases

PubMed Central

Hong, Young S.

2008-01-01

Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

Transduction of hematopoietic stem cells to stimulate RNA interference against feline infectious peritonitis.

PubMed

Anis, Eman A; Dhar, Madhu; Legendre, Alfred M; Wilkes, Rebecca P

2017-06-01

Objectives The goals of the study were: (1) to develop and evaluate non-replicating lentivirus vectors coding for feline coronavirus (FCoV)-specific micro (mi)RNA as a potential antiviral therapy for feline infectious peritonitis (FIP); (2) to assess the feasibility of transducing hematopoietic stem cells (HSCs) with ex vivo introduction of the miRNA-expressing lentivirus vector; and (3) to assess the ability of the expressed miRNA to inhibit FCoV replication in HSCs in vitro. Methods HSCs were obtained from feline bone marrow and replicated in vitro. Three lentiviruses were constructed, each expressing a different anti-FCoV miRNA. HSCs were stably transduced with the miRNA-expressing lentivirus vector that produced the most effective viral inhibition in a feline cell line. The effectiveness of the transduction and the expression of anti-FCoV miRNA were tested by infecting the HSCs with two different strains of FCoV. The inhibition of coronavirus replication was determined by relative quantification of the inhibition of intracellular viral genomic RNA synthesis using real-time, reverse-transcription PCR. The assessment of virus replication inhibition was determined via titration of extracellular virus using the TCID 50 assay. Results Inhibition of FCoV was most significant in feline cells expressing miRNA-L2 that targeted the viral leader sequence, 48 h postinfection. miRNA-L2 expression in stably transduced HSCs resulted in 90% and 92% reductions in FIPV WSU 79-1146 genomic RNA synthesis and extracellular virus production, respectively, as well as 74% and 80% reduction in FECV WSU 79-1683 genomic RNA synthesis and extracellular virus production, respectively, as compared with an infected negative control sample producing non-targeting miRNA. Conclusions and relevance These preliminary results show that genetic modification of HSCs for constitutive production of anti-coronavirus miRNA will reduce FCoV replication.

CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.

PubMed

Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun

2014-09-05

Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.

shRNA-Induced Gene Knockdown In Vivo to Investigate Neutrophil Function.

PubMed

Basit, Abdul; Tang, Wenwen; Wu, Dianqing

2016-01-01

To silence genes in neutrophils efficiently, we exploited the RNA interference and developed an shRNA-based gene knockdown technique. This method involves transfection of mouse bone marrow-derived hematopoietic stem cells with retroviral vector carrying shRNA directed at a specific gene. Transfected stem cells are then transplanted into irradiated wild-type mice. After engraftment of stem cells, the transplanted mice have two sets of circulating neutrophils. One set has a gene of interest knocked down while the other set has full complement of expressed genes. This efficient technique provides a unique way to directly compare the response of neutrophils with a knocked-down gene to that of neutrophils with the full complement of expressed genes in the same environment.

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Expression of the proto-oncogene Pokemon in colorectal cancer--inhibitory effects of an siRNA.

PubMed

Zhao, Gan-Ting; Yang, Li-Juan; Li, Xi-Xia; Cui, Hui-Lin; Guo, Rui

2013-01-01

This study aimed to investigate expression of the proto-oncogene POK erythroid myeloid ontogenic factor (Pokemon) in colorectal cancer (CRC), and assess inhibitory effects of a small interference RNA (siRNA) expression vector in SW480 and SW620 cells. Semi-quantitative reverse transcription-polymerase chain reaction (PCR) and immunohistochemistry were performed to determine mRNA and protein expression levels of Pokemon in CRC tissues. Indirect immunofluorescence staining was applied to investigate the location of Pokemon in SW480 and SW620 cells. The siRNA expression vectors that were constructed to express a short hairpin RNA against Pokemon were transfected to the SW480 and SW620 cells with a liposome. Expression levels of Pokemon mRNA and protein were examined by real-time quantitative-fluorescent PCR and western blot analysis. The effects of Pokemon silencing on proliferation of SW480 and SW620 cells were evaluated with reference to growth curves with MTT assays. The mRNA expression level of Pokemon in tumor tissues (0.845 ± 0.344) was significantly higher than that in adjacent tumor specimens (0.321 ± 0.197). The positive expression ratio of Pokemon protein in CRC (87.0%) was significantly higher than that in the adjacent tissues (19.6%). Strong fluorescence staining of Pokemon protein was observed in the cytoplasm of the SW480 and SW620 cells. The inhibition ratios of Pokemon mRNA and protein in the SW480 cells were 83.1% and 73.5% at 48 and 72 h, respectively, compared with those of the negative control cells with the siRNA. In the SW620 cells, the inhibition ratios of Pokemon mRNA and protein were 76.3% and 68.7% at 48 and 72 h, respectively. MTT showed that Pokemon gene silencing inhibited the proliferation of SW480 and SW620 cells. Overexpression of Pokemon in CRC may have a function in carcinogenesis and progression. siRNA expression vectors could effectively inhibit mRNA and protein expression of Pokemon in SW480 and SW620 cells, thereby reducing malignant cell proliferation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carena, Marcela; Liu, Zhen

Heavy scalar and pseudoscalar resonance searches through themore » $$gg\\rightarrow S\\rightarrow t\\bar t$$ process are challenging due to the peculiar behavior of the large interference effects with the standard model $$t\\bar t$$ background. Such effects generate non-trivial lineshapes from additional relative phases between the signal and background amplitudes. We provide the analytic expressions for the differential cross sections to understand the interference effects in the heavy scalar signal lineshapes. We extend our study to the case of CP-violation and further consider the effect of bottom quarks in the production and decay processes. We also evaluate the contributions from additional particles to the gluon fusion production process, such as stops and vector-like quarks, that could lead to significant changes in the behavior of the signal lineshapes. Taking into account the large interference effects, we perform lineshape searches at the LHC and discuss the importance of the systematic uncertainties and smearing effects. Lastly, we present projected sensitivities for two LHC performance scenarios to probe the $$gg\\rightarrow S \\rightarrow t\\bar t$$ channel in various models.« less

Incommensurate smectic order at the free surface in the nematic phase of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2)

NASA Astrophysics Data System (ADS)

Ocko, B. M.; Pershan, P. S.; Safinya, C. R.; Chiang, L. Y.

1987-02-01

We report x-ray reflectivity measurements on the free surface of 4-n-heptylphenyl-4'-(4''-nitrobenzoyloxy)benzoate (DB7NO2) at the nematic to smectic-A phase transition, TNA=99.9 °C. The free surface in the nematic phase exhibits smecticlike ordering at two q vectors, one which is commensurate with the smectic-A monolayer q vector q2. The other q vector is incommensurate corresponding to ordering at ~0.59q2. The commensurate peak constructively interferes with the air-liquid interface while the incommensurate peak destructively interferes. These results are compared with bulk-phase x-ray scattering measurements.

FIVQ algorithm for interference hyper-spectral image compression

NASA Astrophysics Data System (ADS)

Wen, Jia; Ma, Caiwen; Zhao, Junsuo

2014-07-01

Based on the improved vector quantization (IVQ) algorithm [1] which was proposed in 2012, this paper proposes a further improved vector quantization (FIVQ) algorithm for LASIS (Large Aperture Static Imaging Spectrometer) interference hyper-spectral image compression. To get better image quality, IVQ algorithm takes both the mean values and the VQ indices as the encoding rules. Although IVQ algorithm can improve both the bit rate and the image quality, it still can be further improved in order to get much lower bit rate for the LASIS interference pattern with the special optical characteristics based on the pushing and sweeping in LASIS imaging principle. In the proposed algorithm FIVQ, the neighborhood of the encoding blocks of the interference pattern image, which are using the mean value rules, will be checked whether they have the same mean value as the current processing block. Experiments show the proposed algorithm FIVQ can get lower bit rate compared to that of the IVQ algorithm for the LASIS interference hyper-spectral sequences.

Facial expression recognition based on weber local descriptor and sparse representation

NASA Astrophysics Data System (ADS)

Ouyang, Yan

2018-03-01

Automatic facial expression recognition has been one of the research hotspots in the area of computer vision for nearly ten years. During the decade, many state-of-the-art methods have been proposed which perform very high accurate rate based on the face images without any interference. Nowadays, many researchers begin to challenge the task of classifying the facial expression images with corruptions and occlusions and the Sparse Representation based Classification framework has been wildly used because it can robust to the corruptions and occlusions. Therefore, this paper proposed a novel facial expression recognition method based on Weber local descriptor (WLD) and Sparse representation. The method includes three parts: firstly the face images are divided into many local patches, and then the WLD histograms of each patch are extracted, finally all the WLD histograms features are composed into a vector and combined with SRC to classify the facial expressions. The experiment results on the Cohn-Kanade database show that the proposed method is robust to occlusions and corruptions.

RNAi knockdown of oxytocin receptor in the nucleus accumbens inhibits social attachment and parental care in monogamous female prairie voles

PubMed Central

Keebaugh, Alaine C.; Barrett, Catherine E.; LaPrairie, Jamie L.; Jenkins, Jasmine J.; Young, Larry J.

2015-01-01

Oxytocin modulates many aspects of social cognition and behaviors, including maternal nurturing, social recognition and bonding. Natural variation in oxytocin receptor (OXTR) density in the nucleus accumbens (NAcc) is associated with variation in alloparental behavior, and artificially enhancing OXTR expression in the NAcc enhances alloparental behavior and pair bonding in socially monogamous prairie voles. Furthermore, infusion of an OXTR antagonist into the nucleus accumbens (NAcc) inhibits alloparental behavior and partner preference formation. However, antagonists can promiscuously interact with other neuropeptide receptors. To directly examine the role of OXTR signaling in social bonding, we used RNA interference to selectively knockdown, but not eliminate, OXTR in the NAcc of female prairie voles and examined the impact on social behaviors. Using an adeno-associated viral vector expressing a short hairpin RNA (shRNA) targeting Oxtr mRNA, we reduced accumbal OXTR density in female prairie voles from juvenile age through adulthood. Females receiving the shRNA vector displayed a significant reduction in alloparental behavior and disrupted partner preference formation. These are the first direct demonstrations that OXTR plays a critical role in alloparental behavior and adult social attachment, and suggest that natural variation in OXTR expression in this region alone can create variation in social behavior. PMID:25874849

Suppression of the epidermal growth factor receptor inhibits epithelial-mesenchymal transition in human pancreatic cancer PANC-1 cells.

PubMed

Chang, Zhi-Gang; Wei, Jun-Min; Qin, Chang-Fu; Hao, Kun; Tian, Xiao-Dong; Xie, Kun; Xie, Xue-Hai; Yang, Yin-Mo

2012-05-01

Aberrant expression of epidermal growth factor receptor (EGFR) has been detected in pancreatic cancer; however, the mechanisms of EGFR in inducing pancreatic cancer development have not been adequately elucidated. The objective of this study was to determine the role of EGFR in mediating epithelial-mesenchymal transition (EMT) in pancreatic cancer cells. Pancreatic cancer cell line PANC-1 was transfected with small interfering RNA of EGFR by use of a lentiviral expression vector to establish an EGFR-knockdown cell line (si-PANC-1). PANC-1 cells transfected with lentiviral vector expressing negative control sequence were used as negative control (NC-PANC-1). Scratch assay and transwell study were used to analyze cell migration and invasion. Real-time PCR and Western blotting were used to detect the expression of EMT markers E-cadherin, N-cadherin, vimentin, and fibronectin and transcription factors snail, slug, twist1, and sip1 in PANC-1, NC-PANC-1, and si-PANC-1 cells. Immunofluorescent staining with these antibodies and confocal microscopy were used to observe their cellular location and morphologic changes. After RNA interference of EGFR, the migration and invasion ability of si-PANC-1 cells decreased significantly. The expression of epithelial phenotype marker E-cadherin increased and the expression of mesenchymal phenotype markers N-cadherin, vimentin, and fibronectin decreased, indicating reversion of EMT. We also observed intracellular translocation of E-cadherin. Expression of transcription factors snail and slug in si-PANC-1 cells decreased significantly. Suppression of EGFR expression can significantly inhibit EMT of pancreatic cancer PANC-1 cells. The mechanism may be related with the down-regulation of the expression of transcription factors snail and slug.

Role of caspase-9 in the effector caspases and genome expressions, and growth of bovine skeletal myoblasts.

PubMed

Van Ba, Hoa; Hwang, Inho

2014-02-01

Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

Effect of radiofrequency energy emitted from monopolar "Bovie" instruments on cardiac implantable electronic devices.

PubMed

Robinson, Thomas N; Varosy, Paul D; Guillaume, Girard; Dunning, James E; Townsend, Nicole T; Jones, Edward L; Paniccia, Alessandro; Stiegmann, Greg V; Weyer, Christopher; Rozner, Marc A

2014-09-01

The monopolar "Bovie" instrument emits radiofrequency energy that can disrupt the function of other implanted electronic devices through a phenomenon termed electromagnetic interference. The purpose of this study was to quantify the electromagnetic interference occurring on cardiac implantable devices (CIEDs) resulting from monopolar instrument use in common, modifiable clinical scenarios. Three anesthetized pigs underwent CIED placement (1 pacemaker and 2 defibrillators). Electromagnetic interference was quantified when changing the monopolar instrument parameters of generator power, generator mode, surgical technique, orientation of active electrode cord, pathway of current vector, and proximity of active electrode to the CIED. Monopolar instrument parameters that decreased the electromagnetic interference occurring on the CIED included decreasing generator power from 60 W to 30 W (p < 0.001), using cut mode rather than coag mode (p < 0.001), using desiccation technique rather than fulguration technique (p < 0.001), orienting the active electrode cord from the feet rather than across the chest wall (p < 0.001), and avoiding the current vector from crossing the CIED system (p < 0.001). Increasing the distance between the active electrode tool and the CIED system decreased electromagnetic interference occurring on the CIED in a dose-response fashion up to a distance of 10 cm (ANOVA, p < 0.001), after which the magnitude of electromagnetic interference remained constant. Electromagnetic interference occurring on CIEDs resulting from monopolar instruments is minimized by decreasing generator power, using cut mode, using desiccation technique, orienting the active electrode cord from the feet, avoiding the current vector for crossing the CIED system, and increasing the distance between the active electrode and the CIED. Surgeons and operating room staff can minimize electromagnetic interference on CIEDs during monopolar instrument use by accounting for these modifiable clinical factors. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

Elevated guanosine 5'-diphosphate 3'-diphosphate level inhibits bacterial growth and interferes with FtsZ assembly.

PubMed

Yamaguchi, Takayoshi; Iida, Ken-Ichiro; Shiota, Susumu; Nakayama, Hiroaki; Yoshida, Shin-Ichi

2015-12-01

FtsZ, a protein essential for prokaryotic cell division, forms a ring structure known as the Z-ring at the division site. FtsZ has a GTP binding site and is assembled into linear structures in a GTP-dependent manner in vitro. We assessed whether guanosine 5'-diphosphate 3'-diphosphate (ppGpp), a global regulator of gene expression in starved bacteria, affects cell division in Salmonella Paratyphi A. Elevation of intracellular ppGpp levels by using the relA expression vector induced repression of bacterial growth and incorrect FtsZ assembly. We found that FtsZ forms helical structures in the presence of ppGpp by using the GTP binding site; however, ppGpp levels required to form helical structures were at least 20-fold higher than the required GTP levels in vitro. Furthermore, once formed, helical structures did not change to the straight form even after GTP addition. Our data indicate that elevation of the ppGpp level leads to inhibition of bacterial growth and interferes with FtsZ assembly. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Permanent, lowered HLA class I expression using lentivirus vectors with shRNA constructs: Averting cytotoxicity by alloreactive T lymphocytes.

PubMed

Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C

2006-12-01

Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation.

PubMed

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-04-12

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-07-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

Fusions between green fluorescent protein and beta-glucuronidase as sensitive and vital bifunctional reporters in plants.

PubMed

Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P

1998-11-01

By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.

Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

PubMed Central

Huang, Weizhe; He, Ziying

2013-01-01

RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

Primary sensory neuron-specific interference of TRPV1 signaling by adeno-associated virus-encoded TRPV1 peptide aptamer attenuates neuropathic pain

PubMed Central

Xiang, Hongfei; Liu, Zhen; Wang, Fei; Xu, Hao; Roberts, Christopher; Fischer, Gregory; Stucky, Cheryl L; Dean, Caron; Pan, Bin; Hogan, Quinn H; Yu, Hongwei

2017-01-01

Background TRPV1 (transient receptor potential vanilloid subfamily member 1) is a pain signaling channel highly expressed in primary sensory neurons. Attempts for analgesia by systemic TRPV1 blockade produce undesirable side effects, such as hyperthermia and impaired heat pain sensation. One approach for TRPV1 analgesia is to target TRPV1 along the peripheral sensory pathway. Results For functional blockade of TRPV1 signaling, we constructed an adeno-associated virus (AAV) vector expressing a recombinant TRPV1 interfering peptide aptamer, derived from a 38mer tetrameric assembly domain (TAD), encompassing residues 735 to 772 of rat TRPV1, fused to the C-terminus of enhanced green fluorescent protein (EGFP). AAV-targeted sensory neurons expressing EGFP-TAD after vector injection into the dorsal root ganglia (DRG) revealed decreased inward calcium current and diminished intracellular calcium accumulation in response to capsaicin, compared to neurons of naïve or expressing EGFP alone. To examine the potential for treating neuropathic pain, AAV-EGFP-TAD was injected into fourth and fifth lumbar (L) DRGs of rats subjected to neuropathic pain by tibial nerve injury (TNI). Results showed that AAV-directed selective expression of EGFP-TAD in L4/L5 DRG neuron somata, and their peripheral and central axonal projections can limit TNI-induced neuropathic pain behavior, including hypersensitivity to heat and, to a less extent, mechanical stimulation. Conclusion Selective inhibition of TRPV1 activity in primary sensory neurons by DRG delivery of AAV-encoded analgesic interfering peptide aptamers is efficacious in attenuation of neuropathic pain. With further improvements of vector constructs and in vivo application, this approach might have the potential to develop as an alternative gene therapy strategy to treat chronic pain, especially heat hypersensitivity, without complications due to systemic TRPV1 blockade. PMID:28604222

Small silencing RNAs: state-of-the-art.

PubMed

Grimm, Dirk

2009-07-25

Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.

Bacterial delivery of RNAi effectors: transkingdom RNAi.

PubMed

Lage, Hermann; Krühn, Andrea

2010-08-18

RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.

A Coarse Alignment Method Based on Digital Filters and Reconstructed Observation Vectors

PubMed Central

Xu, Xiang; Xu, Xiaosu; Zhang, Tao; Li, Yao; Wang, Zhicheng

2017-01-01

In this paper, a coarse alignment method based on apparent gravitational motion is proposed. Due to the interference of the complex situations, the true observation vectors, which are calculated by the apparent gravity, are contaminated. The sources of the interference are analyzed in detail, and then a low-pass digital filter is designed in this paper for eliminating the high-frequency noise of the measurement observation vectors. To extract the effective observation vectors from the inertial sensors’ outputs, a parameter recognition and vector reconstruction method are designed, where an adaptive Kalman filter is employed to estimate the unknown parameters. Furthermore, a robust filter, which is based on Huber’s M-estimation theory, is developed for addressing the outliers of the measurement observation vectors due to the maneuver of the vehicle. A comprehensive experiment, which contains a simulation test and physical test, is designed to verify the performance of the proposed method, and the results show that the proposed method is equivalent to the popular apparent velocity method in swaying mode, but it is superior to the current methods while in moving mode when the strapdown inertial navigation system (SINS) is under entirely self-contained conditions. PMID:28353682

Vertical amplitude phase structure of a low-frequency acoustic field in shallow water

NASA Astrophysics Data System (ADS)

Kuznetsov, G. N.; Lebedev, O. V.; Stepanov, A. N.

2016-11-01

We obtain in integral and analytic form the relations for calculating the amplitude and phase characteristics of an interference structure of orthogonal projections of the oscillation velocity vector in shallow water. For different frequencies and receiver depths, we numerically study the source depth dependences of the effective phase velocities of an equivalent plane wave, the orthogonal projections of the sound pressure phase gradient, and the projections of the oscillation velocity vector. We establish that at low frequencies in zones of interference maxima, independently of source depth, weakly varying effective phase velocity values are observed, which exceed the sound velocity in water by 5-12%. We show that the angles of arrival of the equivalent plane wave and the oscillation velocity vector in the general case differ; however, they virtually coincide in the zone of the interference maximum of the sound pressure under the condition that the horizontal projections of the oscillation velocity appreciably exceed the value of the vertical projection. We give recommendations on using the sound field characteristics in zones with maximum values for solving rangefinding and signal-detection problems.

Challenges and opportunities for heavy scalar searches in the tt¯ channel at the LHC

DOE PAGES

Carena, Marcela; Liu, Zhen

2016-11-25

Heavy scalar and pseudoscalar resonance searches through themore » $$gg\\rightarrow S\\rightarrow t\\bar t$$ process are challenging due to the peculiar behavior of the large interference effects with the standard model $$t\\bar t$$ background. Such effects generate non-trivial lineshapes from additional relative phases between the signal and background amplitudes. We provide the analytic expressions for the differential cross sections to understand the interference effects in the heavy scalar signal lineshapes. We extend our study to the case of CP-violation and further consider the effect of bottom quarks in the production and decay processes. We also evaluate the contributions from additional particles to the gluon fusion production process, such as stops and vector-like quarks, that could lead to significant changes in the behavior of the signal lineshapes. Taking into account the large interference effects, we perform lineshape searches at the LHC and discuss the importance of the systematic uncertainties and smearing effects. Lastly, we present projected sensitivities for two LHC performance scenarios to probe the $$gg\\rightarrow S \\rightarrow t\\bar t$$ channel in various models.« less

Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

PubMed

Hassan, Ali

2006-06-01

RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

Variation in vasopressin receptor Avpr1a) expression creates diversity in behaviors related to monogamy in prairie voles

PubMed Central

Barrett, Catherine E.; Keebaugh, Alaine C.; Ahern, Todd H.; Bass, Caroline E.; Terwilliger, Ernest F.; Young, Larry J.

2013-01-01

Polymorphisms in noncoding regions of the vasopressin 1a receptor gene (Avpr1a) are associated with a variety of socioemotional characteristics in humans, chimpanzees, and voles, and may impact behavior through site-specific variation in gene expression. The socially monogamous prairie vole offers a unique opportunity to study such neurobiological control of individual differences in complex behavior. Vasopressin 1a receptor (V1aR) signaling is necessary for the formation of the pair bond in males, and prairie voles exhibit greater V1aR binding in the reward-processing ventral pallidum than do asocial voles of the same genus. Diversity in social behavior within prairie voles has been correlated to natural variation in neuropeptide receptor expression in specific brain regions. Here we use RNA interference to examine the causal relationship between intraspecific variation in V1aR and behavioral outcomes, by approximating the degree of naturalistic variation in V1aR expression. Juvenile male prairie voles were injected with viral vectors expressing shRNA sequences targeting Avpr1a mRNA into the ventral pallidum. Down-regulation of pallidal V1aR density resulted in a significant impairment in the preference for a mated female partner and a reduction in anxiety-like behavior in adulthood. No effect on alloparenting was detected. These data demonstrate that within-species naturalistic-like variation in V1aR expression has a profound effect on individual differences in social attachment and emotionality. RNA interference may prove a useful technique to unite the fields of behavioral ecology and neurogenetics to perform ethologically relevant studies of the control of individual variation and offer insight into the evolutionary mechanisms leading to behavioral diversity. PMID:23370363

RNA interference mediated pten knock-down inhibit the formation of polycystic ovary.

PubMed

Ouyang, Jie-Xiu; Luo, Tao; Sun, Hui-Yun; Huang, Jian; Tang, Dan-Feng; Wu, Lei; Zheng, Yue-Hui; Zheng, Li-Ping

2013-08-01

Pten (phosphatase and tensin homolog deleted on chromosome 10), a kind of tumor suppressor gene, plays important roles in female reproductive system. But its expression and roles in the formation of polycystic ovaries are yet to be known. In this study, we constructed a rat model of PCOS using norethindrone and HCG injections and found the expressions of pten mRNA and PTEN protein increased significantly in the polycystic ovary tissue by immunohistochemistry, RT-PCR, and western blot. Furthermore, the results showed that in vivo ovaries could be effectively transfected by lentiviral vectors through the ovarian microinjection method and indicated that pten shRNA may inhibit the formation of polycystic ovaries by pten down-regulation. Our study provides new information regarding the role of PTEN in female reproductive disorders, such as polycystic ovary syndrome.

Effects of AAV-mediated knockdown of nNOS and GPx-1 gene expression in rat hippocampus after traumatic brain injury.

PubMed

Boone, Deborah R; Leek, Jeanna M; Falduto, Michael T; Torres, Karen E O; Sell, Stacy L; Parsley, Margaret A; Cowart, Jeremy C; Uchida, Tatsuo; Micci, Maria-Adelaide; DeWitt, Douglas S; Prough, Donald S; Hellmich, Helen L

2017-01-01

Virally mediated RNA interference (RNAi) to knock down injury-induced genes could improve functional outcome after traumatic brain injury (TBI); however, little is known about the consequences of gene knockdown on downstream cell signaling pathways and how RNAi influences neurodegeneration and behavior. Here, we assessed the effects of adeno-associated virus (AAV) siRNA vectors that target two genes with opposing roles in TBI pathogenesis: the allegedly detrimental neuronal nitric oxide synthase (nNOS) and the potentially protective glutathione peroxidase 1 (GPx-1). In rat hippocampal progenitor cells, three siRNAs that target different regions of each gene (nNOS, GPx-1) effectively knocked down gene expression. However, in vivo, in our rat model of fluid percussion brain injury, the consequences of AAV-siRNA were variable. One nNOS siRNA vector significantly reduced the number of degenerating hippocampal neurons and showed a tendency to improve working memory. GPx-1 siRNA treatment did not alter TBI-induced neurodegeneration or working memory deficits. Nevertheless, microarray analysis of laser captured, virus-infected neurons showed that knockdown of nNOS or GPx-1 was specific and had broad effects on downstream genes. Since nNOS knockdown only modestly ameliorated TBI-induced working memory deficits, despite widespread genomic changes, manipulating expression levels of single genes may not be sufficient to alter functional outcome after TBI.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus.

PubMed

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-12-01

Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions.

Discriminability effect on Garner interference: evidence from recognition of facial identity and expression

PubMed Central

Wang, Yamin; Fu, Xiaolan; Johnston, Robert A.; Yan, Zheng

2013-01-01

Using Garner’s speeded classification task existing studies demonstrated an asymmetric interference in the recognition of facial identity and facial expression. It seems that expression is hard to interfere with identity recognition. However, discriminability of identity and expression, a potential confounding variable, had not been carefully examined in existing studies. In current work, we manipulated discriminability of identity and expression by matching facial shape (long or round) in identity and matching mouth (opened or closed) in facial expression. Garner interference was found either from identity to expression (Experiment 1) or from expression to identity (Experiment 2). Interference was also found in both directions (Experiment 3) or in neither direction (Experiment 4). The results support that Garner interference tends to occur under condition of low discriminability of relevant dimension regardless of facial property. Our findings indicate that Garner interference is not necessarily related to interdependent processing in recognition of facial identity and expression. The findings also suggest that discriminability as a mediating factor should be carefully controlled in future research. PMID:24391609

RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

PubMed

Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

2017-04-01

The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

PubMed

Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

2017-10-01

This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

Effect of chloroquine on gene expression of Plasmodium yoelii nigeriensis during its sporogonic development in the mosquito vector

PubMed Central

Silveira, Henrique; Ramos, Susana; Abrantes, Patrícia; Lopes, Luís Filipe; do Rosario, Virgílio E; Abrahamsen, Mitchell S

2007-01-01

Background The anti-malarial chloroquine can modulate the outcome of infection during the Plasmodium sporogonic development, interfering with Plasmodium gene expression and subsequently, with transmission. The present study sets to identify Plasmodium genes that might be regulated by chloroquine in the mosquito vector. Methods Differential display RT-PCR (DDRT-PCR) was used to identify genes expressed during the sporogonic cycle that are regulated by exposure to chloroquine. Anopheles stephensi mosquitoes were fed on Plasmodium yoelii nigeriensis-infected mice. Three days post-infection, mosquitoes were fed a non-infectious blood meal from mice treated orally with 50 mg/kg chloroquine. Two differentially expressed Plasmodium transcripts (Pyn_chl091 and Pyn_chl055) were further characterized by DNA sequencing and real-time PCR analysis. Results Both transcripts were represented in Plasmodium EST databases, but displayed no homology with any known genes. Pyn_chl091 was upregulated by day 18 post infection when the mosquito had a second blood meal. However, when the effect of chloroquine on that transcript was investigated during the erythrocytic cycle, no significant differences were observed. Although slightly upregulated by chloroquine exposure the expression of Pyn_chl055 was more affected by development, increasing towards the end of the sporogonic cycle. Transcript abundance of Pyn_chl055 was reduced when erythrocytic stages were treated with chloroquine. Conclusion Chloroquine increased parasite load in mosquito salivary glands and interferes with the expression of at least two Plasmodium genes. The transcripts identified contain putative signal peptides and transmembrane domains suggesting that these proteins, due to their location, are targets of chloroquine (not as an antimalarial) probably through cell trafficking and recycling. PMID:17605769

SUMO-Specific Cysteine Protease 1 Promotes Epithelial Mesenchymal Transition of Prostate Cancer Cells via Regulating SMAD4 deSUMOylation

PubMed Central

Zhang, Xiaoyan; Wang, Hao; Wang, Hua; Xiao, Fengjun; Seth, Prem; Xu, Weidong; Jia, Qinghua; Wu, Chutse; Yang, Yuefeng; Wang, Lisheng

2017-01-01

In advanced prostate cancer, small ubiquitin-like modifier (SUMO)-specific cysteine protease 1 (SENP1) is up-regulated. However, the role of SENP1 in regulating deSUMOylation of TGF-β/SMADs signaling is unknown. In this study, we developed a lentiviral vector, PLKO.1-shSENP1, to silence SENP1 in prostate cancer cells with high metastatic characteristics (PC3M). Likewise, we also created an adenovirus vector, Ad5/F11p-SENP1 to over-express SENP1 in prostate cancer cells with low metastatic potential (LNCaP). We showed that silencing of SENP1 promoted cellular apoptosis, and inhibited proliferation and migration of PC3M cells. Moreover, SENP1 silencing increased the SMAD4 expression at protein level, up-regulated E-cadherin and down-regulated Vimentin expression, indicating the inhibition of epithelial mesenchymal transition (EMT). Furthermore, SMAD4 interference abolished SENP1-mediated up-regulation of E-cadherin, suggesting that SENP1 regulated E-cadherin expression via SMAD4. SENP1 over-expression in LNCaP cells reduced SMAD4 protein, and promoted EMT via decreasing E-cadherin and increasing Vimentin. Moreover, down-regulation of SMAD4 and E-cadherin were blocked, after transfection with two SUMOylation sites mutated SMAD4, suggesting that SENP1 might reduce SMAD4 levels to regulate E-cadherin expression via deSUMOylation of SMAD4. In conclusion, SENP1 deSUMOylated SMAD4 to promote EMT via up-regulating E-cadherin in prostate cancer cells. Therefore, SENP1 is a potential target for treatment of advanced prostate cancer. PMID:28417919

[Expression analysis of a transformer gene in Daphnia pulex after RNAi].

PubMed

Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

2016-01-01

In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

Targeted knockout of TNF-α by injection of lentivirus-mediated siRNA into the subacromial bursa for the treatment of subacromial bursitis in rats.

PubMed

Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin

2015-09-01

Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.

[Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

PubMed

Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

2016-01-01

Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

Identification and Expression of the CCAP Receptor in the Chagas’ Disease Vector, Rhodnius prolixus, and Its Involvement in Cardiac Control

PubMed Central

Lee, Dohee; Vanden Broeck, Jozef; Lange, Angela B.

2013-01-01

Rhodnius prolixus is the vector of Chagas’ disease, by virtue of transmitting the parasite Trypanosoma cruzi. There is no cure for Chagas’ disease and therefore controlling R. prolixus is currently the only method of prevention. Understanding the physiology of the disease vector is an important step in developing control measures. Crustacean cardioactive peptide (CCAP) is an important neuropeptide in insects because it has multiple physiological roles such as controlling heart rate and modulating ecdysis behaviour. In this study, we have cloned the cDNA sequence of the CCAP receptor (RhoprCCAPR) from 5th instar R. prolixus and found it to be a G-protein coupled receptor (GPCR). The spatial expression pattern in 5th instars reveals that the RhoprCCAPR transcript levels are high in the central nervous system, hindgut and female reproductive systems, and lower in the salivary glands, male reproductive tissues and a pool of tissues including the dorsal vessel, trachea, and fat body. Interestingly, the RhoprCCAPR expression is increased prior to ecdysis and decreased post-ecdysis. A functional receptor expression assay confirms that the RhoprCCAPR is activated by CCAP (EC50 = 12 nM) but not by adipokinetic hormone, corazonin or an extended FMRFamide. The involvement of CCAP in controlling heartbeat frequency was studied in vivo and in vitro by utilizing RNA interference. In vivo, the basal heartbeat frequency is decreased by 31% in bugs treated with dsCCAPR. Knocking down the receptor in dsCCAPR-treated bugs also resulted in loss of function of applied CCAP in vitro. This is the first report of a GPCR knock-down in R. prolixus and the first report showing that a reduction in CCAPR transcript levels leads to a reduction in cardiac output in any insect. PMID:23874803

Evaluation of vaccine competition using HVT vector vaccines

USDA-ARS?s Scientific Manuscript database

Turkey herpesvirus (HVT) has been widely used as a vaccine for Marek’s disease (MD) since the 1970s. Because HVT is a safe vaccine that is poorly sensitive to interference from maternally derived antibodies, it has seen rising use as a vector for vaccines developed for protection against other comm...

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

RNA interference of carboxyesterases causes nymph mortality in the Asian citrus psyllid, Diaphorina citri.

PubMed

Kishk, Abdelaziz; Anber, Helmy A I; AbdEl-Raof, Tsamoh K; El-Sherbeni, AbdEl-Hakeem D; Hamed, Sobhy; Gowda, Siddarame; Killiny, Nabil

2017-03-01

Asian citrus psyllid, Diaphorina citri Kuwayama (Hemiptera: Liviidae), is an important pest of citrus. In addition, D. citri is the vector of Huanglongbing, a destructive disease in citrus, also known as citrus greening disease caused by Candidatus Liberibacter asiaticus. Huanglongbing causes huge losses for citrus industries. Insecticide application for D. citri is the major strategy to prevent disease spread. The heavy use of insecticides causes development of insecticide resistance. We used RNA interference (RNAi) to silence genes implicated in pesticide resistance in order to increase the susceptibility. The activity of dsRNA to reduce the expression of carboxyesterases including esterases FE4 (EstFE4) and acetylcholinesterases (AChe) in D. citri was investigated. The dsRNA was applied topically to the fourth and fifth instars of nymphs. We targeted several EstFE4 and AChe genes using dsRNA against a consensus sequence for each of them. Five concentrations (25, 50, 75, 100, 125 ng/μl) from both dsRNAs were used. The treatments with the dsRNA caused concentration dependent nymph mortality. The highest gene expression levels of both AChe and EstFE4 were found in the fourth and fifth nymphal instars. Gene expression analysis showed that AChe genes were downregulated in emerged adults from dsRNA-AChe-treated nymphs compared to controls. However, EstFE4 genes were not affected. In the same manner, treatment with dsRNA-EstFE4 reduced expression level of EstFE4 genes in emerged adults from treated nymphs, but did not affect the expression of AChe genes. In the era of environmentally friendly control strategies, RNAi is a new promising venue to reduce pesticide applications. © 2017 Wiley Periodicals, Inc.

Measurement of the topological charge and index of vortex vector optical fields with a space-variant half-wave plate.

PubMed

Liu, Gui-Geng; Wang, Ke; Lee, Yun-Han; Wang, Dan; Li, Ping-Ping; Gou, Fangwang; Li, Yongnan; Tu, Chenghou; Wu, Shin-Tson; Wang, Hui-Tian

2018-02-15

Vortex vector optical fields (VVOFs) refer to a kind of vector optical field with an azimuth-variant polarization and a helical phase, simultaneously. Such a VVOF is defined by the topological index of the polarization singularity and the topological charge of the phase vortex. We present a simple method to measure the topological charge and index of VVOFs by using a space-variant half-wave plate (SV-HWP). The geometric phase grating of the SV-HWP diffracts a VVOF into ±1 orders with orthogonally left- and right-handed circular polarizations. By inserting a polarizer behind the SV-HWP, the two circular polarization states project into the linear polarization and then interfere with each other to form the interference pattern, which enables the direct measurement of the topological charge and index of VVOFs.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression

PubMed Central

Camps, Manel

2010-01-01

ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961

On the time-dependent Aharonov-Bohm effect

NASA Astrophysics Data System (ADS)

Jing, Jian; Zhang, Yu-Fei; Wang, Kang; Long, Zheng-Wen; Dong, Shi-Hai

2017-11-01

The Aharonov-Bohm effect in the background of a time-dependent vector potential is re-examined for both non-relativistic and relativistic cases. Based on the solutions to the Schrodinger and Dirac equations which contain the time-dependent magnetic vector potential, we find that contrary to the conclusions in a recent paper (Singleton and Vagenas 2013 [4]), the interference pattern will be altered with respect to time because of the time-dependent vector potential.

GNSS Space-Time Interference Mitigation and Attitude Determination in the Presence of Interference Signals

PubMed Central

Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

2015-01-01

The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios. PMID:26016909

GNSS space-time interference mitigation and attitude determination in the presence of interference signals.

PubMed

Daneshmand, Saeed; Jahromi, Ali Jafarnia; Broumandan, Ali; Lachapelle, Gérard

2015-05-26

The use of Space-Time Processing (STP) in Global Navigation Satellite System (GNSS) applications is gaining significant attention due to its effectiveness for both narrowband and wideband interference suppression. However, the resulting distortion and bias on the cross correlation functions due to space-time filtering is a major limitation of this technique. Employing the steering vector of the GNSS signals in the filter structure can significantly reduce the distortion on cross correlation functions and lead to more accurate pseudorange measurements. This paper proposes a two-stage interference mitigation approach in which the first stage estimates an interference-free subspace before the acquisition and tracking phases and projects all received signals into this subspace. The next stage estimates array attitude parameters based on detecting and employing GNSS signals that are less distorted due to the projection process. Attitude parameters enable the receiver to estimate the steering vector of each satellite signal and use it in the novel distortionless STP filter to significantly reduce distortion and maximize Signal-to-Noise Ratio (SNR). GPS signals were collected using a six-element antenna array under open sky conditions to first calibrate the antenna array. Simulated interfering signals were then added to the digitized samples in software to verify the applicability of the proposed receiver structure and assess its performance for several interference scenarios.

Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

PubMed Central

Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

2012-01-01

Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

Delivery of gene silencing agents for breast cancer therapy

PubMed Central

2013-01-01

The discovery of RNA interference has opened the door for the development of a new class of cancer therapeutics. Small inhibitory RNA oligos are being designed to specifically suppress expression of proteins that are traditionally considered nondruggable, and microRNAs are being evaluated to exert broad control of gene expression for inhibition of tumor growth. Since most naked molecules are not optimized for in vivo applications, the gene silencing agents need to be packaged into delivery vehicles in order to reach the target tissues as their destinations. Thus, the selection of the right delivery vehicles serves as a crucial step in the development of cancer therapeutics. The current review summarizes the status of gene silencing agents in breast cancer and recent development of candidate cancer drugs in clinical trials. Nanotechnology-based delivery vectors for the formulation and packaging of gene silencing agents are also described. PMID:23659575

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

Stability of Lentiviral Vector-Mediated Transgene Expression in the Brain in the Presence of Systemic Antivector Immune Responses

PubMed Central

ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.

2009-01-01

Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605

Depletion of Pokemon gene inhibits hepatocellular carcinoma cell growth through inhibition of H-ras.

PubMed

Zhang, Quan-Le; Tian, De-An; Xu, Xiang-Jiang

2011-01-01

Pokemon is a transcription repressor which plays a critical role in cell transformation and malignancy. However, little is known about its effect on the development and progression of hepatocellular carcinoma (HCC). The aim of this study was to investigate the expression of Pokemon in human HCC tissues and the biological behavior of Pokemon in HCC cells in which it is overexpressed. We also explored the expression of potential downstream cofactors of Pokemon. Reverse transcription polymerase chain reaction and Western blot analysis were used to investigate the expression of Pokemon in tissues of 30 HCC patients. We then examined cell proliferation or apoptosis and β-catenin or H-ras expression in Pokemon-depleted HepG(2) cells using DNA vector-based RNA interference technology. Pokemon was markedly expressed in 22/30 (73.3%) HCC tissues, with expression levels higher than in adjacent normal liver tissues (p < 0.05); expression is correlated with tumor size. In contrast, depletion of Pokemon inhibited proliferation of HepG(2) or induced apoptosis. Also, H-ras expression decreased to a large extent. Pokemon exerts its oncogenic activity in the development of HCC by promoting cancer cell growth and reducing apoptosis, and the effect may be mediated by H-ras. Copyright © 2011 S. Karger AG, Basel.

Inhibition of myostatin gene expression in skeletal muscle of fish by in vivo electrically mediated dsRNA and shRNAi delivery.

PubMed

Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco

2013-06-01

Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.

An Algorithm for Converting Static Earth Sensor Measurements into Earth Observation Vectors

NASA Technical Reports Server (NTRS)

Harman, R.; Hashmall, Joseph A.; Sedlak, Joseph

2004-01-01

An algorithm has been developed that converts penetration angles reported by Static Earth Sensors (SESs) into Earth observation vectors. This algorithm allows compensation for variation in the horizon height including that caused by Earth oblateness. It also allows pitch and roll to be computed using any number (greater than 1) of simultaneous sensor penetration angles simplifying processing during periods of Sun and Moon interference. The algorithm computes body frame unit vectors through each SES cluster. It also computes GCI vectors from the spacecraft to the position on the Earth's limb where each cluster detects the Earth's limb. These body frame vectors are used as sensor observation vectors and the GCI vectors are used as reference vectors in an attitude solution. The attitude, with the unobservable yaw discarded, is iteratively refined to provide the Earth observation vector solution.

High-level systemic expression of conserved influenza epitope in plants on the surface of rod-shaped chimeric particles.

PubMed

Petukhova, Natalia V; Gasanova, Tatiana V; Ivanov, Peter A; Atabekov, Joseph G

2014-04-21

Recombinant viruses based on the cDNA copy of the tobacco mosaic virus (TMV) genome carrying different versions of the conserved M2e epitope from influenza virus A cloned into the coat protein (CP) gene were obtained and partially characterized by our group previously; cysteines in the human consensus M2e sequence were changed to serine residues. This work intends to show some biological properties of these viruses following plant infections. Agroinfiltration experiments on Nicotiana benthamiana confirmed the efficient systemic expression of M2e peptides, and two point amino acid substitutions in recombinant CPs significantly influenced the symptoms and development of viral infections. Joint expression of RNA interference suppressor protein p19 from tomato bushy stunt virus (TBSV) did not affect the accumulation of CP-M2e-ser recombinant protein in non-inoculated leaves. RT-PCR analysis of RNA isolated from either infected leaves or purified TMV-M2e particles proved the genetic stability of TMV‑based viral vectors. Immunoelectron microscopy of crude plant extracts demonstrated that foreign epitopes are located on the surface of chimeric virions. The rod‑shaped geometry of plant-produced M2e epitopes is different from the icosahedral or helical filamentous arrangement of M2e antigens on the carrier virus-like particles (VLP) described earlier. Thereby, we created a simple and efficient system that employs agrobacteria and plant viral vectors in order to produce a candidate broad-spectrum flu vaccine.

Dengue serotype-specific immune response in Aedes aegypti and Aedes albopictus

PubMed Central

Smartt, Chelsea T; Shin, Dongyoung; Alto, Barry W

2017-01-01

BACKGROUND Dengue viruses (DENV) are considered one of the most important emerging pathogens and dengue disease is a global health threat. The geographic expansion of dengue viruses has led to co-circulation of all four dengue serotypes making it imperative that new DENV control strategies be devised. OBJECTIVES Here we characterize dengue serotype-specific innate immune responses in Aedes aegypti and Aedes albopictus using DENV from Puerto Rico (PR). METHODS Ae. aegypti and Ae. albopictus were infected with dengue serotype 1 and 2 isolated from Puerto Rico. DENV infected mosquito samples were collected and temporal change in expression of selected innate immune response pathway genes analyzed by quantitative real time PCR. FINDINGS The Toll pathway is involved in anti-dengue response in Ae. aegypti, and Ae. albopictus. Infections with PR DENV- 1 elicited a stronger response from genes of the Toll immune pathway than PR DENV-2 in Ae. aegypti but in infected Ae. albopictus expression of Toll pathway genes tended to be similar between the serotypes. Two genes (a ribosomal S5 protein gene and a nimrod-like gene) from Ae. albopictus were expressed in response to DENV. MAIN CONCLUSIONS These studies revealed a role for antiviral genes in DENV serotype-specific interactions with DENV vectors, demonstrated that infections with DENV-2 can modulate the Toll immune response pathway in Ae. aegypti and elucidated candidate molecules that might be used to interfere with serotype specific vector-virus interactions. PMID:29211244

Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

PubMed Central

Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.

1999-01-01

The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005

Assessment of RNAi-induced silencing in banana (Musa spp.).

PubMed

Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

2014-09-18

In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.

Catalase is a determinant of the colonization and transovarial transmission of Rickettsia parkeri in the Gulf Coast tick Amblyomma maculatum.

PubMed

Budachetri, K; Kumar, D; Karim, S

2017-08-01

The Gulf Coast tick (Amblyomma maculatum) has evolved as a competent vector of the spotted-fever group rickettsia, Rickettsia parkeri. In this study, the functional role of catalase, an enzyme responsible for the degradation of toxic hydrogen peroxide, in the colonization of the tick vector by R. parkeri and transovarial transmission of this pathogen to the next tick generation, was investigated. Catalase gene (CAT) expression in midgut, salivary glands and ovarian tissues exhibited a 2-11-fold increase in transcription level upon R. parkeri infection. Depletion of CAT transcripts using an RNA-interference approach significantly reduced R. parkeri infection levels in midgut and salivary gland tissues by 53-63%. The role of CAT in transovarial transmission of R. parkeri was confirmed by simultaneously blocking the transcript and the enzyme by injecting double-stranded RNA for CAT and a catalase inhibitor (3-amino-1,2,4-triazole) into gravid females. Simultaneous inhibition of the CAT transcript and the enzyme significantly reduced the egg conversion ratio with a 44% reduction of R. parkeri transovarial transmission. These data suggest that catalase is required for rickettsial colonization of the tick vector and transovarial transmission to the next generation. © 2017 The Royal Entomological Society.

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

Flexible and inflexible task sets: asymmetric interference when switching between emotional expression, sex, and age classification of perceived faces.

PubMed

Schuch, Stefanie; Werheid, Katja; Koch, Iring

2012-01-01

The present study investigated whether the processing characteristics of categorizing emotional facial expressions are different from those of categorizing facial age and sex information. Given that emotions change rapidly, it was hypothesized that processing facial expressions involves a more flexible task set that causes less between-task interference than the task sets involved in processing age or sex of a face. Participants switched between three tasks: categorizing a face as looking happy or angry (emotion task), young or old (age task), and male or female (sex task). Interference between tasks was measured by global interference and response interference. Both measures revealed patterns of asymmetric interference. Global between-task interference was reduced when a task was mixed with the emotion task. Response interference, as measured by congruency effects, was larger for the emotion task than for the nonemotional tasks. The results support the idea that processing emotional facial expression constitutes a more flexible task set that causes less interference (i.e., task-set "inertia") than processing the age or sex of a face.

RNA interference of pax2 inhibits growth of transplanted human endometrial cancer cells in nude mice

PubMed Central

Zhang, Li-Ping; Shi, Xiao-Yan; Zhao, Chang-Yin; Liu, Yong-Zhen; Cheng, Ping

2011-01-01

The development of human endometrial carcinoma (HEC) is a complex pathologic process involves several oncogenes and tumor suppressor genes. The full-length paired-box gene 2 (pax2), a recently discovered Oncogene, promotes cell proliferation and growth and inhibits apoptosis of HEC cells. Here, we examined the effect of pax2 small interfering RNA (siRNA) on the growth of transplanted HEC cells in nude mice. The expression of Pax2 in 21 cases of normal endometrium and 38 cases of HEC was examined by immohistochemistry (IHC). HEC models were developed by subcutaneously transferring HEC cells into nude mice, followed by treatment with empty lentivirus vector, lentivirus vector-based pax2 siRNA, and phosphate buffered saline, respectively. Four weeks later, tumor size was measured, tumor inhibition rate was calculated, and histological analyses were conducted after staining with hematoxylin and eosin. The expression of Pax2 and Bcl-2 was detected by Western blot; proliferating cell nuclear antigen (PCNA) was detected by IHC. Significant differences were observed in the positive rate of Pax2 between normal endometrium and HEC (14.2% vs. 60.5%, P < 0.01). The expression index of Pax2 in well differentiated tumors was 1.88 ± 1.68, much lower than that in tumors of moderate (3.07 ± 1.96, P < 0.05) or poor differentiation (5.45 ± 2.76, P < 0.01). Tumor necrosis increased, nuclear basophilia stain decreased, tumor growth was inhibited, and PCNA, Pax2, and Bcl-2 expression was reduced in HEC models treated with pax2 siRNA. These results indicate that Pax2 expression is related to HEC tumor biology with the increased expression of Pax2 correlated to malignancy. pax2 siRNA down-regulates Pax2 expression and inhibits tumorigenesis of HEC in nude mice, possibly due to cell apoptosis and the inhibition of tumor proliferation induced by down-regulation of Bcl-2. PMID:21627862

Subspace-based interference removal methods for a multichannel biomagnetic sensor array.

PubMed

Sekihara, Kensuke; Nagarajan, Srikantan S

2017-10-01

In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

Subspace-based interference removal methods for a multichannel biomagnetic sensor array

NASA Astrophysics Data System (ADS)

Sekihara, Kensuke; Nagarajan, Srikantan S.

2017-10-01

Objective. In biomagnetic signal processing, the theory of the signal subspace has been applied to removing interfering magnetic fields, and a representative algorithm is the signal space projection algorithm, in which the signal/interference subspace is defined in the spatial domain as the span of signal/interference-source lead field vectors. This paper extends the notion of this conventional (spatial domain) signal subspace by introducing a new definition of signal subspace in the time domain. Approach. It defines the time-domain signal subspace as the span of row vectors that contain the source time course values. This definition leads to symmetric relationships between the time-domain and the conventional (spatial-domain) signal subspaces. As a review, this article shows that the notion of the time-domain signal subspace provides useful insights over existing interference removal methods from a unified perspective. Main results and significance. Using the time-domain signal subspace, it is possible to interpret a number of interference removal methods as the time domain signal space projection. Such methods include adaptive noise canceling, sensor noise suppression, the common temporal subspace projection, the spatio-temporal signal space separation, and the recently-proposed dual signal subspace projection. Our analysis using the notion of the time domain signal space projection reveals implicit assumptions these methods rely on, and shows that the difference between these methods results only from the manner of deriving the interference subspace. Numerical examples that illustrate the results of our arguments are provided.

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Contextual interference processing during fast categorisations of facial expressions.

PubMed

Frühholz, Sascha; Trautmann-Lengsfeld, Sina A; Herrmann, Manfred

2011-09-01

We examined interference effects of emotionally associated background colours during fast valence categorisations of negative, neutral and positive expressions. According to implicitly learned colour-emotion associations, facial expressions were presented with colours that either matched the valence of these expressions or not. Experiment 1 included infrequent non-matching trials and Experiment 2 a balanced ratio of matching and non-matching trials. Besides general modulatory effects of contextual features on the processing of facial expressions, we found differential effects depending on the valance of target facial expressions. Whereas performance accuracy was mainly affected for neutral expressions, performance speed was specifically modulated by emotional expressions indicating some susceptibility of emotional expressions to contextual features. Experiment 3 used two further colour-emotion combinations, but revealed only marginal interference effects most likely due to missing colour-emotion associations. The results are discussed with respect to inherent processing demands of emotional and neutral expressions and their susceptibility to contextual interference.

Transverse spin in the scattering of focused radially and azimuthally polarized vector beams

NASA Astrophysics Data System (ADS)

Singh, Ankit Kumar; Saha, Sudipta; Gupta, Subhasish Dutta; Ghosh, Nirmalya

2018-04-01

We study the effect of focusing of the radially and azimuthally polarized vector beams on the spin angular momentum (SAM) density and Poynting vector of scattered waves from a Mie particle. Remarkably, the study reveals that the SAM density of the scattered field is solely transverse in nature for radially and azimuthally polarized incident vector beams; however, the Poynting vector shows the usual longitudinal character. We also demonstrate that the transverse SAM density can further be tuned with wavelength and focusing of the incident beam by exploiting the interference of different scattering modes. These results may stimulate further experimental techniques to detect the transverse spin and Belinfante's spin-momentum densities.

Silencing the myotrophin gene by RNA interference leads to the regression of cardiac hypertrophy.

PubMed

Gupta, Sudhiranjan; Maitra, Ratan; Young, Dave; Gupta, Anasuya; Sen, Subha

2009-08-01

Myotrophin-induced activation of NF-kappaB has been shown to be associated with cardiac hypertrophy (CH) that progresses to heart failure (HF). In the present study, we examined the cause-and-effect relationship between myotrophin and NF-kappaB activation using small hairpin RNA (shRNA) against myotrophin both in vitro (using neonatal rat myocytes) and in vivo [using myotrophin transgenic (Myo-Tg) mice, which overexpress myotrophin in the heart, develop CH, and gradually progress to HF]. Among several lentiviral vectors expressing myotrophin shRNAs, L-sh-109 showed the best silencing effect at both the mRNA (155.3 +/- 5.9 vs. 32.5 +/- 5.5, P < 0.001) and protein levels associated with a significant reduction of atrial natriuretic factor (ANF) and NF-kappaB. In vivo, when L-sh-109 was delivered directly into the hearts of 10-wk-old Myo-Tg mice, we observed a significant regression of cardiac mass (8.0 vs. 5.7 mg/g, P < 0.001) and myotrophin gene expression (54.5% over untreated Myo-Tg mice, P < 0.001) associated with a reduction in ANF and NF-kappaB signaling components. Our data suggest that using RNA interference to silence the myotrophin gene prevents NF-kappaB activation, associated with an attenuation of CH. This strategy could be an excellent therapeutic means for the treatment of CH and HF.

Inhibition of CD147 expression by RNA interference reduces proliferation, invasion and increases chemosensitivity in cancer stem cell-like HT-29 cells.

PubMed

Chen, Jie; Pan, Yuqin; He, Bangshun; Ying, Houqun; Wang, Feng; Sun, Huiling; Deng, Qiwen; Liu, Xian; Lin, Kang; Peng, Hongxin; Cho, William C; Wang, Shukui

2015-10-01

The association between CD147 and cancer stem cells (CSCs) provides a new angle for cancer treatments. The aim of this study was to investigate the biological roles of CD147 in colorectal CSCs. The Oct4-green fluorescent protein (GFP) vector was used to isolate CSCs and pYr-mir30-shRNA was used to generate short hairpin RNA (shRNA) specifically for CD147. After RNA interference (RNAi), CD147 was evaluated by reverse transcription‑quantitative PCR and western blot analysis, and its biological functions were assessed by MTT and invasion assays. The results showed that the differentiation of isolated CSC-like HT-29 cells was blocked and these cells were highly positive for CD44 and CD147. RNAi-mediated CD147 silencing reduced the expression of CD147 at both mRNA and protein levels. Moreover, the activities of proliferation and invasion were decreased obviously in CSCs. Knockdown of CD147 increased the chemosensitivity of CSC-like cells to gemcitabine, cisplatin, docetaxel at 0.1, 1 and 10 µM respectively, however, there was no significant difference among the three groups to paclitaxel at 10 µM. In conclusion, these results suggest that CD147 plays an important role in colorectal CSCs and might be regarded as a novel CSC-specific targeted strategy against colorectal cancer.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inoh, Yoshikazu; Furuno, Tadahide; Hirashima, Naohide

Highlights: Black-Right-Pointing-Pointer We use MEL-A-containing cationic liposomes for siRNA delivery. Black-Right-Pointing-Pointer MEL-A-containing cationic liposomes can efficiently and rapidly deliver siRNA into the cytoplasm. Black-Right-Pointing-Pointer Rapid delivery of siRNA is due to the membrane fusion between liposomes and plasma membrane. -- Abstract: The downregulation of gene expression by RNA interference holds great potential for genetic analysis and gene therapy. However, a more efficient delivery system for small interfering RNA (siRNA) into the target cells is required for wide fields such as cell biology, physiology, and clinical application. Non-viral vectors are stronger candidates than viral vectors because they are safer and easiermore » to prepare. We have previously used a new method for gene transfection by combining cationic liposomes with the biosurfactant mannosylerythritol lipid-A (MEL-A). The novel MEL-A-containing cationic liposomes rapidly delivered DNA (plasmids and oligonucleotides) into the cytosol and nucleus through membrane fusion between liposomes and the plasma membrane, and consequently, enhanced the gene transfection efficiency. In this study, we determined the efficiency of MEL-A-containing cationic liposomes for siRNA delivery. We observed that exogenous and endogenous protein expression was suppressed by approximately 60% at 24 h after brief (30 min) incubation of target cells with MEL-A-containing cationic liposome/siRNA complexes. Confocal microscopic analysis showed that suppression of protein expression was caused by rapid siRNA delivery into the cytosol. We found that the MEL-A-containing cationic liposomes directly delivered siRNA into the cytoplasm by the membrane fusion in addition to endocytotic pathway whereas Lipofectamine Trade-Mark-Sign RNAiMax delivered siRNA only by the endocytotic pathway. It seems that the ability to rapidly and directly deliver siRNA into the cytosol using MEL-A-containing cationic liposomes is able to reduce immune responses, cytotoxicity, and other side effects caused by viral vectors in clinical applications.« less

Field applications of stand-off sensing using visible/NIR multivariate optical computing

NASA Astrophysics Data System (ADS)

Eastwood, DeLyle; Soyemi, Olusola O.; Karunamuni, Jeevanandra; Zhang, Lixia; Li, Hongli; Myrick, Michael L.

2001-02-01

12 A novel multivariate visible/NIR optical computing approach applicable to standoff sensing will be demonstrated with porphyrin mixtures as examples. The ultimate goal is to develop environmental or counter-terrorism sensors for chemicals such as organophosphorus (OP) pesticides or chemical warfare simulants in the near infrared spectral region. The mathematical operation that characterizes prediction of properties via regression from optical spectra is a calculation of inner products between the spectrum and the pre-determined regression vector. The result is scaled appropriately and offset to correspond to the basis from which the regression vector is derived. The process involves collecting spectroscopic data and synthesizing a multivariate vector using a pattern recognition method. Then, an interference coating is designed that reproduces the pattern of the multivariate vector in its transmission or reflection spectrum, and appropriate interference filters are fabricated. High and low refractive index materials such as Nb2O5 and SiO2 are excellent choices for the visible and near infrared regions. The proof of concept has now been established for this system in the visible and will later be extended to chemicals such as OP compounds in the near and mid-infrared.

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Asian Citrus Psyllid Expression Profiles Suggest Candidatus Liberibacter Asiaticus-Mediated Alteration of Adult Nutrition and Metabolism, and of Nymphal Development and Immunity

PubMed Central

He, Ruifeng; Nelson, William; Yin, Guohua; Cicero, Joseph M.; Willer, Mark; Kim, Ryan; Kramer, Robin; May, Greg A.; Crow, John A.; Soderlund, Carol A.; Gang, David R.; Brown, Judith K.

2015-01-01

The Asian citrus psyllid (ACP) Diaphorina citri Kuwayama (Hemiptera: Psyllidae) is the insect vector of the fastidious bacterium Candidatus Liberibacter asiaticus (CLas), the causal agent of citrus greening disease, or Huanglongbing (HLB). The widespread invasiveness of the psyllid vector and HLB in citrus trees worldwide has underscored the need for non-traditional approaches to manage the disease. One tenable solution is through the deployment of RNA interference technology to silence protein-protein interactions essential for ACP-mediated CLas invasion and transmission. To identify psyllid interactor-bacterial effector combinations associated with psyllid-CLas interactions, cDNA libraries were constructed from CLas-infected and CLas-free ACP adults and nymphs, and analyzed for differential expression. Library assemblies comprised 24,039,255 reads and yielded 45,976 consensus contigs. They were annotated (UniProt), classified using Gene Ontology, and subjected to in silico expression analyses using the Transcriptome Computational Workbench (TCW) (http://www.sohomoptera.org/ACPPoP/). Functional-biological pathway interpretations were carried out using the Kyoto Encyclopedia of Genes and Genomes databases. Differentially expressed contigs in adults and/or nymphs represented genes and/or metabolic/pathogenesis pathways involved in adhesion, biofilm formation, development-related, immunity, nutrition, stress, and virulence. Notably, contigs involved in gene silencing and transposon-related responses were documented in a psyllid for the first time. This is the first comparative transcriptomic analysis of ACP adults and nymphs infected and uninfected with CLas. The results provide key initial insights into host-parasite interactions involving CLas effectors that contribute to invasion-virulence, and to host nutritional exploitation and immune-related responses that appear to be essential for successful ACP-mediated circulative, propagative CLas transmission. PMID:26091106

Ectopic Expression of Xylella fastidiosa rpfF Conferring Production of Diffusible Signal Factor in Transgenic Tobacco and Citrus Alters Pathogen Behavior and Reduces Disease Severity.

PubMed

Caserta, R; Souza-Neto, R R; Takita, M A; Lindow, S E; De Souza, A A

2017-11-01

The pathogenicity of Xylella fastidiosa is associated with its ability to colonize the xylem of host plants. Expression of genes contributing to xylem colonization are suppressed, while those necessary for insect vector acquisition are increased with increasing concentrations of diffusible signal factor (DSF), whose production is dependent on RpfF. We previously demonstrated that transgenic citrus plants ectopically expressing rpfF from a citrus strain of X. fastidiosa subsp. pauca exhibited less susceptibility to Xanthomonas citri subsp. citri, another pathogen whose virulence is modulated by DSF accumulation. Here, we demonstrate that ectopic expression of rpfF in both transgenic tobacco and sweet orange also confers a reduction in disease severity incited by X. fastidiosa and reduces its colonization of those plants. Decreased disease severity in the transgenic plants was generally associated with increased expression of genes conferring adhesiveness to the pathogen and decreased expression of genes necessary for active motility, accounting for the reduced population sizes achieved in the plants, apparently by limiting pathogen dispersal through the plant. Plant-derived DSF signal molecules in a host plant can, therefore, be exploited to interfere with more than one pathogen whose virulence is controlled by DSF signaling.

Differentially Expressed Genes Associated with Low-Dose Gamma Radiation

NASA Astrophysics Data System (ADS)

Hegyesi, Hargita; Sándor, Nikolett; Schilling, Boglárka; Kis, Enikő; Lumniczky, Katalin; Sáfrány, Géza

We have studied low dose radiation induced gene expression alterations in a primary human fibroblast cell line using Agilent's whole human genome microarray. Cells were irradiated with 60Co γ-rays (0; 0.1; 0.5 Gy) and 2 hours later total cellular RNA was isolated. We observed differential regulation of approximately 300-500 genes represented on the microarray. Of these, 126 were differentially expressed at both doses, among them significant elevation of GDF-15 and KITLG was confirmed by qRT-PCR. Based on the transcriptional studies we selected GDF-15 to assess its role in radiation response, since GDF-15 is one of the p53 gene targets and is believed to participate in mediating p53 activities. First we confirmed gamma-radiation induced dose-dependent changes in GDF-15 expression by qRT-PCR. Next we determined the effect of GDF-15 silencing on radiosensitivity. Four GDF-15 targeting shRNA expressing lentiviral vectors were transfected into immortalized human fibroblast cells. We obtained efficient GDF-15 silencing in one of the four constructs. RNA interference inhibited GDF-15 gene expression and enhanced the radiosensitivity of the cells. Our studies proved that GDF-15 plays an essential role in radiation response and may serve as a promising target in radiation therapy.

Combination of RNA interference and virus receptor trap exerts additive antiviral activity in coxsackievirus B3-induced myocarditis in mice.

PubMed

Stein, Elisabeth A; Pinkert, Sandra; Becher, Peter Moritz; Geisler, Anja; Zeichhardt, Heinz; Klopfleisch, Robert; Poller, Wolfgang; Tschöpe, Carsten; Lassner, Dirk; Fechner, Henry; Kurreck, Jens

2015-02-15

Coxsackievirus B3 (CVB3) is a major heart pathogen against which no therapy exists to date. The potential of a combination treatment consisting of a proteinaceous virus receptor trap and an RNA interference-based component to prevent CVB3-induced myocarditis was investigated. A soluble variant of the extracellular domain of the coxsackievirus-adenovirus receptor (sCAR-Fc) was expressed from an adenoviral vector and 2 short hairpin RNAs (shRdRp2.4) directed against CVB3 were delivered by an adeno-associated virus (AAV) vector. Cell culture experiments revealed additive antiviral activity of the combined application. In a CVB3-induced mouse myocarditis model, both components applied individually significantly reduced inflammation and viral load in the heart. The combination exerted an additive antiviral effect and reduced heart pathology. Hemodynamic measurement revealed that infection with CVB3 resulted in impaired heart function, as illustrated by a drastically reduced cardiac output and impaired contractility and relaxation. Treatment with either sCAR-Fc or shRdRp2.4 significantly improved these parameters. Importantly, the combination of both components led to a further significant improvement of heart function. Combination of sCAR-Fc and shRdRp2.4 exerted additive effects and was significantly more effective than either of the single treatments in inhibiting CVB3-induced myocarditis and preventing cardiac dysfunction. © The Author 2014. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

General expressions for downlink signal to interference and noise ratio in homogeneous and heterogeneous LTE-Advanced networks.

PubMed

Ali, Nora A; Mourad, Hebat-Allah M; ElSayed, Hany M; El-Soudani, Magdy; Amer, Hassanein H; Daoud, Ramez M

2016-11-01

The interference is the most important problem in LTE or LTE-Advanced networks. In this paper, the interference was investigated in terms of the downlink signal to interference and noise ratio (SINR). In order to compare the different frequency reuse methods that were developed to enhance the SINR, it would be helpful to have a generalized expression to study the performance of the different methods. Therefore, this paper introduces general expressions for the SINR in homogeneous and in heterogeneous networks. In homogeneous networks, the expression was applied for the most common types of frequency reuse techniques: soft frequency reuse (SFR) and fractional frequency reuse (FFR). The expression was examined by comparing it with previously developed ones in the literature and the comparison showed that the expression is valid for any type of frequency reuse scheme and any network topology. Furthermore, the expression was extended to include the heterogeneous network; the expression includes the problem of co-tier and cross-tier interference in heterogeneous networks (HetNet) and it was examined by the same method of the homogeneous one.

A Cysteine Protease Is Critical for Babesia spp. Transmission in Haemaphysalis Ticks

PubMed Central

Tsuji, Naotoshi; Miyoshi, Takeharu; Battsetseg, Badger; Matsuo, Tomohide; Xuan, Xuenan; Fujisaki, Kozo

2008-01-01

Vector ticks possess a unique system that enables them to digest large amounts of host blood and to transmit various animal and human pathogens, suggesting the existence of evolutionally acquired proteolytic mechanisms. We report here the molecular and reverse genetic characterization of a multifunctional cysteine protease, longipain, from the babesial parasite vector tick Haemaphysalis longicornis. Longipain shares structural similarity with papain-family cysteine proteases obtained from invertebrates and vertebrates. Endogenous longipain was mainly expressed in the midgut epithelium and was specifically localized at lysosomal vacuoles and possibly released into the lumen. Its expression was up-regulated by host blood feeding. Enzymatic functional assays using in vitro and in vivo substrates revealed that longipain hydrolysis occurs over a broad range of pH and temperature. Haemoparasiticidal assays showed that longipain dose-dependently killed tick-borne Babesia parasites, and its babesiacidal effect occurred via specific adherence to the parasite membranes. Disruption of endogenous longipain by RNA interference revealed that longipain is involved in the digestion of the host blood meal. In addition, the knockdown ticks contained an increased number of parasites, suggesting that longipain exerts a killing effect against the midgut-stage Babesia parasites in ticks. Our results suggest that longipain is essential for tick survival, and may have a role in controlling the transmission of tick-transmittable Babesia parasites. PMID:18483546

Summary of bi-shRNA/GM-CSF augmented autologous tumor cell immunotherapy (FANG™) in advanced cancer of the liver.

PubMed

Nemunaitis, John; Barve, Minal; Orr, Douglas; Kuhn, Joseph; Magee, Mitchell; Lamont, Jeffrey; Bedell, Cynthia; Wallraven, Gladice; Pappen, Beena O; Roth, Alyssa; Horvath, Staci; Nemunaitis, Derek; Kumar, Padmasini; Maples, Phillip B; Senzer, Neil

2014-01-01

Therapies for advanced hepatocellular carcinoma (HCC) are limited. We carried out a phase I trial of a novel autologous whole-cell tumor cell immunotherapy (FANG™), which incorporates a dual granulocyte macrophage colony-stimulating factor (GM-CSF) expressive/bifunctional small hairpin RNA interference (bi-shRNAi) vector. The bi-shRNAi DNA targets furin, which is a proconvertase of transforming growth factors beta (TGFβ) 1 and 2. Safety, mechanism, immunoeffectiveness, and suggested benefit were previously shown [Senzer et al.: Mol Ther 2012;20:679-689; Senzer et al.: J Vaccines Vaccin 2013;4:209]. We now provide further follow-up of a subset of 8 HCC patients. FANG manufacturing was successful in 7 of 8 attempts (one failure due to insufficient cell yield). Median GM-CSF expression was 144 pg/10(6) cells, TGFβ1 knockdown was 100%, and TGFβ2 knockdown was 93% of the vector-transported cells. Five patients were vaccinated (1 or 2.5×10(7) cells/intradermal injection, 6-11 vaccinations). No FANG toxicity was observed. Three of these patients demonstrated evidence of an immune response to the autologous tumor cell sample. Long-term follow-up demonstrated survival of 319, 729, 784, 931+, and 1,043+ days of the FANG-treated patients. In conclusion, evidence supports further assessment of the FANG immunotherapy in HCC. © 2014 S. Karger AG, Basel.

Effects of protein tyrosine phosphatase-PEST are reversed by Akt in T cells.

PubMed

Arimura, Yutaka; Shimizu, Kazuhiko; Koyanagi, Madoka; Yagi, Junji

2014-12-01

T cell activation is regulated by a balance between phosphorylation and dephosphorylation that is under the control of kinases and phosphatases. Here, we examined the role of a non-receptor-type protein tyrosine phosphatase, PTP-PEST, using retrovirus-mediated gene transduction into murine T cells. Based on observations of vector markers (GFP or Thy1.1), exogenous PTP-PEST-positive CD4(+) T cells appeared within 2 days after gene transduction; the percentage of PTP-PEST-positive cells tended to decrease during a resting period in the presence of IL-2 over the next 2 days. These vector markers also showed much lower expression intensities, compared with control cells, suggesting a correlation between the percent reduction and the low marker expression intensity. A catalytically inactive PTP-PEST mutant also showed the same tendency, and stepwise deletion mutants gradually lost their ability to induce the above phenomenon. On the other hand, these PTP-PEST-transduced cells did not have an apoptotic phenotype. No difference in the total cell numbers was found in the wells of a culture plate containing VEC- and PTP-PEST-transduced T cells. Moreover, serine/threonine kinase Akt, but not the anti-apoptotic molecules Bcl-2 and Bcl-XL, reversed the phenotype induced by PTP-PEST. We discuss the novel mechanism by which Akt interferes with PTP-PEST. Copyright © 2014 Elsevier Inc. All rights reserved.

Analysis of expressed sequence tags for Frankliniella occidentalis, the western flower thrips.

PubMed

Rotenberg, D; Whitfield, A E

2010-08-01

Thrips are members of the insect order Thysanoptera and Frankliniella occidentalis (the western flower thrips) is the most economically important pest within this order. F. occidentalis is both a direct pest of crops and an efficient vector of plant viruses, including Tomato spotted wilt virus (TSWV). Despite the world-wide importance of thrips in agriculture, there is little knowledge of the F. occidentalis genome or gene functions at this time. A normalized cDNA library was constructed from first instar thrips and 13 839 expressed sequence tags (ESTs) were obtained. Our EST data assembled into 894 contigs and 11 806 singletons (12 700 nonredundant sequences). We found that 31% of these sequences had significant similarity (E< or = 10(-10)) to protein sequences in the National Center for Biotechnology Information nonredundant (nr) protein database, and 25% were functionally annotated using Blast 2GO. We identified 74 sequences with putative homology to proteins associated with insect innate immunity. Sixteen sequences had significant similarity to proteins associated with small RNA-mediated gene silencing pathways (RNA interference; RNAi), including the antiviral pathway (short interfering RNA-mediated pathway). Our EST collection provides new sequence resources for characterizing gene functions in F. occidentalis and other thrips species with regards to vital biological processes, studying the mechanism of interactions with the viruses harboured and transmitted by the vector, and identifying new insect gene-centred targets for plant disease and insect control.

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Combine EPR and two-slit experiments: Interference of advanced waves

NASA Astrophysics Data System (ADS)

Klyshko, D. N.

1988-10-01

A nonclassical interference effect, using two-photon correlations in nonlinear optical interactions, is discussed. The apparent nonlocality could be conveniently interpreted in terms of advanced waves, emitted by one detector toward the other. A new Bell-type experiment is proposed, in which the measured photon's parameter is the wave-vector (instead of the polarisation), so that the observable can take more than two possible values.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

[Improvement and the mechanism of cardiac function by knockdown of ADAM10 in adriamycin-induced cardiomyopathy rats].

PubMed

Li, Xiaoou; Xie, Lili; He, Bing; Huang, Wei

2018-01-01

Objective To study the role of a disintegrin and metalloproteinase10 (ADAM10) in shedding neural cadherin (N-cadherin) and develop an approach to interfere the process of ventricular remodeling in adriamycin-induced cardiomyopathy (ACM) rats. Methods In a rat model of ACM, the effects of intraperitoneal injection of the lentiviral RNAi vector of ADAM10 on the morphology of cardiomyocytes and contractile function were observed by HE staining and color Doppler echocardiography. The expressions of N-cadherin and C-terminal fragment 1 (CTF1) were detected by Western blotting and immunohistochemistry. Results In the in vivo experiment, a large amount of fluorescence was seen in the isolated primary cardiomyocytes, which indicated that the transfection in the rat model was successful. In the treatment group, the morphology of cardiomyocytes and function of the heart were evidently improved, N-cadherin protein expression was remarkably up-regulated and CTF1 protein was obviously down-regulated compared with the model group. Conclusion Knock-down of ADAM10 increases N-cadherin expression and decreases CTF1 expression, thus improves cardiac function in the rat model of ACM.

RNA viruses and microRNAs: challenging discoveries for the 21st century

PubMed Central

Swaminathan, Gokul; Martin-Garcia, Julio

2013-01-01

RNA viruses represent the predominant cause of many clinically relevant viral diseases in humans. Among several evolutionary advantages acquired by RNA viruses, the ability to usurp host cellular machinery and evade antiviral immune responses is imperative. During the past decade, RNA interference mechanisms, especially microRNA (miRNA)-mediated regulation of cellular protein expression, have revolutionized our understanding of host-viral interactions. Although it is well established that several DNA viruses express miRNAs that play crucial roles in their pathogenesis, expression of miRNAs by RNA viruses remains controversial. However, modulation of the miRNA machinery by RNA viruses may confer multiple benefits for enhanced viral replication and survival in host cells. In this review, we discuss the current literature on RNA viruses that may encode miRNAs and the varied advantages of engineering RNA viruses to express miRNAs as potential vectors for gene therapy. In addition, we review how different families of RNA viruses can alter miRNA machinery for productive replication, evasion of antiviral immune responses, and prolonged survival. We underscore the need to further explore the complex interactions of RNA viruses with host miRNAs to augment our understanding of host-virus interplay. PMID:24046280

RNAi-mediated endogene silencing in strawberry fruit: detection of primary and secondary siRNAs by deep sequencing.

PubMed

Härtl, Katja; Kalinowski, Gregor; Hoffmann, Thomas; Preuss, Anja; Schwab, Wilfried

2017-05-01

RNA interference (RNAi) has been exploited as a reverse genetic tool for functional genomics in the nonmodel species strawberry (Fragaria × ananassa) since 2006. Here, we analysed for the first time different but overlapping nucleotide sections (>200 nt) of two endogenous genes, FaCHS (chalcone synthase) and FaOMT (O-methyltransferase), as inducer sequences and a transitive vector system to compare their gene silencing efficiencies. In total, ten vectors were assembled each containing the nucleotide sequence of one fragment in sense and corresponding antisense orientation separated by an intron (inverted hairpin construct, ihp). All sequence fragments along the full lengths of both target genes resulted in a significant down-regulation of the respective gene expression and related metabolite levels. Quantitative PCR data and successful application of a transitive vector system coinciding with a phenotypic change suggested propagation of the silencing signal. The spreading of the signal in strawberry fruit in the 3' direction was shown for the first time by the detection of secondary small interfering RNAs (siRNAs) outside of the primary targets by deep sequencing. Down-regulation of endogenes by the transitive method was less effective than silencing by ihp constructs probably because the numbers of primary siRNAs exceeded the quantity of secondary siRNAs by three orders of magnitude. Besides, we observed consistent hotspots of primary and secondary siRNA formation along the target sequence which fall within a distance of less than 200 nt. Thus, ihp vectors seem to be superior over the transitive vector system for functional genomics in strawberry fruit. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

PubMed

Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

2017-04-01

Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

PubMed Central

Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

2012-01-01

Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

Definition of Contravariant Velocity Components

NASA Technical Reports Server (NTRS)

Hung, Ching-moa; Kwak, Dochan (Technical Monitor)

2002-01-01

In this paper we have reviewed the basics of tensor analysis in an attempt to clarify some misconceptions regarding contravariant and covariant vector components as used in fluid dynamics. We have indicated that contravariant components are components of a given vector expressed as a unique combination of the covariant base vector system and, vice versa, that the covariant components are components of a vector expressed with the contravariant base vector system. Mathematically, expressing a vector with a combination of base vector is a decomposition process for a specific base vector system. Hence, the contravariant velocity components are decomposed components of velocity vector along the directions of coordinate lines, with respect to the covariant base vector system. However, the contravariant (and covariant) components are not physical quantities. Their magnitudes and dimensions are controlled by their corresponding covariant (and contravariant) base vectors.

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

PubMed

Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

2017-01-01

The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.

RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

PubMed Central

Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

2017-01-01

ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117

Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

PubMed

Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

2017-06-06

Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

TMV-Gate vectors: Gateway compatible tobacco mosaic virus based expression vectors for functional analysis of proteins

PubMed Central

Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin

2012-01-01

Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857

Effect of transient receptor potential vanilloid 6 gene silencing on the expression of calcium transport genes in chicken osteoblasts.

PubMed

Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei

2015-03-01

Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

Using adenovirus armed short hairpin RNA targeting transforming growth factor β1 inhibits melanoma growth and metastasis in an ex vivo animal model.

PubMed

Tai, Kuo-Feng; Wang, Chien-Hsing

2013-12-01

The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.

PubMed

Koike-Yusa, Hiroko; Li, Yilong; Tan, E-Pien; Velasco-Herrera, Martin Del Castillo; Yusa, Kosuke

2014-03-01

Identification of genes influencing a phenotype of interest is frequently achieved through genetic screening by RNA interference (RNAi) or knockouts. However, RNAi may only achieve partial depletion of gene activity, and knockout-based screens are difficult in diploid mammalian cells. Here we took advantage of the efficiency and high throughput of genome editing based on type II, clustered, regularly interspaced, short palindromic repeats (CRISPR)-CRISPR-associated (Cas) systems to introduce genome-wide targeted mutations in mouse embryonic stem cells (ESCs). We designed 87,897 guide RNAs (gRNAs) targeting 19,150 mouse protein-coding genes and used a lentiviral vector to express these gRNAs in ESCs that constitutively express Cas9. Screening the resulting ESC mutant libraries for resistance to either Clostridium septicum alpha-toxin or 6-thioguanine identified 27 known and 4 previously unknown genes implicated in these phenotypes. Our results demonstrate the potential for efficient loss-of-function screening using the CRISPR-Cas9 system.

Static internal performance of a single expansion ramp nozzle with multiaxis thrust vectoring capability

NASA Technical Reports Server (NTRS)

Capone, Francis J.; Schirmer, Alberto W.

1993-01-01

An investigation was conducted at static conditions in order to determine the internal performance characteristics of a multiaxis thrust vectoring single expansion ramp nozzle. Yaw vectoring was achieved by deflecting yaw flaps in the nozzle sidewall into the nozzle exhaust flow. In order to eliminate any physical interference between the variable angle yaw flap deflected into the exhaust flow and the nozzle upper ramp and lower flap which were deflected for pitch vectoring, the downstream corners of both the nozzle ramp and lower flap were cut off to allow for up to 30 deg of yaw vectoring. The effects of nozzle upper ramp and lower flap cutout, yaw flap hinge line location and hinge inclination angle, sidewall containment, geometric pitch vector angle, and geometric yaw vector angle were studied. This investigation was conducted in the static-test facility of the Langley 16-Foot Transonic Tunnel at nozzle pressure ratios up to 8.0.

RNA interference-based functional knockdown of the voltage-gated potassium channel Kv7.2 in dorsal root ganglion neurons after in vitro and in vivo gene transfer by adeno-associated virus vectors.

PubMed

Valdor, Markus; Wagner, Anke; Röhrs, Viola; Berg, Johanna; Fechner, Henry; Schröder, Wolfgang; Tzschentke, Thomas M; Bahrenberg, Gregor; Christoph, Thomas; Kurreck, Jens

2018-01-01

Activation of the neuronal potassium channel Kv7.2 encoded by the KCNQ2 gene has recently been shown to be an attractive mechanism to inhibit nociceptive transmission. However, potent, selective, and clinically proven activators of Kv7.2/Kv7.3 currents with analgesic properties are still lacking. An important prerequisite for the development of new drugs is a model to test the selectivity of novel agonists by abrogating Kv7.2/Kv7.3 function. Since constitutive knockout mice are not viable, we developed a model based on RNA interference-mediated silencing of KCNQ2. By delivery of a KCNQ2-specific short hairpin RNA with adeno-associated virus vectors, we completely abolished the activity of the specific Kv7.2/Kv7.3-opener ICA-27243 in rat sensory neurons. Results obtained in the silencing experiments were consistent between freshly prepared and cryopreserved dorsal root ganglion neurons, as well as in dorsal root ganglion neurons dissociated and cultured after in vivo administration of the silencing vector by intrathecal injections into rats. Interestingly, the tested associated virus serotypes substantially differed with respect to their transduction capability in cultured neuronal cell lines and primary dorsal root ganglion neurons and the in vivo transfer of transgenes by intrathecal injection of associated virus vectors. However, our study provides the proof-of-concept that RNA interference-mediated silencing of KCNQ2 is a suitable approach to create an ex vivo model for testing the specificity of novel Kv7.2/Kv7.3 agonists.

wFlu: Characterization and Evaluation of a Native Wolbachia from the Mosquito Aedes fluviatilis as a Potential Vector Control Agent

PubMed Central

Gonçalves, Daniela da Silva; Moreira, Luciano Andrade

2013-01-01

There is currently considerable interest and practical progress in using the endosymbiotic bacteria Wolbachia as a vector control agent for human vector-borne diseases. Such vector control strategies may require the introduction of multiple, different Wolbachia strains into target vector populations, necessitating the identification and characterization of appropriate endosymbiont variants. Here, we report preliminary characterization of wFlu, a native Wolbachia from the neotropical mosquito Aedes fluviatilis, and evaluate its potential as a vector control agent by confirming its ability to cause cytoplasmic incompatibility, and measuring its effect on three parameters determining host fitness (survival, fecundity and fertility), as well as vector competence (susceptibility) for pathogen infection. Using an aposymbiotic strain of Ae. fluviatilis cured of its native Wolbachia by antibiotic treatment, we show that in its natural host wFlu causes incomplete, but high levels of, unidirectional cytoplasmic incompatibility, has high rates of maternal transmission, and no detectable fitness costs, indicating a high capacity to rapidly spread through host populations. However, wFlu does not inhibit, and even enhances, oocyst infection with the avian malaria parasite Plasmodium gallinaceum. The stage- and sex-specific density of wFlu was relatively low, and with limited tissue distribution, consistent with the lack of virulence and pathogen interference/symbiont-mediated protection observed. Unexpectedly, the density of wFlu was also shown to be specifically-reduced in the ovaries after bloodfeeding Ae. fluviatilis. Overall, our observations indicate that the Wolbachia strain wFlu has the potential to be used as a vector control agent, and suggests that appreciable mutualistic coevolution has occurred between this endosymbiont and its natural host. Future work will be needed to determine whether wFlu has virulent host effects and/or exhibits pathogen interference when artificially-transfected to the novel mosquito hosts that are the vectors of human pathogens. PMID:23555728

TimesVector: a vectorized clustering approach to the analysis of time series transcriptome data from multiple phenotypes.

PubMed

Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun

2017-12-01

Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

PubMed Central

Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

2013-01-01

As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

PubMed

Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

2012-09-01

Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.

PubMed Central

Hu, W S; Bowman, E H; Delviks, K A; Pathak, V K

1997-01-01

Homologous recombination and deletions occur during retroviral replication when reverse transcriptase switches templates. While recombination occurs solely by intermolecular template switching (between copackaged RNAs), deletions can occur by an intermolecular or an intramolecular template switch (within the same RNA). To directly compare the rates of intramolecular and intermolecular template switching, two spleen necrosis virus-based vectors were constructed. Each vector contained a 110-bp direct repeat that was previously shown to delete at a high rate. The 110-bp direct repeat was flanked by two different sets of restriction site markers. These vectors were used to form heterozygotic virions containing RNAs of each parental vector, from which recombinant viruses were generated. By analyses of the markers flanking the direct repeats in recombinant and nonrecombinant proviruses, the rates of intramolecular and intermolecular template switching were determined. The results of these analyses indicate that intramolecular template switching is much more efficient than intermolecular template switching and that direct repeat deletions occur primarily through intramolecular template switching events. These studies also indicate that retroviral recombination occurs within a distinct viral subpopulation and exhibits high negative interference, whereby the selection of one recombination event increases the probability that a second recombination event will be observed. PMID:9223494

Real-time catheter tracking for high-dose-rate prostate brachytherapy using an electromagnetic 3D-guidance device: A preliminary performance study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou Jun; Sebastian, Evelyn; Mangona, Victor

2013-02-15

Purpose: In order to increase the accuracy and speed of catheter reconstruction in a high-dose-rate (HDR) prostate implant procedure, an automatic tracking system has been developed using an electromagnetic (EM) device (trakSTAR, Ascension Technology, VT). The performance of the system, including the accuracy and noise level with various tracking parameters and conditions, were investigated. Methods: A direct current (dc) EM transmitter (midrange model) and a sensor with diameter of 1.3 mm (Model 130) were used in the trakSTAR system for tracking catheter position during HDR prostate brachytherapy. Localization accuracy was assessed under both static and dynamic analyses conditions. For themore » static analysis, a calibration phantom was used to investigate error dependency on operating room (OR) table height (bottom vs midposition vs top), sensor position (distal tip of catheter vs connector end of catheter), direction [left-right (LR) vs anterior-posterior (AP) vs superior-inferior (SI)], sampling frequency (40 vs 80 vs 120 Hz), and interference from OR equipment (present vs absent). The mean and standard deviation of the localization offset in each direction and the corresponding error vectors were calculated. For dynamic analysis, the paths of five straight catheters were tracked to study the effects of directions, sampling frequency, and interference of EM field. Statistical analysis was conducted to compare the results in different configurations. Results: When interference was present in the static analysis, the error vectors were significantly higher at the top table position (3.3 {+-} 1.3 vs 1.8 {+-} 0.9 mm at bottom and 1.7 {+-} 1.0 mm at middle, p < 0.001), at catheter end position (3.1 {+-} 1.1 vs 1.4 {+-} 0.7 mm at the tip position, p < 0.001), and at 40 Hz sampling frequency (2.6 {+-} 1.1 vs 2.4 {+-} 1.5 mm at 80 Hz and 1.8 {+-} 1.1 at 160 Hz, p < 0.001). So did the mean offset errors in the LR direction (-1.7 {+-} 1.4 vs 0.4 {+-} 0.5 mm in AP and 0.8 {+-} 0.8 mm in SI directions, p < 0.001). The error vectors were significantly higher with surrounding interference (2.2 {+-} 1.3 mm) vs without interference (1.0 {+-} 0.7 mm, p < 0.001). An accuracy of 1.6 {+-} 0.2 mm can be reached when using optimum configuration (160 Hz at middle table position). When interference was present in the dynamic tracking, the mean tracking errors in LR direction (1.4 {+-} 0.5 mm) was significantly higher than that in AP direction (0.3 {+-} 0.2 mm, p < 0.001). So did the mean vector errors at 40 Hz (2.1 {+-} 0.2 mm vs 1.3 {+-} 0.2 mm at 80 Hz and 0.9 {+-} 0.2 mm at 160 Hz, p < 0.05). However, when interference was absent, they were comparable in the both directions and at all sampling frequencies. An accuracy of 0.9 {+-} 0.2 mm was obtained for the dynamic tracking when using optimum configuration. Conclusions: The performance of an EM tracking system depends highly on the system configuration and surrounding environment. The accuracy of EM tracking for catheter reconstruction in a prostate HDR brachytherapy procedure can be improved by reducing interference from surrounding equipment, decreasing distance from transmitter to tracking area, and choosing appropriated sampling frequency. A calibration scheme is needed to further reduce the tracking error when the interference is high.« less

Light Vector Meson Photoproduction off of 1H at Jefferson Lab and p-w Interference in the Leptonic Decay Channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Djalali, Chaden; Paolone, Michael; Weygand, Dennis

2014-09-01

Although the phenomena of r – w interference has been studied at great length in pionic decay channel over the past 50 years, a study of the interference in a purely electromagnetic production and decay channel has never been performed on an elementary proton target until now. The only published photo-production data of the r - w leptonic decay channel was obtained in the early seventies on C and Be. An investigation of the r - w interference on a Hydrogen was recently completed at Jefferson Lab with the CLAS detector. The di-lepton spectra was fit with two inter- feringmore » relativistic Breit-Wigner functions, and the interference phase was extracted. Preliminary results will be compared to the previous experimental studies in nuclei.« less

[Use of a novel baculovirus vector to express nucleoprotein gene of Crimean-Congo hemorrhagic fever virus in both insect and mammalian cells].

PubMed

Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang

2002-09-01

To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.

First comparative transcriptomic analysis of wild adult male and female Lutzomyia longipalpis, vector of visceral leishmaniasis.

PubMed

McCarthy, Christina B; Santini, María Soledad; Pimenta, Paulo F P; Diambra, Luis A

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi).

First Comparative Transcriptomic Analysis of Wild Adult Male and Female Lutzomyia longipalpis, Vector of Visceral Leishmaniasis

PubMed Central

McCarthy, Christina B.; Santini, María Soledad; Pimenta, Paulo F. P.; Diambra, Luis A.

2013-01-01

Leishmaniasis is a vector-borne disease with a complex epidemiology and ecology. Visceral leishmaniasis (VL) is its most severe clinical form as it results in death if not treated. In Latin America VL is caused by the protist parasite Leishmania infantum (syn. chagasi) and transmitted by Lutzomyia longipalpis. This phlebotomine sand fly is only found in the New World, from Mexico to Argentina. However, due to deforestation, migration and urbanisation, among others, VL in Latin America is undergoing an evident geographic expansion as well as dramatic changes in its transmission patterns. In this context, the first VL outbreak was recently reported in Argentina, which has already caused 7 deaths and 83 reported cases. Insect vector transcriptomic analyses enable the identification of molecules involved in the insect's biology and vector-parasite interaction. Previous studies on laboratory reared Lu. longipalpis have provided a descriptive repertoire of gene expression in the whole insect, midgut, salivary gland and male reproductive organs. Nevertheless, the study of wild specimens would contribute a unique insight into the development of novel bioinsecticides. Given the recent VL outbreak in Argentina and the compelling need to develop appropriate control strategies, this study focused on wild male and female Lu. longipalpis from an Argentine endemic (Posadas, Misiones) and a Brazilian non-endemic (Lapinha Cave, Minas Gerais) VL location. In this study, total RNA was extracted from the sand flies, submitted to sequence independent amplification and high-throughput pyrosequencing. This is the first time an unbiased and comprehensive transcriptomic approach has been used to analyse an infectious disease vector in its natural environment. Transcripts identified in the sand flies showed characteristic profiles which correlated with the environment of origin and with taxa previously identified in these same specimens. Among these, various genes represented putative targets for vector control via RNA interference (RNAi). PMID:23554910

Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

PubMed

Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

2013-01-01

We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

PubMed

Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

2010-09-01

The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

PubMed

He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

2009-02-01

The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight and left ventricular weight/body weight were significantly lower in ACE-RNAi rats (3.12+/-0.23 mg/g and 2.24+/-0.19 mg/g) compared with the vehicle controls (4.29+/-0.24 mg/g and 3.21+/-0.13 mg/g; P<0.05) and the vector controls (4.43+/-0.19 mg/g and 3.13+/-0.12 mg/g; P<0.05). The conclusion of the present study is that ACE-silencing had significant antihypertensive effects and reversed hypertensive-induced cardiac hypertrophy in SHRs, and therefore RNAi might be a new strategy in controlling hypertension.

Joint Filter and Waveform Design for Radar STAP in Signal Dependent Interference (Preprint)

DTIC Science & Technology

2015-10-01

scheduling for extended targets in radar using information theoretic measures , tracking etc can be seen in [45]–[50], [51]–[56], and the references...range gate, the measured snapshot vector consists of the target returns and the undesired returns, i.e. clutter returns, interference and noise. The...D. Cochran, S. Suvorova, S. Howard, and W. Moran, “Waveform libraries: Measures of effectiveness for radar scheduling,” IEEE Signal Processing

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

Construction of two vectors for gene expression in Trichoderma reesei.

PubMed

Lv, Dandan; Wang, Wei; Wei, Dongzhi

2012-01-01

We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

Configurations of a two-tiered amplified gene expression system in adenoviral vectors designed to improve the specificity of in vivo prostate cancer imaging

PubMed Central

Sato, M; Figueiredo, ML; Burton, JB; Johnson, M; Chen, M; Powell, R; Gambhir, SS; Carey, M; Wu, L

2009-01-01

Effective treatment for recurrent, disseminated prostate cancer is notably limited. We have developed adenoviral vectors with a prostate-specific two-step transcriptional amplification (TSTA) system that would express therapeutic genes at a robust level to target metastatic disease. The TSTA system employs the prostate-specific antigen (PSA) promoter/enhancer to drive a potent synthetic activator, which in turn activates the expression of the therapeutic gene. In this study, we explored different configurations of this bipartite system and discovered that physical separation of the two TSTA components into E1 and E3 regions of adenovirus was able to enhance androgen regulation and cell-discriminatory expression. The TSTA vectors that express imaging reporter genes were assessed by noninvasive imaging technologies in animal models. The improved selectivity of the E1E3 configured vector was reflected in silenced ectopic expression in the lung. Significantly, the enhanced specificity of the E1E3 vector enabled the detection of lung metastasis of prostate cancer. An E1E3 TSTA vector that expresses the herpes simplex virus thymidine kinase gene can effectively direct positron emission tomography (PET) imaging of the tumor. The prostate-targeted gene delivery vectors with robust and cell-specific expression capability will advance the development of safe and effective imaging guided therapy for recurrent metastatic stages of prostate cancer. PMID:18305574

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

PubMed

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design

PubMed Central

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

PubMed Central

Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

2012-01-01

Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.

PubMed

Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G

2008-12-01

With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

PubMed

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-03-06

Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

PubMed Central

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-01-01

Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Expression of Rous sarcoma virus-derived retroviral vectors in the avian blastoderm: Potential as stable genetic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, S.T.; Stoker, A.W.; Bissell, M.J.

1991-12-01

Retroviruses are valuable tools in studies of embryonic development, both as gene expression vectors and as cell lineage markers. In this study early chicken blastoderm cells are shown to be permissive for infection by Rous sarcoma virus and derivative replication-defective by Rous sarcoma virus and derivative replication-defective vectors, and, in contrast to previously published data, these cells will readily express viral genes. In cultured blastoderm cells, Rous sarcoma virus stably integrates and is transcribed efficiently, producing infectious virus particles. Using replication-defective vectors encoding the bacterial lacZ gene, the authors further show that blastoderms can be infected in culture and inmore » ovo. In ovo, lacZ expression is seen within 24 hours of virus inoculation, and by 96 hours stably expressing clones of cells are observed in diverse tissues throughout the embryo, including epidermis, somites, and heart, as well as in extraembryonic membranes. Given the rapid onset of vector expression and the broad range of permissive cell types, it should be feasible to use Rous sarcoma virus-derived retroviruses as early lineage markers and expression vectors beginning at the blastoderm stage of avian embryogenesis.« less

Comprehensive proteome profiling in Aedes albopictus to decipher Wolbachia-arbovirus interference phenomenon.

PubMed

Saucereau, Yoann; Valiente Moro, Claire; Dieryckx, Cindy; Dupuy, Jean-William; Tran, Florence-Hélène; Girard, Vincent; Potier, Patrick; Mavingui, Patrick

2017-08-18

Aedes albopictus is a vector of arboviruses that cause severe diseases in humans such as Chikungunya, Dengue and Zika fevers. The vector competence of Ae. albopictus varies depending on the mosquito population involved and the virus transmitted. Wolbachia infection status in believed to be among key elements that determine viral transmission efficiency. Little is known about the cellular functions mobilized in Ae. albopictus during co-infection by Wolbachia and a given arbovirus. To decipher this tripartite interaction at the molecular level, we performed a proteome analysis in Ae. albopictus C6/36 cells mono-infected by Wolbachia wAlbB strain or Chikungunya virus (CHIKV), and bi-infected. We first confirmed significant inhibition of CHIKV by Wolbachia. Using two-dimensional gel electrophoresis followed by nano liquid chromatography coupled with tandem mass spectrometry, we identified 600 unique differentially expressed proteins mostly related to glycolysis, translation and protein metabolism. Wolbachia infection had greater impact on cellular functions than CHIKV infection, inducing either up or down-regulation of proteins associated with metabolic processes such as glycolysis and ATP metabolism, or structural glycoproteins and capsid proteins in the case of bi-infection with CHIKV. CHIKV infection inhibited expression of proteins linked with the processes of transcription, translation, lipid storage and miRNA pathways. The results of our proteome profiling have provided new insights into the molecular pathways involved in tripartite Ae. albopictus-Wolbachia-CHIKV interaction and may help defining targets for the better implementation of Wolbachia-based strategies for disease transmission control.

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

Adenoviral vector tethering to metal surfaces via hydrolysable cross-linkers for the modulation of vector release and transduction

PubMed Central

Fishbein, Ilia; Forbes, Scott P.; Chorny, Michael; Connolly, Jeanne M.; Adamo, Richard F.; Corrales, Ricardo; Alferiev, Ivan S.; Levy, Robert J.

2013-01-01

The use of arterial stents and other medical implants as a delivery platform for surface immobilized gene vectors allows for safe and efficient localized expression of therapeutic transgenes. In this study we investigate the use of hydrolysable cross-linkers with distinct kinetics of hydrolysis for delivery of gene vectors from polyallylamine bisphosphonate-modified metal surfaces. Three cross-linkers with the estimated t1/2 of ester bonds hydrolysis of 5, 12 and 50 days demonstrated a cumulative 20%, 39% and 45% vector release, respectively, after 30 days exposure to physiological buffer at 37°C. Transgene expression in endothelial and smooth muscles cells transduced with substrate immobilized adenovirus resulted in significantly different expression profiles for each individual cross-linker. Furthermore, immobilization of adenoviral vectors effectively extended their transduction effectiveness beyond the initial phase of release. Transgene expression driven by adenovirus-tethered stents in rat carotid arteries demonstrated that a faster rate of cross-linker hydrolysis resulted in higher expression levels at day 1, which declined by day 8 after stent implantation, while inversely, slower hydrolysis was associated with increased arterial expression at day 8 in comparison with day 1. In conclusion, adjustable release of transduction-competent adenoviral vectors from metallic surfaces can be achieved, both in vitro and in vivo, through surface immobilization of adenoviral vectors using hydrolysable cross-linkers with structure-specific release kinetics. PMID:23777912

Kinematic sensitivity of robot manipulators

NASA Technical Reports Server (NTRS)

Vuskovic, Marko I.

1989-01-01

Kinematic sensitivity vectors and matrices for open-loop, n degrees-of-freedom manipulators are derived. First-order sensitivity vectors are defined as partial derivatives of the manipulator's position and orientation with respect to its geometrical parameters. The four-parameter kinematic model is considered, as well as the five-parameter model in case of nominally parallel joint axes. Sensitivity vectors are expressed in terms of coordinate axes of manipulator frames. Second-order sensitivity vectors, the partial derivatives of first-order sensitivity vectors, are also considered. It is shown that second-order sensitivity vectors can be expressed as vector products of the first-order sensitivity vectors.

Linear Transceiver Design for Interference Alignment: Complexity and Computation

DTIC Science & Technology

2010-07-01

restriction on the choice of beamforming vector of node b. Thus, for any fixed transmit node b in H , there are multiple restriction sets, each...signal space can be chosen. The receive nodes in H can achieve interference alignment if and only if these restricted sets of one-dimensional signal...total number of restriction sets is at most linear in the number of edges in H and each restriction set contains at most two one-dimensional

Engineering zucchini yellow mosaic potyvirus as a non-pathogenic vector for expression of heterologous proteins in cucurbits.

PubMed

Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A

2001-04-27

Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.

Attosecond polarization control in atomic RABBITT-like experiments assisted by a circularly polarized laser

NASA Astrophysics Data System (ADS)

Boll, D. I. R.; Fojón, O. A.

2017-12-01

We study theoretically the single ionization of noble gas atoms by the combined action of an attosecond pulse train with linear polarization and an assistant laser field with circular polarization. We employ a non-perturbative model that under certain approximations gives closed-form expressions for the angular distributions of photoelectrons. Interestingly, our model allow us to interpret these angular distributions as two-centre interferences where the orientation and the modulus of the separation vector between the virtual emitters is governed by the assistant laser field. Additionally, we show that such a configuration of light fields is similar to the polarization control technique, where both the attosecond pulse train and the assistant laser field have linear polarizations whose relative orientation may be controlled. Moreover, in order to compare our results with the available experimental data, we obtain analytical expressions for the cross sections integrated over the photoelectron emission angles. By means of these expressions, we define the ‘magic time’ as the delay for which the total cross sections for atomic targets exhibit the same functional form as the one of the monochromatic photoionization of diatomic molecular targets.

A Modular Plasmid Assembly Kit for Multigene Expression, Gene Silencing and Silencing Rescue in Plants

PubMed Central

Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin

2014-01-01

The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083

Heterologous expression of enterocin A, a bacteriocin from Enterococcus faecium, fused to a cellulose-binding domain in Escherichia coli results in a functional protein with inhibitory activity against Listeria.

PubMed

Klocke, Michael; Mundt, Kerstin; Idler, Frank; Jung, Sabrina; Backhausen, Jan E

2005-06-01

The genes for the bacteriocins enterocin A and B were isolated from Enterococcus faecium ATB 197a. Using the pET37b(+) vector, the enterocin genes were fused to an Escherichia coli specific export signal sequence, a cellulose-binding domain (CBD(cenA)) and a S-tag under the control of a T7lac promotor. The constructs were subsequently cloned into E. coli host cells. The expression of the recombinant enterocins had different effects on both the host cells and other Gram-positive bacteria. The expression of entA in Esc. coli led to the synthesis and secretion of functional active enterocin A fusion proteins, which were active against some Gram-positive indicator bacteria, but did not influence the viability of the host cells. In contrast, the expression of enterocin B fusion proteins led to a reduced viability of the host cells, indicating a misfolding of the protein or interference with the cellular metabolism of Esc. coli. Indicator strains of Gram-positive bacteria were not inhibited by purified enterocin B fusion proteins. However, recombinant enterocin B displayed inhibitory activity after the proteolytic cleavage of the fused peptides.

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

Alpharetroviral Self-inactivating Vectors: Long-term Transgene Expression in Murine Hematopoietic Cells and Low Genotoxicity

PubMed Central

Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel

2012-01-01

Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016

“Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

PubMed Central

Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

2001-01-01

Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

PubMed

Crosby, Catherine M; Barry, Michael A

2017-02-18

Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

PubMed Central

Marraffini, Luciano A.; Sontheimer, Erik J.

2010-01-01

Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

How resonance-continuum interference changes 750 GeV diphoton excess: Signal enhancement and peak shift

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jung, Sunghoon; Song, Jeonghyeon; Yoon, Yeo Woong

2016-05-02

A hypothetical new scalar resonance, a candidate explanation for the recently observed 750 GeV diphoton excess at the LHC 13 TeV, necessarily interferes with the continuum background gg → γγ. The interference has two considerable effects: (1) enhancing or suppressing diphoton signal rate due to the imaginary-part interference and (2) distorting resonance shape due to the real-part interference. We study them based on the best-fit analysis of two benchmark models: two Higgs doublets with ~50 GeV width (exhibiting the imaginary-part interference effect) and a singlet scalar with 5 GeV width (exhibiting the real-part one), both extended with vector-like fermions. Furthermore,more » we find that the resonance contribution can be enhanced by a factor of 2 (1.6) for 3 (6) fb signal rate, or the 68% CL allowed mass region is shifted by O (1) GeV. If the best-fit excess rate decreases in the future data, the interference effects will become more significant.« less

Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming.

PubMed

Schmitt, Christopher E; Morales, Blanca M; Schmitz, Ellen M H; Hawkins, John S; Lizama, Carlos O; Zape, Joan P; Hsiao, Edward C; Zovein, Ann C

2017-06-05

Non-integrating episomal vectors have become an important tool for induced pluripotent stem cell reprogramming. The episomal vectors carrying the "Yamanaka reprogramming factors" (Oct4, Klf, Sox2, and L-Myc + Lin28) are critical tools for non-integrating reprogramming of cells to a pluripotent state. However, the reprogramming process remains highly stochastic, and is hampered by an inability to easily identify clones that carry the episomal vectors. We modified the original set of vectors to express spectrally separable fluorescent proteins to allow for enrichment of transfected cells. The vectors were then tested against the standard original vectors for reprogramming efficiency and for the ability to enrich for stoichiometric ratios of factors. The reengineered vectors allow for cell sorting based on reprogramming factor expression. We show that these vectors can assist in tracking episomal expression in individual cells and can select the reprogramming factor dosage. Together, these modified vectors are a useful tool for understanding the reprogramming process and improving induced pluripotent stem cell isolation efficiency.

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

In situ reprogramming to transdifferentiate fibroblasts into cardiomyocytes using adenoviral vectors: Implications for clinical myocardial regeneration.

PubMed

Mathison, Megumi; Singh, Vivek P; Chiuchiolo, Maria J; Sanagasetti, Deepthi; Mao, Yun; Patel, Vivekkumar B; Yang, Jianchang; Kaminsky, Stephen M; Crystal, Ronald G; Rosengart, Todd K

2017-02-01

The reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells improves ventricular function in myocardial infarction models. Only integrating persistent expression vectors have thus far been used to induce reprogramming, potentially limiting its clinical applicability. We therefore tested the reprogramming potential of nonintegrating, acute expression adenoviral (Ad) vectors. Ad or lentivirus vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) were validated in vitro. Sprague-Dawley rats then underwent coronary ligation and Ad-mediated administration of vascular endothelial growth factor to generate infarct prevascularization. Three weeks later, animals received Ad or lentivirus encoding G, M, or T (AdGMT or LentiGMT) or an equivalent dose of a null vector (n = 11, 10, and 10, respectively). Outcomes were analyzed by echocardiography, magnetic resonance imaging, and histology. Ad and lentivirus vectors provided equivalent G, M, and T expression in vitro. AdGMT and LentiGMT both likewise induced expression of the cardiomyocyte marker cardiac troponin T in approximately 6% of cardiac fibroblasts versus <1% cardiac troponin T expression in AdNull (adenoviral vector that does not encode a transgene)-treated cells. Infarcted myocardium that had been treated with AdGMT likewise demonstrated greater density of cells expressing the cardiomyocyte marker beta myosin heavy chain 7 compared with AdNull-treated animals. Echocardiography demonstrated that AdGMT and LentiGMT both increased ejection fraction compared with AdNull (AdGMT: 21% ± 3%, LentiGMT: 14% ± 5%, AdNull: -0.4% ± 2%; P < .05). Ad vectors are at least as effective as lentiviral vectors in inducing cardiac fibroblast transdifferentiation into induced cardiomyocyte-like cells and improving cardiac function in postinfarct rat hearts. Short-term expression Ad vectors may represent an important means to induce cardiac cellular reprogramming in humans. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Short Hairpin RNA Gene Silencing of Prolyl Hydroxylase-2 with a Minicircle Vector Improves Neovascularization of Hindlimb Ischemia

PubMed Central

Lijkwan, Maarten A.; Hellingman, Alwine A.; Bos, Ernst J.; van der Bogt, Koen E.A.; Huang, Mei; Kooreman, Nigel G.; de Vries, Margreet R.; Peters, Hendrika A.B.; Robbins, Robert C.; Quax, Paul H.A.

2014-01-01

Abstract In this study, we target the hypoxia inducible factor-1 alpha (HIF-1-alpha) pathway by short hairpin RNA interference therapy targeting prolyl hydroxylase-2 (shPHD2). We use the minicircle (MC) vector technology as an alternative for conventional nonviral plasmid (PL) vectors in order to improve neovascularization after unilateral hindlimb ischemia in a murine model. Gene expression and transfection efficiency of MC and PL, both in vitro and in vivo, were assessed using bioluminescence imaging (BLI) and firefly luciferase (Luc) reporter gene. C57Bl6 mice underwent unilateral electrocoagulation of the femoral artery and gastrocnemic muscle injection with MC-shPHD2, PL-shPHD2, or phosphate-buffered saline (PBS) as control. Blood flow recovery was monitored using laser Doppler perfusion imaging, and collaterals were visualized by immunohistochemistry and angiography. MC-Luc showed a 4.6-fold higher in vitro BLI signal compared with PL-Luc. BLI signals in vivo were 4.3×105±3.3×105 (MC-Luc) versus 0.4×105±0.3×105 (PL-Luc) at day 28 (p=0.016). Compared with PL-shPHD2 or PBS, MC-shPHD2 significantly improved blood flow recovery, up to 50% from day 3 until day 14 after ischemia induction. MC-shPHD2 significantly increased collateral density and capillary density, as monitored by alpha-smooth muscle actin expression and CD31+ expression, respectively. Angiography data confirmed the histological findings. Significant downregulation of PHD2 mRNA levels by MC-shPHD2 was confirmed by quantitative polymerase chain reaction. Finally, Western blot analysis confirmed significantly higher levels of HIF-1-alpha protein by MC-shPHD2, compared with PL-shPHD2 and PBS. This study provides initial evidence of a new potential therapeutic approach for peripheral artery disease. The combination of HIF-1-alpha pathway targeting by shPHD2 with the robust nonviral MC plasmid improved postischemic neovascularization, making this approach a promising potential treatment option for critical limb ischemia. PMID:24090375

Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

PubMed

Yang, Yongbo; Wu, Chengxiang; Wu, Jianguo; Nerurkar, Vivek R; Yanagihara, Richard; Lu, Yuanan

2008-05-01

West Nile virus (WNV) has been responsible for the largest outbreaks of arboviral encephalitis in U.S. history. No specific drug is currently available for the effective treatment of WNV infection. To exploit RNA interference as a potential therapeutic approach, a Moloney murine leukemia virus-based retrovirus vector was used to effectively deliver WNV-specific small interfering RNA (siRNA) into human neuroblastoma HTB-11 cells. Viral plaque assays demonstrated that transduced cells were significantly refractory to WNV replication, as compared to untransduced control cells (P < 0.05), which correlated with the reduced expression of target viral genes and respective viral proteins. Therefore, retrovirus-mediated delivery of siRNA for gene silencing can be used to study the specific functions of viral genes associated with replication and may have potential therapeutic applications.

Aeromagnetic gradient compensation method for helicopter based on ɛ-support vector regression algorithm

NASA Astrophysics Data System (ADS)

Wu, Peilin; Zhang, Qunying; Fei, Chunjiao; Fang, Guangyou

2017-04-01

Aeromagnetic gradients are typically measured by optically pumped magnetometers mounted on an aircraft. Any aircraft, particularly helicopters, produces significant levels of magnetic interference. Therefore, aeromagnetic compensation is essential, and least square (LS) is the conventional method used for reducing interference levels. However, the LSs approach to solving the aeromagnetic interference model has a few difficulties, one of which is in handling multicollinearity. Therefore, we propose an aeromagnetic gradient compensation method, specifically targeted for helicopter use but applicable on any airborne platform, which is based on the ɛ-support vector regression algorithm. The structural risk minimization criterion intrinsic to the method avoids multicollinearity altogether. Local aeromagnetic anomalies can be retained, and platform-generated fields are suppressed simultaneously by constructing an appropriate loss function and kernel function. The method was tested using an unmanned helicopter and obtained improvement ratios of 12.7 and 3.5 in the vertical and horizontal gradient data, respectively. Both of these values are probably better than those that would have been obtained from the conventional method applied to the same data, had it been possible to do so in a suitable comparative context. The validity of the proposed method is demonstrated by the experimental result.

Downregulation of CD147 expression by RNA interference inhibits HT29 cell proliferation, invasion and tumorigenicity in vitro and in vivo.

PubMed

Li, Rui; Pan, Yuqin; He, Bangshun; Xu, Yeqiong; Gao, Tianyi; Song, Guoqi; Sun, Huiling; Deng, Qiwen; Wang, Shukui

2013-12-01

We investigated the effect of CD147 silencing on HT29 cell proliferation and invasion. We constructed a novel short hairpin RNA (shRNA) expression vector pYr-mir30-shRNA. The plasmid was transferred to HT29 cells. The expression of CD147, MCT1 (lactate transporters monocarboxylate transporter 1) and MCT4 (lactate transporters monocarboxylate transporter 4) were monitored by quantitative PCR and western blotting, respectively. The MMP-2 (matrix metalloproteinase-2) and MMP-9 (matrix metalloproteinase-9) activities were determined by gelatin zymography assay, while the intracellular lactate concentration was determined by the lactic acid assay kit. WST-8 assay was used to determine the HT29 cell proliferation and the chemosensitivity. Invasion assay was used to determine the invasion of HT29 cells. In addition, we established a colorectal cancer model, and detected CD147 expression in vivo. The results showed that the expression of CD147 and MCT1 was significantly reduced at both mRNA and protein levels, and also the activity of MMP-2 and MMP-9 was reduced. The proliferation and invasion were decreased, but chemosensitivity to cisplatin was increased. In vivo, the CD147 expression was also significantly decreased, and reduced the tumor growth after CD147 gene silencing. The results demonstrated that silencing of CD147 expression inhibited the proliferation and invasion, suggesting CD147 silencing might be an adjuvant gene therapy strategy to chemotherapy.

Polarization splitter based on interference effects in all-solid photonic crystal fibers.

PubMed

Mao, Dong; Guan, Chunying; Yuan, Libo

2010-07-01

We propose a novel kind of polarization splitter in all-solid photonic crystal fibers based on the mode interference effects. Both the full-vector finite-element method and the semi-vector three-dimensional beam propagation method are employed to design and analyze the characteristics of the splitter. Numerical simulations show that x-polarized and y-polarized modes are split entirely along with 6.8 mm long propagation. An extinction ratio of more than 20 dB and a crosstalk of less than -20 dB are obtained within the wavelength range of 1.541-1.556 microm. The extinction ratio and the crosstalk at 1.55 microm are 28.9 and -29.0 dB for x polarization, while the extinction ratio and the crosstalk at 1.55 microm are 29.9 and -29.8 dB for y polarization, respectively.

Transverse spin and transverse momentum in scattering of plane waves.

PubMed

Saha, Sudipta; Singh, Ankit K; Ray, Subir K; Banerjee, Ayan; Gupta, Subhasish Dutta; Ghosh, Nirmalya

2016-10-01

We study the near field to the far field evolution of spin angular momentum (SAM) density and the Poynting vector of the scattered waves from spherical scatterers. The results show that at the near field, the SAM density and the Poynting vector are dominated by their transverse components. While the former (transverse SAM) is independent of the helicity of the incident circular polarization state, the latter (transverse Poynting vector) depends upon the polarization state. It is further demonstrated that the interference of the transverse electric and transverse magnetic scattering modes enhances both the magnitudes and the spatial extent of the transverse SAM and the transverse momentum components.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

[Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

PubMed

Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

2015-07-01

To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Retrovirus-based vectors for transient and permanent cell modification.

PubMed

Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

2015-10-01

Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Gene silencing in primary and metastatic tumors by small interfering RNA delivery in mice: quantitative analysis using melanoma cells expressing firefly and sea pansy luciferases.

PubMed

Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu

2005-07-20

Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.

RNA interference targeting CD147 inhibits metastasis and invasion of human breast cancer MCF-7 cells by downregulating MMP-9/VEGF expression.

PubMed

Li, Fang; Zhang, Junping; Guo, Jiqiang; Jia, Yuan; Han, Yaping; Wang, Zhuanhua

2018-06-12

Breast cancer is one of the most common malignancies. It is necessary to identify new markers for predicting tumor progression and therapeutic molecular targets. It has been reported that CD147 is one of the most commonly expressed proteins in primary tumors and in metastatic cells. In this study, we investigated the role of CD147 in human breast cancer metastasis and invasion, and examined its underlying molecular mechanisms. Immunohistochemistry results revealed high expression of CD147 in human breast tumor tissues, which was positively correlated with the malignancy of breast cancer. MCF-7 cells were transfected with CD147 siRNA eukaryotic expression vector, which resulted in significant knockdown of CD147. We found that CD147 siRNA dramatically inhibited cell proliferation, metastasis, and invasion. Furthermore, our results demonstrated that CD147 siRNA inhibited the synthesis of matrix metalloproteinase 9 (MMP-9) but had no significant effect on matrix metalloproteinase 2 (MMP-2). In addition, CD147 siRNA significantly inhibited the production of vascular endothelial growth factor (VEGF). Taken together, these data indicate that CD147 promotes breast cancer cell proliferation, metastasis, and invasion by modulating MMP-9 and VEGF expression. Thus, CD147 may be used as an important indicator for the judgment of malignant behavior of breast cancer, and may be a potential novel target for breast cancer therapy.

Expression of a major surface protein of Trypanosoma brucei insect forms is controlled by the activity of mitochondrial enzymes.

PubMed

Vassella, Erik; Probst, Matthias; Schneider, André; Studer, Erwin; Renggli, Christina Kunz; Roditi, Isabel

2004-09-01

In cycling between the mammalian host and the tsetse fly vector, trypanosomes undergo major changes in energy metabolism and surface coat composition. Early procyclic (insect) forms in the tsetse fly midgut are coated by glycoproteins known as EP and GPEET procyclins. EP expression continues in late procyclic forms, whereas GPEET is down-regulated. In culture, expression of GPEET is modulated by glycerol or glucose. Here, we demonstrate that a glycerol-responsive element of 25 nucleotides within the 3' untranslated region of GPEET mRNA also controls expression by glucose and during development in the fly. In trypanosomes, mitochondrial ATP is produced mainly by the acetate: succinate-CoA transferase/succinyl-CoA synthetase (ASCT) cycle, the citric acid cycle, and the cytochromes. Silencing of the pyruvate dehydrogenase or succinyl-CoA synthetase from the ASCT cycle by RNA interference induces reexpression of GPEET in late procyclic forms, whereas inhibition of the citric acid cycle or the cytochromes has no effect. In contrast, inhibition of the alternative oxidase, the second branch of the electron transport chain, with salicylhydroxamic acid overrides the effect of glucose or glycerol and causes a reduction in the level of GPEET mRNA. Our results reveal a new mechanism by which expression of a surface glycoprotein is controlled by the activity of mitochondrial enzymes.

Polarization of the interference field during reflection of electromagnetic waves from an intermedia boundary

NASA Astrophysics Data System (ADS)

Bulakhov, M. G.; Buyanov, Yu. I.; Yakubov, V. P.

1996-10-01

It has been shown that a full vector measurement of the total field allows one to uniquely distinguish the incident and reflected waves at each observation point without the use of a spatial difference based on an analysis of the polarization structure of the interference pattern which arises during reflection of electromagnetic waves from an intermedia boundary. We have investigated the stability of these procedures with respect to measurement noise by means of numerical modeling.

Development of nonhuman adenoviruses as vaccine vectors

PubMed Central

Bangari, Dinesh S.; Mittal, Suresh K.

2006-01-01

Human adenoviral (HAd) vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system. However, clinical use of adenoviral vectors for vaccine purposes is anticipated to be limited by vector immunity that is either preexisting or develops rapidly following the first inoculation with adenoviral vectors. Vector immunity inactivates the vector particles and rapidly removes the transduced cells, thereby limiting the duration of transgene expression. Due to strong vector immunity, subsequent use of the same vector is usually less efficient. In order to circumvent this limitation, nonhuman adenoviral vectors have been proposed as alternative vectors. In addition to eluding HAd immunity, these vectors possess most of the attractive features of HAd vectors. Several replication-competent or replication-defective nonhuman adenoviral vectors have been developed and investigated for their potential as vaccine delivery vectors. Here, we review recent advances in the design and characterization of various nonhuman adenoviral vectors, and discuss their potential applications for human and animal vaccination. PMID:16297508

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-09-01

Human immunodeficiency virus (HIV)-associated sensory neuropathy is a common neurological complication of HIV infection affecting up to 30% of HIV-positive individuals. However, the exact neuropathological mechanisms remain unknown, which hinders our ability to develop effective treatments for HIV-related neuropathic pain (NP). In this study, we tested the hypothesis that inhibition of proinflammatory factors with overexpression of interleukin (IL)-10 reduces HIV-related NP in a rat model. NP was induced by the application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve. The hindpaws of rats were inoculated with nonreplicating herpes simplex virus (HSV) vectors expressing anti-inflammatory cytokine IL-10 or control vector. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The mechanical threshold response was assessed over time using the area under curves. The expression of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 in both the lumbar spinal cord and the L4/5 dorsal root ganglia (DRG), was examined at 14 and 28 days after vector inoculation using Western blots. We found that in the gp120-induced NP model, IL-10 overexpression mediated by the HSV vector resulted in a significant elevation of the mechanical threshold that was apparent on day 3 after vector inoculation compared with the control vector (P < 0.001). The antiallodynic effect of the single HSV vector inoculation expressing IL-10 lasted >28 days. The area under curve in the HSV vector expressing IL-10 was increased compared with that in the control vector (P < 0.0001). HSV vectors expressing IL-10 reversed the upregulation of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 expression at 14 and/or 28 days in the DRG and/or the spinal dorsal horn. Our studies demonstrate that blocking the signaling of these proinflammatory molecules in the DRG and/or the spinal cord using the HSV vector expressing IL-10 is able to reduce HIV-related NP. These results provide new insights on the potential mechanisms of HIV-associated NP and a proof of concept for treating painful HIV sensory neuropathy with this type of gene therapy.

Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors

PubMed Central

Giritch, Anatoli; Marillonnet, Sylvestre; Engler, Carola; van Eldik, Gerben; Botterman, Johan; Klimyuk, Victor; Gleba, Yuri

2006-01-01

Plant viral vectors allow expression of heterologous proteins at high yields, but so far, they have been unable to express heterooligomeric proteins efficiently. We describe here a rapid and indefinitely scalable process for high-level expression of functional full-size mAbs of the IgG class in plants. The process relies on synchronous coinfection and coreplication of two viral vectors, each expressing a separate antibody chain. The two vectors are derived from two different plant viruses that were found to be noncompeting. Unlike vectors derived from the same virus, noncompeting vectors effectively coexpress the heavy and light chains in the same cell throughout the plant body, resulting in yields of up to 0.5 g of assembled mAbs per kg of fresh-leaf biomass. This technology allows production of gram quantities of mAbs for research purposes in just several days, and the same protocol can be used on an industrial scale in situations requiring rapid response, such as pandemic or terrorism events. PMID:16973752

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

PubMed Central

Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

2012-01-01

Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

Host structural carbohydrate induces vector transmission of a bacterial plant pathogen.

PubMed

Killiny, Nabil; Almeida, Rodrigo P P

2009-12-29

Many insect-borne pathogens have complex life histories because they must colonize both hosts and vectors for successful dissemination. In addition, the transition from host to vector environments may require changes in gene expression before the pathogen's departure from the host. Xylella fastidiosa is a xylem-limited plant-pathogenic bacterium transmitted by leafhopper vectors that causes diseases in a number of economically important plants. We hypothesized that factors of host origin, such as plant structural polysaccharides, are important in regulating X. fastidiosa gene expression and mediating vector transmission of this pathogen. The addition of pectin and glucan to a simple defined medium resulted in dramatic changes in X. fastidiosa's phenotype and gene-expression profile. Cells grown in the presence of pectin became more adhesive than in other media tested. In addition, the presence of pectin and glucan in media resulted in significant changes in the expression of several genes previously identified as important for X. fastidiosa's pathogenicity in plants. Furthermore, vector transmission of X. fastidiosa was induced in the presence of both polysaccharides. Our data show that host structural polysaccharides mediate gene regulation in X. fastidiosa, which results in phenotypic changes required for vector transmission. A better understanding of how vector-borne pathogens transition from host to vector, and vice versa, may lead to previously undiscovered disease-control strategies.

Lack of Humoral Immune Response to the Tetracycline (Tet) Activator in Rats Injected Intracranially with Tet-off rAAV Vectors

PubMed Central

Han, Ye; Chang, Qin A.; Virag, Tamas; West, Neva C.; George, David; Castro, Maria G.; Bohn, Martha C.

2010-01-01

The ability to safely control transgene expression from viral vectors is a long-term goal in the gene therapy field. We have previously reported tight regulation of GFP expression in rat brain using a self-regulating tet-off rAAV vector. The immune responses against tet regulatory elements observed by other groups in nonhuman primates after intramuscular injection of tet-on encoding vectors raise concerns about the clinical value of tet-regulated vectors. However, previous studies have not examined immune responses following injection of AAV vectors into brain. Therefore, rat striatum was injected with tet-off rAAV harboring a therapeutic gene for Parkinson's disease, either hAADC or hGDNF. The expression of each gene was tightly controlled by the tet-off regulatory system. Using an ELISA developed with purified GST-tTA protein, no detectable immunogenicity against tTA was observed in sera of rats that received an intrastriatal injection of either vector. In contrast, sera from rats intradermally injected with an adenovirus containing either tTA or rtTA, as positive controls, had readily detectable antibodies. These observations suggest that tet-off rAAV vectors do not elicit an immune response when injected into rat brain and that these may offer safer vectors for Parkinson's disease than vectors with constitutive expression. PMID:20164859

Modified Newcastle Disease virus as an improved vaccine vector against Simian Immunodeficiency virus.

PubMed

Manoharan, Vinoth K; Khattar, Sunil K; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

2018-06-12

SIV infection in macaques is a relevant animal model for HIV pathogenesis and vaccine study in humans. To design a safe and effective vaccine against HIV, we evaluated the suitability of naturally-occurring avirulent Newcastle disease virus (NDV) strains and several modified versions of NDV as vectors for the expression and immunogenicity of SIV envelope protein gp160. All the NDV vectors expressed gp160 protein in infected cells. The gp160 expressed by these vectors formed oligomers and was incorporated into the NDV envelope. All the NDV vectors expressing gp160 were attenuated in chickens. Intranasal immunization of guinea pigs with modified NDV vectors such as rNDV-APMV-2CS/gp160 and rNDV-APMV-8CS/gp160 (NDV strain LaSota containing the cleavage site sequences of F protein of avian paramyxovirus (APMV) serotype 2 and 8, respectively), and rNDV-BC-F-HN/gp160 (NDV strain BC containing LaSota F cleavage site and LaSota F and HN genes) elicited improved SIV-specific humoral and mucosal immune responses compared to other NDV vectors. These modified vectors were also efficient in inducing neutralizing antibody responses to tier 1 A SIVmac251.6 and tier 1B SIVmac251/M766 strains. This study suggests that our novel modified NDV vectors are safe and immunogenic and can be used as vaccine vector to control HIV.

Gene Transfer of Glutamic Acid Decarboxylase 67 by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats.

PubMed

Kanao, Megumi; Kanda, Hirotsugu; Huang, Wan; Liu, Shue; Yi, Hyun; Candiotti, Keith A; Lubarsky, David A; Levitt, Roy C; Hao, Shuanglin

2015-06-01

Human immunodeficiency virus (HIV)-related painful sensory neuropathies primarily consist of the HIV infection-related distal sensory polyneuropathy and antiretroviral toxic neuropathies. Pharmacotherapy provides only partial relief of pain in patients with HIV/acquired immune deficiency syndrome because little is known about the exact neuropathological mechanisms for HIV-associated neuropathic pain (NP). Hypofunction of γ-aminobutyric acid (GABA) GABAergic inhibitory mechanisms has been reported after peripheral nerve injury. In this study, we tested the hypothesis that HIV gp120 combined with antiretroviral therapy reduces spinal GABAergic inhibitory tone and that restoration of GABAergic inhibitory tone will reduce HIV-related NP in a rat model. The application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve plus systemic ddC (one antiretroviral drug) induced mechanical allodynia. The hind paws of rats were inoculated with replication-defective herpes simplex virus (HSV) vectors genetically encoding gad1 gene to express glutamic acid decarboxylase 67 (GAD67), an enzyme that catalyzes the decarboxylation of glutamate to GABA. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The expression of GAD67 in both the lumbar spinal cord and the L4-5 dorsal root ganglia was examined using western blots. The expression of mitochondrial superoxide in the spinal dorsal horn was examined using MitoSox imaging. The immunoreactivity of spinal GABA, pCREB, and pC/EBPβ was tested using immunohistochemistry. In the gp120 with ddC-induced neuropathic pain model, GAD67 expression mediated by the HSV vector caused an elevation of mechanical threshold that was apparent on day 3 after vector inoculation. The antiallodynic effect of the single HSV vector inoculation expressing GAD67 lasted >28 days. The area under the time-effect curves in the HSV vector expressing GAD67 was increased compared with that in the control vectors (P = 0.0005). Intrathecal GABA-A/B agonists elevated mechanical threshold in the pain model. The HSV vectors expressing GAD67 reversed the lowered GABA immunoreactivity in the spinal dorsal horn in the neuropathic rats. HSV vectors expressing GAD67 in the neuropathic rats reversed the increased signals of mitochondrial superoxide in the spinal dorsal horn. The vectors expressing GAD67 reversed the upregulated immunoreactivity expression of pCREB and pC/EBPβ in the spinal dorsal horn in rats exhibiting NP. Based on our results, we suggest that GAD67 mediated by HSV vectors acting through the suppression of mitochondrial reactive oxygen species and transcriptional factors in the spinal cord decreases pain in the HIV-related neuropathic pain model, providing preclinical evidence for gene therapy applications in patients with HIV-related pain states.

Modification and identification of a vector for making a large phage antibody library.

PubMed

Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing

2007-11-20

The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.

Down-Regulation of Gene Expression by RNA-Induced Gene Silencing

NASA Astrophysics Data System (ADS)

Travella, Silvia; Keller, Beat

Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.

Applications of lentiviral vectors in molecular imaging.

PubMed

Chatterjee, Sushmita; De, Abhijit

2014-06-01

Molecular imaging provides the ability of simultaneous visual and quantitative estimation of long term gene expression directly from living organisms. To reveal the kinetics of gene expression by imaging method, often sustained expression of the transgene is required. Lentiviral vectors have been extensively used over last fifteen years for delivery of a transgene in a wide variety of cell types. Lentiviral vectors have the well known advantages such as sustained transgene delivery through stable integration into the host genome, the capability of infecting non-dividing and dividing cells, broad tissue tropism, a reasonably large carrying capacity for delivering therapeutic and reporter gene combinations. Additionally, they do not express viral proteins during transduction, have a potentially safe integration site profile, and a relatively easy system for vector manipulation and infective viral particle production. As a result, lentiviral vector mediated therapeutic and imaging reporter gene delivery to various target organs holds promise for the future treatment. In this review, we have conducted a brief survey of important lentiviral vector developments in diverse biomedical fields including reproductive biology.

Genetically modified pigs produced with a nonviral episomal vector

PubMed Central

Manzini, Stefano; Vargiolu, Alessia; Stehle, Isa M; Bacci, Maria Laura; Cerrito, Maria Grazia; Giovannoni, Roberto; Zannoni, Augusta; Bianco, Maria Rosaria; Forni, Monica; Donini, Pierluigi; Papa, Michele; Lipps, Hans J; Lavitrano, Marialuisa

2006-01-01

Genetic modification of cells and animals is an invaluable tool for biotechnology and biomedicine. Currently, integrating vectors are used for this purpose. These vectors, however, may lead to insertional mutagenesis and variable transgene expression and can undergo silencing. Scaffold/matrix attachment region-based vectors are nonviral expression systems that replicate autonomously in mammalian cells, thereby making possible safe and reliable genetic modification of higher eukaryotic cells and organisms. In this study, genetically modified pig fetuses were produced with the scaffold/matrix attachment region-based vector pEPI, delivered to embryos by the sperm-mediated gene transfer method. The pEPI vector was detected in 12 of 18 fetuses in the different tissues analyzed and was shown to be retained as an episome. The reporter gene encoded by the pEPI vector was expressed in 9 of 12 genetically modified fetuses. In positive animals, all tissues analyzed expressed the reporter gene; moreover in these tissues, the positive cells were on the average 79%. The high percentage of EGFP-expressing cells and the absence of mosaicism have important implications for biotechnological and biomedical applications. These results are an important step forward in animal transgenesis and can provide the basis for the future development of germ-line gene therapy. PMID:17101993

Thrust-wrench fault interference in a brittle medium: new insights from analogue modelling experiments

NASA Astrophysics Data System (ADS)

Rosas, Filipe; Duarte, Joao; Schellart, Wouter; Tomas, Ricardo; Grigorova, Vili; Terrinha, Pedro

2015-04-01

We present analogue modelling experimental results concerning thrust-wrench fault interference in a brittle medium, to try to evaluate the influence exerted by different prescribed interference angles in the formation of morpho-structural interference fault patterns. All the experiments were conceived to simulate simultaneous reactivation of confining strike-slip and thrust faults defining a (corner) zone of interference, contrasting with previously reported discrete (time and space) superposition of alternating thrust and strike-slip events. Different interference angles of 60°, 90° and 120° were experimentally investigated by comparing the specific structural configurations obtained in each case. Results show that a deltoid-shaped morpho-structural pattern is consistently formed in the fault interference (corner) zone, exhibiting a specific geometry that is fundamentally determined by the different prescribed fault interference angle. Such angle determines the orientation of the displacement vector shear component along the main frontal thrust direction, determining different fault confinement conditions in each case, and imposing a complying geometry and kinematics of the interference deltoid structure. Model comparison with natural examples worldwide shows good geometric and kinematic similarity, pointing to the existence of matching underlying dynamic process. Acknowledgments This work was sponsored by the Fundação para a Ciência e a Tecnologia (FCT) through project MODELINK EXPL/GEO-GEO/0714/2013.

Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

PubMed Central

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

2015-01-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

Reflections on the early development of poxvirus vectors.

PubMed

Moss, Bernard

2013-09-06

Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

2006-10-06

We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

PubMed

Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

2016-08-01

Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

[Expression and identification of eukaryotic expression vectors of Brucella melitensis lipoprotein OMP19].

PubMed

He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao

2016-04-01

To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Adenovirus vector expressing keratinocyte growth factor using CAG promoter impairs pulmonary function of mice with elastase-induced emphysema.

PubMed

Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu

2017-07-01

Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

Playback interference of glassy-winged sharp shooter communication

USDA-ARS?s Scientific Manuscript database

Animal communication is vital to reproduction, particularly for securing a mate. Insects commonly communicate by exchanging vibrational signals that are transmitted through host plants. The glassy-winged sharpshooter (GWSS), Homalodisca vitripennis, is an important vector of Xylella fastidiosa, a pl...

Production of transgenic cloned pigs expressing the far-red fluorescent protein monomeric Plum.

PubMed

Watanabe, Masahito; Kobayashi, Mirina; Nagaya, Masaki; Matsunari, Hitomi; Nakano, Kazuaki; Maehara, Miki; Hayashida, Gota; Takayanagi, Shuko; Sakai, Rieko; Umeyama, Kazuhiro; Watanabe, Nobuyuki; Onodera, Masafumi; Nagashima, Hiroshi

2015-01-01

Monomeric Plum (Plum), a far-red fluorescent protein with photostability and photopermeability, is potentially suitable for in vivo imaging and detection of fluorescence in body tissues. The aim of this study was to generate transgenic cloned pigs exhibiting systemic expression of Plum using somatic cell nuclear transfer (SCNT) technology. Nuclear donor cells for SCNT were obtained by introducing a Plum-expression vector driven by a combination of the cytomegalovirus early enhancer and chicken beta-actin promoter into porcine fetal fibroblasts (PFFs). The cleavage and blastocyst formation rates of reconstructed SCNT embryos were 81.0% (34/42) and 78.6% (33/42), respectively. At 36-37 days of gestation, three fetuses systemically expressing Plum were obtained from one recipient to which 103 SCNT embryos were transferred (3/103, 2.9%). For generation of offspring expressing Plum, rejuvenated PFFs were established from one cloned fetus and used as nuclear donor cells. Four cloned offspring and one stillborn cloned offspring were produced from one recipient to which 117 SCNT embryos were transferred (5/117, 4.3%). All offspring exhibited high levels of Plum fluorescence in blood cells, such as lymphocytes, monocytes and granulocytes. In addition, the skin, heart, kidney, pancreas, liver and spleen also exhibited Plum expression. These observations demonstrated that transfer of the Plum gene did not interfere with the development of porcine SCNT embryos and resulted in the successful generation of transgenic cloned pigs that systemically expressed Plum. This is the first report of the generation and characterization of transgenic cloned pigs expressing the far-red fluorescent protein Plum.

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

PubMed Central

Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

2013-01-01

Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

Generation of 2A-linked multicistronic cassettes by recombinant PCR.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.

Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

PubMed

Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

2007-08-01

Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

Reduction of adenovirus E1A mRNA by RNAi results in enhanced recombinant protein expression in transiently transfected HEK293 cells.

PubMed

Hacker, David L; Bertschinger, Martin; Baldi, Lucia; Wurm, Florian M

2004-10-27

Human embryonic kidney 293 (HEK293) cells, a widely used host for large-scale transient expression of recombinant proteins, are transformed with the adenovirus E1A and E1B genes. Because the E1A proteins function as transcriptional activators or repressors, they may have a positive or negative effect on transient transgene expression in this cell line. Suspension cultures of HEK293 EBNA (HEK293E) cells were co-transfected with a reporter plasmid expressing the GFP gene and a plasmid expressing a short hairpin RNA (shRNA) targeting the E1A mRNAs for degradation by RNA interference (RNAi). The presence of the shRNA in HEK293E cells reduced the steady state level of E1A mRNA up to 75% and increased transient GFP expression from either the elongation factor-1alpha (EF-1alpha) promoter or the human cytomegalovirus (HCMV) immediate early promoter up to twofold. E1A mRNA depletion also resulted in a twofold increase in transient expression of a recombinant IgG in both small- and large-scale suspension cultures when the IgG light and heavy chain genes were controlled by the EF-1alpha promoter. Finally, transient IgG expression was enhanced 2.5-fold when the anti-E1A shRNA was expressed from the same vector as the IgG light chain gene. These results demonstrated that E1A has a negative effect on transient gene expression in HEK293E cells, and they established that RNAi can be used to enhance recombinant protein expression in mammalian cells.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Adaptive antenna arrays for weak interfering signals

NASA Technical Reports Server (NTRS)

Gupta, I. J.

1985-01-01

The interference protection provided by adaptive antenna arrays to an Earth station or satellite receive antenna system is studied. The case where the interference is caused by the transmission from adjacent satellites or Earth stations whose signals inadverently enter the receiving system and interfere with the communication link is considered. Thus, the interfering signals are very weak. To increase the interference suppression, one can either decrease the thermal noise in the feedback loops or increase the gain of the auxiliary antennas in the interfering signal direction. Both methods are examined. It is shown that one may have to reduce the noise correlation to impractically low values and if directive auxiliary antennas are used, the auxiliary antenna size may have to be too large. One can, however, combine the two methods to achieve the specified interference suppression with reasonable requirements of noise decorrelation and auxiliary antenna size. Effects of the errors in the steering vector on the adaptive array performance are studied.

Gene silencing in non-model insects: Overcoming hurdles using symbiotic bacteria for trauma-free sustainable delivery of RNA interference: Sustained RNA interference in insects mediated by symbiotic bacteria: Applications as a genetic tool and as a biocide.

PubMed

Whitten, Miranda; Dyson, Paul

2017-03-01

Insight into animal biology and development provided by classical genetic analysis of the model organism Drosophila melanogaster was an incentive to develop advanced genetic tools for this insect. But genetic systems for the over one million other known insect species are largely undeveloped. With increasing information about insect genomes resulting from next generation sequencing, RNA interference is now the method of choice for reverse genetics, although it is constrained by the means of delivery of interfering RNA. A recent advance to ensure sustained delivery with minimal experimental intervention or trauma to the insect is to exploit commensal bacteria for symbiont-mediated RNA interference. This technology not only offers an efficient means for RNA interference in insects in laboratory conditions, but also has potential for use in the control of human disease vectors, agricultural pests and pathogens of beneficial insects. © 2017 WILEY Periodicals, Inc.

Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

PubMed Central

Nakanishi, Mahito; Otsu, Makoto

2012-01-01

Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

PubMed

Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

2017-08-01

Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Bcr/Abl interferes with the Fanconi anemia/BRCA pathway: implications in the chromosomal instability of chronic myeloid leukemia cells.

PubMed

Valeri, Antonio; Alonso-Ferrero, Maria Eugenia; Río, Paula; Pujol, María Roser; Casado, José A; Pérez, Laura; Jacome, Ariana; Agirre, Xabier; Calasanz, Maria José; Hanenberg, Helmut; Surrallés, Jordi; Prosper, Felipe; Albella, Beatriz; Bueren, Juan A

2010-12-28

Chronic myeloid leukemia (CML) is a malignant clonal disorder of the hematopoietic system caused by the expression of the BCR/ABL fusion oncogene. Although it is well known that CML cells are genetically unstable, the mechanisms accounting for this genomic instability are still poorly understood. Because the Fanconi anemia (FA) pathway is believed to control several mechanisms of DNA repair, we investigated whether this pathway was disrupted in CML cells. Our data show that CML cells have a defective capacity to generate FANCD2 nuclear foci, either in dividing cells or after DNA damage. Similarly, human cord blood CD34(+) cells transduced with BCR/ABL retroviral vectors showed impaired FANCD2 foci formation, whereas FANCD2 monoubiquitination in these cells was unaffected. Soon after the transduction of CD34(+) cells with BCR/ABL retroviral vectors a high proportion of cells with supernumerary centrosomes was observed. Similarly, BCR/ABL induced a high proportion of chromosomal abnormalities, while mediated a cell survival advantage after exposure to DNA cross-linking agents. Significantly, both the impaired formation of FANCD2 nuclear foci, and also the predisposition of BCR/ABL cells to develop centrosomal and chromosomal aberrations were reverted by the ectopic expression of BRCA1. Taken together, our data show for the first time a disruption of the FA/BRCA pathway in BCR/ABL cells, suggesting that this defective pathway should play an important role in the genomic instability of CML by the co-occurrence of centrosomal amplification and DNA repair deficiencies.

The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

NASA Astrophysics Data System (ADS)

Roizman, Bernard

1996-10-01

Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

Detectable reporter gene expression following transduction of adenovirus and adeno-associated virus serotype 2 vectors within full-thickness osteoarthritic and unaffected canine cartilage in vitro and unaffected guinea pig cartilage in vivo.

PubMed

Santangelo, Kelly S; Baker, Sarah A; Nuovo, Gerard; Dyce, Jonathan; Bartlett, Jeffrey S; Bertone, Alicia L

2010-02-01

This study quantified and compared the transduction efficiencies of adenoviral (Ad), Arg-Gly-Asp (RGD)-modified Ad, adeno-associated viral serotype 2 (AAV2), and self-complementary AAV2 (scAAV2) vectors within full-thickness osteoarthritic (OA) and unaffected canine cartilage explants in vitro. Intraarticular administration of Ad and scAAV2 vectors was performed to determine the ability of these vectors to transduce unaffected guinea pig cartilage in vivo. Following explant exposure to vector treatment or control, the onset and surface distribution of reporter gene expression was monitored daily with fluorescent microscopy. At termination, explants were divided: one half was digested for analysis using flow cytometry; the remaining portion was used for histology and immunohistochemistry (IHC). Intact articular joints were collected for real-time RT-PCR and IHC to detect reporter gene expression following injection of selected vectors. Ad vector transduced focal areas along the perimeters of explants; the remaining vectors transduced chondrocytes across 100% of the surface. Greater mean transduction efficiencies were found with both AAV2 vectors as compared to the Ad vector (p < or = 0.026). Ad and Ad-RGD vectors transduced only superficial chondrocytes of OA and unaffected cartilage. Uniform reporter gene expression from AAV2 and scAAV2 was detected in the tangential and transitional zones of OA cartilage, but not deeper zones. AAV2 and scAAV2 vectors achieved partial and full-thickness transduction of unaffected cartilage. In vivo work revealed that scAAV2 vector, but not Ad vector, transduced deeper zones of cartilage and menisci. This study demonstrates that AAV2 and scAAV2 are reliable vectors for use in cartilage in vitro and in vivo. (c) 2009 Orthopaedic Research Society.

Viral Vectors for in Vivo Gene Transfer

NASA Astrophysics Data System (ADS)

Thévenot, E.; Dufour, N.; Déglon, N.

The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

Targeted nanobubbles in low-frequency ultrasound-mediated gene transfection and growth inhibition of hepatocellular carcinoma cells.

PubMed

Wu, Bolin; Qiao, Qiang; Han, Xue; Jing, Hui; Zhang, Hao; Liang, Hongjian; Cheng, Wen

2016-09-01

The use of SonoVue combined with ultrasound exposure increases the transfection efficiency of short interfering RNA (siRNA). The objective of this study was to prepare targeted nanobubbles (TNB) conjugated with NET-1 siRNA and an antibody GPC3 to direct nanobubbles to hepatocellular carcinoma cells. SMMC-7721 human hepatocellular carcinoma cells were treated with six different groups. The transfection efficiency and cellular apoptosis were measured by flow cytometry. The protein and messenger RNA (mRNA) expression were measured by Western blot and quantitative real-time PCR, respectively. The migration and invasion potential of the cells were determined by Transwell analysis. The results show that US-guided siRNA-TNB transfection effectively enhanced gene silencing. In summary, siRNA-TNB may be an effective delivery vector to mediate highly effective RNA interference in tumor treatment.

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

PubMed Central

Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

2015-01-01

Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

PubMed

Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

2015-01-01

Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

Special Issue: Gene Therapy with Emphasis on RNA Interference

PubMed Central

Lundstrom, Kenneth

2015-01-01

Gene therapy was originally thought to cover replacement of malfunctioning genes in treatment of various diseases. Today, the field has been expanded to application of viral and non-viral vectors for delivery of recombinant proteins for the compensation of missing or insufficient proteins, anti-cancer genes and proteins for destruction of tumor cells, immunostimulatory genes and proteins for stimulation of the host defense system against viral agents and tumors. Recently, the importance of RNA interference and its application in gene therapy has become an attractive alternative for drug development. PMID:26447255

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Viral Interference and Persistence in Mosquito-Borne Flaviviruses.

PubMed

Salas-Benito, Juan Santiago; De Nova-Ocampo, Mónica

2015-01-01

Mosquito-borne flaviviruses are important pathogens for humans, and the detection of two or more flaviviruses cocirculating in the same geographic area has often been reported. However, the epidemiological impact remains to be determined. Mosquito-borne flaviviruses are primarily transmitted through Aedes and Culex mosquitoes; these viruses establish a life-long or persistent infection without apparent pathological effects. This establishment requires a balance between virus replication and the antiviral host response. Viral interference is a phenomenon whereby one virus inhibits the replication of other viruses, and this condition is frequently associated with persistent infections. Viral interference and persistent infection are determined by several factors, such as defective interfering particles, competition for cellular factors required for translation/replication, and the host antiviral response. The interaction between two flaviviruses typically results in viral interference, indicating that these viruses share common features during the replicative cycle in the vector. The potential mechanisms involved in these processes are reviewed here.

Beamspace dual signal space projection (bDSSP): a method for selective detection of deep sources in MEG measurements.

PubMed

Sekihara, Kensuke; Adachi, Yoshiaki; Kubota, Hiroshi K; Cai, Chang; Nagarajan, Srikantan S

2018-06-01

Magnetoencephalography (MEG) has a well-recognized weakness at detecting deeper brain activities. This paper proposes a novel algorithm for selective detection of deep sources by suppressing interference signals from superficial sources in MEG measurements. The proposed algorithm combines the beamspace preprocessing method with the dual signal space projection (DSSP) interference suppression method. A prerequisite of the proposed algorithm is prior knowledge of the location of the deep sources. The proposed algorithm first derives the basis vectors that span a local region just covering the locations of the deep sources. It then estimates the time-domain signal subspace of the superficial sources by using the projector composed of these basis vectors. Signals from the deep sources are extracted by projecting the row space of the data matrix onto the direction orthogonal to the signal subspace of the superficial sources. Compared with the previously proposed beamspace signal space separation (SSS) method, the proposed algorithm is capable of suppressing much stronger interference from superficial sources. This capability is demonstrated in our computer simulation as well as experiments using phantom data. The proposed bDSSP algorithm can be a powerful tool in studies of physiological functions of midbrain and deep brain structures.

Beamspace dual signal space projection (bDSSP): a method for selective detection of deep sources in MEG measurements

NASA Astrophysics Data System (ADS)

Sekihara, Kensuke; Adachi, Yoshiaki; Kubota, Hiroshi K.; Cai, Chang; Nagarajan, Srikantan S.

2018-06-01

Objective. Magnetoencephalography (MEG) has a well-recognized weakness at detecting deeper brain activities. This paper proposes a novel algorithm for selective detection of deep sources by suppressing interference signals from superficial sources in MEG measurements. Approach. The proposed algorithm combines the beamspace preprocessing method with the dual signal space projection (DSSP) interference suppression method. A prerequisite of the proposed algorithm is prior knowledge of the location of the deep sources. The proposed algorithm first derives the basis vectors that span a local region just covering the locations of the deep sources. It then estimates the time-domain signal subspace of the superficial sources by using the projector composed of these basis vectors. Signals from the deep sources are extracted by projecting the row space of the data matrix onto the direction orthogonal to the signal subspace of the superficial sources. Main results. Compared with the previously proposed beamspace signal space separation (SSS) method, the proposed algorithm is capable of suppressing much stronger interference from superficial sources. This capability is demonstrated in our computer simulation as well as experiments using phantom data. Significance. The proposed bDSSP algorithm can be a powerful tool in studies of physiological functions of midbrain and deep brain structures.

Oral Modeling of an Adenovirus-Based Quadrivalent Influenza Vaccine in Ferrets and Mice.

PubMed

Scallan, Ciaran D; Lindbloom, Jonathan D; Tucker, Sean N

2016-06-01

Oral vaccines delivered as tablets offer a number of advantages over traditional parenteral-based vaccines including the ease of delivery, lack of needles, no need for trained medical personnel, and the ability to formulate into temperature-stable tablets. We have been evaluating an oral vaccine platform based on recombinant adenoviral vectors for the purpose of creating a prophylactic vaccine to prevent influenza, and have demonstrated vaccine efficacy in animal models and substantial immunogenicity in humans. These studies have evaluated monovalent vaccines to date. To protect against the major circulating A and B influenza strains, a multivalent influenza vaccine will be required. In this study, the immunogenicity of orally delivered monovalent, bivalent, trivalent, and quadrivalent vaccines was tested in ferrets and mice. The various vaccine combinations were tested by blending monovalent recombinant adenovirus vaccines, each expressing hemagglutinin from a single strain. Human tablet delivery was modeled in animals by oral gavage in mice and by endoscopic delivery in ferrets. We demonstrated minimal interference between the various vaccine vectors when used in combination and that the oral quadrivalent vaccine compared favorably to an approved trivalent inactivated vaccine. The quadrivalent vaccine presented here produced immune responses that we predict should be capable of providing protection against multiple influenza strains, and the platform should have applications to other multivalent vaccines. Vaxart, Inc.

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

Gene transfer to the cerebellum.

PubMed

Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

2010-12-01

There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

Design and construction of 2A peptide-linked multicistronic vectors.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. This article describes the design and construction of 2A peptide-linked multicistronic vectors, which can be used to express multiple proteins from a single open reading frame (ORF). The small 2A peptide sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector.

Construction of two Lactococcus lactis expression vectors combining the Gateway and the NIsin Controlled Expression systems.

PubMed

Douillard, François P; Mahony, Jennifer; Campanacci, Valérie; Cambillau, Christian; van Sinderen, Douwe

2011-09-01

Over the last 10 years, the NIsin Controlled Expression (NICE) system has been extensively used in the food-grade bacterium Lactococcus lactis subsp. cremoris to produce homologous and heterologous proteins for academic and biotechnological purposes. Although various L. lactis molecular tools have been developed, no expression vectors harboring the popular Gateway recombination system are currently available for this widely used cloning host. In this study, we constructed two expression vectors that combine the NICE and the Gateway recombination systems and we tested their applicability by recombining and over-expressing genes encoding structural proteins of lactococcal phages Tuc2009 and TP901-1. Over-expressed phage proteins were analyzed by immunoblotting and purified by His-tag affinity chromatography with protein productions yielding 2.8-3.7 mg/l of culture. This therefore is the first description of L. lactis NICE expression vectors which integrate the Gateway cloning technology and which are suitable for the production of sufficient amounts of proteins to facilitate subsequent structural and functional analyses. Copyright © 2011 Elsevier Inc. All rights reserved.

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Expression of lysozymes from Erwinia amylovora phages and Erwinia genomes and inhibition by a bacterial protein.

PubMed

Müller, Ina; Gernold, Marina; Schneider, Bernd; Geider, Klaus

2012-01-01

Genes coding for lysozyme-inhibiting proteins (Ivy) were cloned from the chromosomes of the plant pathogens Erwinia amylovora and Erwinia pyrifoliae. The product interfered not only with activity of hen egg white lysozyme, but also with an enzyme from E. amylovora phage ΦEa1h. We have expressed lysozyme genes from the genomes of three Erwinia species in Escherichia coli. The lysozymes expressed from genes of the E. amylovora phages ΦEa104 and ΦEa116, Erwinia chromosomes and Arabidopsis thaliana were not affected by Ivy. The enzyme from bacteriophage ΦEa1h was fused at the N- or C-terminus to other peptides. Compared to the intact lysozyme, a His-tag reduced its lytic activity about 10-fold and larger fusion proteins abolished activity completely. Specific protease cleavage restored lysozyme activity of a GST-fusion. The bacteriophage-encoded lysozymes were more active than the enzymes from bacterial chromosomes. Viral lyz genes were inserted into a broad-host range vector, and transfer to E. amylovora inhibited cell growth. Inserted in the yeast Pichia pastoris, the ΦEa1h-lysozyme was secreted and also inhibited by Ivy. Here we describe expression of unrelated cloned 'silent' lyz genes from Erwinia chromosomes and a novel interference of bacterial Ivy proteins with a viral lysozyme. Copyright © 2012 S. Karger AG, Basel.

Influence of Expression Plasmid of Connective Tissue Growth Factor and Tissue Inhibitor of Metalloproteinase-1 shRNA on Hepatic Precancerous Fibrosis in Rats.

PubMed

Zhang, Qun; Shu, Fu-Li; Jiang, Yu-Feng; Huang, Xin-En

2015-01-01

In this study, influence caused by expression plasmids of connective tissue growth factor (CTGF) and tissue inhibitor of metalloproteinase-1 (TIMP-1) short hairpin RNA (shRNA) on mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII in hepatic tissue with hepatic fibrosis, a precancerous condition, in rats is analyzed. To screen and construct shRNA expression plasimid which effectively interferes RNA targets of CTGF and TIMP-1 in rats. 50 cleaning Wistar male rats are allocated randomly at 5 different groups after precancerous fibrosis models and then injection of shRNA expression plasimids. Plasmid psiRNA-GFP-Com (CTGF and TIMP-1 included), psiRNA-GFP-CTGF, psiRNA-GFP-TIMP-1 and psiRNA- DUO-GFPzeo of blank plasmid are injected at group A, B, C and D, respectively, and as model control group that none plasimid is injected at group E. In 2 weeks after last injection, to hepatic tissue at different groups, protein expression of CTGF, TIMP-1, procol-α1and PC III is tested by immunohistochemical method and,mRNA expression of CTGF,TIMP-1,procol-α1 and PCIII is measured by real-time PCR. One-way ANOVA is used to comparison between-groups. Compared with model group, there is no obvious difference of mRNA expression among CTGF,TIMP-1,procol-α1,PC III and of protein expression among CTGF, TIMP-1, procol-α1, PC III in hepatic tissue at group injected with blank plasmid. Expression quantity of mRNA of CTGF, TIMP-1, procol-α1 and PCIII at group A, B and C decreases, protein expression of CTGF, TIMP-1, procol-α1, PC III in hepatic tissue is lower, where the inhibition of combination RNA interference group (group A) on procol-α1 mRNA transcription and procol-α1 protein expression is superior to that of single interference group (group B and C) (P<0.01 or P<0.05). RNA interference on CTGF and/or TIMP-1 is obviously a inhibiting factor for mRNA and protein expression of CTGF, TIMP-1, procol-α1 and PCIII. Combination RNA interference on genes of CTGF and TIMP-1 is superior to that of single RNA interference, and this could be a contribution for prevention of precancerous condition.

Immunogenicity of Newcastle disease virus vectors expressing Norwalk virus capsid protein in the presence or absence of VP2 protein.

PubMed

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y; Samal, Siba K

2015-10-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirus-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

Response to Blood Meal in the Fat Body of Anopheles stephensi Using Quantitative Proteomics: Toward New Vector Control Strategies Against Malaria.

PubMed

Kumar, Manish; Mohanty, Ajeet Kumar; Sreenivasamurthy, Sreelakshmi K; Dey, Gourav; Advani, Jayshree; Pinto, Sneha M; Kumar, Ashwani; Prasad, Thottethodi Subrahmanya Keshava

2017-09-01

Malaria remains a grand challenge for disruptive innovation in global health therapeutics and diagnostics. Anopheles stephensi is one of the major vectors of malaria in Asia. Vector and transmission control are key focus areas in the fight against malaria, a field of postgenomics research where proteomics can play a substantive role. Moreover, to identify novel strategies to control the vector population, it is necessary to understand the vector life processes at a global and molecular scale. In this context, fat body is a vital organ required for vitellogenesis, vector immunity, vector physiology, and vector-parasite interaction. Given its central role in energy metabolism, vitellogenesis, and immune function, the proteome profile of the fat body and the impact of blood meal (BM) ingestion on the protein abundances of this vital organ have not been investigated so far. Therefore, using a proteomics approach, we identified the proteins expressed in the fat body of An. stephensi and their differential expression in response to BM ingestion. In all, we identified 3,218 proteins in the fat body using high-resolution mass spectrometry, of which 483 were found to be differentially expressed in response to the BM ingestion. Bioinformatics analysis of these proteins underscored their role in amino acid metabolism, vitellogenesis, lipid transport, signal peptide processing, mosquito immunity, and oxidation-reduction processes. Interestingly, we identified five novel genes, which were found to be differentially expressed upon BM ingestion. Proteins that exhibited altered expression in the present study are potential targets for vector control strategies and development of transmission blocking vaccines in the fight against malaria.

An efficient Foxtail mosaic virus vector system with reduced environmental risk

PubMed Central

2010-01-01

Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

PubMed

Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

2000-02-01

Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

PubMed

Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

2009-03-01

Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells

PubMed Central

Chicaybam, Leonardo; Barcelos, Camila; Peixoto, Barbara; Carneiro, Mayra; Limia, Cintia Gomez; Redondo, Patrícia; Lira, Carla; Paraguassú-Braga, Flávio; Vasconcelos, Zilton Farias Meira De; Barros, Luciana; Bonamino, Martin Hernán

2017-01-01

Genetic modification of cell lines and primary cells is an expensive and cumbersome approach, often involving the use of viral vectors. Electroporation using square-wave generating devices, like Lonza’s Nucleofector, is a widely used option, but the costs associated with the acquisition of electroporation kits and the transient transgene expression might hamper the utility of this methodology. In the present work, we show that our in-house developed buffers, termed Chicabuffers, can be efficiently used to electroporate cell lines and primary cells from murine and human origin. Using the Nucleofector II device, we electroporated 14 different cell lines and also primary cells, like mesenchymal stem cells and cord blood CD34+, providing optimized protocols for each of them. Moreover, when combined with sleeping beauty-based transposon system, long-term transgene expression could be achieved in all types of cells tested. Transgene expression was stable and did not interfere with CD34+ differentiation to committed progenitors. We also show that these buffers can be used in CRISPR-mediated editing of PDCD1 gene locus in 293T and human peripheral blood mononuclear cells. The optimized protocols reported in this study provide a suitable and cost-effective platform for the genetic modification of cells, facilitating the widespread adoption of this technology. PMID:28168187

Elimination of endogenous aberrant kappa chain transcripts from sp2/0-derived hybridoma cells by specific ribozyme cleavage: utility in genetic therapy of HIV-1 infections.

PubMed Central

Duan, L; Pomerantz, R J

1994-01-01

The pooled degenerate-primer polymerase chain reaction (PCR) technology is now widely used in the amplification and cloning of murine hybridoma-specific immunoglobulin gene cDNAs. The design of primers is mainly based on the highly conserved 5' terminus of immunoglobulin gene variable regions and the constant region in the 3' terminus. Of note, most murine hybridoma cell lines are derived from the Sp2/0 cell line, which is demonstrated to express endogenous aberrant kappa chains (abV kappa). This high-level endogenous abV kappa mixes with specific kappa chains in the hybridomas and interferes with the efficiency of the reverse transcriptase (RT)-PCR cloning strategy. In this report, during the cloning of murine anti-human immunodeficiency virus type I (HIV-1) hybridoma immunoglobulin cDNAs, a specific primer-PCR screening system was developed, based on the abV kappa complementarity-defining region (CDR), to eliminate abV kappa-carrying plasmids. Furthermore, an abV kappa sequence-specific derived ribozyme was developed and packaged in a retroviral expression vector system. This abV kappa ribozyme can be transduced into different murine hybridomas, and expressed intracellularly to potently eliminate endogenous abV kappa RNA. Images PMID:7816635

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

PubMed

Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

2013-12-01

Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

A host-restricted viral vector for antigen-specific immunization against Lyme disease pathogen.

PubMed

Xiao, Sa; Kumar, Manish; Yang, Xiuli; Akkoyunlu, Mustafa; Collins, Peter L; Samal, Siba K; Pal, Utpal

2011-07-18

Newcastle disease virus (NDV) is an avian virus that is attenuated in primates and is a potential vaccine vector for human use. We evaluated NDV as a vector for expressing selected antigens of the Lyme disease pathogen Borrelia burgdorferi. A series of recombinant NDVs were generated that expressed intracellular or extracellular forms of two B. burgdorferi antigens: namely, the basic membrane protein A (BmpA) and the outer surface protein C (OspC). Expression of the intracellular and extracellular forms of these antigens was confirmed in cultured chicken cells. C3H or Balb/C mice that were immunized intranasally with the NDV vectors mounted vigorous serum antibody responses against the NDV vector, but failed to mount a robust response against either the intracellular or extracellular forms of BmpA or OspC. By contrast, a single immunization of hamsters with the NDV vectors via the intranasal, intramuscular, or intraperitoneal route resulted in rapid and rigorous antibody responses against the intracellular or extracellular forms of BmpA and OspC. When groups of hamsters were separately inoculated with various NDV vectors and challenged with B. burgdorferi (10(8)cells/animal), immunization with vector expressing either intracellular or extracellular BmpA was associated with a significant reduction of the pathogen load in the joints. Taken together, our studies highlighted the importance of NDV as vaccine vector that can be used for simple yet effective immunization of hosts against bacterial infections including Lyme disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

The myeloid-binding peptide adenoviral vector enables multi-organ vascular endothelial gene targeting.

PubMed

Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M

2014-08-01

Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.

Molecular cloning and production of caprine recombinant Oct4 protein for generation induced pluripotent stem cells.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba

2015-12-01

Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.

Asian citrus psyllid RNAi pathway - RNAi evidence

USDA-ARS?s Scientific Manuscript database

In silico analyses of the draft genome of Diaphorina citri, the Asian citrus psyllid, for genes within the Ribonucleic acid interference(RNAi), pathway was successful. The psyllid is the vector of the plant-infecting bacterium, Candidatus Liberibacter asiaticus (CLas), which is linked to citrus gree...

Novel Methods for Mosquito Control using RNAi.

USDA-ARS?s Scientific Manuscript database

The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...

Fiber-based three-dimensional multi-mode interference device as efficient power divider and vector curvature sensor

NASA Astrophysics Data System (ADS)

Zhang, Ziyang; Fiebrandt, Julia; Haynes, Dionne; Sun, Kai; Madhav, Kalaga; Stoll, Andreas; Makan, Kirill; Makan, Vadim; Roth, Martin

2018-03-01

Three-dimensional multi-mode interference devices are demonstrated using a single-mode fiber (SMF) center-spliced to a section of polygon-shaped core multimode fiber (MMF). This simple structure can effectively generate well-localized self-focusing spots that match to the layout of a chosen multi-core fiber (MCF) as a launcher device. An optimized hexagon-core MMF can provide efficient coupling from a SMF to a 7-core MCF with an insertion loss of 0.6 dB and a power imbalance of 0.5 dB, while a square-core MMF can form a self-imaging pattern with symmetrically distributed 2 × 2, 3 × 3 or 4 × 4 spots. These spots can be directly received by a two-dimensional detector array. The device can work as a vector curvature sensor by comparing the relative power among the spots with a resolution of ∼0.1° over a 1.8 mm-long MMF.

Two different kinds of rogue waves in weakly crossing sea states

NASA Astrophysics Data System (ADS)

Ruban, V. P.

2009-06-01

Formation of giant waves in sea states with two spectral maxima centered at close wave vectors k0±Δk/2 in the Fourier plane is numerically simulated using the fully nonlinear model for long-crested water waves [V. P. Ruban, Phys. Rev. E 71, 055303(R) (2005)]. Depending on an angle θ between the vectors k0 and Δk , which determines a typical orientation of interference stripes in the physical plane, rogue waves arise having different spatial structure. If θ≲arctan(1/2) , then typical giant waves are relatively long fragments of essentially two-dimensional (2D) ridges, separated by wide valleys and consisting of alternating oblique crests and troughs. At nearly perpendicular k0 and Δk , the interference minima develop to coherent structures similar to the dark solitons of the nonlinear Schrodinger equation, and a 2D freak wave looks much as a piece of a one-dimensional freak wave bounded in the transversal direction by two such dark solitons.

Possible superconductivity in Sr₂IrO₄ probed by quasiparticle interference.

PubMed

Gao, Yi; Zhou, Tao; Huang, Huaixiang; Wang, Qiang-Hua

2015-03-18

Based on the possible superconducting (SC) pairing symmetries recently proposed, the quasiparticle interference (QPI) patterns in electron- and hole-doped Sr₂IrO₄ are theoretically investigated. In the electron-doped case, the QPI spectra can be explained based on a model similar to the octet model of the cuprates while in the hole-doped case, both the Fermi surface topology and the sign of the SC order parameter resemble those of the iron pnictides and there exists a QPI vector resulting from the interpocket scattering between the electron and hole pockets. In both cases, the evolution of the QPI vectors with energy and their behaviors in the nonmagnetic and magnetic impurity scattering cases can well be explained based on the evolution of the constant-energy contours and the sign structure of the SC order parameter. The QPI spectra presented in this paper can be compared with future scanning tunneling microscopy experiments to test whether there are SC phases in electron- and hole-doped Sr₂IrO₄ and what the pairing symmetry is.

Development of a domain-specific genetic language to design Chlamydomonas reinhardtii expression vectors.

PubMed

Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean

2014-01-15

Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.

An integrated vector system for cellular studies of phage display-derived peptides.

PubMed

Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

2002-09-15

Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

The small non-coding RNA response to virus infection in the Leishmania vector Lutzomyia longipalpis.

PubMed

Ferreira, Flávia Viana; Aguiar, Eric Roberto Guimarães Rocha; Olmo, Roenick Proveti; de Oliveira, Karla Pollyanna Vieira; Silva, Emanuele Guimarães; Sant'Anna, Maurício Roberto Viana; Gontijo, Nelder de Figueiredo; Kroon, Erna Geessien; Imler, Jean Luc; Marques, João Trindade

2018-06-01

Sandflies are well known vectors for Leishmania but also transmit a number of arthropod-borne viruses (arboviruses). Few studies have addressed the interaction between sandflies and arboviruses. RNA interference (RNAi) mechanisms utilize small non-coding RNAs to regulate different aspects of host-pathogen interactions. The small interfering RNA (siRNA) pathway is a broad antiviral mechanism in insects. In addition, at least in mosquitoes, another RNAi mechanism mediated by PIWI interacting RNAs (piRNAs) is activated by viral infection. Finally, endogenous microRNAs (miRNA) may also regulate host immune responses. Here, we analyzed the small non-coding RNA response to Vesicular stomatitis virus (VSV) infection in the sandfly Lutzoymia longipalpis. We detected abundant production of virus-derived siRNAs after VSV infection in adult sandflies. However, there was no production of virus-derived piRNAs and only mild changes in the expression of vector miRNAs in response to infection. We also observed abundant production of virus-derived siRNAs against two other viruses in Lutzomyia Lulo cells. Together, our results suggest that the siRNA but not the piRNA pathway mediates an antiviral response in sandflies. In agreement with this hypothesis, pre-treatment of cells with dsRNA against VSV was able to inhibit viral replication while knock-down of the central siRNA component, Argonaute-2, led to increased virus levels. Our work begins to elucidate the role of RNAi mechanisms in the interaction between L. longipalpis and viruses and should also open the way for studies with other sandfly-borne pathogens.

[Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

PubMed

Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

2012-11-04

To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.

Chromosomal integration of adenoviral vector DNA in vivo.

PubMed

Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan

2010-10-01

So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

MicroRNA-Regulated Non-Viral Vectors with Improved Tumor Specificity in an Orthotopic Rat Model of Hepatocellular Carcinoma

PubMed Central

Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.

2013-01-01

In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

PubMed Central

Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

2008-01-01

In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

VEST: Abstract Vector Calculus Simplification in Mathematica

DOE Office of Scientific and Technical Information (OSTI.GOV)

J. Squire, J. Burby and H. Qin

2013-03-12

We present a new package, VEST (Vector Einstein Summation Tools), that performs abstract vector calculus computations in Mathematica. Through the use of index notation, VEST is able to reduce scalar and vector expressions of a very general type using a systematic canonicalization procedure. In addition, utilizing properties of the Levi-Civita symbol, the program can derive types of multi-term vector identities that are not recognized by canonicalization, subsequently applying these to simplify large expressions. In a companion paper [1], we employ VEST in the automation of the calculation of Lagrangians for the single particle guiding center system in plasma physics, amore » computation which illustrates its ability to handle very large expressions. VEST has been designed to be simple and intuitive to use, both for basic checking of work and more involved computations. __________________________________________________« less

VEST: Abstract vector calculus simplification in Mathematica

NASA Astrophysics Data System (ADS)

Squire, J.; Burby, J.; Qin, H.

2014-01-01

We present a new package, VEST (Vector Einstein Summation Tools), that performs abstract vector calculus computations in Mathematica. Through the use of index notation, VEST is able to reduce three-dimensional scalar and vector expressions of a very general type to a well defined standard form. In addition, utilizing properties of the Levi-Civita symbol, the program can derive types of multi-term vector identities that are not recognized by reduction, subsequently applying these to simplify large expressions. In a companion paper Burby et al. (2013) [12], we employ VEST in the automation of the calculation of high-order Lagrangians for the single particle guiding center system in plasma physics, a computation which illustrates its ability to handle very large expressions. VEST has been designed to be simple and intuitive to use, both for basic checking of work and more involved computations.

A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

PubMed

Balakrishnan, R; Bolten, B; Backman, K C

1994-01-28

A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

Silencing Genes in the Heart.

PubMed

Fechner, Henry; Vetter, Roland; Kurreck, Jens; Poller, Wolfgang

2017-01-01

Silencing of cardiac genes by RNA interference (RNAi) has developed into a powerful new method to treat cardiac diseases. Small interfering (si)RNAs are the inducers of RNAi, but cultured primary cardiomyocytes and heart are highly resistant to siRNA transfection. This can be overcome by delivery of small hairpin (sh)RNAs or artificial microRNA (amiRNAs) by cardiotropic adeno-associated virus (AAV) vectors. Here we describe as example of the silencing of a cardiac gene, the generation and cloning of shRNA, and amiRNAs directed against the cardiac protein phospholamban. We further describe the generation of AAV shuttle plasmids with self complementary vector genomes, the production of AAV vectors in roller bottles, and their purification via iodixanol gradient centrifugation and concentration with filter systems. Finally we describe the preparation of primary neonatal rat cardiomyocytes (PNRC), the transduction of PNRC with AAV vectors, and the maintenance of the transduced cell culture.

Development of a vector-tensor system to measure the absolute magnetic flux density and its gradient in magnetically shielded rooms.

PubMed

Voigt, J; Knappe-Grüneberg, S; Gutkelch, D; Haueisen, J; Neuber, S; Schnabel, A; Burghoff, M

2015-05-01

Several experiments in fundamental physics demand an environment of very low, homogeneous, and stable magnetic fields. For the magnetic characterization of such environments, we present a portable SQUID system that measures the absolute magnetic flux density vector and the gradient tensor. This vector-tensor system contains 13 integrated low-critical temperature (LTc) superconducting quantum interference devices (SQUIDs) inside a small cylindrical liquid helium Dewar with a height of 31 cm and 37 cm in diameter. The achievable resolution depends on the flux density of the field under investigation and its temporal drift. Inside a seven-layer mu-metal shield, an accuracy better than ±23 pT for the components of the static magnetic field vector and ±2 pT/cm for each of the nine components of the gradient tensor is reached by using the shifting method.

Development of a vector-tensor system to measure the absolute magnetic flux density and its gradient in magnetically shielded rooms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Voigt, J.; Knappe-Grüneberg, S.; Gutkelch, D.

2015-05-15

Several experiments in fundamental physics demand an environment of very low, homogeneous, and stable magnetic fields. For the magnetic characterization of such environments, we present a portable SQUID system that measures the absolute magnetic flux density vector and the gradient tensor. This vector-tensor system contains 13 integrated low-critical temperature (LTc) superconducting quantum interference devices (SQUIDs) inside a small cylindrical liquid helium Dewar with a height of 31 cm and 37 cm in diameter. The achievable resolution depends on the flux density of the field under investigation and its temporal drift. Inside a seven-layer mu-metal shield, an accuracy better than ±23more » pT for the components of the static magnetic field vector and ±2 pT/cm for each of the nine components of the gradient tensor is reached by using the shifting method.« less

Gravity anomalies without geomagnetic disturbances interfere with pigeon homing--a GPS tracking study.

PubMed

Blaser, Nicole; Guskov, Sergei I; Entin, Vladimir A; Wolfer, David P; Kanevskyi, Valeryi A; Lipp, Hans-Peter

2014-11-15

The gravity vector theory postulates that birds determine their position to set a home course by comparing the memorized gravity vector at the home loft with the local gravity vector at the release site, and that they should adjust their flight course to the gravity anomalies encountered. As gravity anomalies are often intermingled with geomagnetic anomalies, we released experienced pigeons from the center of a strong circular gravity anomaly (25 km diameter) not associated with magnetic anomalies and from a geophysical control site, equidistant from the home loft (91 km). After crossing the border zone of the anomaly--expected to be most critical for pigeon navigation--they dispersed significantly more than control birds, except for those having met a gravity anomaly en route. These data increase the credibility of the gravity vector hypothesis. © 2014. Published by The Company of Biologists Ltd.

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema

PubMed Central

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-01-01

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25–6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5–4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = −0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema. PMID:25657707

Gene interference regulates aquaporin-4 expression in swollen tissue of rats with cerebral ischemic edema: Correlation with variation in apparent diffusion coefficient.

PubMed

Hu, Hui; Lu, Hong; He, Zhanping; Han, Xiangjun; Chen, Jing; Tu, Rong

2012-07-25

To investigate the effects of mRNA interference on aquaporin-4 expression in swollen tissue of rats with ischemic cerebral edema, and diagnose the significance of diffusion-weighted MRI, we injected 5 μL shRNA- aquaporin-4 (control group) or siRNA- aquaporin-4 solution (1:800) (RNA interference group) into the rat right basal ganglia immediately before occlusion of the middle cerebral artery. At 0.25 hours after occlusion of the middle cerebral artery, diffusion-weighted MRI displayed a high signal; within 2 hours, the relative apparent diffusion coefficient decreased markedly, aquaporin-4 expression increased rapidly, and intracellular edema was obviously aggravated; at 4 and 6 hours, the relative apparent diffusion coefficient slowly returned to control levels, aquaporin-4 expression slightly increased, and angioedema was observed. In the RNA interference group, during 0.25-6 hours after injection of siRNA- aquaporin-4 solution, the relative apparent diffusion coefficient slightly fluctuated and aquaporin-4 expression was upregulated; during 0.5-4 hours, the relative apparent diffusion coefficient was significantly higher, while aquaporin-4 expression was significantly lower when compared with the control group, and intracellular edema was markedly reduced; at 0.25 and 6 hours, the relative apparent diffusion coefficient and aquaporin-4 expression were similar when compared with the control group; obvious angioedema remained at 6 hours. Pearson's correlation test results showed that aquaporin-4 expression was negatively correlated with the apparent diffusion coefficient (r = -0.806, P < 0.01). These findings suggest that upregulated aquaporin-4 expression is likely to be the main molecular mechanism of intracellular edema and may be the molecular basis for decreased relative apparent diffusion coefficient. Aquaporin-4 gene interference can effectively inhibit the upregulation of aquaporin-4 expression during the stage of intracellular edema with time-effectiveness. Moreover, diffusion-weighted MRI can accurately detect intracellular edema.

An optimized ERP brain-computer interface based on facial expression changes.

PubMed

Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

2014-06-01

Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

An optimized ERP brain-computer interface based on facial expression changes

NASA Astrophysics Data System (ADS)

Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

2014-06-01

Objective. Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Approach. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. Main results. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). Significance. The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

PubMed

Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

2016-10-01

Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

AAV vector-mediated secretion of chondroitinase provides a sensitive tracer for axonal arborisations.

PubMed

Alves, João Nuno; Muir, Elizabeth M; Andrews, Melissa R; Ward, Anneliese; Michelmore, Nicholas; Dasgupta, Debayan; Verhaagen, Joost; Moloney, Elizabeth B; Keynes, Roger J; Fawcett, James W; Rogers, John H

2014-04-30

As part of a project to express chondroitinase ABC (ChABC) in neurons of the central nervous system, we have inserted a modified ChABC gene into an adeno-associated viral (AAV) vector and injected it into the vibrissal motor cortex in adult rats to determine the extent and distribution of expression of the enzyme. A similar vector for expression of green fluorescent protein (GFP) was injected into the same location. For each vector, two versions with minor differences were used, giving similar results. After 4 weeks, the brains were stained to show GFP and products of chondroitinase digestion. Chondroitinase was widely expressed, and the AAV-ChABC and AAV-GFP vectors gave similar expression patterns in many respects, consistent with the known projections from the directly transduced neurons in vibrissal motor cortex and adjacent cingulate cortex. In addition, diffusion of vector to deeper neuronal populations led to labelling of remote projection fields which was much more extensive with AAV-ChABC than with AAV-GFP. The most notable of these populations are inferred to be neurons of cortical layer 6, projecting widely in the thalamus, and neurons of the anterior pole of the hippocampus, projecting through most of the hippocampus. We conclude that, whereas GFP does not label the thinnest axonal branches of some neuronal types, chondroitinase is efficiently secreted from these arborisations and enables their extent to be sensitively visualised. After 12 weeks, chondroitinase expression was undiminished. Copyright © 2014 Elsevier B.V. All rights reserved.

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Live attenuated rubella vectors expressing SIV and HIV vaccine antigens replicate and elicit durable immune responses in rhesus macaques

PubMed Central

2013-01-01

Background Live attenuated viruses are among our most potent and effective vaccines. For human immunodeficiency virus, however, a live attenuated strain could present substantial safety concerns. We have used the live attenuated rubella vaccine strain RA27/3 as a vector to express SIV and HIV vaccine antigens because its safety and immunogenicity have been demonstrated in millions of children. One dose protects for life against rubella infection. In previous studies, rubella vectors replicated to high titers in cell culture while stably expressing SIV and HIV antigens. Their viability in vivo, however, as well as immunogenicity and antibody persistence, were unknown. Results This paper reports the first successful trial of rubella vectors in rhesus macaques, in combination with DNA vaccines in a prime and boost strategy. The vectors grew robustly in vivo, and the protein inserts were highly immunogenic. Antibody titers elicited by the SIV Gag vector were greater than or equal to those elicited by natural SIV infection. The antibodies were long lasting, and they were boosted by a second dose of replication-competent rubella vectors given six months later, indicating the induction of memory B cells. Conclusions Rubella vectors can serve as a vaccine platform for safe delivery and expression of SIV and HIV antigens. By presenting these antigens in the context of an acute infection, at a high level and for a prolonged duration, these vectors can stimulate a strong and persistent immune response, including maturation of memory B cells. Rhesus macaques will provide an ideal animal model for demonstrating immunogenicity of novel vectors and protection against SIV or SHIV challenge. PMID:24041113

A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

PubMed Central

Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

2010-01-01

Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

PubMed

Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

2014-01-01

Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

PubMed

Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

2008-04-01

Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

PubMed Central

Ford, Kathryn L.; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M.; Foster, Gary D.

2016-01-01

Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

Hypoxia/hepatoma dual specific suicide gene expression plasmid delivery using bio-reducible polymer for hepatocellular carcinoma therapy.

PubMed

Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan

2013-10-10

Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.

Helper-dependent adenovirus achieve more efficient and persistent liver transgene expression in non-human primates under immunosuppression.

PubMed

Unzu, C; Melero, I; Hervás-Stubbs, S; Sampedro, A; Mancheño, U; Morales-Kastresana, A; Serrano-Mendioroz, I; de Salamanca, R E; Benito, A; Fontanellas, A

2015-11-01

Helper-dependent adenoviral (HDA) vectors constitute excellent gene therapy tools for metabolic liver diseases. We have previously shown that an HDA vector encoding human porphobilinogen deaminase (PBGD) corrects acute intermittent porphyria mice. Now, six non-human primates were injected in the left hepatic lobe with the PBGD-encoding HDA vector to study levels and persistence of transgene expression. Intrahepatic administration of 5 × 10(12) viral particles kg(-1) (10(10) infective units kg(-1)) of HDA only resulted in transient (≈14 weeks) transgene expression in one out of three individuals. In contrast, a more prolonged 90-day immunosuppressive regimen (tacrolimus, mycophenolate, rituximab and steroids) extended meaningful transgene expression for over 76 weeks in two out of two cases. Transgene expression under immunosuppression (IS) reached maximum levels 6 weeks after HDA administration and gradually declined reaching a stable plateau within the therapeutic range for acute porphyria. The non-injected liver lobes also expressed the transgene because of vector circulation. IS controlled anticapsid T-cell responses and decreased the induction of neutralizing antibodies. Re-administration of HDA-hPBGD at week +78 achieved therapeutically meaningful transgene expression only in those animals receiving IS again at the time of this second vector exposure. Overall, immunity against adenoviral capsids poses serious hurdles for long-term HDA-mediated liver transduction, which can be partially circumvented by pharmacological IS.

Challenging assumptions of notational transparency: the case of vectors in engineering mathematics

NASA Astrophysics Data System (ADS)

Craig, Tracy S.

2017-11-01

The notation for vector analysis has a contentious nineteenth century history, with many different notations describing the same or similar concepts competing for use. While the twentieth century has seen a great deal of unification in vector analysis notation, variation still remains. In this paper, the two primary notations used for expressing the components of a vector are discussed in historical and current context. Popular mathematical texts use the two notations as if they are transparent and interchangeable. In this research project, engineering students' proficiency at vector analysis was assessed and the data were analyzed using the Rasch measurement method. Results indicate that the students found items expressed in unit vector notation more difficult than those expressed in parenthesis notation. The expert experience of notation as transparent and unproblematically symbolic of underlying processes independent of notation is shown to contrast with the student experience where the less familiar notation is experienced as harder to work with.

Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules

PubMed Central

Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.

2011-01-01

Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

PubMed Central

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

PubMed Central

Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

2000-01-01

We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

Modified Newcastle disease virus vectors expressing the H5 hemagglutinin induce enhanced protection against highly pathogenic H5N1 avian influenza virus in chickens

PubMed Central

Kim, Shin-Hee; Paldurai, Anandan; Xiao, Sa; Collins, Peter L.; Samal, Siba K.

2016-01-01

Naturally-occurring attenuated strains of Newcastle disease virus (NDV) are being developed as vaccine vectors for use in poultry and humans. However, some NDV strains, such as Beaudette C (BC), may retain too much virulence in poultry for safe use, and more highly attenuated strains may be suboptimally immunogenic. We therefore modified the BC strain by changing the multibasic cleavage site sequence of the F protein to the dibasic sequence of avirulent strain LaSota. Additionally, the BC, F, and HN proteins were modified in several ways to enhance virus replication. These modified BC-derived vectors and the LaSota strain were engineered to express the hemagglutin (HA) protein of H5N1 highly pathogenic influenza virus (HPAIV). In general, the modified BC-based vectors expressing HA replicated better than LaSota/HA, and expressed higher levels of HA protein. Pathogenicity tests indicated that all the modified viruses were highly attenuated in chickens. Based on in vitro characterization, two of the modified BC vectors were chosen for evaluation in chickens as vaccine vectors against H5N1 HPAIV A/Vietnam/1203/04. Immunization of chickens with rNDV vector vaccines followed by challenge with HPAIV demonstrated high levels of protection against clinical disease and mortality. However, only those chickens immunized with modified BC/HA in which residues 271–330 from the F protein had been replaced with the corresponding sequence from the NDV AKO strain conferred complete protection against challenge virus shedding. Our findings suggest that this modified rNDV can be used safely as a vaccine vector with enhanced replication, expression, and protective efficacy in avian species, and potentially in humans. PMID:24968158

A CGMMV genome-replicon vector with partial sequences of coat protein gene efficiently expresses GFP in Nicotiana benthamiana.

PubMed

Jailani, A Abdul Kader; Solanki, Vikas; Roy, Anirban; Sivasudha, T; Mandal, Bikash

2017-04-02

A highly infectious clone of Cucumber green mottle mosaic virus (CGMMV), a cucurbit-infecting tobamovirus was utilized for designing of gene expression vectors. Two versions of vector were examined for their efficacy in expressing the green fluorescent protein (GFP) in Nicotiana benthamiana. When the GFP gene was inserted at the stop codon of coat protein (CP) gene of the CGMMV genome without any read-through codon, systemic expression of GFP, as well as virion formation and systemic symptoms expression were obtained in N. benthamiana. The qRT-PCR analysis showed 23 fold increase of GFP over actin at 10days post inoculation (dpi), which increased to 45 fold at 14dpi and thereafter the GFP expression was significantly declined. Further, we show that when the most of the CP sequence is deleted retaining only the first 105 nucleotides, the shortened vector containing GFP in frame of original CP open reading frame (ORF) resulted in 234 fold increase of GFP expression over actin at 5dpi in N. benthamiana without the formation of virions and disease symptoms. Our study demonstrated that a simple manipulation of CP gene in the CGMMV genome while preserving the translational frame of CP resulted in developing a virus-free, rapid and efficient foreign protein expression system in the plant. The CGMMV based vectors developed in this study may be potentially useful for the production of edible vaccines in cucurbits. Copyright © 2017 Elsevier B.V. All rights reserved.

A genetically adjuvanted influenza B virus vector increases immunogenicity and protective efficacy in mice.

PubMed

Kittel, Christian; Wressnigg, Nina; Shurygina, Anna Polina; Wolschek, Markus; Stukova, Marina; Romanovskaya-Romanko, Ekatherina; Romanova, Julia; Kiselev, Oleg; Muster, Thomas; Egorov, Andrej

2015-10-01

The existence of multiple antigenically distinct types and subtypes of influenza viruses allows the construction of a multivalent vector system for the mucosal delivery of foreign sequences. Influenza A viruses have been exploited successfully for the expression of extraneous antigens as well as immunostimulatory molecules. In this study, we describe the development of an influenza B virus vector whose functional part of the interferon antagonist NS1 was replaced by human interleukin 2 (IL2) as a genetic adjuvant. We demonstrate that IL2 expressed by this viral vector displays immune adjuvant activity in immunized mice. Animals vaccinated with the IL2 viral vector showed an increased hemagglutination inhibition antibody response and higher protective efficacy after challenge with a wild-type influenza B virus when compared to mice vaccinated with a control virus. Our results demonstrate that it is feasible to construct influenza B vaccine strains expressing immune-potentiating foreign sequences from the NS genomic segment. Based on these data, it is now hypothetically possible to create a trivalent (or quadrivalent) live attenuated influenza vaccine in which each component expresses a selected genetic adjuvant with tailored expression levels.

Cytomegalovirus vector expressing RAE-1γ induces enhanced anti-tumor capacity of murine CD8+ T cells.

PubMed

Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan

2017-08-01

Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

Correction of Murine Sickle Cell Disease Using γ-Globin Lentiviral Vectors to Mediate High-level Expression of Fetal Hemoglobin

PubMed Central

Pestina, Tamara I; Hargrove, Phillip W; Jay, Dennis; Gray, John T; Boyd, Kelli M; Persons, Derek A

2008-01-01

Increased levels of red cell fetal hemogloblin, whether due to hereditary persistence of expression or from induction with hydroxyurea therapy, effectively ameliorate sickle cell disease (SCD). Therefore, we developed erythroid-specific, γ-globin lentiviral vectors for hematopoietic stem cell (HSC)-targeted gene therapy with the goal of permanently increasing fetal hemoglobin (HbF) production in sickle red cells. We evaluated two different γ-globin lentiviral vectors for therapeutic efficacy in the BERK sickle cell mouse model. The first vector, V5, contained the γ-globin gene driven by 3.1 kb of β-globin regulatory sequences and a 130-bp β-globin promoter. The second vector, V5m3, was identical except that the γ-globin 3′-untranslated region (3′-UTR) was replaced with the β-globin 3′-UTR. Adult erythroid cells have β-globin mRNA 3′-UTR-binding proteins that enhance β-globin mRNA stability and we postulated this design might enhance γ-globin expression. Stem cell gene transfer was efficient and nearly all red cells in transplanted mice expressed human γ-globin. Both vectors demonstrated efficacy in disease correction, with the V5m3 vector producing a higher level of γ-globin mRNA which was associated with high-level correction of anemia and secondary organ pathology. These data support the rationale for a gene therapy approach to SCD by permanently enhancing HbF using a γ-globin lentiviral vector. PMID:19050697

Large area and deep sub-wavelength interference lithography employing odd surface plasmon modes.

PubMed

Liu, Liqin; Luo, Yunfei; Zhao, Zeyu; Zhang, Wei; Gao, Guohan; Zeng, Bo; Wang, Changtao; Luo, Xiangang

2016-07-28

In this paper, large area and deep sub-wavelength interference patterns are realized experimentally by using odd surface plasmon modes in the metal/insulator/metal structure. Theoretical investigation shows that the odd modes possesses much higher transversal wave vector and great inhibition of tangential electric field components, facilitating surface plasmon interference fringes with high resolution and contrast in the measure of electric field intensity. Interference resist patterns with 45 nm (∼λ/8) half-pitch, 50 nm depth, and area size up to 20 mm × 20 mm were obtained by using 20 nm Al/50 nm photo resist/50 nm Al films with greatly reduced surface roughness and 180 nm pitch exciting grating fabricated with conventional laser interference lithography. Much deeper resolution down to 19.5 nm is also feasible by decreasing the thickness of PR. Considering that no requirement of expensive EBL or FIB tools are employed, it provides a cost-effective way for large area and nano-scale fabrication.

Molecular design for recombinant adeno-associated virus (rAAV) vector production.

PubMed

Aponte-Ubillus, Juan Jose; Barajas, Daniel; Peltier, Joseph; Bardliving, Cameron; Shamlou, Parviz; Gold, Daniel

2018-02-01

Recombinant adeno-associated virus (rAAV) vectors are increasingly popular tools for gene therapy applications. Their non-pathogenic status, low inflammatory potential, availability of viral serotypes with different tissue tropisms, and prospective long-lasting gene expression are important attributes that make rAAVs safe and efficient therapeutic options. Over the last three decades, several groups have engineered recombinant AAV-producing platforms, yielding high titers of transducing vector particles. Current specific productivity yields from different platforms range from 10 3 to 10 5 vector genomes (vg) per cell, and there is an ongoing effort to improve vector yields in order to satisfy high product demands required for clinical trials and future commercialization.Crucial aspects of vector production include the molecular design of the rAAV-producing host cell line along with the design of AAV genes, promoters, and regulatory elements. Appropriately, configuring and balancing the expression of these elements not only contributes toward high productivity, it also improves process robustness and product quality. In this mini-review, the rational design of rAAV-producing expression systems is discussed, with special attention to molecular strategies that contribute to high-yielding, biomanufacturing-amenable rAAV production processes. Details on molecular optimization from four rAAV expression systems are covered: adenovirus, herpesvirus, and baculovirus complementation systems, as well as a recently explored yeast expression system.

Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches

PubMed Central

Hoffmann, Stefan A.; Kruse, Sabrina M.; Arndt, Katja M.

2016-01-01

Abstract We have investigated transcriptional interference between convergent genes in E. coli and demonstrate substantial interference for inter-promoter distances of as far as 3 kb. Interference can be elicited by both strong σ70 dependent and T7 promoters. In the presented design, a strong promoter driving gene expression of a ‘forward’ gene interferes with the expression of a ‘reverse’ gene by a weak promoter. This arrangement allows inversely correlated gene expression without requiring further regulatory components. Thus, modulation of the activity of the strong promoter alters expression of both the forward and the reverse gene. We used this design to develop a dual selection system for conditional operator site binding, allowing positive selection both for binding and for non-binding to DNA. This study demonstrates the utility of this novel system using the Lac repressor as a model protein for conditional DNA binding, and spectinomycin and chloramphenicol resistance genes as positive selection markers in liquid culture. Randomized LacI libraries were created and subjected to subsequent dual selection, but mispairing IPTG and selection cues in respect to the wild-type LacI response, allowing the isolation of a LacI variant with a reversed IPTG response within three rounds of library generation and dual selection. PMID:26932362

Tombusvirus-based vector systems to permit over-expression of genes or that serve as sensors of antiviral RNA silencing in plants.

PubMed

Shamekova, Malika; Mendoza, Maria R; Hsieh, Yi-Cheng; Lindbo, John; Omarov, Rustem T; Scholthof, Herman B

2014-03-01

A next generation Tomato bushy stunt virus (TBSV) coat protein gene replacement vector system is described that can be applied by either RNA inoculation or through agroinfiltration. A vector expressing GFP rapidly yields high levels of transient gene expression in inoculated leaves of various plant species, as illustrated for Nicotiana benthamiana, cowpea, tomato, pepper, and lettuce. A start-codon mutation to down-regulate the dose of the P19 silencing suppressor reduces GFP accumulation, whereas mutations that result in undetectable levels of P19 trigger rapid silencing of GFP. Compared to existing virus vectors the TBSV system has a unique combination of a very broad host range, rapid and high levels of replication and gene expression, and the ability to regulate its suppressor. These features are attractive for quick transient assays in numerous plant species for over-expression of genes of interest, or as a sensor to monitor the efficacy of antiviral RNA silencing. Copyright © 2014. Published by Elsevier Inc.

RNA interference of argininosuccinate synthetase restores sensitivity to recombinant arginine deiminase (rADI) in resistant cancer cells

PubMed Central

2011-01-01

Background Sensitivity of cancer cells to recombinant arginine deiminase (rADI) depends on expression of argininosuccinate synthetase (AS), a rate-limiting enzyme in synthesis of arginine from citrulline. To understand the efficiency of RNA interfering of AS in sensitizing the resistant cancer cells to rADI, the down regulation of AS transiently and permanently were performed in vitro, respectively. Methods We studied the use of down-regulation of this enzyme by RNA interference in three human cancer cell lines (A375, HeLa, and MCF-7) as a way to restore sensitivity to rADI in resistant cells. The expression of AS at levels of mRNA and protein was determined to understand the effect of RNA interference. Cell viability, cell cycle, and possible mechanism of the restore sensitivity of AS RNA interference in rADI treated cancer cells were evaluated. Results AS DNA was present in all cancer cell lines studied, however, the expression of this enzyme at the mRNA and protein level was different. In two rADI-resistant cell lines, one with endogenous AS expression (MCF-7 cells) and one with induced AS expression (HeLa cells), AS small interference RNA (siRNA) inhibited 37-46% of the expression of AS in MCF-7 cells. ASsiRNA did not affect cell viability in MCF-7 which may be due to the certain amount of residual AS protein. In contrast, ASsiRNA down-regulated almost all AS expression in HeLa cells and caused cell death after rADI treatment. Permanently down-regulated AS expression by short hairpin RNA (shRNA) made MCF-7 cells become sensitive to rADI via the inhibition of 4E-BP1-regulated mTOR signaling pathway. Conclusions Our results demonstrate that rADI-resistance can be altered via AS RNA interference. Although transient enzyme down-regulation (siRNA) did not affect cell viability in MCF-7 cells, permanent down-regulation (shRNA) overcame the problem of rADI-resistance due to the more efficiency in AS silencing. PMID:21453546

Different effects of enhanced and reduced expression of pub gene on the formation of embryoid bodies by cultured embryonic mouse stem cell.

PubMed

Novosadova, E V; Manuilova, E S; Arsen'eva, E L; Khaidarova, N V; Dolotov, O V; Inozemtseva, L S; Kozachenkov, K Yu; Tarantul, V Z; Grivennikov, I A

2005-07-01

The effects of pub gene on proliferation and initial stages of differentiation of embryonic mouse stem cells were studied in vitro. To this end we used enhanced expression of human pub gene (hpub) and suppression of expression of mouse endogenous pub gene with RNA-interference in embryonic stem cells. Proliferative activity of genetically modified polyclonal lines of the embryonic stem cells transfected with plasmids carrying expressing hpub gene or plasmids generating small interference RNA to this gene did not differ from that of the control cells. Inhibition of expression of endogenous pub gene in embryonic stem cells using small interference RNA 2-fold decreased the formation of embryoid bodies, at the same time additional expression of exogenous hpub gene almost 2-fold increased their number in comparison with the control. It was hypothesized that pub gene participates in early stages of differentiation of embryonic stem cells leading to the formation of embryoid bodies.

Protection against California 2002 NDV strain afforded by adenovirus vectored vaccine expressing Fusion or Hemagglutination-neuraminidase genes

USDA-ARS?s Scientific Manuscript database

Vectored vaccines expressing the combination of the hemagglutinin-neuraminidase (HN) and fusion (F) genes generally have better clinical protection against Newcastle disease virus (NDV) than when either the F and HN genes are expressed alone. Interestingly, the protection induced by F is usually bet...

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Vaccination With a Highly Attenuated Recombinant Vesicular Stomatitis Virus Vector Protects Against Challenge With a Lethal Dose of Ebola Virus

PubMed Central

Matassov, Demetrius; Marzi, Andrea; Latham, Terri; Xu, Rong; Ota-Setlik, Ayuko; Feldmann, Friederike; Geisbert, Joan B.; Mire, Chad E.; Hamm, Stefan; Nowak, Becky; Egan, Michael A.; Geisbert, Thomas W.; Eldridge, John H.; Feldmann, Heinz; Clarke, David K.

2015-01-01

Previously, recombinant vesicular stomatitis virus (rVSV) pseudotypes expressing Ebolavirus glycoproteins (GPs) in place of the VSV G protein demonstrated protection of nonhuman primates from lethal homologous Ebolavirus challenge. Those pseudotype vectors contained no additional attenuating mutations in the rVSV genome. Here we describe rVSV vectors containing a full complement of VSV genes and expressing the Ebola virus (EBOV) GP from an additional transcription unit. These rVSV vectors contain the same combination of attenuating mutations used previously in the clinical development pathway of an rVSV/human immunodeficiency virus type 1 vaccine. One of these rVSV vectors (N4CT1-EBOVGP1), which expresses membrane-anchored EBOV GP from the first position in the genome (GP1), elicited a balanced cellular and humoral GP-specific immune response in mice. Guinea pigs immunized with a single dose of this vector were protected from any signs of disease following lethal EBOV challenge, while control animals died in 7–9 days. Subsequently, N4CT1-EBOVGP1 demonstrated complete, single-dose protection of 2 macaques following lethal EBOV challenge. A single sham-vaccinated macaque died from disease due to EBOV infection. These results demonstrate that highly attenuated rVSV vectors expressing EBOV GP may provide safer alternatives to current EBOV vaccines. PMID:26109675

Energy gap formation mechanism through the interference phenomena of electrons in face-centered cubic elements and compounds with the emphasis on half-Heusler and Heusler compounds

NASA Astrophysics Data System (ADS)

Mizutani, U.; Sato, H.

2018-05-01

Many face-centred cubic elements and compounds with the number of atoms per unit cell N equal to 8, 12 and 16 are known to be stabilised by forming either a band gap or a pseudogap at the Fermi level. They are conveniently expressed as cF8, cF12 and cF16, respectively, in the Pearson symbol. From the cF8 family, we worked on three tetravalent elements C (diamond), Si and Ge, SZn-type AsGa compound and NaCl-type compounds like BiLu, AsSc, etc. From the cF12 family, more than 80 compounds were selected, with a particular emphasis on ABC- and half-Heusler-type ternary equiatomic compounds. Among cF16 compounds, both the Heusler compounds ABC2 and Zintl compounds were studied. We revealed that, regardless of whether or not the transition metal (TM) and/or rare-earth (RE) elements are involved as constituent elements, the energy gap formation mechanism for cF8, cF12 and cF16 compounds can be universally discussed in terms of interference phenomenon of itinerant electrons with set of reciprocal lattice planes with ? = 8, 11 and 12, where ? refers to square of the critical reciprocal of lattice vector of an fcc lattice. The number of itinerant electrons per unit cell, e/uc, for all these band gap/pseudogap-bearing compounds is found to fall on a universal line called "3/2-power law" when plotted against ? on a logarithmic scale. This proves the validity of the fulfilment of the interference condition ? in conformity with other pseudogap compounds with different crystal symmetries and different sizes of the unit cell reported in literature.

Repeat Transduction in the Mouse Lung by Using Adeno-Associated Virus Vectors with Different Serotypes

PubMed Central

Halbert, Christine L.; Rutledge, Elizabeth A.; Allen, James M.; Russell, David W.; Miller, A. Dusty

2000-01-01

Vectors derived from adeno-associated virus type 2 (AAV2) promote gene transfer and expression in the lung; however, we have found that while gene expression can persist for at least 8 months in mice, it was reduced dramatically in rabbits over a period of 2 months. The efficiency and persistence of AAV2-mediated gene expression in the human lung have yet to be determined, but it seems likely that readministration will be necessary over the lifetime of an individual. Unfortunately, we have found that transduction by a second administration of an AAV2 vector is blocked, presumably due to neutralizing antibodies generated in response to the primary vector exposure. Here, we have explored the use of AAV2 vectors pseudotyped with capsid proteins from AAV serotypes 2, 3, and 6 for readministration in the mouse lung. We found that an AAV6 vector transduced airway epithelial and alveolar cells in the lung at rates that were at least as high as those of AAV2 pseudotype vectors, while transduction rates mediated by AAV3 were much lower. AAV6 pseudotype vector transduction was unaffected by prior administration of an AAV2 or AAV3 vector, and transduction by an AAV2 pseudotype vector was unaffected by prior AAV6 vector administration, showing that cross-reactive neutralizing antibodies against AAV2 and AAV6 are not generated in mice. Interestingly, while prior administration of an AAV2 vector completely blocked transduction by a second AAV2 pseudotype vector, prior administration of an AAV6 vector only partially inhibited transduction by a second administration of an AAV6 pseudotype vector. Analysis of sera obtained from mice and humans showed that AAV6 is less immunogenic than AAV2, which helps explain this finding. These results support the development of AAV6 vectors for lung gene therapy both alone and in combination with AAV2 vectors. PMID:10627564

Scarless genome editing and stable inducible expression vectors for Geobacter sulfurreducens

DOE PAGES

Chan, Chi Ho; Levar, Caleb E.; Zacharoff, Lori; ...

2015-08-07

Metal reduction by members of the Geobacteraceae is encoded by multiple gene clusters, and the study of extracellular electron transfer often requires biofilm development on surfaces. Genetic tools that utilize polar antibiotic cassette insertions limit mutant construction and complementation. In addition, unstable plasmids create metabolic burdens that slow growth, and the presence of antibiotics such as kanamycin can interfere with the rate and extent of Geobacter biofilm growth. We report here genetic system improvements for the model anaerobic metal-reducing bacterium Geobacter sulfurreducens. A motile strain of G. sulfurreducens was constructed by precise removal of a transposon interrupting the fgrM flagellarmore » regulator gene using SacB/sucrose counterselection, and Fe(III) citrate reduction was eliminated by deletion of the gene encoding the inner membrane cytochrome imcH. We also show that RK2-based plasmids were maintained in G. sulfurreducens for over 15 generations in the absence of antibiotic selection in contrast to unstable pBBR1 plasmids. Therefore, we engineered a series of new RK2 vectors containing native constitutive Geobacter promoters, and modified one of these promoters for VanR-dependent induction by the small aromatic carboxylic acid vanillate. Inducible plasmids fully complemented Δ imcH mutants for Fe(III) reduction, Mn(IV) oxide reduction, and growth on poised electrodes. A real-time, high-throughput Fe(III) citrate reduction assay is described that can screen numerous G. sulfurreducens strain constructs simultaneously and shows the sensitivity of imcH expression by the vanillate system. Lastly, these tools will enable more sophisticated genetic studies in G. sulfurreducens without polar insertion effects or need for multiple antibiotics.« less

Development of novel cardiovascular therapeutics from small regulatory RNA molecules--an outline of key requirements.

PubMed

Poller, W; Fechner, H

2010-01-01

Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.

Rotations with Rodrigues' Vector

ERIC Educational Resources Information Center

Pina, E.

2011-01-01

The rotational dynamics was studied from the point of view of Rodrigues' vector. This vector is defined here by its connection with other forms of parametrization of the rotation matrix. The rotation matrix was expressed in terms of this vector. The angular velocity was computed using the components of Rodrigues' vector as coordinates. It appears…

Rule-Based Design of Plant Expression Vectors Using GenoCAD.

PubMed

Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean

2015-01-01

Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.

The prospect of gene therapy for prostate cancer: update on theory and status.

PubMed

Koeneman, K S; Hsieh, J T

2001-09-01

Molecularly based novel therapeutic agents are needed to address the problem of locally recurrent, or metastatic, advanced hormone-refractory prostate cancer. Recent basic science advances in mechanisms of gene expression, vector delivery, and targeting have rendered clinically relevant gene therapy to the prostatic fossa and distant sites feasible in the near future. Current research and clinical investigative efforts involving methods for more effective vector delivery and targeting, with enhanced gene expression to selected (specific) sites, are reviewed. These areas of research involve tissue-specific promoters, transgene exploration, vector design and delivery, and selective vector targeting. The 'vectorology' involved mainly addresses selective tissue homing with ligands, mechanisms of innate immune system evasion for durable transgene expression, and the possibility of repeat administration.

Bringing RNA Interference (RNAi) into the High School Classroom

ERIC Educational Resources Information Center

Sengupta, Sibani

2013-01-01

RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

Construction, expression and in vitro biological behaviors of Ig scFv fragment in patients with chronic B cell leukemia.

PubMed

Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin

2006-01-01

The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.

Improved muscle-derived expression of human coagulation factor IX from a skeletal actin/CMV hybrid enhancer/promoter.

PubMed

Hagstrom, J N; Couto, L B; Scallan, C; Burton, M; McCleland, M L; Fields, P A; Arruda, V R; Herzog, R W; High, K A

2000-04-15

Hemophilia B is caused by the absence of functional coagulation factor IX (F.IX) and represents an important model for treatment of genetic diseases by gene therapy. Recent studies have shown that intramuscular injection of an adeno-associated viral (AAV) vector into mice and hemophilia B dogs results in vector dose-dependent, long-term expression of biologically active F.IX at therapeutic levels. In this study, we demonstrate that levels of expression of approximately 300 ng/mL (6% of normal human F.IX levels) can be reached by intramuscular injection of mice using a 2- to 4-fold lower vector dose (1 x 10(11) vector genomes/mouse, injected into 4 intramuscular sites) than previously described. This was accomplished through the use of an improved expression cassette that uses the cytomegalovirus (CMV) immediate early enhancer/promoter in combination with a 1.2-kilobase portion of human skeletal actin promoter. These results correlated with enhanced levels of F.IX transcript and secreted F.IX protein in transduced murine C2C12 myotubes. Systemic F.IX expression from constructs containing the CMV enhancer/promoter alone was 120 to 200 ng/mL in mice injected with 1 x 10(11) vector genomes. Muscle-specific promoters performed poorly for F.IX transgene expression in vitro and in vivo. However, the incorporation of a sequence from the alpha-skeletal actin promoter containing at least 1 muscle-specific enhancer and 1 enhancer-like element further improved muscle-derived expression of F.IX from a CMV enhancer/promoter-driven expression cassette over previously published results. These findings will allow the design of a clinical protocol for therapeutic levels of F.IX expression with lower vector doses, thus enhancing efficacy and safety of the protocol. (Blood. 2000;95:2536-2542)

Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector

NASA Astrophysics Data System (ADS)

Miyoshi, Hiroyuki; Takahashi, Masayo; Gage, Fred H.; Verma, Inder M.

1997-09-01

The development of methods for efficient gene transfer to terminally differentiated retinal cells is important to study the function of the retina as well as for gene therapy of retinal diseases. We have developed a lentiviral vector system based on the HIV that can transduce terminally differentiated neurons of the brain in vivo. In this study, we have evaluated the ability of HIV vectors to transfer genes into retinal cells. An HIV vector containing a gene encoding the green fluorescent protein (GFP) was injected into the subretinal space of rat eyes. The GFP gene under the control of the cytomegalovirus promoter was efficiently expressed in both photoreceptor cells and retinal pigment epithelium. However, the use of the rhodopsin promoter resulted in expression predominantly in photoreceptor cells. Most successfully transduced eyes showed that photoreceptor cells in >80% of the area of whole retina expressed the GFP. The GFP expression persisted for at least 12 weeks with no apparent decrease. The efficient gene transfer into photoreceptor cells by HIV vectors will be useful for gene therapy of retinal diseases such as retinitis pigmentosa.

Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy.

PubMed Central

Gorziglia, M I; Kadan, M J; Yei, S; Lim, J; Lee, G M; Luthra, R; Trapnell, B C

1996-01-01

A novel recombinant adenovirus vector, Av3nBg, was constructed with deletions in adenovirus E1, E2a, and E3 regions and expressing a beta-galactosidase reporter gene. Av3nBg can be propagated at a high titer in a corresponding A549-derived cell line, AE1-2a, which contains the adenovirus E1 and E2a region genes inducibly expressed from separate glucocorticoid-responsive promoters. Av3nBg demonstrated gene transfer and expression comparable to that of Av1nBg, a first-generation adenovirus vector with deletions in E1 and E3. Several lines of evidence suggest that this vector is significantly more attenuated than E1 and E3 deletion vectors. Metabolic DNA labeling studies showed no detectable de novo vector DNA synthesis or accumulation, and metabolic protein labeling demonstrated no detectable de novo hexon protein synthesis for Av3nBg in naive A549 cells even at a multiplicity of infection of up to 3,000 PFU per cell. Additionally, naive A549 cells infected by Av3nBg did not accumulate infectious virions. In contrast, both Av1nBg and Av2Lu vectors showed DNA replication and hexon protein synthesis at multiplicities of infection of 500 PFU per cell. Av2Lu has a deletion in E1 and also carries a temperature-sensitive mutation in E2a. Thus, molecular characterization has demonstrated that the Av3nBg vector is improved with respect to the potential for vector DNA replication and hexon protein expression compared with both first-generation (Av1nBg) and second-generation (Av2Lu) adenoviral vectors. These observations may have important implications for potential use of adenovirus vectors in human gene therapy. PMID:8648763

The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

PubMed Central

Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

2004-01-01

Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

Development of leafhopper cell culture to trace the early infection process of a nucleorhabdovirus, rice yellow stunt virus, in insect vector cells.

PubMed

Wang, Haitao; Wang, Juan; Xie, Yunjie; Fu, Zhijun; Wei, Taiyun; Zhang, Xiao-Feng

2018-04-20

In China, the rice pathogen Rice yellow stunt virus (RYSV), a member of the genus Nucleorhabdovirus in the family Rhabdoviridae, was a severe threat to rice production during the1960s and1970s. Fundamental aspects of the biology of this virus such as protein localization and formation of the RYSV viroplasm during infection of insect vector cells are largely unexplored. The specific role(s) of the structural proteins nucleoprotein (N) and phosphoprotein (P) in the assembly of the viroplasm during RYSV infection in insect vector is also unclear. In present study, we used continuous leafhopper cell culture, immunocytochemical techniques, and transmission electron microscopy to investigate the subcellular distributions of N and P during RYSV infection. Both GST pull-down assay and yeast two-hybrid assay were used to assess the in vitro interaction of N and P. The dsRNA interference assay was performed to study the functional roles of N and P in the assembly of RYSV viroplasm. Here we demonstrated that N and P colocalized in the nucleus of RYSV-infected Nephotettix cincticeps cell and formed viroplasm-like structures (VpLSs). The transiently expressed N and P are sufficient to form VpLSs in the Sf9 cells. In addition, the interactions of N/P, N/N and P/P were confirmed in vitro. More interestingly, the accumulation of RYSV was significantly reduced when the transcription of N gene or P gene was knocked down by dsRNA treatment. In summary, our results suggest that N and P are the main viral factors responsible for the formation of viroplasm in RYSV-infected insect cells. Early during RYSV infection in the insect vector, N and P interacted with each other in the nucleus to form viroplasm-like structures, which are essential for the infection of RYSV.

Assessing the potential for AAV vector genotoxicity in a murine model

PubMed Central

Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

2011-01-01

Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

Detection of osteoclastic cell-cell fusion through retroviral vector packaging.

PubMed

Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi

2004-11-01

Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.

[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

PubMed

Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

2014-06-01

This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

PubMed

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

PubMed Central

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

Chemosterilants for Control of Insects and Insect Vectors of Disease.

PubMed

Baxter, Richard H G

2016-10-01

Both historically and at present, vector control is the most generally effective means of controlling malaria transmission. Insecticides are the predominant method of vector control, but the sterile insect technique (SIT) is a complementary strategy with a successful track record in both agricultural and public health sectors. Strategies of genetic and radiation-induced sterilization of Anopheles have to date been limited by logistical and/or regulatory hurdles. A safe and effective mosquito chemosterilant would therefore be of major utility to future deployment of SIT for malaria control. Here we review the prior and current use of chemosterilants in SIT, and assess the potential for future research. Recent genomic and proteomic studies reveal opportunities for specific targeting of seminal fluid proteins, and the capacity to interfere with sperm motility and storage in the female.

Measuring the self-healing of the spatially inhomogeneous states of polarization of vector Bessel beams

NASA Astrophysics Data System (ADS)

Milione, Giovanni; Dudley, Angela; Nguyen, Thien An; Chakraborty, Ougni; Karimi, Ebrahim; Forbes, Andrew; Alfano, Robert R.

2015-03-01

We experimentally measured the self-healing of the spatially inhomogeneous states of polarization of vector Bessel beams. Radially and azimuthally polarized vector Bessel beams were experimentally generated via a digital version of Durnin's method, using a spatial light modulator in concert with a liquid crystal q-plate. As a proof of principle, their intensities and spatially inhomogeneous states of polarization were experimentally measured using Stokes polarimetry as they propagated through two disparate obstructions. It was found, similar to their intensities, that their spatially inhomogeneous states of polarization self-healed. The self-healing can be understood via geometric optics, i.e., the interference of the unobstructed conical rays in the shadow region of the obstruction, and may have applications in, for example, optical trapping.

Internal and External Dispersal of Plants by Animals: An Aquatic Perspective on Alien Interference

PubMed Central

van Leeuwen, Casper H. A.

2018-01-01

Many alien plants use animal vectors for dispersal of their diaspores (zoochory). If alien plants interact with native disperser animals, this can interfere with animal-mediated dispersal of native diaspores. Interference by alien species is known for frugivorous animals dispersing fruits of terrestrial plants by ingestion, transport and egestion (endozoochory). However, less attention has been paid to possible interference of alien plants with dispersal of diaspores via external attachment (ectozoochory, epizoochory or exozoochory), interference in aquatic ecosystems, or positive effects of alien plants on dispersal of native plants. This literature study addresses the following hypotheses: (1) alien plants may interfere with both internal and external animal-mediated dispersal of native diaspores; (2) interference also occurs in aquatic ecosystems; (3) interference of alien plants can have both negative and positive effects on native plants. The studied literature revealed that alien species can comprise large proportions of both internally and externally transported diaspores. Because animals have limited space for ingested and adhering diaspores, alien species affect both internal and external transport of native diaspores. Alien plant species also form large proportions of all dispersed diaspores in aquatic systems and interfere with dispersal of native aquatic plants. Alien interference can be either negative (e.g., through competition with native plants) or positive (e.g., increased abundance of native dispersers, changed disperser behavior or attracting additional disperser species). I propose many future research directions, because understanding whether alien plant species disrupt or facilitate animal-mediated dispersal of native plants is crucial for targeted conservation of invaded (aquatic) plant communities. PMID:29487609

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

[Cloning of human CD45 gene and its expression in Hela cells].

PubMed

Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

2015-11-01

To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

Regulated Expression of Adenoviral Vectors-Based Gene Therapies

PubMed Central

Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.

2008-01-01

Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649

Development of an Expression Vector to Overexpress or Downregulate Genes in Curvularia protuberata.

PubMed

Liu, Chengke; Cleckler, Blake; Morsy, Mustafa

2018-05-05

Curvularia protuberata , an endophytic fungus in the Ascomycota, provides plants with thermotolerance only when it carries a mycovirus known as Curvularia thermotolerance virus (CThTV), and forms a three-way symbiotic relationship among these organisms. Under heat stress, several genes are expressed differently between virus-free C. protuberata (VF) and C. protuberata carrying CThTV (AN). We developed an expression vector, pM2Z-fun, carrying a zeocin resistance gene driven by the ToxA promoter, to study gene functions in C. protuberata to better understand this three-way symbiosis. Using this new 3.7-kb vector, five genes that are differentially expressed in C. protuberata —including genes involved in the trehalose, melanin, and catalase biosynthesis pathways—were successfully overexpressed or downregulated in VF or AN C. protuberata strains, respectively. The VF overexpression lines showed higher metabolite and enzyme activity than in the control VF strain. Furthermore, downregulation of expression of the same genes in the AN strain resulted in lower metabolite and enzyme activity than in the control AN strain. The newly generated expression vector, pM2Z-fun, has been successfully used to express target genes in C. protuberata and will be useful in further functional expression studies in other Ascomycota fungi.

Interference Processes During Reradiation of Attosecond Pulses of Electromagnetic Field by Graphene

NASA Astrophysics Data System (ADS)

Makarov, D. N.; Matveev, V. I.; Makarova, K. A.

2018-05-01

Interference spectra during reradiation of attosecond pulses of electromagnetic field by graphene sheets are considered. Analytical expressions for calculations of spectral distributions are derived. As an example, the interference spectra of a graphene sheet and a flat rectangular lattice are compared.

UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

PubMed Central

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

Serotype-dependent transduction efficiencies of recombinant adeno-associated viral vectors in monkey neocortex

PubMed Central

Gerits, Annelies; Vancraeyenest, Pascaline; Vreysen, Samme; Laramée, Marie-Eve; Michiels, Annelies; Gijsbers, Rik; Van den Haute, Chris; Moons, Lieve; Debyser, Zeger; Baekelandt, Veerle; Arckens, Lutgarde; Vanduffel, Wim

2015-01-01

Abstract. Viral vector-mediated expression of genes (e.g., coding for opsins and designer receptors) has grown increasingly popular. Cell-type specific expression is achieved by altering viral vector tropism through crosspackaging or by cell-specific promoters driving gene expression. Detailed information about transduction properties of most recombinant adeno-associated viral vector (rAAV) serotypes in macaque cortex is gradually becoming available. Here, we compare transduction efficiencies and expression patterns of reporter genes in two macaque neocortical areas employing different rAAV serotypes and promoters. A short version of the calmodulin-kinase-II (CaMKIIα0.4) promoter resulted in reporter gene expression in cortical neurons for all tested rAAVs, albeit with different efficiencies for spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1 and proportion of transduced cells: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. In contrast to rodent studies, the cytomegalovirus (CMV) promoter appeared least efficient in macaque cortex. The human synapsin-1 promoter preceded by the CMV enhancer (enhSyn1) produced homogeneous reporter gene expression across all layers, while two variants of the CaMKIIα promoter resulted in different laminar transduction patterns and cell specificities. Finally, differences in expression patterns were observed when the same viral vector was injected in two neocortical areas. Our results corroborate previous findings that reporter-gene expression patterns and efficiency of rAAV transduction depend on serotype, promoter, cortical layer, and area. PMID:26839901

[Construction of the lentiviral expression vector for anti-p185(erbB2) mouse/human chimeric antibody].

PubMed

Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi

2013-04-01

This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.

Immunogenicity and Protection Against Influenza H7N3 in Mice by Modified Vaccinia Virus Ankara Vectors Expressing Influenza Virus Hemagglutinin or Neuraminidase.

PubMed

Meseda, Clement A; Atukorale, Vajini; Soto, Jackeline; Eichelberger, Maryna C; Gao, Jin; Wang, Wei; Weiss, Carol D; Weir, Jerry P

2018-03-29

Influenza subtypes such as H7 have pandemic potential since they are able to infect humans with severe consequences, as evidenced by the ongoing H7N9 infections in China that began in 2013. The diversity of H7 viruses calls for a broadly cross-protective vaccine for protection. We describe the construction of recombinant modified vaccinia virus Ankara (MVA) vectors expressing the hemagglutinin (HA) or neuraminidase (NA) from three H7 viruses representing both Eurasian and North American H7 lineages - A/mallard/Netherlands/12/2000 (H7N3), A/Canada/rv444/2004 (H7N3), and A/Shanghai/02/2013 (H7N9). These vectors were evaluated for immunogenicity and protective efficacy against H7N3 virus in a murine model of intranasal challenge. High levels of H7-, N3-, and N9-specific antibodies, including neutralizing antibodies, were induced by the MVA-HA and MVA-NA vectors. Mice vaccinated with MVA vectors expressing any of the H7 antigens were protected, suggesting cross-protection among H7 viruses. In addition, MVA vectors expressing N3 but not N9 elicited protection against H7N3 virus challenge. Similar outcomes were obtained when immune sera from MVA vector-immunized mice were passively transferred to naïve mice prior to challenge with the H7N3 virus. The results support the further development of an MVA vector platform as a candidate vaccine for influenza strains with pandemic potential.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Pathogenic effects of Rift Valley fever virus NSs gene are alleviated in cultured cells by expressed antiviral short hairpin RNAs.

PubMed

Scott, Tristan; Paweska, Janusz T; Arbuthnot, Patrick; Weinberg, Marc S

2012-01-01

Rift Valley fever virus (RVFV), a member of the Bunyaviridae family, may cause severe hepatitis, encephalitis and haemorrhagic fever in humans. There are currently no available licensed vaccines or therapies to treat the viral infection in humans. RNA interference (RNAi)-based viral gene silencing offers a promising approach to inhibiting replication of this highly pathogenic virus. The small (S) segment of the RVFV tripartite genome carries the genetic determinates for pathogenicity during infection. This segment encodes the non-structural S (NSs) and essential nucleocapsid (N) genes. To advance RNAi-based inhibition of RVFV replication, we designed several Pol III short hairpin RNA (shRNA) expression cassettes against the NSs and N genes, including a multimerized plasmid vector that included four shRNA expression cassettes. Effective target silencing was demonstrated using full- and partial-length target reporter assays, and confirmed by western blot analysis of exogenous N and NSs expression. Small RNA northern blots showed detectable RNAi guide strand formation from single and multimerized shRNA constructs. Using a cell culture model of RVFV replication, shRNAs targeting the N gene decreased intracellular nucleocapsid protein concentration and viral replication. The shRNAs directed against the NSs gene reduced NSs protein concentrations and alleviated NSs-mediated cytotoxicity, which may be caused by host transcription suppression. These data are the first demonstration that RNAi activators have a potential therapeutic benefit for countering RVFV infection.

A novel intranuclear RNA vector system for long-term stem cell modification

PubMed Central

Ikeda, Yasuhiro; Makino, Akiko; Matchett, William E.; Holditch, Sara J.; Lu, Brian; Dietz, Allan B.; Tomonaga, Keizo

2015-01-01

Genetically modified stem and progenitor cells have emerged as a promising regenerative platform in the treatment of genetic and degenerative disorders, highlighted by their successful therapeutic use in inherent immunodeficiencies. However, biosafety concerns over insertional mutagenesis resulting from integrating recombinant viral vectors have overshadowed the widespread clinical applications of genetically modified stem cells. Here, we report an RNA-based episomal vector system, amenable for long-term transgene expression in stem cells. Specifically, we used a unique intranuclear RNA virus, Borna disease virus (BDV), as the gene transfer vehicle, capable of persistent infections in various cell types. BDV-based vectors allowed for long-term transgene expression in mesenchymal stem cells (MSCs) without affecting cellular morphology, cell surface CD105 expression, or the adipogenicity of MSCs. Similarly, replication-defective BDV vectors achieved long-term transduction of human induced pluripotent stem cells (iPSCs), while maintaining the ability to differentiate into three embryonic germ layers. Thus, the BDV-based vectors offer a genomic modification-free, episomal RNA delivery system for sustained stem cell transduction. PMID:26632671

Receptor-mediated gene transfer vectors: progress towards genetic pharmaceuticals.

PubMed

Molas, M; Gómez-Valadés, A G; Vidal-Alabró, A; Miguel-Turu, M; Bermudez, J; Bartrons, R; Perales, J C

2003-10-01

Although specific delivery to tissues and unique cell types in vivo has been demonstrated for many non-viral vectors, current methods are still inadequate for human applications, mainly because of limitations on their efficiencies. All the steps required for an efficient receptor-mediated gene transfer process may in principle be exploited to enhance targeted gene delivery. These steps are: DNA/vector binding, internalization, subcellular trafficking, vesicular escape, nuclear import, and unpacking either for transcription or other functions (i.e., antisense, RNA interference, etc.). The large variety of vector designs that are currently available, usually aimed at improving the efficiency of these steps, has complicated the evaluation of data obtained from specific derivatives of such vectors. The importance of the structure of the final vector and the consequences of design decisions at specific steps on the overall efficiency of the vector will be discussed in detail. We emphasize in this review that stability in serum and thus, proper bioavailability of vectors to their specific receptors may be the single greatest limiting factor on the overall gene transfer efficiency in vivo. We discuss current approaches to overcome the intrinsic instability of synthetic vectors in the blood. In this regard, a summary of the structural features of the vectors obtained from current protocols will be presented and their functional characteristics evaluated. Dissecting information on molecular conjugates obtained by such methodologies, when carefully evaluated, should provide important guidelines for the creation of effective, targeted and safe DNA therapeutics.

Attenuated Human Parainfluenza Virus Type 1 Expressing the Respiratory Syncytial Virus (RSV) Fusion (F) Glycoprotein from an Added Gene: Effects of Prefusion Stabilization and Packaging of RSV F

PubMed Central

Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo. In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo, resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. PMID:28835504

Representation of the contextual statistical model by hyperbolic amplitudes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khrennikov, Andrei

We continue the development of a so-called contextual statistical model (here context has the meaning of a complex of physical conditions). It is shown that, besides contexts producing the conventional trigonometric cos-interference, there exist contexts producing the hyperbolic cos-interference. Starting with the corresponding interference formula of total probability we represent such contexts by hyperbolic probabilistic amplitudes or in the abstract formalism by normalized vectors of a hyperbolic analogue of the Hilbert space. There is obtained a hyperbolic Born's rule. Incompatible observables are represented by noncommutative operators. This paper can be considered as the first step towards hyperbolic quantum probability. Wemore » also discuss possibilities of experimental verification of hyperbolic quantum mechanics: in physics of elementary particles, string theory as well as in experiments with nonphysical systems, e.g., in psychology, cognitive sciences, and economy.« less

Attosecond control of orbital parity mix interferences and the relative phase of even and odd harmonics in an attosecond pulse train.

PubMed

Laurent, G; Cao, W; Li, H; Wang, Z; Ben-Itzhak, I; Cocke, C L

2012-08-24

We experimentally demonstrate that atomic orbital parity mix interferences can be temporally controlled on an attosecond time scale. Electron wave packets are formed by ionizing argon gas with a comb of odd and even high-order harmonics, in the presence of a weak infrared field. Consequently, a mix of energy-degenerate even and odd parity states is fed in the continuum by one- and two-photon transitions. These interfere, leading to an asymmetric electron emission along the polarization vector. The direction of the emission can be controlled by varying the time delay between the comb and infrared field pulses. We show that such asymmetric emission provides information on the relative phase of consecutive odd and even order harmonics in the attosecond pulse train.

Representation of the contextual statistical model by hyperbolic amplitudes

NASA Astrophysics Data System (ADS)

Khrennikov, Andrei

2005-06-01

We continue the development of a so-called contextual statistical model (here context has the meaning of a complex of physical conditions). It is shown that, besides contexts producing the conventional trigonometric cos-interference, there exist contexts producing the hyperbolic cos-interference. Starting with the corresponding interference formula of total probability we represent such contexts by hyperbolic probabilistic amplitudes or in the abstract formalism by normalized vectors of a hyperbolic analogue of the Hilbert space. There is obtained a hyperbolic Born's rule. Incompatible observables are represented by noncommutative operators. This paper can be considered as the first step towards hyperbolic quantum probability. We also discuss possibilities of experimental verification of hyperbolic quantum mechanics: in physics of elementary particles, string theory as well as in experiments with nonphysical systems, e.g., in psychology, cognitive sciences, and economy.

Radio Frequency Compatibility of an RFID Tag on Glideslope Navigation Receivers

NASA Technical Reports Server (NTRS)

Nguyen, Truong X.; Mielnik, John J.

2008-01-01

A process is demonstrated to show compatibility between a radio frequency identification (RFID) tag and an aircraft glideslope (GS) radio receiver. The particular tag chosen was previously shown to have significant peak spurious emission levels that far exceeded the emission limits in the GS aeronautical band. The spurious emissions are emulated in the study by capturing the RFID fundamental transmission and playing back the signal in the GS band. The signal capturing and playback are achieved with a vector signal generator and a spectrum analyzer that can output the in-phase and quadrature components (IQ). The simulated interference signal is combined with a desired GS signal before being injected into a GS receiver s antenna port for interference threshold determination. Minimum desired propagation loss values to avoid interference are then computed and compared against actual propagation losses for several aircraft.

Neutron interference in the Earth's gravitational field

NASA Astrophysics Data System (ADS)

Galiautdinov, Andrei; Ryder, Lewis H.

2017-06-01

This work relates to the famous experiments, performed in 1975 and 1979 by Werner et al., measuring neutron interference and neutron Sagnac effects in the earth's gravitational field. Employing the method of Stodolsky in its weak field approximation, explicit expressions are derived for the two phase shifts, which turn out to be in agreement with the experiments and with the previously obtained expressions derived from semi-classical arguments: these expressions are simply modified by relativistic correction factors.

Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

PubMed Central

2013-01-01

Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina.

PubMed

Blixt, Maria K E; Hallböök, Finn

2016-01-01

Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression-specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac "donor" vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor.

[Construction and expression of the eukaryotic expression vector carrying HSV-1 gC glycoprotein gene].

PubMed

Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an

2011-05-01

To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.

Three gene expression vector sets for concurrently expressing multiple genes in Saccharomyces cerevisiae.

PubMed

Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko

2014-05-01

Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Newer insecticides for plant virus disease management.

PubMed

Castle, Steven; Palumbo, John; Prabhaker, Nilima

2009-05-01

Effective management of insect and mite vectors of plant pathogens is of crucial importance to minimize vector-borne diseases in crops. Pesticides play an important role in managing vector populations by reducing the number of individuals that can acquire and transmit a virus, thereby potentially lowering disease incidence. Certain insecticides exhibit properties other than lethal toxicity that affect feeding behaviours or otherwise interfere with virus transmission. To evaluate the potential of various treatments against the Bemisia tabaci-transmitted Cucurbit yellow stunting disorder virus (CYSDV), insecticide field trials were conducted in Yuma, AZ, USA, during spring and autumn growing seasons. Differences in vector-intensity each season led to mixed results, but at least five insecticide treatments showed promise in limiting virus spread during spring 2008. Increasing concern among growers in this region regarding recent epidemics of CYSDV is leading to more intensive use of insecticides that threatens to erupt into unmanageable resistance. Sustainability of insecticides is an important goal of pest management and more specifically resistance management, especially for some of the most notorious vector species such as B. tabaci and Myzus persiscae that are likely to develop resistance.

[Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

PubMed

Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

2014-08-01

To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

Distractor Interference during Smooth Pursuit Eye Movements

ERIC Educational Resources Information Center

Spering, Miriam; Gegenfurtner, Karl R.; Kerzel, Dirk

2006-01-01

When 2 targets for pursuit eye movements move in different directions, the eye velocity follows the vector average (S. G. Lisberger & V. P. Ferrera, 1997). The present study investigates the mechanisms of target selection when observers are instructed to follow a predefined horizontal target and to ignore a moving distractor stimulus. Results show…

Transcriptomics-guided development of RNA interference strategies to manage whiteflies: a globally distributed vector of crop viruses

USDA-ARS?s Scientific Manuscript database

Over 300 viruses are transmitted by the whitefly, Bemisia tabaci, with 90% of them belonging to the genus, Begomovirus. Begomoviruses are exclusively transmitted by whiteflies to a range of agriculture crops, resulting in billions of dollars lost annually, while jeopardizing food security worldwide....

Electroweak Higgs boson plus three jet production at next-to-leading-order QCD.

PubMed

Campanario, Francisco; Figy, Terrance M; Plätzer, Simon; Sjödahl, Malin

2013-11-22

We calculate next-to-leading order (NLO) QCD corrections to electroweak Higgs boson plus three jet production. Both vector boson fusion (VBF) and Higgs-strahlung type contributions are included along with all interferences. The calculation is implemented within the Matchbox NLO framework of the Herwig++ event generator.

An efficient protocol for the production of tRNA-free recombinant Selenocysteine Synthase (SELA) from Escherichia coli and its biophysical characterization.

PubMed

Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique

2013-03-01

Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.

Possible superconductivity in Sr2IrO4 probed by quasiparticle interference

PubMed Central

Gao, Yi; Zhou, Tao; Huang, Huaixiang; Wang, Qiang-Hua

2015-01-01

Based on the possible superconducting (SC) pairing symmetries recently proposed, the quasiparticle interference (QPI) patterns in electron- and hole-doped Sr2IrO4 are theoretically investigated. In the electron-doped case, the QPI spectra can be explained based on a model similar to the octet model of the cuprates while in the hole-doped case, both the Fermi surface topology and the sign of the SC order parameter resemble those of the iron pnictides and there exists a QPI vector resulting from the interpocket scattering between the electron and hole pockets. In both cases, the evolution of the QPI vectors with energy and their behaviors in the nonmagnetic and magnetic impurity scattering cases can well be explained based on the evolution of the constant-energy contours and the sign structure of the SC order parameter. The QPI spectra presented in this paper can be compared with future scanning tunneling microscopy experiments to test whether there are SC phases in electron- and hole-doped Sr2IrO4 and what the pairing symmetry is. PMID:25783417

Intrajugular Vein Delivery of AAV9-RNAi Prevents Neuropathological Changes and Weight Loss in Huntington's Disease Mice

PubMed Central

Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L

2014-01-01

Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280

LncRNA-RMRP promotes carcinogenesis by acting as a miR-206 sponge and is used as a novel biomarker for gastric cancer.

PubMed

Shao, Yongfu; Ye, Meng; Li, Qier; Sun, Weiliang; Ye, Guoliang; Zhang, Xinjun; Yang, Yunben; Xiao, Bingxiu; Guo, Junming

2016-06-21

Long noncoding RNAs (lncRNAs) play crucial roles in tumorigenesis. However, the mechanisms of most lncRNAs in cancers are largely unknown. Because the RNA component of mitochondrial RNA processing endoribonuclease (RMRP) is one of the dysregulated lncRNAs in gastric cancer, this study explored its molecular mechanisms in carcinogenesis. RMRP levels in 792 tissues, plasma and gastric juices from patients with various stages of gastric tumorigenesis were analyzed by quantitative reverse transcription-polymerase chain reaction. Overexpression and RNA interference were used to manipulate RMRP expression by RMRP expression vector and small interfering RNAs, respectively. Its mechanisms were evaluated by flow cytometry, real-time cell analysis, plate colony formation assays, and xenograft models. RMRP levels in tissue, plasma and gastric juices from patients with gastric cancer were significantly different from those from controls. Its levels were significantly associated with Borrmann type and metastasis. Plasma and gastric juice RMRP had higher sensitivity and specificity than commonly used markers (such as carcinoembryonic antigen and carbohydrate antigen 19-9). Knockdown of RMRP significantly inhibited cell proliferation in vitro and in vivo, whereas overexpression of RMRP promoted cell growth. Acting as a miR-206 sponge, RMRP modulated cell cycle by regulating Cyclin D2 expression. RMRP plays a crucial role in gastric cancer occurrence and can be used as a novel biomarker for gastric cancer.

An adenovirus prime/plasmid boost strategy for induction of equipotent immune responses to two dengue virus serotypes.

PubMed

Khanam, Saima; Rajendra, Pilankatta; Khanna, Navin; Swaminathan, Sathyamangalam

2007-02-15

Dengue is a public health problem of global significance for which there is neither an effective antiviral therapy nor a preventive vaccine. It is a mosquito-borne viral disease, caused by dengue (DEN) viruses, which are members of the Flaviviridae family. There are four closely related serotypes, DEN-1, DEN-2, DEN-3 and DEN-4, each of which is capable of causing disease. As immunity to any one serotype can potentially sensitize an individual to severe disease during exposure to a heterologous serotype, the general consensus is that an effective vaccine should be tetravalent, that is, it must be capable of affording protection against all four serotypes. The current strategy of creating tetravalent vaccine formulations by mixing together four monovalent live attenuated vaccine viruses has revealed the phenomenon of viral interference leading to the manifestation of immune responses biased towards a single serotype. This work stems from the emergence of (i) the DEN virus envelope (E) domain III (EDIII) as the most important region of the molecule from a vaccine perspective and (ii) the adenovirus (Ad) as a promising vaccine vector platform. We describe the construction of a recombinant, replication-defective Ad (rAd) vector encoding a chimeric antigen made of in-frame linked EDIIIs of DEN virus serotypes 2 and 4. Using this rAd vector, in conjunction with a plasmid vector encoding the same chimeric bivalent antigen, in a prime-boost strategy, we show that it is possible to elicit equipotent neutralizing and T cell responses specific to both DEN serotypes 2 and 4. Our data support the hypothesis that a DEN vaccine targeting more than one serotype may be based on a single DNA-based vector to circumvent viral interference. This work lays the foundation for developing a single Ad vector encoding EDIIIs of all four DEN serotypes to evoke a balanced immune response against each one of them. Thus, this work has implications for the development of safe and effective tetravalent dengue vaccines.

Simple cloning strategy using GFPuv gene as positive/negative indicator.

PubMed

Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato

2011-09-15

Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

Interference and Polarized Light.

ERIC Educational Resources Information Center

Charas, Seymour

1988-01-01

Discusses a demonstration of interference phenomena using three sheets of polaroid material, a light source, and a light meter. Describes instructional procedures with mathematical expressions and a diagram. (YP)

[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].

PubMed

Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong

2012-07-01

To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.

RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

PubMed Central

Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

1999-01-01

In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

Construction of novel shuttle expression vectors for gene expression in Bacillus subtilis and Bacillus pumilus.

PubMed

Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong

2015-01-01

A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants.

PubMed

Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

PubMed Central

Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science. PMID:29300787

High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system

PubMed Central

Huang, Zhong; Phoolcharoen, Waranyoo; Lai, Huafang; Piensook, Khanrat; Cardineau, Guy; Zeitlin, Larry; Whaley, Kevin J.; Arntzen, Charles J.

2010-01-01

Plant viral vectors have great potential in rapid production of important pharmaceutical proteins. However, high-yield production of heterooligomeric proteins that require the expression and assembly of two or more protein subunits often suffers problems due to the “competing” nature of viral vectors derived from the same virus. Previously we reported that a bean yellow dwarf virus (BeYDV)-derived, three-component DNA replicon system allows rapid production of single recombinant proteins in plants (Huang et al. 2009). In this article, we report further development of this expression system for its application in high-yield production of oligomeric protein complexes including monoclonal antibodies (mAbs) in plants. We showed that the BeYDV replicon system permits simultaneous efficient replication of two DNA replicons and thus, high-level accumulation of two recombinant proteins in the same plant cell. We also demonstrated that a single vector that contains multiple replicon cassettes was as efficient as the three-component system in driving the expression of two distinct proteins. Using either the non-competing, three-vector system or the multi-replicon single vector, we produced both the heavy and light chain subunits of a protective IgG mAb 6D8 against Ebola virus GP1 (Wilson et al. 2000) at 0.5 mg of mAb per gram leaf fresh weight within 4 days post infiltration of Nicotiana benthamiana leaves. We further demonstrated that full-size tetrameric IgG complex containing two heavy and two light chains was efficiently assembled and readily purified, and retained its functionality in specific binding to inactivated Ebola virus. Thus, our single-vector replicon system provides high-yield production capacity for heterooligomeric proteins, yet eliminates the difficult task of identifying non-competing virus and the need for co-infection of multiple expression modules. The multi-replicon vector represents a significant advance in transient expression technology for antibody production in plants. PMID:20047189

Transduction of skeletal muscles with common reporter genes can promote muscle fiber degeneration and inflammation.

PubMed

Winbanks, Catherine E; Beyer, Claudia; Qian, Hongwei; Gregorevic, Paul

2012-01-01

Recombinant adeno-associated viral vectors (rAAV vectors) are promising tools for delivering transgenes to skeletal muscle, in order to study the mechanisms that control the muscle phenotype, and to ameliorate diseases that perturb muscle homeostasis. Many studies have employed rAAV vectors carrying reporter genes encoding for β-galactosidase (β-gal), human placental alkaline phosphatase (hPLAP), and green fluorescent protein (GFP) as experimental controls when studying the effects of manipulating other genes. However, it is not clear to what extent these reporter genes can influence signaling and gene expression signatures in skeletal muscle, which may confound the interpretation of results obtained in experimentally manipulated muscles. Herein, we report a strong pro-inflammatory effect of expressing reporter genes in skeletal muscle. Specifically, we show that the administration of rAAV6:hPLAP vectors to the hind limb muscles of mice is associated with dose- and time-dependent macrophage recruitment, and skeletal muscle damage. Dose-dependent expression of hPLAP also led to marked activity of established pro-inflammatory IL-6/Stat3, TNFα, IKKβ and JNK signaling in lysates obtained from homogenized muscles. These effects were independent of promoter type, as expression cassettes featuring hPLAP under the control of constitutive CMV and muscle-specific CK6 promoters both drove cellular responses when matched for vector dose. Importantly, the administration of rAAV6:GFP vectors did not induce muscle damage or inflammation except at the highest doses we examined, and administration of a transgene-null vector (rAAV6:MCS) did not cause damage or inflammation at any of the doses tested, demonstrating that GFP-expressing, or transgene-null vectors may be more suitable as experimental controls. The studies highlight the importance of considering the potential effects of reporter genes when designing experiments that examine gene manipulation in vivo.

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

Self-focusing therapeutic gene delivery with intelligent gene vector swarms: intra-swarm signalling through receptor transgene expression in targeted cells.

PubMed

Tolmachov, Oleg E

2015-01-01

Gene delivery in vivo that is tightly focused on the intended target cells is essential to maximize the benefits of gene therapy and to reduce unwanted side-effects. Cell surface markers are immediately available for probing by therapeutic gene vectors and are often used to direct gene transfer with these vectors to specific target cell populations. However, it is not unusual for the choice of available extra-cellular markers to be too scarce to provide a reliable definition of the desired therapeutically relevant set of target cells. Therefore, interrogation of intra-cellular determinants of cell-specificity, such as tissue-specific transcription factors, can be vital in order to provide detailed cell-guiding information to gene vector particles. An important improvement in cell-specific gene delivery can be achieved through auto-buildup in vector homing efficiency using intelligent 'self-focusing' of swarms of vector particles on target cells. Vector self-focusing was previously suggested to rely on the release of diffusible chemo-attractants after a successful target-specific hit by 'scout' vector particles. I hypothesize that intelligent self-focusing behaviour of swarms of cell-targeted therapeutic gene vectors can be accomplished without the employment of difficult-to-use diffusible chemo-attractants, instead relying on the intra-swarm signalling through cells expressing a non-diffusible extra-cellular receptor for the gene vectors. In the proposed model, cell-guiding information is gathered by the 'scout' gene vector particles, which: (1) attach to a variety of cells via a weakly binding (low affinity) receptor; (2) successfully facilitate gene transfer into these cells; (3) query intra-cellular determinants of cell-specificity with their transgene expression control elements and (4) direct the cell-specific biosynthesis of a vector-encoded strongly binding (high affinity) cell-surface receptor. Free members of the vector swarm loaded with therapeutic cargo are then attracted to and internalized into the intended target cells via the expressed cognate strongly binding extra-cellular receptor, causing escalation of gene transfer into these cells and increasing the copy number of the therapeutic gene expression modules. Such self-focusing swarms of gene vectors can be either homogeneous, with 'scout' and 'therapeutic' members of the swarm being structurally identical, or, alternatively, heterogeneous (split), with 'scout' and 'therapeutic' members of the swarm being structurally specialized. It is hoped that the proposed self-focusing cell-targeted gene vector swarms with receptor-mediated intra-swarm signalling could be particularly effective in 'top-up' gene delivery scenarios, achieving high-level and sustained expression of therapeutic transgenes that are prone to shut-down through degradation and silencing. Crucially, in contrast to low-precision 'general location' vector guidance by diffusible chemo-attractants, ear-marking non-diffusible receptors can provide high-accuracy targeting of therapeutic vector particles to the specific cell, which has undergone a 'successful cell-specific hit' by a 'scout' vector particle. Opportunities for cell targeting could be expanded, since in the proposed model of self-focusing it could be possible to probe a broad selection of intra-cellular determinants of cell-specificity and not just to rely exclusively on extra-cellular markers of cell-specificity. By employing such self-focusing gene vectors for the improvement of cell-targeted delivery of therapeutic genes, e.g., in cancer therapy or gene addition therapy of recessive genetic diseases, it could be possible to broaden a leeway for the reduction of the vector load and, consequently, to minimize undesired vector cytotoxicity, immune reactions, and the risk of inadvertent genetic modification of germline cells in genetic treatment in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-07-30

HIV-associated sensory neuropathy affects over 50% of HIV patients and is a common peripheral nerve complication of HIV infection and highly active antiretroviral therapy (HAART). Evidence shows that painful HIV sensory neuropathy is influenced by neuroinflammatory events that include the proinflammatory molecules, MAP Kinase, tumor necrosis factor-α (TNFα), stromal cell-derived factor 1-α (SDF1α), and C-X-C chemokine receptor type 4 (CXCR4). However, the exact mechanisms of painful HIV sensory neuropathy are not known, which hinders our ability to develop effective treatments. In this study, we investigated whether inhibition of proinflammatory factors reduces the HIV-associated neuropathic pain state. Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2',3'-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Mechanical threshold was tested using von Frey filament fibers. Non-replicating herpes simplex virus (HSV) vectors expressing interleukin 10 (IL10) were inoculated into the hindpaws of rats. The expression of TNFα, SDF1α, and CXCR4 in the lumbar spinal cord and L4/5 dorsal root ganglia (DRG) was examined using western blots. IL-10 expression mediated by the HSV vectors resulted in a significant elevation of mechanical threshold. The anti-allodynic effect of IL-10 expression mediated by the HSV vectors lasted more than 3 weeks. The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors. The HSV vectors expressing IL-10 also concomitantly reversed the upregulation of p-p38, TNFα, SDF1α, and CXCR4 induced by gp120 in the lumbar spinal dorsal horn and/or the DRG at 2 and/or 4 weeks. The blocking of the signaling of these proinflammatory molecules is able to reduce HIV-related neuropathic pain, which provide a novel mechanism-based approach to treating HIV-associated neuropathic pain using gene therapy.

IL-10 mediated by herpes simplex virus vector reduces neuropathic pain induced by HIV gp120 combined with ddC in rats

PubMed Central

2014-01-01

Background HIV-associated sensory neuropathy affects over 50% of HIV patients and is a common peripheral nerve complication of HIV infection and highly active antiretroviral therapy (HAART). Evidence shows that painful HIV sensory neuropathy is influenced by neuroinflammatory events that include the proinflammatory molecules, MAP Kinase, tumor necrosis factor-α (TNFα), stromal cell-derived factor 1-α (SDF1α), and C-X-C chemokine receptor type 4 (CXCR4). However, the exact mechanisms of painful HIV sensory neuropathy are not known, which hinders our ability to develop effective treatments. In this study, we investigated whether inhibition of proinflammatory factors reduces the HIV-associated neuropathic pain state. Results Neuropathic pain was induced by peripheral HIV coat protein gp120 combined with 2′,3′-dideoxycytidine (ddC, one of the nucleoside reverse transcriptase inhibitors (NRTIs)). Mechanical threshold was tested using von Frey filament fibers. Non-replicating herpes simplex virus (HSV) vectors expressing interleukin 10 (IL10) were inoculated into the hindpaws of rats. The expression of TNFα, SDF1α, and CXCR4 in the lumbar spinal cord and L4/5 dorsal root ganglia (DRG) was examined using western blots. IL-10 expression mediated by the HSV vectors resulted in a significant elevation of mechanical threshold. The anti-allodynic effect of IL-10 expression mediated by the HSV vectors lasted more than 3 weeks. The area under the effect-time curves (AUC) in mechanical threshold in rats inoculated with the HSV vectors expressing IL-10, was increased compared with the control vectors, indicating antinociceptive effect of the IL-10 vectors. The HSV vectors expressing IL-10 also concomitantly reversed the upregulation of p-p38, TNFα, SDF1α, and CXCR4 induced by gp120 in the lumbar spinal dorsal horn and/or the DRG at 2 and/or 4 weeks. Conclusion The blocking of the signaling of these proinflammatory molecules is able to reduce HIV-related neuropathic pain, which provide a novel mechanism-based approach to treating HIV-associated neuropathic pain using gene therapy. PMID:25078297

Magnetofection™ of NMDA Receptor Subunits GluN1 and GluN2A Expression Vectors in Non-Neuronal Host Cells.

PubMed

Bruneau, Nadine; Szepetowski, Pierre

2017-01-01

The functional study of reconstituted NMDA receptors (NMDARs) in host cells requires that the corresponding vectors for the expression of the NMDAR subunits are co-transfected with high efficiency. Magnetofection™ is a technology used to deliver nucleic acids to cells. It is driven and site-specifically guided by the attractive forces of magnetic fields acting on magnetic nanoparticles that are associated with nucleic acid vectors. In magnetofection™, cationic lipids form self-assembled complexes with the nucleic acid vectors of interest. Those complexes are then associated with magnetic nanoparticles that are concentrated at the surface of cultured cells by applying a permanent magnetic field. Magnetofection™ is a simple method to transfect cultured cells with high transfection rates. Satisfactory expression levels are obtained with very low amounts of nucleic acid vector. Moreover, incubation time with host cells is less than 1 h, as compared with the several hours needed with standard transfection assays.

Gene Transfer into Rat Brain Using Adenoviral Vectors

PubMed Central

Puntel, Mariana; Kroeger, Kurt M.; Sanderson, Nicholas S.R.; Thomas, Clare E.; Castro, Maria G.; Lowenstein, Pedro R.

2010-01-01

Viral vector–mediated gene delivery is an attractive procedure for introducing genes into the brain, both for purposes of basic neuroscience research and to develop gene therapy for neurological diseases. Replication-defective adenoviruses possess many features which make them ideal vectors for this purpose—efficiently transducing terminally differentiated cells such as neurons and glial cells, resulting in high levels of transgene expression in vivo. Also, in the absence of anti-adenovirus immunity, these vectors can sustain very long-term transgene expression within the brain parenchyma. This unit provides protocols for the stereotactic injection of adenoviral vectors into the brain, followed by protocols to detect transgene expression or infiltrates of immune cells by immunocytochemistry or immunofluorescence. ELISPOT and neutralizing antibody assay methodologies are provided to quantitate the levels of cellular and humoral immune responses against adenoviruses. Quantitation of adenoviral vector genomes within the rat brain using qPCR is also described. Curr. Protoc. Neurosci. 50:4.24.1–4.24.49. © 2010 by John Wiley & Sons, Inc. PMID:20066657

A polarization-division multiplexing SSB-OFDM system with beat interference cancellation receivers

NASA Astrophysics Data System (ADS)

Yang, Peiling; Ma, Jianxin; Zhang, Junyi

2018-06-01

In this paper, we have proposed a polarization-division multiplexing (PDM) single-sideband optical orthogonal frequency division multiplexing (SSB-OOFDM) scheme with signal-signal beat interference cancellation receivers with balanced detection (ICRBD). This system can double channel capacity and improve spectrum efficiency (SE) with the reduced guard band (GB) due to the PDM. Multiple input multiple output (MIMO) technique is used to solve polarization mode dispersion (PMD) associated with channel estimation and equalization. By simulation, we demonstrate the efficacy of the proposed technique for a 2 ×40 Gbit/s 16-QAM SSB-PDM-OOFDM system according to the error vector magnitude (EVM) and the constellation diagrams.

High-efficiency Transduction of Rhesus Hematopoietic Repopulating Cells by a Modified HIV1-based Lentiviral Vector

PubMed Central

Uchida, Naoya; Hargrove, Phillip W.; Lap, Coen J.; Evans, Molly E.; Phang, Oswald; Bonifacino, Aylin C.; Krouse, Allen E.; Metzger, Mark E.; Nguyen, Anh-Dao; Hsieh, Matthew M.; Wolfsberg, Tyra G.; Donahue, Robert E.; Persons, Derek A.; Tisdale, John F.

2012-01-01

Human immunodeficiency virus type 1 (HIV1) vectors poorly transduce rhesus hematopoietic cells due to species-specific restriction factors, including the tripartite motif-containing 5 isoformα (TRIM5α) which targets the HIV1 capsid. We previously developed a chimeric HIV1 (χHIV) vector system wherein the vector genome is packaged with the simian immunodeficiency virus (SIV) capsid for efficient transduction of both rhesus and human CD34+ cells. To evaluate whether χHIV vectors could efficiently transduce rhesus hematopoietic repopulating cells, we performed a competitive repopulation assay in rhesus macaques, in which half of the CD34+ cells were transduced with standard SIV vectors and the other half with χHIV vectors. As compared with SIV vectors, χHIV vectors achieved higher vector integration, and the transgene expression rates were two- to threefold higher in granulocytes and red blood cells and equivalent in lymphocytes and platelets for 2 years. A recipient of χHIV vector-only transduced cells reached up to 40% of transgene expression rates in granulocytes and lymphocytes and 20% in red blood cells. Similar to HIV1 and SIV vectors, χHIV vector frequently integrated into gene regions, especially into introns. In summary, our χHIV vector demonstrated efficient transduction for rhesus long-term repopulating cells, comparable with SIV vectors. This χHIV vector should allow preclinical testing of HIV1-based therapeutic vectors in large animal models. PMID:22871664

The upstream enhancer elements of the G6PC promoter are critical for optimal G6PC expression in murine glycogen storage disease type Ia.

PubMed

Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y

2013-11-01

Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.

[Sendai virus vector: vector development and its application to health care and biotechnology].

PubMed

Iida, Akihiro

2007-06-01

Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.

PubMed

Wei, Y; Wang, S; Wang, X

2014-01-01

Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.

Importance of murine study design for testing toxicity of retroviral vectors in support of phase I trials.

PubMed

Will, Elke; Bailey, Jeff; Schuesler, Todd; Modlich, Ute; Balcik, Brenden; Burzynski, Ben; Witte, David; Layh-Schmitt, Gerlinde; Rudolph, Cornelia; Schlegelberger, Brigitte; von Kalle, Christof; Baum, Christopher; Sorrentino, Brian P; Wagner, Lars M; Kelly, Patrick; Reeves, Lilith; Williams, David A

2007-04-01

Although retroviral vectors are one of the most widely used vehicles for gene transfer, there is no uniformly accepted pre-clinical model defined to assess their safety, in particular their risk related to insertional mutagenesis. In the murine pre-clinical study presented here, 40 test and 10 control mice were transplanted with ex vivo manipulated bone marrow cells to assess the long-term effects of the transduction of hematopoietic cells with the retroviral vector MSCV-MGMT(P140K)wc. Test mice had significant gene marking 8-12 months post-transplantation with an average of 0.93 vector copies per cell and 41.5% of peripheral blood cells expressing the transgene MGMT(P140K), thus confirming persistent vector expression. Unexpectedly, six test mice developed malignant lymphoma. No vector was detected in the tumor cells of five animals with malignancies, indicating that the malignancies were not caused by insertional mutagenesis or MGMT(P140K) expression. Mice from a concurrent study with a different transgene also revealed additional cases of vector-negative lymphomas of host origin. We conclude that the background tumor formation in this mouse model complicates safety determination of retroviral vectors and propose an improved study design that we predict will increase the relevance and accuracy of interpretation of pre-clinical mouse studies.

Intramammary expression and therapeutic effect of a human lysozyme-expressing vector for treating bovine mastitis*

PubMed Central

Sun, Huai-Chang; Xue, Fang-Ming; Qian, Ke; Fang, Hao-Xia; Qiu, Hua-Lei; Zhang, Xin-Yu; Yin, Zhao-Hua

2006-01-01

To develop a gene therapy strategy for treating bovine mastitis, a new mammary-specific vector containing human lysozyme (hLYZ) cDNA and kanamycin resistance gene was constructed for intramammary expression and clinical studies. After one time acupuncture or intracisternal infusion of healthy cows with 400 μg of the p215C3LYZ vector, over 2.0 μg/ml of rhLYZ could be detected by enzymatic assay for about 3 weeks in the milk samples. Western blotting showed that rhLYZ secreted into milk samples from the vector-injected cows had molecular weight similar to that of the natural hLYZ in human colostrums. Twenty days after the primary injection, the quarters were re-injected with the same vector by quarter acupuncture and even higher concentrations of rhLYZ could be detected. Indirect competitive ELISA of milk samples showed that the vector injection did not induce detectable humoral immune response against hLYZ. Clinical studies showed that twice acupuncture of quarters with the p215C3LYZ vector had overt therapeutic effect on clinical and subclinical mastitis previously treated with antibiotics, including disappearance of clinical symptoms and relatively high microbiological cure rates. These data provide a solid rationale for using the vector to develop gene therapy for treating bovine mastitis. PMID:16532537

Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer.

PubMed

Buchlis, George; Podsakoff, Gregory M; Radu, Antonetta; Hawk, Sarah M; Flake, Alan W; Mingozzi, Federico; High, Katherine A

2012-03-29

In previous work we transferred a human factor IX-encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer.

Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer

PubMed Central

Buchlis, George; Podsakoff, Gregory M.; Radu, Antonetta; Hawk, Sarah M.; Flake, Alan W.; Mingozzi, Federico

2012-01-01

In previous work we transferred a human factor IX–encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer. PMID:22271447

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Heterologous prime-boost immunization of Newcastle disease virus vectored vaccines protected broiler chickens against highly pathogenic avian influenza and Newcastle disease viruses.

PubMed

Kim, Shin-Hee; Samal, Siba K

2017-07-24

Avian Influenza virus (AIV) is an important pathogen for both human and animal health. There is a great need to develop a safe and effective vaccine for AI infections in the field. Live-attenuated Newcastle disease virus (NDV) vectored AI vaccines have shown to be effective, but preexisting antibodies to the vaccine vector can affect the protective efficacy of the vaccine in the field. To improve the efficacy of AI vaccine, we generated a novel vectored vaccine by using a chimeric NDV vector that is serologically distant from NDV. In this study, the protective efficacy of our vaccines was evaluated by using H5N1 highly pathogenic avian influenza virus (HPAIV) strain A/Vietnam/1203/2004, a prototype strain for vaccine development. The vaccine viruses were three chimeric NDVs expressing the hemagglutinin (HA) protein in combination with the neuraminidase (NA) protein, matrix 1 protein, or nonstructural 1 protein. Comparison of their protective efficacy between a single and prime-boost immunizations indicated that prime immunization of 1-day-old SPF chicks with our vaccine viruses followed by boosting with the conventional NDV vector strain LaSota expressing the HA protein provided complete protection of chickens against mortality, clinical signs and virus shedding. Further verification of our heterologous prime-boost immunization using commercial broiler chickens suggested that a sequential immunization of chickens with chimeric NDV vector expressing the HA and NA proteins following the boost with NDV vector expressing the HA protein can be a promising strategy for the field vaccination against HPAIVs and against highly virulent NDVs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification and characterization of highly versatile peptide-vectors that bind non-competitively to the low-density lipoprotein receptor for in vivo targeting and delivery of small molecules and protein cargos

PubMed Central

David, Marion; Lécorché, Pascaline; Masse, Maxime; Faucon, Aude; Abouzid, Karima; Gaudin, Nicolas; Varini, Karine; Gassiot, Fanny; Ferracci, Géraldine; Jacquot, Guillaume; Vlieghe, Patrick

2018-01-01

Insufficient membrane penetration of drugs, in particular biotherapeutics and/or low target specificity remain a major drawback in their efficacy. We propose here the rational characterization and optimization of peptides to be developed as vectors that target cells expressing specific receptors involved in endocytosis or transcytosis. Among receptors involved in receptor-mediated transport is the LDL receptor. Screening complex phage-displayed peptide libraries on the human LDLR (hLDLR) stably expressed in cell lines led to the characterization of a family of cyclic and linear peptides that specifically bind the hLDLR. The VH411 lead cyclic peptide allowed endocytosis of payloads such as the S-Tag peptide or antibodies into cells expressing the hLDLR. Size reduction and chemical optimization of this lead peptide-vector led to improved receptor affinity. The optimized peptide-vectors were successfully conjugated to cargos of different nature and size including small organic molecules, siRNAs, peptides or a protein moiety such as an Fc fragment. We show that in all cases, the peptide-vectors retain their binding affinity to the hLDLR and potential for endocytosis. Following i.v. administration in wild type or ldlr-/- mice, an Fc fragment chemically conjugated or fused in C-terminal to peptide-vectors showed significant biodistribution in LDLR-enriched organs. We have thus developed highly versatile peptide-vectors endowed with good affinity for the LDLR as a target receptor. These peptide-vectors have the potential to be further developed for efficient transport of therapeutic or imaging agents into cells -including pathological cells—or organs that express the LDLR. PMID:29485998

Application of Genomics for Understanding Plant Virus-Insect Vector Interactions and Insect Vector Control.

PubMed

Kaur, Navneet; Hasegawa, Daniel K; Ling, Kai-Shu; Wintermantel, William M

2016-10-01

The relationships between plant viruses and their vectors have evolved over the millennia, and yet, studies on viruses began <150 years ago and investigations into the virus and vector interactions even more recently. The advent of next generation sequencing, including rapid genome and transcriptome analysis, methods for evaluation of small RNAs, and the related disciplines of proteomics and metabolomics offer a significant shift in the ability to elucidate molecular mechanisms involved in virus infection and transmission by insect vectors. Genomic technologies offer an unprecedented opportunity to examine the response of insect vectors to the presence of ingested viruses through gene expression changes and altered biochemical pathways. This review focuses on the interactions between viruses and their whitefly or thrips vectors and on potential applications of genomics-driven control of the insect vectors. Recent studies have evaluated gene expression in vectors during feeding on plants infected with begomoviruses, criniviruses, and tospoviruses, which exhibit very different types of virus-vector interactions. These studies demonstrate the advantages of genomics and the potential complementary studies that rapidly advance our understanding of the biology of virus transmission by insect vectors and offer additional opportunities to design novel genetic strategies to manage insect vectors and the viruses they transmit.