RNA interference for functional genomics and improvement of cotton (Gossypium species)
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...
Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube
USDA-ARS?s Scientific Manuscript database
RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....
Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.
2016-01-01
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085
RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?
Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N
2016-02-26
The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.
Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.
Abe, Hiroshi; Kimura, Yasuaki
2018-01-01
Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.
Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok
2012-07-01
A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.
EPA Registers Innovative Tool to Control Corn Rootworm
Ribonucleic acid interference (RNAi) based Plant Incorporated Protectant (PIP) technology is a new and innovative scientific tool utilized by U.S. growers. Learn more about RNAi technology and the 4 new products containing the RNAi based PIP called SMARTST
Ribonucleic acid interference (RNAi) and control of citrus pests
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...
USDA-ARS?s Scientific Manuscript database
Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...
ERIC Educational Resources Information Center
Roy, Nicole M.
2013-01-01
RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…
[RNA interference library research progress and its application in cancer research].
Zhao, Ning; Cai, Li
2013-02-01
RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)
Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765
RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).
Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E
2016-01-01
RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.
RNA interference: learning gene knock-down from cell physiology
Mocellin, Simone; Provenzano, Maurizio
2004-01-01
Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080
Emerging strategies for RNA interference (RNAi) applications in insects.
Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W
2015-01-01
RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.
RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella
Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.
2004-01-01
Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231
OfftargetFinder: a web tool for species-specific RNAi design.
Good, R T; Varghese, T; Golz, J F; Russell, D A; Papanicolaou, A; Edwards, O; Robin, C
2016-04-15
RNA interference (RNAi) technology is being developed as a weapon for pest insect control. To maximize the specificity that such an approach affords we have developed a bioinformatic web tool that searches the ever-growing arthropod transcriptome databases so that pest-specific RNAi sequences can be identified. This will help technology developers finesse the design of RNAi sequences and suggests which non-target species should be assessed in the risk assessment process. http://rnai.specifly.org crobin@unimelb.edu.au. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
"Caenorhabditis Elegans" as an Undergraduate Educational Tool for Teaching RNAi
ERIC Educational Resources Information Center
Andersen, Janet; Krichevsky, Alexander; Leheste, Joerg R.; Moloney, Daniel J.
2008-01-01
Discovery of RNA-mediated interference (RNAi) is widely recognized as one of the most significant molecular biology breakthroughs in the past 10 years. There is a need for science educators to develop teaching tools and laboratory activities that demonstrate the power of this new technology and help students to better understand the RNAi process.…
The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...
RNAi technologies in agricultural biotechnology: The Toxicology Forum 40th Annual Summer Meeting.
Sherman, James H; Munyikwa, Tichafa; Chan, Stephen Y; Petrick, Jay S; Witwer, Kenneth W; Choudhuri, Supratim
2015-11-01
During the 40th Annual Meeting of The Toxicology Forum, the current and potential future science, regulations, and politics of agricultural biotechnology were presented and discussed. The meeting session described herein focused on the technology of RNA interference (RNAi) in agriculture. The general process by which RNAi works, currently registered RNAi-based plant traits, example RNAi-based traits in development, potential use of double stranded RNA (dsRNA) as topically applied pesticide active ingredients, research related to the safety of RNAi, biological barriers to ingested dsRNA, recent regulatory RNAi science reviews, and regulatory considerations related to the use of RNAi in agriculture were discussed. Participants generally agreed that the current regulatory framework is robust and appropriate for evaluating the safety of RNAi employed in agricultural biotechnology and were also supportive of the use of RNAi to develop improved crop traits. However, as with any emerging technology, the potential range of future products, potential future regulatory frameworks, and public acceptance of the technology will continue to evolve. As such, continuing dialogue was encouraged to promote education of consumers and science-based regulations. Copyright © 2015 Elsevier Inc. All rights reserved.
Role of RNA interference in plant improvement
NASA Astrophysics Data System (ADS)
Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant
2011-06-01
Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.
Non-transgenic RNAi technology to control insects on citrus
USDA-ARS?s Scientific Manuscript database
This research demonstrated a non-transgenic delivery method for ribonucleic acid interference, RNAi, that reduced fitness as measured in increased mortality over time, of two insect pests of citrus, ie. psyllids and leafhoppers. The Asian citrus psyllid transmits a deadly plant-infecting bacterium o...
RNA interference: Applications and advances in insect toxicology and insect pest management.
Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan
2015-05-01
Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.
RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.
Rytlewski, Julie A; Beronja, Slobodan
2015-01-01
The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.
RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.
Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil
2017-01-01
Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.
Hassan, Ali
2006-06-01
RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.
Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha
2015-05-01
In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.
Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis)
Chaoyang Zhao; Miguel A. Alvarez Gonzales; Therese M. Poland; Omprakash Mittapalli
2015-01-01
The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong...
RNA Interference for improving the Outcome of Islet Transplantation
Li, Feng; Mahato, Ram I
2010-01-01
Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190
RNA interference-based therapeutics for inherited long QT syndrome.
Li, Guoliang; Ma, Shuting; Sun, Chaofeng
2015-08-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.
RNA interference-based therapeutics for inherited long QT syndrome
LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG
2015-01-01
Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327
Stacking up CRISPR against RNAi for therapeutic gene inhibition.
Haussecker, Dirk
2016-09-01
Both RNA interference (RNAi) and clustered regularly-interspaced short palindromic repeats (CRISPR) technologies allow for the sequence-specific inhibition of gene function and therefore have the potential to be used as therapeutic modalities. By judging the current public and scientific journal interest, it would seem that CRISPR, by enabling clean, durable knockouts, will dominate therapeutic gene inhibition, also at the expense of RNAi. This review aims to look behind prevailing sentiments and to more clearly define the likely scope of the therapeutic applications of the more recently developed CRISPR technology and its relative strengths and weaknesses with regards to RNAi. It is found that largely because of their broadly overlapping delivery constraints, while CRISPR presents formidable competition for DNA-directed RNAi strategies, its impact on RNAi therapeutics triggered by synthetic oligonucleotides will likely be more moderate. Instead, RNAi and genome editing, and in particular CRISPR, are poised to jointly promote a further shift toward sequence-targeted precision medicines. © 2016 Federation of European Biochemical Societies.
USDA-ARS?s Scientific Manuscript database
Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...
Chin, Wei-Xin; Ang, Swee Kim; Chu, Justin Jang Hann
2017-01-01
In invertebrate eukaryotes and prokaryotes, respectively, the RNAi and clustered regularly interspaced short palindromic repeats-CRISPR-associated (CRISPR-Cas) pathways are highly specific and efficient RNA and DNA interference systems, and are well characterised as potent antiviral systems. It has become possible to recruit or reconstitute these pathways in mammalian cells, where they can be directed against desired host or viral targets. The RNAi and CRISPR-Cas systems can therefore yield ideal antiviral therapeutics, capable of specific and efficient viral inhibition with minimal off-target effects, but development of such therapeutics can be slow. This review covers recent advances made towards developing RNAi or CRISPR-Cas strategies for clinical use. These studies address the delivery, toxicity or target design issues that typically plague the in vivo or clinical use of these technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zotti, M J; Smagghe, G
2015-06-01
The time has passed for us to wonder whether RNA interference (RNAi) effectively controls pest insects or protects beneficial insects from diseases. The RNAi era in insect science began with studies of gene function and genetics that paved the way for the development of novel and highly specific approaches for the management of pest insects and, more recently, for the treatment and prevention of diseases in beneficial insects. The slight differences in components of RNAi pathways are sufficient to provide a high degree of variation in responsiveness among insects. The current framework to assess the negative effects of genetically modified (GM) plants on human health is adequate for RNAi-based GM plants. Because of the mode of action of RNAi and the lack of genomic data for most exposed non-target organisms, it becomes difficult to determine the environmental risks posed by RNAi-based technologies and the benefits provided for the protection of crops. A better understanding of the mechanisms that determine the variability in the sensitivity of insects would accelerate the worldwide release of commercial RNAi-based approaches.
RNAi-based GM plants: food for thought for risk assessors.
Ramon, Matthew; Devos, Yann; Lanzoni, Anna; Liu, Yi; Gomes, Ana; Gennaro, Andrea; Waigmann, Elisabeth
2014-12-01
RNA interference (RNAi) is an emerging technology that offers new opportunities for the generation of new traits in genetically modified (GM) plants. Potential risks associated with RNAi-based GM plants and issues specific to their risk assessment were discussed during an international scientific workshop (June 2014) organized by the European Food Safety Authority (EFSA). Selected key outcomes of the workshop are reported here. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Exploring Fusarium head blight disease control by RNA interference
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...
Silencing of ATP11B by RNAi-Induced Changes in Neural Stem Cell Morphology.
Wang, Jiao; Wang, Qian; Zhou, Fangfang; Wang, Dong; Wen, Tieqiao
2017-01-01
RNA interference (RNAi) technology is one of the main research tools in many studies of neural stem cells. This study describes effects of ATP11B on the morphology change of neural stem cells by using RNAi. ATP11B belongs to P4-ATPases family, which is preferential translocate phosphatidylserine of cell membrane. Although it exists in neural stem cells, its physiological function is poorly understood. By using RNAi technology to downregulate expression of ATP11B, we found distinct morphological changes in neural stem cells. More important, psiRNA-ATP11B-transfected cells displayed short neurite outgrowth compared to the control cells. These data strongly suggest that ATP11B plays a key role in the morphological change of neural stem cells.
Zhou, Yinjian; Zhang, Chunling; Liang, Wei
2014-11-10
RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.
In vivo RNAi: Today and Tomorrow
Perrimon, Norbert; Ni, Jian-Quan; Perkins, Lizabeth
2010-01-01
SUMMARY RNA interference (RNAi) provides a powerful reverse genetics approach to analyze gene functions both in tissue culture and in vivo. Because of its widespread applicability and effectiveness it has become an essential part of the tool box kits of model organisms such as Caenorhabditis elegans, Drosophila, and the mouse. In addition, the use of RNAi in animals in which genetic tools are either poorly developed or nonexistent enables a myriad of fundamental questions to be asked. Here, we review the methods and applications of in vivo RNAi to characterize gene functions in model organisms and discuss their impact to the study of developmental as well as evolutionary questions. Further, we discuss the applications of RNAi technologies to crop improvement, pest control and RNAi therapeutics, thus providing an appreciation of the potential for phenomenal applications of RNAi to agriculture and medicine. PMID:20534712
Photoinduced RNA interference.
Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi
2012-07-17
Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of the target gene was detected even without PCI. Recently, a polymer capable of trapping the siRNA in endocytic vesicles controlled RNAi almost entirely by light. CLIP-RNAi uses photosensitizing carrier proteins that can be activated over a wide range of visible light wavelengths. With this method RNA carrier/siRNA complexes are completely trapped within endosomes, and RNAi is controlled strictly by light. Such precise, light-dependent control will open up new possibilities for cellular and molecular biology and therapy. Most recently, gold nanoparticles (AuNPs) conjugated to siRNA have provided temporal and spatial control of RNAi. The light-dependent melting of AuNPs accompanied by a shape transformation induces the release of thiolated siRNAs from AuNPs. In this method, the unique optical properties of the AuNP enable deep penetration of the excitation light into tissues at nearinfrared wavelengths. The development of photoinduced RNAi technology will lead to novel insights into gene functions and selective drug delivery, and many other scientific fields will continue to influence its progress.
Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference
Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant
2015-01-01
The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748
Sindhu, Anoop S; Maier, Tom R; Mitchum, Melissa G; Hussey, Richard S; Davis, Eric L; Baum, Thomas J
2009-01-01
Cyst nematodes are highly evolved sedentary plant endoparasites that use parasitism proteins injected through the stylet into host tissues to successfully parasitize plants. These secretory proteins likely are essential for parasitism as they are involved in a variety of parasitic events leading to the establishment of specialized feeding cells required by the nematode to obtain nourishment. With the advent of RNA interference (RNAi) technology and the demonstration of host-induced gene silencing in parasites, a new strategy to control pests and pathogens has become available, particularly in root-knot nematodes. Plant host-induced silencing of cyst nematode genes so far has had only limited success but similarly should disrupt the parasitic cycle and render the host plant resistant. Additional in planta RNAi data for cyst nematodes are being provided by targeting four parasitism genes through host-induced RNAi gene silencing in transgenic Arabidopsis thaliana, which is a host for the sugar beet cyst nematode Heterodera schachtii. Here it is reported that mRNA abundances of targeted nematode genes were specifically reduced in nematodes feeding on plants expressing corresponding RNAi constructs. Furthermore, this host-induced RNAi of all four nematode parasitism genes led to a reduction in the number of mature nematode females. Although no complete resistance was observed, the reduction of developing females ranged from 23% to 64% in different RNAi lines. These observations demonstrate the relevance of the targeted parasitism genes during the nematode life cycle and, potentially more importantly, suggest that a viable level of resistance in crop plants may be accomplished in the future using this technology against cyst nematodes.
Automated microscopy for high-content RNAi screening
2010-01-01
Fluorescence microscopy is one of the most powerful tools to investigate complex cellular processes such as cell division, cell motility, or intracellular trafficking. The availability of RNA interference (RNAi) technology and automated microscopy has opened the possibility to perform cellular imaging in functional genomics and other large-scale applications. Although imaging often dramatically increases the content of a screening assay, it poses new challenges to achieve accurate quantitative annotation and therefore needs to be carefully adjusted to the specific needs of individual screening applications. In this review, we discuss principles of assay design, large-scale RNAi, microscope automation, and computational data analysis. We highlight strategies for imaging-based RNAi screening adapted to different library and assay designs. PMID:20176920
GenomeRNAi: a database for cell-based RNAi phenotypes.
Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael
2007-01-01
RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.
Smith, Ian; Greenside, Peyton G; Natoli, Ted; Lahr, David L; Wadden, David; Tirosh, Itay; Narayan, Rajiv; Root, David E; Golub, Todd R; Subramanian, Aravind; Doench, John G
2017-11-01
The application of RNA interference (RNAi) to mammalian cells has provided the means to perform phenotypic screens to determine the functions of genes. Although RNAi has revolutionized loss-of-function genetic experiments, it has been difficult to systematically assess the prevalence and consequences of off-target effects. The Connectivity Map (CMAP) represents an unprecedented resource to study the gene expression consequences of expressing short hairpin RNAs (shRNAs). Analysis of signatures for over 13,000 shRNAs applied in 9 cell lines revealed that microRNA (miRNA)-like off-target effects of RNAi are far stronger and more pervasive than generally appreciated. We show that mitigating off-target effects is feasible in these datasets via computational methodologies to produce a consensus gene signature (CGS). In addition, we compared RNAi technology to clustered regularly interspaced short palindromic repeat (CRISPR)-based knockout by analysis of 373 single guide RNAs (sgRNAs) in 6 cells lines and show that the on-target efficacies are comparable, but CRISPR technology is far less susceptible to systematic off-target effects. These results will help guide the proper use and analysis of loss-of-function reagents for the determination of gene function.
GenomeRNAi: a database for cell-based RNAi phenotypes
Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael
2007-01-01
RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at PMID:17135194
Towards the elements of successful insect Ribonucleic acid interference (RNAi)
USDA-ARS?s Scientific Manuscript database
Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
DeVincenzo, John P
2009-10-01
A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral effects. The first proof of concept test of efficacy of an RNAi-based therapeutic in man has been initiated. A discussion of the science behind RNA interference is followed by a presentation of the potential practical issues in applying this technology to neonatal respiratory viral diseases. RNAi may offer new strategies for the treatment of a variety of orphan diseases including neonatal diseases, RSV infections, and other respiratory viruses.
Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M
1999-01-01
In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456
Differential effects of RNAi treatments on field populations of the western corn rootworm.
Chu, Chia-Ching; Sun, Weilin; Spencer, Joseph L; Pittendrigh, Barry R; Seufferheld, Manfredo J
2014-03-01
RNA interference (RNAi) mediated crop protection against insect pests is a technology that is greatly anticipated by the academic and industrial pest control communities. Prior to commercialization, factors influencing the potential for evolution of insect resistance to RNAi should be evaluated. While mutations in genes encoding the RNAi machinery or the sequences targeted for interference may serve as a prominent mechanism of resistance evolution, differential effects of RNAi on target pests may also facilitate such evolution. However, to date, little is known about how variation of field insect populations could influence the effectiveness of RNAi treatments. To approach this question, we evaluated the effects of RNAi treatments on adults of three western corn rootworm (WCR; Diabrotica virgifera virgifera LeConte) populations exhibiting different levels of gut cysteine protease activity, tolerance of soybean herbivory, and immune gene expression; two populations were collected from crop rotation-resistant (RR) problem areas and one from a location where RR was not observed (wild type; WT). Our results demonstrated that RNAi targeting DvRS5 (a highly expressed cysteine protease gene) reduced gut cysteine protease activity in all three WCR populations. However, the proportion of the cysteine protease activity that was inhibited varied across populations. When WCR adults were treated with double-stranded RNA of an immune gene att1, different changes in survival among WT and RR populations on soybean diets occurred. Notably, for both genes, the sequences targeted for RNAi were the same across all populations examined. These findings indicate that the effectiveness of RNAi treatments could vary among field populations depending on their physiological and genetic backgrounds and that the consistency of an RNAi trait's effectiveness on phenotypically different populations should be considered or tested prior to wide deployment. Also, genes that are potentially subjected to differential selection in the field should be avoided for RNAi-based pest control. Published by Elsevier Inc.
Kaur, Punit; Nagaraja, Ganachari M; Asea, Alexzander
2011-01-01
Elevated heat shock protein 27 (Hsp27) expression has been found in a number of tumors, including breast, prostate, gastric, uterine, ovarian, head and neck, and tumor arising from the nervous system and urinary system, and determined to be a predictor of poor clinical outcome. Although the mechanism of action of Hsp27 has been well documented, there are currently no available inhibitors of Hsp27 in clinical trials. RNA interference (RNAi) has the potential to offer more specificity and flexibility than traditional drugs to silence gene expression. Not surprisingly, RNAi has become a major focus for biotechnology and pharmaceutical companies, which are now in the early stages of developing RNAi therapeutics, mostly based on short interfering RNA (siRNAs), to target viral infection, cancer, hypercholesterolemia, cardiovascular disease, macular degeneration, and neurodegenerative diseases. However, the critical issues associated with RNAi as a therapeutic are delivery, specificity, and stability of the RNAi reagents. To date, the delivery is currently considered the biggest hurdle, as the introduction of siRNAs systemically into body fluids can result in their degradation, off-target effects, and immune detection. In this chapter, we discuss a method of combined lentiviral and RNAi-based technology for the delivery and permanent silencing of the hsp25 gene.
Virus-Derived Gene Expression and RNA Interference Vector for Grapevine
Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.
2012-01-01
The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553
Development of small RNA delivery systems for lung cancer therapy.
Fujita, Yu; Kuwano, Kazuyoshi; Ochiya, Takahiro
2015-03-06
RNA interference (RNAi) has emerged as a powerful tool for studying target identification and holds promise for the development of therapeutic gene silencing. Recent advances in RNAi delivery and target selection provide remarkable opportunities for translational medical research. The induction of RNAi relies on small silencing RNAs, which affect specific messenger RNA (mRNA) degradation. Two types of small RNA molecules, small interfering RNAs (siRNAs) and microRNAs (miRNAs), have a central function in RNAi technology. The success of RNAi-based therapeutic delivery may be dependent upon uncovering a delivery route, sophisticated delivery carriers, and nucleic acid modifications. Lung cancer is still the leading cause of cancer death worldwide, for which novel therapeutic strategies are critically needed. Recently, we have reported a novel platform (PnkRNA™ and nkRNA®) to promote naked RNAi approaches through inhalation without delivery vehicles in lung cancer xenograft models. We suggest that a new class of RNAi therapeutic agent and local drug delivery system could also offer a promising RNAi-based strategy for clinical applications in cancer therapy. In this article, we show recent strategies for an RNAi delivery system and suggest the possible clinical usefulness of RNAi-based therapeutics for lung cancer treatment.
Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying
2016-01-01
RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174
Gene Silencing in Insect Cells Using RNAi.
Wu, Hsuan-Chen; March, John C; Bentley, William E
2016-01-01
A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.
Intelligent Interfaces for Mining Large-Scale RNAi-HCS Image Databases
Lin, Chen; Mak, Wayne; Hong, Pengyu; Sepp, Katharine; Perrimon, Norbert
2010-01-01
Recently, High-content screening (HCS) has been combined with RNA interference (RNAi) to become an essential image-based high-throughput method for studying genes and biological networks through RNAi-induced cellular phenotype analyses. However, a genome-wide RNAi-HCS screen typically generates tens of thousands of images, most of which remain uncategorized due to the inadequacies of existing HCS image analysis tools. Until now, it still requires highly trained scientists to browse a prohibitively large RNAi-HCS image database and produce only a handful of qualitative results regarding cellular morphological phenotypes. For this reason we have developed intelligent interfaces to facilitate the application of the HCS technology in biomedical research. Our new interfaces empower biologists with computational power not only to effectively and efficiently explore large-scale RNAi-HCS image databases, but also to apply their knowledge and experience to interactive mining of cellular phenotypes using Content-Based Image Retrieval (CBIR) with Relevance Feedback (RF) techniques. PMID:21278820
Bringing RNA Interference (RNAi) into the High School Classroom
ERIC Educational Resources Information Center
Sengupta, Sibani
2013-01-01
RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.
Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin
2018-01-01
RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977
RNAi revised--target mRNA-dependent enhancement of gene silencing.
Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias
2015-12-15
The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bacterial delivery of RNAi effectors: transkingdom RNAi.
Lage, Hermann; Krühn, Andrea
2010-08-18
RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was enhanced in the pristine drug-resistant cancer cells and the MDR phenotype was reversed. By means of this model the data provide the proof-of-concept that tkRNAi is suitable for modulation of cancer-associated factors, e.g. ABCB1, in human cancer cells.
Potential and development of inhaled RNAi therapeutics for the treatment of pulmonary tuberculosis.
Man, Dede K W; Chow, Michael Y T; Casettari, Luca; Gonzalez-Juarrero, Mercedes; Lam, Jenny K W
2016-07-01
Tuberculosis (TB), caused by the infection of Mycobacterium tuberculosis (Mtb), continues to pose a serious threat to public health, and the situation is worsening with the rapid emergence of multidrug resistant (MDR) TB. Current TB regimens require long duration of treatment, and their toxic side effects often lead to poor adherence and low success rates. There is an urgent need for shorter and more effective treatment for TB. In recent years, RNA interference (RNAi) has become a powerful tool for studying gene function by silencing the target genes. The survival of Mtb in host macrophages involves the attenuation of the antimicrobial responses mounted by the host cells. RNAi technology has helped to improve our understanding of how these bacilli interferes with the bactericidal effect and host immunity during TB infection. It has been suggested that the host-directed intervention by modulation of host pathways can be employed as a novel and effective therapy against TB. This therapeutic approach could be achieved by RNAi, which holds enormous potential beyond a laboratory to the clinic. RNAi therapy targeting TB is being investigated for enhancing host antibacterial capacity or improving drug efficacy on drug resistance strains while minimizing the associated adverse effects. One of the key challenges of RNAi therapeutics arises from the delivery of the RNAi molecules into the target cells, and inhalation could serve as a direct administration route for the treatment of pulmonary TB in a non-invasive manner. However, there are still major obstacles that need to be overcome. This review focuses on the RNAi candidates that are currently explored for the treatment of TB and discusses the major barriers of pulmonary RNAi delivery. From this, we hope to stimulate further studies of local RNAi therapeutics for pulmonary TB treatment. Copyright © 2016 Elsevier B.V. All rights reserved.
Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.
Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F
2018-04-03
High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.
Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D
2018-06-01
The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.
Delivery of RNAi Therapeutics to the Airways-From Bench to Bedside.
Qiu, Yingshan; Lam, Jenny K W; Leung, Susan W S; Liang, Wanling
2016-09-20
RNA interference (RNAi) is a potent and specific post-transcriptional gene silencing process. Since its discovery, tremendous efforts have been made to translate RNAi technology into therapeutic applications for the treatment of different human diseases including respiratory diseases, by manipulating the expression of disease-associated gene(s). Similar to other nucleic acid-based therapeutics, the major hurdle of RNAi therapy is delivery. Pulmonary delivery is a promising approach of delivering RNAi therapeutics directly to the airways for treating local conditions and minimizing systemic side effects. It is a non-invasive route of administration that is generally well accepted by patients. However, pulmonary drug delivery is a challenge as the lungs pose a series of anatomical, physiological and immunological barriers to drug delivery. Understanding these barriers is essential for the development an effective RNA delivery system. In this review, the different barriers to pulmonary drug delivery are introduced. The potential of RNAi molecules as new class of therapeutics, and the latest preclinical and clinical studies of using RNAi therapeutics in different respiratory conditions are discussed in details. We hope this review can provide some useful insights for moving inhaled RNAi therapeutics from bench to bedside.
Taylor, Jessica; Woodcock, Simon
2015-09-01
For more than a decade, RNA interference (RNAi) has brought about an entirely new approach to functional genomics screening. Enabling high-throughput loss-of-function (LOF) screens against the human genome, identifying new drug targets, and significantly advancing experimental biology, RNAi is a fast, flexible technology that is compatible with existing high-throughput systems and processes; however, the recent advent of clustered regularly interspaced palindromic repeats (CRISPR)-Cas, a powerful new precise genome-editing (PGE) technology, has opened up vast possibilities for functional genomics. CRISPR-Cas is novel in its simplicity: one piece of easily engineered guide RNA (gRNA) is used to target a gene sequence, and Cas9 expression is required in the cells. The targeted double-strand break introduced by the gRNA-Cas9 complex is highly effective at removing gene expression compared to RNAi. Together with the reduced cost and complexity of CRISPR-Cas, there is the realistic opportunity to use PGE to screen for phenotypic effects in a total gene knockout background. This review summarizes the exciting development of CRISPR-Cas as a high-throughput screening tool, comparing its future potential to that of well-established RNAi screening techniques, and highlighting future challenges and opportunities within these disciplines. We conclude that the two technologies actually complement rather than compete with each other, enabling greater understanding of the genome in relation to drug discovery. © 2015 Society for Laboratory Automation and Screening.
Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao
2014-04-01
During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.
Individualised cancer therapeutics: dream or reality? Therapeutics construction.
Shen, Yuqiao; Senzer, Neil; Nemunaitis, John
2005-11-01
The analysis of DNA microarray and proteomic data, and the subsequent integration into functional expression sets, provides a circuit map of the hierarchical cellular networks responsible for sustaining the viability and environmental competitiveness of cancer cells, that is, their robust systematics. These technologies can be used to 'snapshot' the unique patterns of molecular derangements and modified interactions in cancer, and allow for strategic selection of therapeutics that best match the individual profile of the tumour. This review highlights technology that can be used to selectively disrupt critical molecular targets and describes possible vehicles to deliver the synthesised molecular therapeutics to the relevant cellular compartments of the malignant cells. RNA interference (RNAi) involves a group of evolutionarily conserved gene silencing mechanisms in which small sequences of double-stranded RNA or intrinsic antisense RNA trigger mRNA cleavage or translational repression, respectively. Although RNAi molecules can be synthesised to 'silence' virtually any gene, even if upregulated, a mechanism for selective delivery of RNAi effectors to sites of malignant disease remains challenging. The authors will discuss gene-modified conditionally replicating viruses as candidate vehicles for the delivery of RNAi.
Han, Qiang; Wang, Zhenzhen; He, Yunxin; Xiong, Yehui; Lv, Shun; Li, Shupeng; Zhang, Zhigang; Qiu, Dewen; Zeng, Hongmei
2017-01-01
RNA interference (RNAi) has been developed as an efficient technology. RNAi insect-resistant transgenic plants expressing double-stranded RNA (dsRNA) that is ingested into insects to silence target genes can affect the viability of these pests or even lead to their death. HaHR3, a molt-regulating transcription factor gene, was previously selected as a target expressed in bacteria and tobacco plants to control Helicoverpa armigera by RNAi technology. In this work, we selected the dsRNA-HaHR3 fragment to silence HaHR3 in cotton bollworm for plant mediated-RNAi research. A total of 19 transgenic cotton lines expressing HaHR3 were successfully cultivated, and seven generated lines were used to perform feeding bioassays. Transgenic cotton plants expressing dsHaHR3 were shown to induce high larval mortality and deformities of pupation and adult eclosion when used to feed the newly hatched larvae, and 3rd and 5th instar larvae of H. armigera. Moreover, HaHR3 transgenic cotton also demonstrated an improved cotton yield when compared with controls. PMID:28867769
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.
Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin
2018-01-01
RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992
Biosafety research for non-target organism risk assessment of RNAi-based GE plants
Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo
2015-01-01
RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220
Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.
Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar
2015-01-01
The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.
RNA Interference in Infectious Tropical Diseases
Hong, Young S.
2008-01-01
Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671
iScreen: Image-Based High-Content RNAi Screening Analysis Tools.
Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua
2015-09-01
High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.
Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.
2010-01-01
Background RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or Caenorhabditis elegans, often large dsRNAs are used. One of the drawbacks of RNAi technology is that unwanted gene products with sequence similarity to the gene of interest can be down regulated too. To verify the outcome of an RNAi experiment and to avoid these unwanted off-target effects, an additional non-overlapping dsRNA can be used to down-regulate the same gene. However it has never been tested whether this approach is sufficient to reduce the risk of off-targets. Methodology We created a novel tool to analyse the occurance of off-target effects in Drosophila and we analyzed 99 randomly chosen genes. Principal Findings Here we show that nearly all genes contain non-overlapping internal sequences that do show overlap in a common off-target gene. Conclusion Based on our in silico findings, off-target effects should not be ignored and our presented on-line tool enables the identification of two RNA interference constructs, free of overlapping off-targets, from any gene of interest. PMID:20957038
Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu
2016-12-01
RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.
RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.
Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu
2017-04-01
Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.
RNA interference: ready to silence cancer?
Mocellin, Simone; Costa, Rodolfo; Nitti, Donato
2006-01-01
RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.
Bowerman, Bruce
2011-10-01
Molecular genetic investigation of the early Caenorhabditis elegans embryo has contributed substantially to the discovery and general understanding of the genes, pathways, and mechanisms that regulate and execute developmental and cell biological processes. Initially, worm geneticists relied exclusively on a classical genetics approach, isolating mutants with interesting phenotypes after mutagenesis and then determining the identity of the affected genes. Subsequently, the discovery of RNA interference (RNAi) led to a much greater reliance on a reverse genetics approach: reducing the function of known genes with RNAi and then observing the phenotypic consequences. Now the advent of next-generation DNA sequencing technologies and the ensuing ease and affordability of whole-genome sequencing are reviving the use of classical genetics to investigate early C. elegans embryogenesis.
RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.
Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy
2018-06-01
Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Small silencing RNAs: state-of-the-art.
Grimm, Dirk
2009-07-25
Over just a single decade, we have witnessed the rapid maturation of the field of RNA interference - the sequence-specific gene silencing mediated by small double-stranded RNAs - directly from its infancy into adulthood. With exciting data currently emerging from first clinical trials, it is now more likely than ever that RNAi drugs will soon provide another potent class of agents in our battle against infectious and genetic diseases. Accelerating this process and adding to RNAi's promise is our steadily expanding arsenal of innovative RNAi-based experimental tools and clinically applicable technologies. This article will critically review a selection of relevant recent advances in RNAi therapeutics, from novel asymmetric or bi-functional siRNA designs, deliberate use of small RNAs to regulate nuclear transcription, engineering of potent adeno-associated viral vectors for shRNA expression, exploitation of endogenous miRNAs to control transgene expression or vector tropism, to elegant attempts to inhibit cellular miRNAs involved in human disease. This review will also present cautionary notes on the potential risks inherent to in vivo RNAi applications, before discussing the latest surprising findings on circulating miRNAs in human body fluids, and concluding with an outlook into the possible future of RNAi as an increasingly powerful biomedical tool.
Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.
2012-01-01
Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-01-01
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667
Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.
Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu
2015-03-03
RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.
RNA interference in the clinic: challenges and future directions
Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.
2011-01-01
Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526
Advance of RNA interference technique in Hemipteran insects.
Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia
2012-07-24
RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.
Selective gene silencing by viral delivery of short hairpin RNA
2010-01-01
RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246
Targeting the undruggable: Advances and obstacles in current RNAi therapy
Wu, Sherry Y.; Lopez-Berestein, Gabriel; Calin, George A.; Sood, Anil K.
2014-01-01
RNA interference (RNAi) therapeutics represents a rapidly emerging platform for personalized cancer treatment. Recent advances in delivery, target selection, and safety of RNAi cancer therapy provide unprecedented opportunities for clinical translation. Here, we discuss these advances and present strategies for making RNAi-based therapy a viable part of cancer management. PMID:24920658
RNA interference of tubulin genes has lethal effects in Mythimna separate.
Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji
2018-05-23
RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.
RNAi-mediated resistance to viruses in genetically engineered plants.
Ibrahim, Abdulrazak B; Aragão, Francisco J L
2015-01-01
RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.
Suppression of RNA Interference by Adenovirus Virus-Associated RNA†
Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran
2005-01-01
We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.
RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding
Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung
2014-01-01
RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689
USDA-ARS?s Scientific Manuscript database
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...
RNA interference: from biology to drugs and therapeutics.
Appasani, Krishnarao
2004-07-01
RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.
Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control.
Perkin, Lindsey C; Adrianos, Sherry L; Oppert, Brenda
2016-09-19
Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi) may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA) in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs.
RNA interference-mediated intrinsic antiviral immunity in invertebrates.
Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul
2013-01-01
In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...
USDA-ARS?s Scientific Manuscript database
RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...
Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).
Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash
2015-01-01
The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.
Key enzymes and proteins of crop insects as candidate for RNAi based gene silencing
Kola, Vijaya Sudhakara Rao; Renuka, P.; Madhav, Maganti Sheshu; Mangrauthia, Satendra K.
2015-01-01
RNA interference (RNAi) is a mechanism of homology dependent gene silencing present in plants and animals. It operates through 21–24 nucleotides small RNAs which are processed through a set of core enzymatic machinery that involves Dicer and Argonaute proteins. In recent past, the technology has been well appreciated toward the control of plant pathogens and insects through suppression of key genes/proteins of infecting organisms. The genes encoding key enzymes/proteins with the great potential for developing an effective insect control by RNAi approach are actylcholinesterase, cytochrome P450 enzymes, amino peptidase N, allatostatin, allatotropin, tryptophan oxygenase, arginine kinase, vacuolar ATPase, chitin synthase, glutathione-S-transferase, catalase, trehalose phosphate synthase, vitellogenin, hydroxy-3-methylglutaryl coenzyme A reductase, and hormone receptor genes. Through various studies, it is demonstrated that RNAi is a reliable molecular tool which offers great promises in meeting the challenges imposed by crop insects with careful selection of key enzymes/proteins. Utilization of RNAi tool to target some of these key proteins of crop insects through various approaches is described here. The major challenges of RNAi based insect control such as identifying potential targets, delivery methods of silencing trigger, off target effects, and complexity of insect biology are very well illustrated. Further, required efforts to address these challenges are also discussed. PMID:25954206
Molecular mechanisms influencing efficiency of RNA interference in insects.
Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan
2018-06-21
RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Asian citrus psyllid RNAi pathway - RNAi evidence
USDA-ARS?s Scientific Manuscript database
In silico analyses of the draft genome of Diaphorina citri, the Asian citrus psyllid, for genes within the Ribonucleic acid interference(RNAi), pathway was successful. The psyllid is the vector of the plant-infecting bacterium, Candidatus Liberibacter asiaticus (CLas), which is linked to citrus gree...
Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.
2014-01-01
RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428
Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice
De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.
2006-01-01
RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951
Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi
2017-01-01
Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.
RNAi control of aflatoxins in peanut plants, a multifactorial system
USDA-ARS?s Scientific Manuscript database
RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...
Blood-brain barrier transport of non-viral gene and RNAi therapeutics.
Boado, Ruben J
2007-09-01
The development of gene- and RNA interference (RNAi)-based therapeutics represents a challenge for the drug delivery field. The global brain distribution of DNA genes, as well as the targeting of specific regions of the brain, is even more complicated because conventional delivery systems, i.e. viruses, have poor diffusion in brain when injected in situ and do not cross the blood-brain barrier (BBB), which is only permeable to lipophilic molecules of less than 400 Da. Recent advances in the "Trojan Horse Liposome" (THL) technology applied to the transvascular non-viral gene therapy of brain disorders presents a promising solution to the DNA/RNAi delivery obstacle. The THL is comprised of immunoliposomes carrying either a gene for protein replacement or small hairpin RNA (shRNA) expression plasmids for RNAi effect, respectively. The THL is engineered with known lipids containing polyethyleneglycol (PEG), which stabilizes its structure in vivo in circulation. The tissue target specificity of THL is given by conjugation of approximately 1% of the PEG residues to peptidomimetic monoclonal antibodies (MAb) that bind to specific endogenous receptors (i.e. insulin and transferrin receptors) located on both the BBB and the brain cellular membranes, respectively. These MAbs mediate (a) receptor-mediated transcytosis of the THL complex through the BBB, (b) endocytosis into brain cells and (c) transport to the brain cell nuclear compartment. The present review presents an overview of the THL technology and its current application to gene therapy and RNAi, including experimental models of Parkinson's disease and brain tumors.
RNAi mediated, stable resistance to Triticum mosaic virus in wheat
USDA-ARS?s Scientific Manuscript database
Triticum mosaic virus (TriMV), discovered in 2006, affects wheat production systems in the Great Plains of the United States. There are no available TriMV resistant commercial varieties. RNA interference (RNAi) was evaluated as an alternative strategy to generate resistance to TriMV. An RNAi pANDA...
Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima
2011-02-01
Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.
Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference
Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara
2011-01-01
RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.
2012-01-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954
Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J
2012-05-01
The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.
Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A
2011-02-01
To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses. PMID:25668122
HIV-1 RRE RNA acts as an RNA silencing suppressor by competing with TRBP-bound siRNAs.
Daniels, Sylvanne M; Sinck, Lucile; Ward, Natalie J; Melendez-Peña, Carlos E; Scarborough, Robert J; Azar, Ibrahim; Rance, Elodie; Daher, Aïcha; Pang, Ka-Ming; Rossi, John J; Gatignol, Anne
2015-01-01
Several proteins and RNAs expressed by mammalian viruses have been reported to interfere with RNA interference (RNAi) activity. We investigated the ability of the HIV-1-encoded RNA elements Trans-Activation Response (TAR) and Rev-Response Element (RRE) to alter RNAi. MicroRNA let7-based assays showed that RRE is a potent suppressor of RNAi activity, while TAR displayed moderate RNAi suppression. We demonstrate that RRE binds to TAR-RNA Binding Protein (TRBP), an essential component of the RNA Induced Silencing Complex (RISC). The binding of TAR and RRE to TRBP displaces small interfering (si)RNAs from binding to TRBP. Several stem-deleted RRE mutants lost their ability to suppress RNAi activity, which correlated with a reduced ability to compete with siRNA-TRBP binding. A lentiviral vector expressing TAR and RRE restricted RNAi, but RNAi was restored when Rev or GagPol were coexpressed. Adenoviruses are restricted by RNAi and encode their own suppressors of RNAi, the Virus-Associated (VA) RNA elements. RRE enhanced the replication of wild-type and VA-deficient adenovirus. Our work describes RRE as a novel suppressor of RNAi that acts by competing with siRNAs rather than by disrupting the RISC. This function is masked in lentiviral vectors co-expressed with viral proteins and thus will not affect their use in gene therapy. The potent RNAi suppressive effects of RRE identified in this study could be used to enhance the expression of RNAi restricted viruses used in oncolysis such as adenoviruses.
Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C
2005-02-22
RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.
Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.
Wang, Leo L; Burdick, Jason A
2017-01-01
It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Affinity approaches in RNAi-based therapeutics purification.
Pereira, Patrícia; Queiroz, João A; Figueiras, Ana; Sousa, Fani
2016-05-15
The recent investigation on RNA interference (RNAi) related mechanisms and applications led to an increased awareness of the importance of RNA in biology. Nowadays, RNAi-based technology has emerged as a potentially powerful tool for silencing gene expression, being exploited to develop new therapeutics for treating a vast number of human disease conditions, as it is expected that this technology can be translated onto clinical applications in a near future. This approach makes use of a large number of small (namely short interfering RNAs, microRNAs and PIWI-interacting RNAs) and long non-coding RNAs (ncRNAs), which are likely to have a crucial role as the next generation therapeutics. The commercial and biomedical interest in these RNAi-based therapy applications have fostered the need to develop innovative procedures to easily and efficiently purify RNA, aiming to obtain the final product with high purity degree, good quality and biological activity. Recently, affinity chromatography has been applied to ncRNAs purification, in view of the high specificity. Therefore, this article intends to review the biogenesis pathways of regulatory ncRNAs and also to discuss the most significant and recent developments as well as applications of affinity chromatography in the challenging task of purifying ncRNAs. In addition, the importance of affinity chromatography in ncRNAs purification is addressed and prospects for what is forthcoming are presented. Copyright © 2016 Elsevier B.V. All rights reserved.
RNA Interference in Insect Vectors for Plant Viruses.
Kanakala, Surapathrudu; Ghanim, Murad
2016-12-12
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.
RNA Interference in Insect Vectors for Plant Viruses
Kanakala, Surapathrudu; Ghanim, Murad
2016-01-01
Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446
Respiratory viral diseases: access to RNA interference therapy
Bitko, Vira; Barik, Sailen
2008-01-01
This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824
Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.
2012-01-01
Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421
RNA interference inhibits yellow fever virus replication in vitro and in vivo.
Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L
2009-04-01
RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.
Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A
2017-02-01
Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.
Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy
2011-02-01
Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.
Multimodality Imaging of RNA Interference
Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo
2013-01-01
The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567
Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum
Tomoyasu, Yoshinori
2014-01-01
The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485
Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A
2017-02-01
RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.
RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.
Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana
2018-01-01
Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.
Induction of RNA interference in dendritic cells.
Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping
2004-01-01
Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.
Biolistics-based gene silencing in plants using a modified particle inflow gun.
Davies, Kevin M; Deroles, Simon C; Boase, Murray R; Hunter, Don A; Schwinn, Kathy E
2013-01-01
RNA interference (RNAi) is one of the most commonly used techniques for examining the function of genes of interest. In this chapter we present two examples of RNAi that use the particle inflow gun for delivery of the DNA constructs. In one example transient RNAi is used to show the function of an anthocyanin regulatory gene in flower petals. In the second example stably transformed cell cultures are produced with an RNAi construct that results in a change in the anthocyanin hydroxylation pattern.
RNAi Screening in Spodoptera frugiperda.
Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K
2016-01-01
RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.
Genome Editing in the Cricket, Gryllus bimaculatus.
Watanabe, Takahito; Noji, Sumihare; Mito, Taro
2017-01-01
Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal and include many beneficial and deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome editing technologies in this species would greatly promote functional genomics studies. Genome editing has proven to be an effective method for site-specific genome manipulation in various species. Here, we describe a protocol for genome editing including gene knockout and gene knockin in G. bimaculatus for functional genomics studies.
Efficacy of a Novel Class of RNA Interference Therapeutic Agents
Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki
2012-01-01
RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145
RNA interference-based nanosystems for inflammatory bowel disease therapy
Guo, Jian; Jiang, Xiaojing; Gui, Shuangying
2016-01-01
Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943
CRISPR Genome Engineering for Human Pluripotent Stem Cell Research
Chaterji, Somali; Ahn, Eun Hyun; Kim, Deok-Ho
2017-01-01
The emergence of targeted and efficient genome editing technologies, such as repurposed bacterial programmable nucleases (e.g., CRISPR-Cas systems), has abetted the development of cell engineering approaches. Lessons learned from the development of RNA-interference (RNA-i) therapies can spur the translation of genome editing, such as those enabling the translation of human pluripotent stem cell engineering. In this review, we discuss the opportunities and the challenges of repurposing bacterial nucleases for genome editing, while appreciating their roles, primarily at the epigenomic granularity. First, we discuss the evolution of high-precision, genome editing technologies, highlighting CRISPR-Cas9. They exist in the form of programmable nucleases, engineered with sequence-specific localizing domains, and with the ability to revolutionize human stem cell technologies through precision targeting with greater on-target activities. Next, we highlight the major challenges that need to be met prior to bench-to-bedside translation, often learning from the path-to-clinic of complementary technologies, such as RNA-i. Finally, we suggest potential bioinformatics developments and CRISPR delivery vehicles that can be deployed to circumvent some of the challenges confronting genome editing technologies en route to the clinic. PMID:29158838
Double strand RNA delivery system for plant-sap-feeding insects
Ghosh, Saikat Kumar B.; Hunter, Wayne B.; Park, Alexis L.; Gundersen-Rindal, Dawn E.
2017-01-01
Double-stranded RNA (dsRNA)-mediated gene silencing, also known as RNA interference (RNAi), has been a breakthrough technology for functional genomic studies and represents a potential tool for the management of insect pests. Since the inception of RNAi numerous studies documented successful introduction of exogenously synthesized dsRNA or siRNA into an organism triggering highly efficient gene silencing through the degradation of endogenous RNA homologous to the presented siRNA. Managing hemipteran insect pests, especially Halyomorpha halys (Stål) (Heteroptera: Pentatomidae), the brown marmorated stink bug (BMSB), is critical to food productivity. BMSB was recently introduced into North America where it is both an invasive agricultural pest of high value specialty, row, and staple crops, as well as an indoor nuisance pest. RNAi technology may serve as a viable tool to manage this voracious pest, but delivery of dsRNA to piercing-sucking insects has posed a tremendous challenge. Effective and practical use of RNAi as molecular biopesticides for biocontrol of insects like BMSB in the environment requires that dsRNAs be delivered in vivo through ingestion. Therefore, the key challenge for molecular biologists in developing insect-specific molecular biopesticides is to find effective and reliable methods for practical delivery of stable dsRNAs such as through oral ingestion. Here demonstrated is a reliable delivery system of effective insect-specific dsRNAs through oral feeding through a new delivery system to induce a significant decrease in expression of targeted genes such as JHAMT and Vg. This state-of-the-art delivery method overcomes environmental delivery challenges so that RNAi is induced through insect-specific dsRNAs orally delivered to hemipteran and other insect pests. PMID:28182760
Therapeutic application of RNAi: is mRNA targeting finally ready for prime time?
Grimm, Dirk; Kay, Mark A.
2007-01-01
With unprecedented speed, RNA interference (RNAi) has advanced from its basic discovery in lower organisms to becoming a powerful genetic tool and perhaps our single most promising biotherapeutic for a wide array of diseases. Numerous studies document RNAi efficacy in laboratory animals, and the first clinical trials are underway and thus far suggest that RNAi is safe to use in humans. Yet substantial hurdles have also surfaced and must be surmounted before therapeutic RNAi applications can become a standard therapy. Here we review the most critical roadblocks and concerns for clinical RNAi transition, delivery, and safety. We highlight emerging solutions and concurrently discuss novel therapeutic RNAi-based concepts. The current rapid advances create realistic optimism that the establishment of RNAi as a new and potent clinical modality in humans is near. PMID:18060021
2014-01-01
Background Triacylglycerols (TAGs) are the most abundant form of storage oil in plants. They consist of three fatty acid chains (usually C16 or C18) covalently linked to glycerol. SDP1 is a specific lipase for the first step of TAG catabolism in Arabidopsis seeds. Arabidopsis mutants deficient in SDP1 accumulate high levels of oils, probably due to blockage in TAG degradation. We applied this knowledge from the model plant, Arabidopsis thaliana, to engineer increased seed oil content in the biodiesel plant Jatropha curcas using RNA interference (RNAi) technology. Results As Jatropha is a biodiesel crop, any significant increase in its seed oil content would be an important agronomic trait. Using A. thaliana as a model plant, we found that a deficiency of SDP1 led to higher TAG accumulation and a larger number of oil bodies in seeds compared with wild type (Columbia-0; Col-0). We cloned Jatropha JcSDP1, and verified its function by complementation of the Arabidopsis sdp1-5 mutant. Taking advantage of the observation with Arabidopsis, we used RNAi technology to generate JcSDP1 deficiency in transgenic Jatropha. We found that Jatropha JcSDP1-RNAi plants accumulated 13 to 30% higher total seed storage lipid, along with a 7% compensatory decrease in protein content, compared with control (CK; 35S:GFP) plants. Free fatty acid (FFA) content in seeds was reduced from 27% in control plants to 8.5% in JcSDP1-RNAi plants. Conclusion Here, we showed that SDP1 deficiency enhances seed oil accumulation in Arabidopsis. Based on this result, we generated SDP1-deficient transgenic Jatropha plants using by RNAi technology with a native JcSDP1 promoter to silence endogenous JcSDP1 expression. Seeds of Jatropha JcSDP1-RNAi plants accumulated up to 30% higher total lipid and had reduced FFA content compared with control (CK; 35S:GFP) plants. Our strategy of improving an important agronomic trait of Jatropha can be extended to other oil crops to yield higher seed oil. PMID:24606605
Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.
Gonzalez-Alegre, Pedro
2007-04-01
RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.
RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates
Palmer, William H.; Hadfield, Jarrod D.; Obbard, Darren J.
2018-01-01
Conflict between organisms can lead to a reciprocal adaptation that manifests as an increased evolutionary rate in genes mediating the conflict. This adaptive signature has been observed in RNA-interference (RNAi) pathway genes involved in the suppression of viruses and transposable elements in Drosophila melanogaster, suggesting that a subset of Drosophila RNAi genes may be locked in an arms race with these parasites. However, it is not known whether rapid evolution of RNAi genes is a general phenomenon across invertebrates, or which RNAi genes generally evolve adaptively. Here we use population genomic data from eight invertebrate species to infer rates of adaptive sequence evolution, and to test for past and ongoing selective sweeps in RNAi genes. We assess rates of adaptive protein evolution across species using a formal meta-analytic framework to combine data across species and by implementing a multispecies generalized linear mixed model of mutation counts. Across species, we find that RNAi genes display a greater rate of adaptive protein substitution than other genes, and that this is primarily mediated by positive selection acting on the genes most likely to defend against viruses and transposable elements. In contrast, evidence for recent selective sweeps is broadly spread across functional classes of RNAi genes and differs substantially among species. Finally, we identify genes that exhibit elevated adaptive evolution across the analyzed insect species, perhaps due to concurrent parasite-mediated arms races. PMID:29437826
Silence of the transcripts: RNA interference in medicine.
Barik, Sailen
2005-10-01
Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.
Therapeutic Potency of Nanoformulations of siRNAs and shRNAs in Animal Models of Cancers.
Karim, Md Emranul; Tha, Kyi Kyi; Othman, Iekhsan; Borhan Uddin, Mohammad; Chowdhury, Ezharul Hoque
2018-05-26
RNA Interference (RNAi) has brought revolutionary transformations in cancer management in the past two decades. RNAi-based therapeutics including siRNA and shRNA have immense scope to silence the expression of mutant cancer genes specifically in a therapeutic context. Although tremendous progress has been made to establish catalytic RNA as a new class of biologics for cancer management, a lot of extracellular and intracellular barriers still pose a long-lasting challenge on the way to clinical approval. A series of chemically suitable, safe and effective viral and non-viral carriers have emerged to overcome physiological barriers and ensure targeted delivery of RNAi. The newly invented carriers, delivery techniques and gene editing technology made current treatment protocols stronger to fight cancer. This review has provided a platform about the chronicle of siRNA development and challenges of RNAi therapeutics for laboratory to bedside translation focusing on recent advancement in siRNA delivery vehicles with their limitations. Furthermore, an overview of several animal model studies of siRNA- or shRNA-based cancer gene therapy over the past 15 years has been presented, highlighting the roles of genes in multiple cancers, pharmacokinetic parameters and critical evaluation. The review concludes with a future direction for the development of catalytic RNA vehicles and design strategies to make RNAi-based cancer gene therapy more promising to surmount cancer gene delivery challenges.
Huang, Kun; Liu, Ju; Zhang, Hui; Wang, Jiliang; Li, Huili
2016-01-01
Ischaemia/reperfusion (I/R) injury will cause additional death of cardiomyocytes in ischaemic heart disease. Recent studies revealed that renalase was involved in the I/R injury. So, the myocardial tissue-specific knockdown mouse models were needed for the investigations of renalase. To establish the mouse models, intramyocardial injection of siRNAs targeting renalase was performed in mice. The wild distribution and high transfection efficiency of the siRNAs were approved. And the renalase expression was efficiently suppressed in myocardial tissue. Compared with the high cost, time consumption, and genetic compensation risk of the Cre/loxP technology, RNA interference (RNAi) technology is much cheaper and less time-consuming. Among the RNAi technologies, injection of siRNAs is safer than virus. And considering the properties of the I/R injury mouse models, the efficiency and durability of injection with siRNAs are acceptable for the studies. Altogether, intramyocardial injection of siRNAs targeting renalase is an economical, safe, and efficient method to establish myocardial tissue-specific renalase knockdown mouse models.
Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J
2011-03-01
Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.
Next-generation libraries for robust RNA interference-based genome-wide screens
Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.
2015-01-01
Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438
Ibrahim, Abdulrazak B; Monteiro, Tatiane R; Cabral, Glaucia B; Aragão, Francisco J L
2017-10-01
RNA interference (RNAi)-based transgenic technologies have evolved as potent biochemical tools for silencing specific genes of plant pathogens and pests. The approach has been demonstrated to be useful in silencing genes in insect species. Here, we report on the successful construction of RNAi-based plasmid containing an interfering cassette designed to generate dsRNAs that target a novel v-ATPase transcript in whitefly (Bemisia tabaci), an important agricultural pest in tropical and sub-tropical regions. The presence of the transgene was confirmed in T 0 and T 1 generations of transgenic lettuce lines, segregating in a Mendelian fashion. Seven lines were infested with whiteflies and monitored over a period of 32 days. Analysis of mortality showed that within five days of feeding, insects on transgenic plants showed a mortality rate of 83.8-98.1%. In addition, a reduced number of eggs (95 fold less) was observed in flies feeding on transgenic lettuce plants than insects on control lines. Quantitative reverse transcription PCR showed decreased expression level of endogenous v-ATPase gene in whiteflies feeding on transgenic plants. This technology is a foundation for the production of whitefly-resistant commercial crops, improving agricultural sustainability and food security, reducing the use of more environmentally aggressive methods of pest control.
Conditional RNAi: towards a silent gene therapy.
Lee, Sang-Kyung; Kumar, Priti
2009-07-02
RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.
Novel Methods for Mosquito Control using RNAi.
USDA-ARS?s Scientific Manuscript database
The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...
Aedes aegypti uses RNA interference in defense against Sindbis virus infection.
Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D
2008-03-17
RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.
Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan
2013-01-01
RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001
Prokaryotic Argonautes - variations on the RNA interference theme.
van der Oost, John; Swarts, Daan C; Jore, Matthijs M
2014-04-15
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.
Prokaryotic Argonautes - variations on the RNA interference theme
van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.
2014-01-01
The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239
Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease
Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John
2012-01-01
Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703
Symbiont-mediated RNA interference in insects
Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.
2016-01-01
RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963
Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway
2012-01-01
Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893
Basnet, Sanjay; Kamble, Shripat T
2018-05-04
The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.
Runo, Steven
2011-01-01
RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.
RNA Interference in Moths: Mechanisms, Applications, and Progress
Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He
2016-01-01
The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569
RNAi-mediated male sterility of tobacco by silencing TA29.
Nawaz-ul-Rehman, Muhammad Shah; Mansoor, Shahid; Khan, Asif Ali; Zafar, Yusuf; Briddon, Rob W
2007-06-01
The superior performance of F1 hybrids has a significant impact on agricultural productivity. For commercial application, the availability of an efficient system for obtaining male-sterile lines of crops is an essential prerequisite. Here we have investigated the use of RNA interference (RNAi) technology to silence a male-specific gene in the model host tobacco. TA29 is expressed exclusively in anthers at the time of microspore development. About 10 out of 13 tobacco lines transformed with a hairpin RNAi construct containing TA29 sequences were male sterile. Transgenic plants were phenotypically indistinguishable from non-transgenic plants. At the anthesis stage, pollen grains from transgenic, male-sterile plants were aborted and lysed in comparison to the round and fully developed pollen in non-transgenic plants. Microscopic analysis of anthers showed selective degradation of tapetum in transgenic plants with no microspore development. One week after self-pollination, the ovules of non-transgenic plants were double the size of those in transgenic plants, due to successful self-fertilization. Male sterile transgenic plants set seed normally, when cross-pollinated with pollen from non-transgenic plants, confirming no adverse effect on the female parts of the flower. These results show that silencing of male-specific genes by RNAi is potentially a useful tool for generating male-sterile lines for producing hybrid seed.
Grimm, Dirk
2011-10-26
For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.
Flavivirus RNAi suppression: decoding non-coding RNA.
Pijlman, Gorben P
2014-08-01
Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.
Interfering RNA with multi-targets for efficient gene suppression in HCC cells.
Li, Tiejun; Zhu, York Yuanyuan; Ji, Yi; Zhou, Songfeng
2018-06-01
RNA interference (RNAi) technology has been widely used in therapeutics development, especially multiple targeted RNAi strategy, which is a better method for multiple gene suppression. In the study, interfering RNAs (iRNAs) were designed for carrying two or three different siRNA sequences in different secondary structure formats (loop or cloverleaf). By using these types of iRNAs, co-inhibition of survivin and B-cell lymphoma-2 (Bcl-2) was investigated in hepatocellular carcinoma (HCC) cells, and we obtained promising gene silencing effects without showing undesirable interferon response. Furthermore, suppression effects on proliferation, invasion, and induced apoptosis in HCC cells were validated. The results suggest that long iRNAs with secondary structure may be a preferred strategy for multigenic disease therapy, especially for cancer and viral gene therapy and their iRNA drug development.
Modeling RNA interference in mammalian cells
2011-01-01
Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of parameters with an intuitive physical meaning, that makes it a unique and reliable mathematical tool. The findings here presented will be a useful instrument for better understanding RNAi biology and as modelling tool in Systems and Synthetic Biology. PMID:21272352
Hunter, Wayne; Ellis, James; Vanengelsdorp, Dennis; Hayes, Jerry; Westervelt, Dave; Glick, Eitan; Williams, Michael; Sela, Ilan; Maori, Eyal; Pettis, Jeffery; Cox-Foster, Diana; Paldi, Nitzan
2010-12-23
The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsible for up to 30% of the world's food production through pollination of crops. Since fall 2006, honey bees in the U.S. have faced a serious population decline, due in part to a phenomenon called Colony Collapse Disorder (CCD), which is a disease syndrome that is likely caused by several factors. Data from an initial study in which investigators compared pathogens in honey bees affected by CCD suggested a putative role for Israeli Acute Paralysis Virus, IAPV. This is a single stranded RNA virus with no DNA stage placed taxonomically within the family Dicistroviridae. Although subsequent studies have failed to find IAPV in all CCD diagnosed colonies, IAPV has been shown to cause honey bee mortality. RNA interference technology (RNAi) has been used successfully to silence endogenous insect (including honey bee) genes both by injection and feeding. Moreover, RNAi was shown to prevent bees from succumbing to infection from IAPV under laboratory conditions. In the current study IAPV specific homologous dsRNA was used in the field, under natural beekeeping conditions in order to prevent mortality and improve the overall health of bees infected with IAPV. This controlled study included a total of 160 honey bee hives in two discrete climates, seasons and geographical locations (Florida and Pennsylvania). To our knowledge, this is the first successful large-scale real world use of RNAi for disease control.
Preventing bee mortality with RNA interference
USDA-ARS?s Scientific Manuscript database
We present a real world example of the successful use of an RNAi product for disease control. RNAi increased bee health in the presence of the bee viral pathogen, IAPV. The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsib...
USDA-ARS?s Scientific Manuscript database
Modern molecular biological techniques allow for the design of molecules of ribonucleic acid capable of disrupting key biological processes of pests and diseases. A major requirement for the practical application of ribonucleic acid interference (RNAi) against insect pests is an efficient entry path...
E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update
Horn, Thomas; Boutros, Michael
2010-01-01
The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868
Towards the elements of successful insect RNAi.
Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E
2013-12-01
RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.
The next phase of life-sciences spaceflight research
Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Higashitani, Atsushi
2011-01-01
Recently we demonstrated that the effectiveness of RNAi interference (RNAi) for inhibiting gene expression is maintained during spaceflight in the worm Caenorhabditis elegans and argued for the biomedical importance of this finding. We also successfully utilized green fluorescent protein (GFP)-tagged proteins to monitor changes in GPF localization during flight. Here we discuss potential applications of RNAi and GFP in spaceflight studies and the ramifications of these experiments for the future of space life-sciences research. PMID:22446523
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-10-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.
Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.
Parrish, S; Fire, A
2001-01-01
RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844
Interference of hepatitis C virus RNA replication by short interfering RNAs
NASA Astrophysics Data System (ADS)
Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.
2003-02-01
Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.
Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.
2009-01-01
Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664
Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo
2017-04-01
RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role in regulating conidiation in M. robertsii Our study also demonstrates that diverse small RNA pathways exist in M. robertsii The study provides a theoretical platform for exploration of the functions of Dicer and Argonaute genes involved in RNAi in fungi. Copyright © 2017 American Society for Microbiology.
Beyond insects: current status, achievements and future perspectives of RNAi in mite pests.
Niu, Jinzhi; Shen, Guangmao; Christiaens, Olivier; Smagghe, Guy; He, Lin; Wang, Jinjun
2018-05-11
Mites comprise a group of key agricultural pests on a wide range of crops. They cause harm through feeding on the plant and transferring dangerous pathogens, and the rapid evolution of pesticide resistance in mites highlights the need for novel control methods. Currently, RNA interference (RNAi) shows a great potential for insect pest control. Here, we review the literature associated with RNAi in mite pests. We discuss different target genes and RNAi efficiency in various mite species, a promising Varroa control program through RNAi, the synergy of RNAi with plant defense mechanisms and microorganisms, and the current understandings of systemic movement of dsRNA. Based on this, we can conclude that there is a clear potential for an RNAi-based mite control application but further research on several aspects is needed, including: (i) the factors influencing the RNAi efficiency, (ii) the mechanism of environmental RNAi and cross-kingdom dsRNA trafficking, (iii) the mechanism of possible systemic and parental RNAi, and (iv) non-target effects, specifically in predatory mites, should be considered during the RNAi target selection. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Caenorhabditis elegans ABCRNAi transporters interact genetically with rde-2 and mut-7.
Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa
2008-02-01
RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABC(RNAi) mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABC(RNAi) gene class. Genetic complementation tests reveal functions for ABC(RNAi) transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABC(RNAi) proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABC(RNAi) mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABC(RNAi) gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABC(RNAi) transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity.
USDA-ARS?s Scientific Manuscript database
Development of Ribonucleic acid interference, RNAi against insect pests needs to show species target specificity so that beneficial insects remain unharmed, as many pest insects are a food source for predatory insects like lady beetles. We evaluated an RNAi product specific to Asian citrus psyllid f...
Kandeel, Mahmoud; Kitade, Yukio
2013-07-01
RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.
Jung, Je Hyeong; Kannan, Baskaran; Dermawan, Hugo; Moxley, Geoffrey W; Altpeter, Fredy
2016-11-01
Sugarcane (Saccharum spp. hybrids) is a major feedstock for commercial bioethanol production. The recent integration of conversion technologies that utilize lignocellulosic sugarcane residues as well as sucrose from stem internodes has elevated bioethanol yields. RNAi suppression of lignin biosynthetic enzymes is a successful strategy to improve the saccharification of lignocellulosic biomass. 4-coumarate:coenzyme A ligase (4CL) is a key enzyme in the biosynthesis of phenylpropanoid metabolites, such as lignin and flavonoids. Identifying a major 4CL involved in lignin biosynthesis among multiple isoforms with functional divergence is key to manipulate lignin biosynthesis. In this study, two full length 4CL genes (Sh4CL1 and Sh4CL2) were isolated and characterized in sugarcane. Phylogenetic, expression and RNA interference (RNAi) analysis confirmed that Sh4CL1 is a major lignin biosynthetic gene. An intragenic precision breeding strategy may facilitate the regulatory approval of the genetically improved events and was used for RNAi suppression of Sh4CL1. Both, the RNAi inducing cassette and the expression cassette for the mutated ALS selection marker consisted entirely of DNA sequences from sugarcane or the sexually compatible species Sorghum bicolor. Field grown sugarcane with intragenic RNAi suppression of Sh4CL1 resulted in reduction of the total lignin content by up to 16.5 % along with altered monolignol ratios without reduction in biomass yield. Mature, field grown, intragenic sugarcane events displayed 52-76 % improved saccharification efficiency of lignocellulosic biomass compared to wild type (WT) controls. This demonstrates for the first time that an intragenic approach can add significant value to lignocellulosic feedstocks for biofuel and biochemical production.
Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus
2018-05-01
Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences
Robert, Valérie J.P.; Sijen, Titia; van Wolfswinkel, Josien; Plasterk, Ronald H.A.
2005-01-01
Protection of genomes against invasion by repetitive sequences, such as transposons, viruses, and repetitive transgenes, involves strong and selective silencing of these sequences. During silencing of repetitive transgenes, a trans effect (“cosuppression”) occurs that results in silencing of cognate endogenous genes. Here we report RNA interference (RNAi) screens performed to catalog genes required for cosuppression in the Caenorhabditis elegans germline. We find factors with a putative role in chromatin remodeling and factors involved in RNAi. Together with molecular data also presented in this study, these results suggest that in C. elegans repetitive sequences trigger transcriptional gene silencing using RNAi and chromatin factors. PMID:15774721
Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.
2013-01-01
Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
Wuriyanghan, Hada; Falk, Bryce W.
2013-01-01
The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will provide a faster and more convenient method for screening of suitable RNAi target sequences in planta. PMID:23824081
Role of genetically engineered animals in future food production.
McColl, K A; Clarke, B; Doran, T J
2013-03-01
Genetically engineered (GE) animals are likely to have an important role in the future in meeting the food demand of a burgeoning global population. There have already been many notable achievements using this technology in livestock, poultry and aquatic species. In particular, the use of RNA interference (RNAi) to produce virus-resistant animals is a rapidly-developing area of research. However, despite the promise of this technology, very few GE animals have been commercialised. This review aims to provide information so that veterinarians and animal health scientists are better able to participate in the debate on GE animals. © 2013 The Authors. Australian Veterinary Journal © 2013 Australian Veterinary Association.
Cen, Yan-Hui; Guo, Wen-Wen; Luo, Bin; Lin, Yong-Da; Zhang, Qing-Mei; Zhou, Su-Fang; Luo, Guo-Rong; Xiao, Shao-Wen; Xie, Xiao-Xun
2012-10-01
OY-TES-1 is a member of the CTA (cancer-testis antigen) group expressed in a variety of cancer and restrictedly expressed in adult normal tissues, except for testis. To determine whether MSCs (mesenchymal stem cells) express OY-TES-1 and its possible roles on MSCs, OY-TES-1 expression in MSCs isolated from human bone marrow was tested with RT (reverse transcription)-PCR, immunocytochemistry and Western blot. Using RNAi (RNA interference) technology, OY-TES-1 expression was knocked down followed by analysing cell viability, cell cycle, apoptosis and migration ability. MSCs expressed OY-TES-1 at both mRNA and protein levels. The down-regulation of OY-TES-1 expression in these MSCs caused cell growth inhibition, cell cycle arrest, apoptosis induction and migration ability attenuation. Through these primary results it was suggested that OY-TES-1 may influence the biological behaviour of MSCs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smialowska, Agata, E-mail: smialowskaa@gmail.com; School of Life Sciences, Södertörn Högskola, Huddinge 141-89; Djupedal, Ingela
Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its rolemore » in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.« less
Role of RNA interference (RNAi) in the Moss Physcomitrella patens.
Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel
2013-01-14
RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.
RNAi therapeutics and applications of microRNAs in cancer treatment.
Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka
2013-06-01
RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.
Bugs Are Not to Be Silenced: Small RNA Pathways and Antiviral Responses in Insects.
Mongelli, Vanesa; Saleh, Maria-Carla
2016-09-29
Like every other organism on Earth, insects are infected with viruses, and they rely on RNA interference (RNAi) mechanisms to circumvent viral infections. A remarkable characteristic of RNAi is that it is both broadly acting, because it is triggered by double-stranded RNA molecules derived from virtually any virus, and extremely specific, because it targets only the particular viral sequence that initiated the process. Reviews covering the different facets of the RNAi antiviral immune response in insects have been published elsewhere. In this review, we build a framework to guide future investigation. We focus on the remaining questions and avenues of research that need to be addressed to move the field forward, including issues such as the activity of viral suppressors of RNAi, comparative genomics, the development of detailed maps of the subcellular localization of viral replication complexes with the RNAi machinery, and the regulation of the antiviral RNAi response.
Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.
2010-01-01
RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369
Mutisya, Daniel; Selvam, Chelliah; Lunstad, Benjamin D.; Pallan, Pradeep S.; Haas, Amanda; Leake, Devin; Egli, Martin; Rozners, Eriks
2014-01-01
RNA interference (RNAi) has become an important tool in functional genomics and has an intriguing therapeutic potential. However, the current design of short interfering RNAs (siRNAs) is not optimal for in vivo applications. Non-ionic phosphate backbone modifications may have the potential to improve the properties of siRNAs, but are little explored in RNAi technologies. Using X-ray crystallography and RNAi activity assays, the present study demonstrates that 3′-CH2-CO-NH-5′ amides are excellent replacements for phosphodiester internucleoside linkages in RNA. The crystal structure shows that amide-modified RNA forms a typical A-form duplex. The amide carbonyl group points into the major groove and assumes an orientation that is similar to the P–OP2 bond in the phosphate linkage. Amide linkages are well hydrated by tandem waters linking the carbonyl group and adjacent phosphate oxygens. Amides are tolerated at internal positions of both the guide and passenger strand of siRNAs and may increase the silencing activity when placed near the 5′-end of the passenger strand. As a result, an siRNA containing eight amide linkages is more active than the unmodified control. The results suggest that RNAi may tolerate even more extensive amide modification, which may be useful for optimization of siRNAs for in vivo applications. PMID:24813446
Common ground: small RNA programming and chromatin modifications.
Lejeune, Erwan; Allshire, Robin C
2011-06-01
Epigenetic mechanisms regulate genome structure and expression profiles in eukaryotes. RNA interference (RNAi) and other small RNA-based chromatin-modifying activities can act to reset the epigenetic landscape at defined chromatin domains. Centromeric heterochromatin assembly is a RNAi-dependent process in the fission yeast Schizosaccharomyces pombe, and provides a paradigm for detailed examination of such epigenetic processes. Here we review recent progress in understanding the mechanisms that underpin RNAi-mediated heterochromatin formation in S. pombe. We discuss recent analyses of the events that trigger RNAi and manipulations which uncouple RNAi and chromatin modification. Finally we provide an overview of similar molecular machineries across species where related small RNA pathways appear to drive the epigenetic reprogramming in germ cells and/or during early development in metazoans. Copyright © 2011 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...
USDA-ARS?s Scientific Manuscript database
Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...
Avila, Emily L; Brown, Michelle; Pan, Songqin; Desikan, Radhika; Neill, Steven J; Girke, Thomas; Surpin, Marci; Raikhel, Natasha V
2008-01-01
Vacuolar sorting receptors (VSRs) are responsible for the proper targeting of soluble cargo proteins to their destination compartments. The Arabidopsis genome encodes seven VSRs. In this work, the spatio-temporal expression of one of the members of this gene family, AtVSR3, was determined by RT-PCR and promoter::reporter gene fusions. AtVSR3 was expressed specifically in guard cells. Consequently, a reverse genetics approach was taken to determine the function of AtVSR3 by using RNA interference (RNAi) technology. Plants expressing little or no AtVSR3 transcript had a compressed life cycle, bolting approximately 1 week earlier and senescing up to 2 weeks earlier than the wild-type parent line. While the development and distribution of stomata in AtVSR3 RNAi plants appeared normal, stomatal function was altered. The guard cells of mutant plants did not close in response to abscisic acid treatment, and the mean leaf temperatures of the RNAi plants were on average 0.8 degrees C lower than both wild type and another vacuolar sorting receptor mutant, atvsr1-1. Furthermore, the loss of AtVSR3 protein caused the accumulation of nitric oxide and hydrogen peroxide, signalling molecules implicated in the regulation of stomatal opening and closing. Finally, proteomics and western blot analyses of cellular proteins isolated from wild-type and AtVSR3 RNAi leaves showed that phospholipase Dgamma, which may play a role in abscisic acid signalling, accumulated to higher levels in AtVSR3 RNAi guard cells. Thus, AtVSR3 may play an important role in responses to plant stress.
Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang
2014-01-01
Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.
Next-generation transgenic cotton: pyramiding RNAi and Bt counters insect resistance.
Ni, Mi; Ma, Wei; Wang, Xiaofang; Gao, Meijing; Dai, Yan; Wei, Xiaoli; Zhang, Lei; Peng, Yonggang; Chen, Shuyuan; Ding, Lingyun; Tian, Yue; Li, Jie; Wang, Haiping; Wang, Xiaolin; Xu, Guowang; Guo, Wangzhen; Yang, Yihua; Wu, Yidong; Heuberger, Shannon; Tabashnik, Bruce E; Zhang, Tianzhen; Zhu, Zhen
2017-09-01
Transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are extensively cultivated worldwide. To counter rapidly increasing pest resistance to crops that produce single Bt toxins, transgenic plant 'pyramids' producing two or more Bt toxins that kill the same pest have been widely adopted. However, cross-resistance and antagonism between Bt toxins limit the sustainability of this approach. Here we describe development and testing of the first pyramids of cotton combining protection from a Bt toxin and RNA interference (RNAi). We developed two types of transgenic cotton plants producing double-stranded RNA (dsRNA) from the global lepidopteran pest Helicoverpa armigera designed to interfere with its metabolism of juvenile hormone (JH). We focused on suppression of JH acid methyltransferase (JHAMT), which is crucial for JH synthesis, and JH-binding protein (JHBP), which transports JH to organs. In 2015 and 2016, we tested larvae from a Bt-resistant strain and a related susceptible strain of H. armigera on seven types of cotton: two controls, Bt cotton, two types of RNAi cotton (targeting JHAMT or JHBP) and two pyramids (Bt cotton plus each type of RNAi). Both types of RNAi cotton were effective against Bt-resistant insects. Bt cotton and RNAi acted independently against the susceptible strain. In computer simulations of conditions in northern China, where millions of farmers grow Bt cotton as well as abundant non-transgenic host plants of H. armigera, pyramided cotton combining a Bt toxin and RNAi substantially delayed resistance relative to using Bt cotton alone. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Kir, Gokhan; Ye, Huaxun; Nelissen, Hilde; Neelakandan, Anjanasree K.; Kusnandar, Andree S.; Luo, Anding; Inzé, Dirk; Sylvester, Anne W.; Yin, Yanhai; Becraft, Philip W.
2015-01-01
Brassinosteroids (BRs) are plant hormones involved in various growth and developmental processes. The BR signaling system is well established in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) but poorly understood in maize (Zea mays). BRASSINOSTEROID INSENSITIVE1 (BRI1) is a BR receptor, and database searches and additional genomic sequencing identified five maize homologs including duplicate copies of BRI1 itself. RNA interference (RNAi) using the extracellular coding region of a maize zmbri1 complementary DNA knocked down the expression of all five homologs. Decreased response to exogenously applied brassinolide and altered BR marker gene expression demonstrate that zmbri1-RNAi transgenic lines have compromised BR signaling. zmbri1-RNAi plants showed dwarf stature due to shortened internodes, with upper internodes most strongly affected. Leaves of zmbri1-RNAi plants are dark green, upright, and twisted, with decreased auricle formation. Kinematic analysis showed that decreased cell division and cell elongation both contributed to the shortened leaves. A BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1-yellow fluorescent protein (BES1-YFP) transgenic line was developed that showed BR-inducible BES1-YFP accumulation in the nucleus, which was decreased in zmbri1-RNAi. Expression of the BES1-YFP reporter was strong in the auricle region of developing leaves, suggesting that localized BR signaling is involved in promoting auricle development, consistent with the zmbri1-RNAi phenotype. The blade-sheath boundary disruption, shorter ligule, and disrupted auricle morphology of RNAi lines resemble KNOTTED1-LIKE HOMEOBOX (KNOX) mutants, consistent with a mechanistic connection between KNOX genes and BR signaling. PMID:26162429
RNAi functionalized scaffold for scarless skin regeneration
Liu, Xing; Ma, Lie; Gao, Changyou
2013-01-01
Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756
Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G
2010-04-01
Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for the first time, a functional RNAi pathway in a cestode and show that the robust knock-down of abundant gene transcripts is achievable using long dsRNAs following short exposure times. 2009 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Using RNA interference to knock down the adhesion protein TES.
Griffith, Elen
2007-01-01
RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.
Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S
2018-06-19
Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.
Considering RNAi experimental design in parasitic helminths.
Dalzell, Johnathan J; Warnock, Neil D; McVeigh, Paul; Marks, Nikki J; Mousley, Angela; Atkinson, Louise; Maule, Aaron G
2012-04-01
Almost a decade has passed since the first report of RNA interference (RNAi) in a parasitic helminth. Whilst much progress has been made with RNAi informing gene function studies in disparate nematode and flatworm parasites, substantial and seemingly prohibitive difficulties have been encountered in some species, hindering progress. An appraisal of current practices, trends and ideals of RNAi experimental design in parasitic helminths is both timely and necessary for a number of reasons: firstly, the increasing availability of parasitic helminth genome/transcriptome resources means there is a growing need for gene function tools such as RNAi; secondly, fundamental differences and unique challenges exist for parasite species which do not apply to model organisms; thirdly, the inherent variation in experimental design, and reported difficulties with reproducibility undermine confidence. Ideally, RNAi studies of gene function should adopt standardised experimental design to aid reproducibility, interpretation and comparative analyses. Although the huge variations in parasite biology and experimental endpoints make RNAi experimental design standardization difficult or impractical, we must strive to validate RNAi experimentation in helminth parasites. To aid this process we identify multiple approaches to RNAi experimental validation and highlight those which we deem to be critical for gene function studies in helminth parasites.
Schuster, Susan; Tholen, Lotte E; Overheul, Gijs J; van Kuppeveld, Frank J M; van Rij, Ronald P
2017-01-01
Antiviral immunity in insects and plants is mediated by the RNA interference (RNAi) pathway in which viral long double-stranded RNA (dsRNA) is processed into small interfering RNAs (siRNAs) by Dicer enzymes. Although this pathway is evolutionarily conserved, its involvement in antiviral defense in mammals is the subject of debate. In vertebrates, recognition of viral RNA induces a sophisticated type I interferon (IFN)-based immune response, and it has been proposed that this response masks or inhibits antiviral RNAi. To test this hypothesis, we analyzed viral small RNA production in differentiated cells deficient in the cytoplasmic RNA sensors RIG-I and MDA5. We did not detect 22-nucleotide (nt) viral siRNAs upon infection with three different positive-sense RNA viruses. Our data suggest that the depletion of cytoplasmic RIG-I-like sensors is not sufficient to uncover viral siRNAs in differentiated cells. IMPORTANCE The contribution of the RNA interference (RNAi) pathway in antiviral immunity in vertebrates has been widely debated. It has been proposed that RNAi possesses antiviral activity in mammalian systems but that its antiviral effect is masked by the potent antiviral interferon response in differentiated mammalian cells. In this study, we show that inactivation of the interferon response is not sufficient to uncover antiviral activity of RNAi in human epithelial cells infected with three wild-type positive-sense RNA viruses.
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.
Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.
CRISPR/Cas9: From Genome Engineering to Cancer Drug Discovery
Luo, Ji
2016-01-01
Advances in translational research are often driven by new technologies. The advent of microarrays, next-generation sequencing, proteomics and RNA interference (RNAi) have led to breakthroughs in our understanding of the mechanisms of cancer and the discovery of new cancer drug targets. The discovery of the bacterial clustered regularly interspaced palindromic repeat (CRISPR) system and its subsequent adaptation as a tool for mammalian genome engineering has opened up new avenues for functional genomics studies. This review will focus on the utility of CRISPR in the context of cancer drug target discovery. PMID:28603775
2007-02-05
lines. Three regulatory mechanisms have been examined in our laboratory: antisense inhibition, ribozyme cleavage, and RNA interference (RNAi...cell lines. However, the latter two regulatory mechanisms, ribozyme -based inactivation and RNAi-mediated silencing, demonstrated significant activity...in these cell lines as is briefly described below. Microswitches responsive to the small molecule theophylline and targeting GFP based on a ribozyme
C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.
Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua
2009-08-07
The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.
RNA interference-based therapeutics: new strategies to fight infectious disease.
López-Fraga, M; Wright, N; Jiménez, A
2008-12-01
For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.
Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.
Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L
2016-12-05
Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.
Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis
Park, Sang-Hyuck; Ong, Rebecca Garlock; Mei, Chuansheng; Sticklen, Mariam
2014-01-01
To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure. PMID:25080235
Lignin down-regulation of Zea mays via dsRNAi and klason lignin analysis.
Park, Sang-Hyuck; Ong, Rebecca Garlock; Mei, Chuansheng; Sticklen, Mariam
2014-07-23
To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure.
Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.
2010-01-01
The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014
Musiyenko, Alla; Bitko, Vira; Barik, Sailen
2007-07-01
Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.
RNAi and retroviruses: are they in RISC?
Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri
2013-02-01
RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.
Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens
2011-10-01
vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens
Seo, Gil Ju; Kincaid, Rodney P.; Phanaksri, Teva; Burke, James M.; Pare, Justin M.; Cox, Jennifer E.; Hsiang, Tien-Ying; Krug, Robert M.; Sullivan, Christopher S.
2013-01-01
SUMMARY RNA interference (RNAi) is an established antiviral defense mechanism in plants and invertebrates. Whether RNAi serves a similar function in mammalian cells remains unresolved. We find that in some cell types, mammalian RNAi activity is reduced shortly after viral infection via poly ADP-ribosylation of the RNA induced silencing complex (RISC), a core component of RNAi. Well-established antiviral signaling pathways, including RIG-I/MAVS and RNAseL, contribute to inhibition of RISC. In the absence of virus infection, microRNAs repress interferon-stimulated genes (ISGs) associated with cell death and proliferation, thus maintaining homeostasis. Upon detection of intracellular pathogen-associated molecular patterns, RISC activity decreases, contributing to increased expression of ISGs. Our results suggest that unlike in lower eukaryotes, mammalian RISC is not antiviral in some contexts, but rather, RISC has been co-opted to negatively regulate toxic host antiviral effectors via microRNAs. PMID:24075860
Soaking RNAi in Bombyx mori BmN4-SID1 Cells Arrests Cell Cycle Progression
Mon, Hiroaki; Li, Zhiqing; Kobayashi, Isao; Tomita, Shuichiro; Lee, JaeMan; Sezutsu, Hideki; Tamura, Toshiki; Kusakabe, Takahiro
2013-01-01
RNA interference (RNAi) is an evolutionarily conserved mechanism for sequence-specific gene silencing. Previously, the BmN4-SID1 cell expressing Caenorhabditis ele gans SID-1 was established, in which soaking RNAi could induce effective gene silencing. To establish its utility, 6 cell cycle progression related cDNAs, CDK1, MYC, MYB, RNRS, CDT1, and GEMININ, were isolated from the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), and their expressions were further silenced by soaking RNAi in the BmN4-SID1 cells. The cell cycle progression analysis using flow cytometer demonstrated that the small amount of double stranded RNA was enough to arrest cell cycle progression at the specific cell phases. These data suggest that RNAi in the BmN4-SID1 cells can be used as a powerful tool for loss-of-function analysis of B. mori genes. PMID:24773378
Mutisya, Daniel; Selvam, Chelliah; Lunstad, Benjamin D; Pallan, Pradeep S; Haas, Amanda; Leake, Devin; Egli, Martin; Rozners, Eriks
2014-06-01
RNA interference (RNAi) has become an important tool in functional genomics and has an intriguing therapeutic potential. However, the current design of short interfering RNAs (siRNAs) is not optimal for in vivo applications. Non-ionic phosphate backbone modifications may have the potential to improve the properties of siRNAs, but are little explored in RNAi technologies. Using X-ray crystallography and RNAi activity assays, the present study demonstrates that 3'-CH2-CO-NH-5' amides are excellent replacements for phosphodiester internucleoside linkages in RNA. The crystal structure shows that amide-modified RNA forms a typical A-form duplex. The amide carbonyl group points into the major groove and assumes an orientation that is similar to the P-OP2 bond in the phosphate linkage. Amide linkages are well hydrated by tandem waters linking the carbonyl group and adjacent phosphate oxygens. Amides are tolerated at internal positions of both the guide and passenger strand of siRNAs and may increase the silencing activity when placed near the 5'-end of the passenger strand. As a result, an siRNA containing eight amide linkages is more active than the unmodified control. The results suggest that RNAi may tolerate even more extensive amide modification, which may be useful for optimization of siRNAs for in vivo applications. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.
2004-01-01
Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234
RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans
Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.
2005-01-01
In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635
Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia
2018-06-01
When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.
Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun
2011-01-01
Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219
Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao
2013-02-01
To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.
Power, Imana L; Dang, Phat M; Sobolev, Victor S; Orner, Valerie A; Powell, Joseph L; Lamb, Marshall C; Arias, Renee S
2017-04-01
Aflatoxin contamination is a major constraint in food production worldwide. In peanut (Arachis hypogaea L.), these toxic and carcinogenic aflatoxins are mainly produced by Aspergillus flavus Link and A. parasiticus Speare. The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in peanut seed. In this study, we performed high-throughput sequencing of small RNA populations in a control line and in two transformed peanut lines that expressed an inverted repeat targeting five genes involved in the aflatoxin-biosynthesis pathway and that showed up to 100% less aflatoxin B 1 than the controls. The objective was to determine the putative involvement of the small RNA populations in aflatoxin reduction. In total, 41 known microRNA (miRNA) families and many novel miRNAs were identified. Among those, 89 known and 10 novel miRNAs were differentially expressed in the transformed lines. We furthermore found two small interfering RNAs derived from the inverted repeat, and 39 sRNAs that mapped without mismatches to the genome of A. flavus and were present only in the transformed lines. This information will increase our understanding of the effectiveness of RNAi and enable the possible improvement of the RNAi technology for the control of aflatoxins. Copyright © 2017 Elsevier B.V. All rights reserved.
Multifunctional Envelope-Type siRNA Delivery Nanoparticle Platform for Prostate Cancer Therapy.
Xu, Xiaoding; Wu, Jun; Liu, Yanlan; Saw, Phei Er; Tao, Wei; Yu, Mikyung; Zope, Harshal; Si, Michelle; Victorious, Amanda; Rasmussen, Jonathan; Ayyash, Dana; Farokhzad, Omid C; Shi, Jinjun
2017-03-28
With the capability of specific silencing of target gene expression, RNA interference (RNAi) technology is emerging as a promising therapeutic modality for the treatment of cancer and other diseases. One key challenge for the clinical applications of RNAi is the safe and effective delivery of RNAi agents such as small interfering RNA (siRNA) to a particular nonliver diseased tissue (e.g., tumor) and cell type with sufficient cytosolic transport. In this work, we proposed a multifunctional envelope-type nanoparticle (NP) platform for prostate cancer (PCa)-specific in vivo siRNA delivery. A library of oligoarginine-functionalized and sharp pH-responsive polymers was synthesized and used for self-assembly with siRNA into NPs with the features of long blood circulation and pH-triggered oligoarginine-mediated endosomal membrane penetration. By further modification with ACUPA, a small molecular ligand specifically recognizing prostate-specific membrane antigen (PSMA) receptor, this envelope-type nanoplatform with multifunctional properties can efficiently target PSMA-expressing PCa cells and silence target gene expression. Systemic delivery of the siRNA NPs can efficiently silence the expression of prohibitin 1 (PHB1), which is upregulated in PCa and other cancers, and significantly inhibit PCa tumor growth. These results suggest that this multifunctional envelope-type nanoplatform could become an effective tool for PCa-specific therapy.
siRNA Delivery to the Lung: What’s New?
Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas
2014-01-01
RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426
Establishment of a tissue-specific RNAi system in C. elegans.
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo
2007-10-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.
Establishment of a tissue-specific RNAi system in C. elegans
Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo
2011-01-01
In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718
Human Virus-Derived Small RNAs Can Confer Antiviral Immunity in Mammals.
Qiu, Yang; Xu, Yanpeng; Zhang, Yao; Zhou, Hui; Deng, Yong-Qiang; Li, Xiao-Feng; Miao, Meng; Zhang, Qiang; Zhong, Bo; Hu, Yuanyang; Zhang, Fu-Chun; Wu, Ligang; Qin, Cheng-Feng; Zhou, Xi
2017-06-20
RNA interference (RNAi) functions as a potent antiviral immunity in plants and invertebrates; however, whether RNAi plays antiviral roles in mammals remains unclear. Here, using human enterovirus 71 (HEV71) as a model, we showed HEV71 3A protein as an authentic viral suppressor of RNAi during viral infection. When the 3A-mediated RNAi suppression was impaired, the mutant HEV71 readily triggered the production of abundant HEV71-derived small RNAs with canonical siRNA properties in cells and mice. These virus-derived siRNAs were produced from viral dsRNA replicative intermediates in a Dicer-dependent manner and loaded into AGO, and they were fully active in degrading cognate viral RNAs. Recombinant HEV71 deficient in 3A-mediated RNAi suppression was significantly restricted in human somatic cells and mice, whereas Dicer deficiency rescued HEV71 infection independently of type I interferon response. Thus, RNAi can function as an antiviral immunity, which is induced and suppressed by a human virus, in mammals. Copyright © 2017 Elsevier Inc. All rights reserved.
Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.
Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A
2018-05-01
RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.
The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.
Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C
2017-01-01
The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster . We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies.
RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems
Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther
2017-01-01
ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila melanogaster. We found that RVFV infection induces both the exogenous small interfering RNA (siRNA) and piRNA pathways, which contribute to the control of viral replication in insects. Furthermore, we demonstrate the production of virus-derived piRNAs in Culex quinquefasciatus mosquitoes. Understanding these pathways and the targets within them offers the potential of the development of novel RVFV control measures in vector-based strategies. PMID:28497117
Small RNAs in plants: recent development and application for crop improvement
Kamthan, Ayushi; Chaudhuri, Abira; Kamthan, Mohan; Datta, Asis
2015-01-01
The phenomenon of RNA interference (RNAi) which involves sequence-specific gene regulation by small non-coding RNAs, i.e., small interfering RNA (siRNA) and microRNA (miRNA) has emerged as one of most powerful approaches for crop improvement. RNAi based on siRNA is one of the widely used tools of reverse genetics which aid in revealing gene functions in many species. This technology has been extensively applied to alter the gene expression in plants with an aim to achieve desirable traits. RNAi has been used for enhancing the crop yield and productivity by manipulating the gene involved in biomass, grain yield and enhanced shelf life of fruits and vegetables. It has also been applied for developing resistance against various biotic (bacteria, fungi, viruses, nematodes, insects) and abiotic stresses (drought, salinity, cold, etc.). Nutritional improvements of crops have also been achieved by enriching the crops with essential amino acids, fatty acids, antioxidants and other nutrients beneficial for human health or by reducing allergens or anti-nutrients. microRNAs are key regulators of important plant processes like growth, development, and response to various stresses. In spite of similarity in size (20–24 nt), miRNA differ from siRNA in precursor structures, pathway of biogenesis, and modes of action. This review also highlights the miRNA based genetic modification technology where various miRNAs/artificial miRNAs and their targets can be utilized for improving several desirable plant traits. microRNA based strategies are much efficient than siRNA-based RNAi strategies due to its specificity and less undesirable off target effects. As per the FDA guidelines, small RNA (sRNA) based transgenics are much safer for consumption than those over-expressing proteins. This review thereby summarizes the emerging advances and achievement in the field of sRNAs and its application for crop improvement. PMID:25883599
RNAi of COL1A1 in mesenchymal progenitor cells.
Millington-Ward, Sophia; McMahon, Helena P; Allen, Danny; Tuohy, Gearóid; Kiang, Anna-Sophia; Palfi, Arpad; Kenna, Paul F; Humphries, Peter; Farrar, G Jane
2004-10-01
Given that mutant COL1A1 is known to cause Osteogenesis Imperfecta (OI), tools to modulate COL1A1 expression are likely to be of significant therapeutic value. In this context, we have evaluated RNA interference (RNAi) as a means to downregulate COL1A1 expression in Cos-7 cells and in human mesenchymal progenitor stem cells (MPCs), the latter cells giving rise to bone and therefore representing a target cell type for collagen-related disorders. In addition, allele-specificity, a key factor to the success of RNAi-based suppression, was explored with a view to developing a mutation-independent RNAi-based therapeutic for OI by targeting an intragenic SNP within transcripts derived from the COL1A1 gene. Preferential suppression of individual polymorphic alleles that differed by a single nucleotide was observed.
Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin
Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema
2016-01-01
Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422
Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J
2005-01-01
Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.
Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C
2002-06-28
Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.
Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2017-01-01
The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039
Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing
2017-06-01
The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017 Elsevier Ltd. All rights reserved.
ERIC Educational Resources Information Center
Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak
2010-01-01
RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…
How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference
ERIC Educational Resources Information Center
Kuldell, Natalie H.
2006-01-01
It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…
Killiny, Nabil; Kishk, Abdelaziz
2017-06-01
RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.
RNA interference can be used to disrupt gene function in tardigrades
Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob
2012-01-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800
RNA interference can be used to disrupt gene function in tardigrades.
Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob
2013-05-01
How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.
Chen, Qing; Rehman, S; Smant, G; Jones, John T
2005-07-01
RNA interference (RNAi) has been used widely as a tool for examining gene function and a method that allows its use with plant-parasitic nematodes recently has been described. Here, we use a modified method to analyze the function of secreted beta-1,4, endoglucanases of the potato cyst nematode Globodera rostochiensis, the first in vivo functional analysis of a pathogenicity protein of a plant-parasitic nematode. Knockout of the beta-1,4, endoglucanases reduced the ability of the nematodes to invade roots. We also use RNAi to show that gr-ams-1, a secreted protein of the main sense organs (the amphids), is essential for host location.
Pareek, Manish; Rajam, Manchikatla Venkat
2017-09-01
Fusarium oxysporum is a soil-borne plant fungal pathogen, and causes colossal losses in several crop plants including tomato. Effective control measures include the use of harmful fungicides and resistant cultivars, but these methods have shown limited success. Conventional methods to validate fungal pathogenic genes are labour intensive. Therefore, an alternative strategy is required to efficiently characterize unknown pathogenic genes. RNA interference (RNAi) has emerged as a potential tool to functionally characterize novel fungal pathogenic genes and also to control fungal diseases. Here, we report an efficient method to produce stable RNAi transformants of F. oxysporum using Agrobacterium-mediated transformation (AMT). We have transformed F. oxysporum spores using RNAi constructs of Fmk1, Hog1, and Pbs2 MAP kinase signalling genes. Fmk1 RNAi fungal transformants showed loss of surface hydrophobicity, reduced invasive growth on tomato fruits and hypo-virulence on tomato seedlings. Hog1 and Pbs2 RNAi transformants showed altered conidial size, and reduced invasive growth and pathogenesis. These results showed that AMT using RNAi constructs is an effective approach for dissecting the role of genes involved in pathogenesis in F. oxysporum and this could be extended for other fungal systems. The obtained knowledge can be easily translated for developing fungal resistant crops by RNAi. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F
2009-02-01
RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.
Arakane, Y; Muthukrishnan, S; Kramer, K J; Specht, C A; Tomoyasu, Y; Lorenzen, M D; Kanost, M; Beeman, R W
2005-10-01
Functional analysis of the two chitin synthase genes, TcCHS1 and TcCHS2, in the red flour beetle, Tribolium castaneum, revealed unique and complementary roles for each gene. TcCHS1-specific RNA interference (RNAi) disrupted all three types of moult (larval-larval, larval-pupal and pupal-adult) and greatly reduced whole-body chitin content. Exon-specific RNAi showed that splice variant 8a of TcCHS1 was required for both the larval-pupal and pupal-adult moults, whereas splice variant 8b was required only for the latter. TcCHS2-specific RNAi had no effect on metamorphosis or on total body chitin content. However, RNAi-mediated down-regulation of TcCHS2, but not TcCHS1, led to cessation of feeding, a dramatic shrinkage in larval size and reduced chitin content in the midgut.
The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.
Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi
2011-01-01
Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.
The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight
Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi
2011-01-01
Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804
Machado, Ana Karla; Brown, Neil A; Urban, Martin; Kanyuka, Kostya
2017-01-01
Abstract Fusarium graminearum is a major fungal pathogen of cereals worldwide, causing seedling, stem base and floral diseases, including Fusarium head blight (FHB). In addition to yield and quality losses, FHB contaminates cereal grain with mycotoxins, including deoxynivalenol, which are harmful to human, animal and ecosystem health. Currently, FHB control is only partially effective due to several intractable problems. RNA interference (RNAi) is a natural mechanism that regulates gene expression. RNAi has been exploited in the development of new genomic tools that allow the targeted silencing of genes of interest in many eukaryotes. Host‐induced gene silencing (HIGS) is a transgenic technology used to silence fungal genes in planta during attempted infection and thereby reduces disease levels. HIGS relies on the host plant's ability to produce mobile small interfering RNA molecules, generated from long double‐stranded RNA, which are complementary to targeted fungal genes. These molecules are transferred from the plant to invading fungi via an uncharacterised mechanism, to cause gene silencing. Here, we describe recent advances in RNAi‐mediated control of plant pathogenic fungi, highlighting the key advantages and disadvantages. We then discuss the developments and implications of combining HIGS with other methods of disease control. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:28967180
Single-cell analysis of population context advances RNAi screening at multiple levels
Snijder, Berend; Sacher, Raphael; Rämö, Pauli; Liberali, Prisca; Mench, Karin; Wolfrum, Nina; Burleigh, Laura; Scott, Cameron C; Verheije, Monique H; Mercer, Jason; Moese, Stefan; Heger, Thomas; Theusner, Kristina; Jurgeit, Andreas; Lamparter, David; Balistreri, Giuseppe; Schelhaas, Mario; De Haan, Cornelis A M; Marjomäki, Varpu; Hyypiä, Timo; Rottier, Peter J M; Sodeik, Beate; Marsh, Mark; Gruenberg, Jean; Amara, Ali; Greber, Urs; Helenius, Ari; Pelkmans, Lucas
2012-01-01
Isogenic cells in culture show strong variability, which arises from dynamic adaptations to the microenvironment of individual cells. Here we study the influence of the cell population context, which determines a single cell's microenvironment, in image-based RNAi screens. We developed a comprehensive computational approach that employs Bayesian and multivariate methods at the single-cell level. We applied these methods to 45 RNA interference screens of various sizes, including 7 druggable genome and 2 genome-wide screens, analysing 17 different mammalian virus infections and four related cell physiological processes. Analysing cell-based screens at this depth reveals widespread RNAi-induced changes in the population context of individual cells leading to indirect RNAi effects, as well as perturbations of cell-to-cell variability regulators. We find that accounting for indirect effects improves the consistency between siRNAs targeted against the same gene, and between replicate RNAi screens performed in different cell lines, in different labs, and with different siRNA libraries. In an era where large-scale RNAi screens are increasingly performed to reach a systems-level understanding of cellular processes, we show that this is often improved by analyses that account for and incorporate the single-cell microenvironment. PMID:22531119
Pompey, Justine M; Foda, Bardees; Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.
[Expression analysis of a transformer gene in Daphnia pulex after RNAi].
Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L
2016-01-01
In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.
Singh, Upinder
2015-01-01
Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096
Wu, Ke; Hoy, Marjorie A.
2014-01-01
Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis. PMID:25329675
Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S
2011-11-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury without destabilizing the vessel wall.
Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen
2011-01-01
Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury without destabilizing the vessel wall. PMID:21856925
RNA Interference: Biology, Mechanism, and Applications
Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.
2003-01-01
Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679
Ammara, Um e; Mansoor, Shahid; Saeed, Muhammad; Amin, Imran; Briddon, Rob W; Al-Sadi, Abdullah Mohammed
2015-03-04
Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus (family Geminiviridae) is responsible for heavy yield losses for tomato production around the globe. In Oman at least five distinct begomoviruses cause disease in tomato, including TYLCV. Unusually, TYLCV infections in Oman are sometimes associated with a betasatellite (Tomato leaf curl betasatellite [ToLCB]; a symptom modulating satellite). RNA interference (RNAi) can be used to develop resistance against begomoviruses at either the transcriptional or post-transcriptional levels. A hairpin RNAi (hpRNAi) construct to express double-stranded RNA homologous to sequences of the intergenic region, coat protein gene, V2 gene and replication-associated gene of Tomato yellow leaf curl virus-Oman (TYLCV-OM) was produced. Initially, transient expression of the hpRNAi construct at the site of virus inoculation was shown to reduce the number of plants developing symptoms when inoculated with either TYLCV-OM or TYLCV-OM with ToLCB-OM to Nicotiana benthamiana or tomato. Solanum lycopersicum L. cv. Pusa Ruby was transformed with the hpRNAi construct and nine confirmed transgenic lines were obtained and challenged with TYLCV-OM and ToLCB-OM by Agrobacterium-mediated inoculation. For all but one line, for which all plants remained symptomless, inoculation with TYLCV-OM led to a proportion (≤25%) of tomato plants developing symptoms of infection. For inoculation with TYLCV-OM and ToLCB-OM all lines showed a proportion of plants (≤45%) symptomatic. However, for all infected transgenic plants the symptoms were milder and virus titre in plants was lower than in infected non-transgenic tomato plants. These results show that RNAi can be used to develop resistance against geminiviruses in tomato. The resistance in this case is not immunity but does reduce the severity of infections and virus titer. Also, the betasatellite may compromise resistance, increasing the proportion of plants which ultimately show symptoms.
Watanabe, Takahito; Noji, Sumihare; Mito, Taro
2016-01-01
Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal. These insects include many deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome-editing technologies in this species would greatly promote functional genomics studies. Genome editing using transcription activator-like effector nucleases (TALENs) has proven to be an effective method for site-specific genome manipulation in various species. TALENs are artificial nucleases that are capable of inducing DNA double-strand breaks into specified target sequences. Here, we describe a protocol for TALEN-based gene knockout in G. bimaculatus, including a mutant selection scheme via mutation detection assays, for generating homozygous knockout organisms.
Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.
2013-01-01
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797
Claser, Carla; Curcio, Marli; de Mello, Samanta M; Silveira, Eduardo V; Monteiro, Hugo P; Rodrigues, Mauricio M
2008-12-17
As an obligatory intracellular parasite, Trypanosoma cruzi, the etiological agent of Chagas' disease, must invade and multiply within mammalian cells. Cytokeratin 18 (CK18) is among the host molecules that have been suggested as a mediator of important events during T. cruzi-host cell interaction. Based on that possibility, we addressed whether RNA interference (RNAi)-mediated down regulation of the CK18 gene could interfere with the parasite life cycle in vitro. HeLa cells transiently transfected with CK18-RNAi had negligible levels of CK18 transcripts, and significantly reduced levels of CK18 protein expression as determined by immunoblotting or immunofluorescence. CK18 negative or positive HeLa cells were invaded equally as well by trypomastigotes of different T. cruzi strains. Also, in CK18 negative or positive cells, parasites recruited host cells lysosomes and escaped from the parasitophorous vacuole equally as well. After that, the growth of amastigotes of the Y or CL-Brener strains, was drastically arrested in CK18 RNAi-treated cells. After 48 hours, the number of amastigotes was several times lower in CK18 RNAi-treated cells when compared to control cells. Simultaneous staining of parasites and CK18 showed that in HeLa cells infected with the Y strain both co-localize. Although the amastigote surface protein-2 contains the domain VTVXNVFLYNR previously described to bind to CK18, in several attempts, we failed to detect binding of a recombinant protein to CK-18. The study demonstrates that silencing CK18 by transient RNAi, inhibits intracellular multiplication of the Y and CL strain of T. cruzi in HeLa cells, but not trypanosome binding and invasion.
Claser, Carla; Curcio, Marli; de Mello, Samanta M; Silveira, Eduardo V; Monteiro, Hugo P; Rodrigues, Mauricio M
2008-01-01
Background As an obligatory intracellular parasite, Trypanosoma cruzi, the etiological agent of Chagas' disease, must invade and multiply within mammalian cells. Cytokeratin 18 (CK18) is among the host molecules that have been suggested as a mediator of important events during T. cruzi-host cell interaction. Based on that possibility, we addressed whether RNA interference (RNAi)-mediated down regulation of the CK18 gene could interfere with the parasite life cycle in vitro. HeLa cells transiently transfected with CK18-RNAi had negligible levels of CK18 transcripts, and significantly reduced levels of CK18 protein expression as determined by immunoblotting or immunofluorescence. Results CK18 negative or positive HeLa cells were invaded equally as well by trypomastigotes of different T. cruzi strains. Also, in CK18 negative or positive cells, parasites recruited host cells lysosomes and escaped from the parasitophorous vacuole equally as well. After that, the growth of amastigotes of the Y or CL-Brener strains, was drastically arrested in CK18 RNAi-treated cells. After 48 hours, the number of amastigotes was several times lower in CK18 RNAi-treated cells when compared to control cells. Simultaneous staining of parasites and CK18 showed that in HeLa cells infected with the Y strain both co-localize. Although the amastigote surface protein-2 contains the domain VTVXNVFLYNR previously described to bind to CK18, in several attempts, we failed to detect binding of a recombinant protein to CK-18. Conclusion The study demonstrates that silencing CK18 by transient RNAi, inhibits intracellular multiplication of the Y and CL strain of T. cruzi in HeLa cells, but not trypanosome binding and invasion. PMID:19087356
Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz
2012-01-01
Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.
2012-01-01
Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894
Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing
2016-01-01
Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .
Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P
2013-01-04
RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.
USDA-ARS?s Scientific Manuscript database
Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...
Yang, Yingzhen; Jittayasothorn, Yingyos; Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5' end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs.
Chronis, Demosthenis; Wang, Xiaohong; Cousins, Peter; Zhong, Gan-Yuan
2013-01-01
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constructs, containing a stem sequence of 42 bp (pART27-42) or 271 bp (pART27-271) of the 16D10 gene, were transformed into grape hairy roots and compared for their small interfering RNA (siRNA) production and efficacy on suppression of nematode infection. Transgenic hairy root lines carrying either of the two RNAi constructs showed less susceptibility to nematode infection compared with control. Small RNA libraries from four pART27-42 and two pART27-271 hairy root lines were sequenced using an Illumina sequencing technology. The pART27-42 lines produced hundred times more 16D10-specific siRNAs than the pART27-271 lines. On average the 16D10 siRNA population had higher GC content than the 16D10 stem sequences in the RNAi constructs, supporting previous observation that plant dicer-like enzymes prefer GC-rich sequences as substrates for siRNA production. The stems of the 16D10 RNAi constructs were not equally processed into siRNAs. Several hot spots for siRNA production were found in similar positions of the hairpin stems in pART27-42 and pART27-271. Interestingly, stem sequences at the loop terminus produced more siRNAs than those at the stem base. Furthermore, the relative abundance of guide and passenger single-stranded RNAs from putative siRNA duplexes was largely correlated with their 5′ end thermodynamic strength. This study demonstrated the feasibility of using a plant-derived RNAi approach for generation of novel nematode resistance in grapes and revealed several interesting molecular characteristics of transgene siRNAs important for optimizing plant RNAi constructs. PMID:23874962
Tai, Kuo-Feng; Wang, Chien-Hsing
2013-12-01
The transforming growth factor β (TGF-β) is the key molecule implicated in impaired immune function in human patients with malignant melanoma. TGF-β can promote tumor growth, invasion, and metastasis in advanced stages of melanoma. Blocking these tumor-promoting effects of TGF-β provides a potentially important therapeutic strategy for the treatment of melanoma. In this study, we used an adenovirus-based shRNA expression system and successfully constructed Ad/TGF-β1-RNA interference (RNAi) which mediated the RNAi for TGF-β1 gene silencing. We examined the effects of TGF-β1 protein knockdown by RNAi on the growth and metastasis of melanoma in C57BL/6 mice induced by the B16F0 cell line. The TGF-β1 hairpin oligonucleotide was cloned into adenoviral vector. The resulting recombinant adenoviruses infected murine melanoma cell line, B16F0, and designated as B16F0/TGF-β1-RNAi cells. The blank adenoviral vector also infected B16F0 cells and designed as B16F0/vector-control cells served as a control. TGF-β1 expression was reduced in B16F0/TGF-β1-RNAi cells compared with B16F0 cells and B16F0/vector-control cells. Three million wild-type B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells were injected subcutaneously into the right flanks of adult female syngeneic mice C57BL/6. The tumor sizes were 756.09 (65.35), 798.48 (78.77), and 203.55 (24.56) mm at the 14th day in the mice receiving B16F0 cells, B16F0/vector-control cells, and B16F0/TGFβ1-RNAi cells, respectively. The P value was less than 0.01 by 1-way analysis of variance. TGF-β1 knockdown in B16F0 cells enhanced the infiltration of CD4 and CD8 T cells in the tumor regions. C57BL/6 mice were evaluated for pulmonary metastasis after tail vein injection of 2 million B16F0 cells, B16F0/vector-control cells, and B16F0/TGF-β1-RNAi cells. The pulmonary metastasis also reduced significantly on days 14 day and 21 in mice injected with B16F0/TGF-β1-RNAi tumors. The blood vessel density of the tumors markedly reduced in B16F0/TGF-β1-RNAi tumors. Our results showed that Ad/TGF-β1-RNAi could induce silencing of the TGF-β1 gene effectively. Silencing of TGF-β1 expression in B16F0 cells by RNAi technology can inhibit the growth and metastasis of this tumor after being transplanted to C57BL/6 mice. This kind of adenoviral vector based on RNAi might be a promising vector for cancer therapy.
NASA Astrophysics Data System (ADS)
Hu, Zongli; Parekh, Urvi; Maruta, Natsumi; Trusov, Yuri; Botella, Jimmy
2015-01-01
Fusarium oxysporum is a devastating pathogen causing extensive yield losses in a variety of crops and development of sustainable, environmentally friendly methods to improve crop resistance is crucial. We have used Host-Derived RNA interference (HD-RNAi) technology to partially silence three different genes (FOW2, FRP1 and OPR) in the hemi-biotrophic fungus Fusarium oxysporum f. sp. conglutinans. Expression of double stranded RNA molecules targeting fungal pathogen genes was achieved in a number of transgenic Arabidopsis lines. F. oxysporum infecting the transgenic lines displayed substantially reduced mRNA levels on all three targeted genes, with an average of 75%, 83% and 72% reduction for FOW2, FRP1 and OPR respectively. The silencing of pathogen genes had a clear positive effect on the ability of the transgenic lines to fight infection. All transgenic lines displayed enhanced resistance to F. oxysporum with delayed disease symptom development, especially FRP1 and OPR lines. Survival rates after fungal infection were higher in the transgenic lines compared to control wild type plants which consistently showed survival rates of 10%, with FOW2 lines showing 25% survival; FRP1 lines 30-50% survival and FOW2 between 45-70% survival. The down-regulation effect was specific for the targeted genes without unintended effects in related genes. In addition to producing resistant crops, HD-RNAi can provide a useful tool to rapidly screen candidate fungal pathogenicity genes without the need to produce fungal knockout mutants.
Kocan, Katherine M; Manzano-Roman, Raúl; de la Fuente, José
2007-05-01
RNA interference (RNAi) has become the most powerful experimental tool for the study of gene function in ticks. Subolesin, initially called 4D8, was found to be protective against tick infestations when used as a vaccine and was shown to be highly conserved among ixodid tick species at the nucleotide and protein levels. RNAi caused systemic silencing of subolesin and demonstrated that this protein is involved in regulation of tick feeding, reproduction, and development. Recently, these results were extended to the one-host tick Rhipicephalus (Boophilus) microplus in which injection of dsRNA into replete females resulted in transovarial silencing of subolesin expression in eggs and larvae. Herein, we report transovarial silencing of subolesin by RNAi in the three-host ticks, Amblyomma americanum, Dermacentor variabilis, and Ixodes scapularis. Silencing of subolesin expression by RNAi in these tick species also affected subolesin expression in eggs and larvae. Transovarial RNAi appears to be a common mechanism in ixodid ticks and provides a simple method for the rapid characterization of tick genes involved in oviposition, embryogenesis, and larval development.
Small RNAs—The Secret Agents in the Plant-Pathogen Interactions
Weiberg, Arne; Jin, Hailing
2015-01-01
Eukaryotic regulatory small RNAs (sRNAs) that induce RNA interference (RNAi) are involved in a plethora of biological processes, including host immunity and pathogen virulence. In plants, diverse classes of sRNAs contribute to the regulation of host innate immunity. These immune-regulatory sRNAs operate through distinct RNAi pathways that trigger transcriptional or post-transcriptional gene silencing. Similarly, many pathogen-derived sRNAs also regulate pathogen virulence. Remarkably, the influence of regulatory sRNAs is not limited to the individual organism in which they are generated. It can sometimes extend to interacting species from even different kingdoms. There they trigger gene silencing in the interacting organism, a phenomenon called cross-kingdom RNAi. This is exhibited in advanced pathogens and parasites that produce sRNAs to suppress host immunity. Conversely, in host-induced gene silencing (HIGS), diverse plants are engineered to trigger RNAi against pathogens and pests to confer host resistance. Cross-kingdom RNAi opens up a vastly unexplored area of research on mobile sRNAs in the battlefield between hosts and pathogens. PMID:26123395
Delivery of RNA interference therapeutics using polycation-based nanoparticles.
Howard, Kenneth Alan
2009-07-25
RNAi-based therapies are dependent on extracellular and intracellular delivery of RNA molecules for enabling target interaction. Polycation-based nanoparticles (or polyplexes) formed by self-assembly with RNA can be used to modulate pharmacokinetics and intracellular trafficking to improve the therapeutic efficacy of RNAi-based therapeutics. This review describes the application of polyplexes for extracellular and intracellular delivery of synthetic RNA molecules. Focus is given to routes of administration and silencing effects in animal disease models. The inclusion of functional components into the nanoparticle for controlling cellular trafficking and RNA release is discussed. This work highlights the versatile nature of polycation-based nanoparticles to fulfil the delivery requirements for RNA molecules with flexibility in design to evolve alongside an expanding repertoire of RNAi-based drugs.
Evangelista, Cláudia Carolina Silva; Guidelli, Giovanna Vieira; Borges, Gustavo; Araujo, Thais Fenz; de Souza, Tiago Alves Jorge; Neves, Ubiraci Pereira da Costa; Tunnacliffe, Alan; Pereira, Tiago Campos
2017-01-01
Abstract The molecular basis of anhydrobiosis, the state of suspended animation entered by some species during extreme desiccation, is still poorly understood despite a number of transcriptome and proteome studies. We therefore conducted functional screening by RNA interference (RNAi) for genes involved in anhydrobiosis in the holo-anhydrobiotic nematode Panagrolaimus superbus. A new method of survival analysis, based on staining, and proof-of-principle RNAi experiments confirmed a role for genes involved in oxidative stress tolerance, while a novel medium-scale RNAi workflow identified a further 40 anhydrobiosis-associated genes, including several involved in proteostasis, DNA repair and signal transduction pathways. This suggests that multiple genes contribute to anhydrobiosis in P. superbus. PMID:29111563
Poller, W; Fechner, H
2010-01-01
Understanding of the roles of RNAs within the cell has changed and expanded dramatically during the past few years. Based on fundamentally new insights it is now increasingly possible to employ RNAs as highly valuable tools in molecular biology and medicine. At present, the most important therapeutic strategies are based on non-coding regulatory RNAs inducing RNA interference (RNAi) to silence single genes, and on modulation of cellular microRNAs (miRNAs) to alter complex gene expression patterns in diseased organs. Only recently it became possible to target therapeutic RNAi to specific organs via organotropic viral vector systems and we discuss the most recent strategies in this field, e.g. heart failure treatment by cardiac-targeted RNAi. Due to the peculiar biochemical properties of small RNA molecules, true therapeutic translation of results in vitro is more demanding than with small molecule drugs or proteins. Specifically, there is a critical requirement for extensive studies in animal models of human disease after pre-testing of the RNAi tools in vitro. This requirement likewise applies for miRNA modulations which have complex consequences in the recipient dependent on biochemical stability and distribution of the therapeutic RNA. Problems not yet fully solved are the prediction of targets and specificity of the RNA tools. However, major progress has been made to achieve their tissue-specific and regulatable expression, and breakthroughs in vector technologies from the gene therapy field have fundamentally improved safety and efficacy of RNA-based therapeutic approaches, too. In summary, insight into the molecular mechanisms of action of regulatory RNAs in combination with new delivery tools for RNA therapeutics will significantly expand our cardiovascular therapeutic repertoire beyond classical pharmacology.
Muda, Marco; Worby, Carolyn A; Simonson-Leff, Nancy; Clemens, James C; Dixon, Jack E
2002-08-15
Despite the wealth of information generated by genome-sequencing projects, the identification of in vivo substrates of specific protein kinases and phosphatases is hampered by the large number of candidate enzymes, overlapping enzyme specificity and sequence similarity. In the present study, we demonstrate the power of RNA interference (RNAi) to dissect signal transduction cascades involving specific kinases and phosphatases. RNAi is used to identify the cellular tyrosine kinases upstream of the phosphorylation of Down-Syndrome cell-adhesion molecule (Dscam), a novel cell-surface molecule of the immunoglobulin-fibronectin super family, which has been shown to be important for axonal path-finding in Drosophila. Tyrosine phosphorylation of Dscam recruits the Src homology 2 domain of the adaptor protein Dock to the receptor. Dock, the ortho- logue of mammalian Nck, is also essential for correct axonal path-finding in Drosophila. We further determined that Dock is tyrosine-phosphorylated in vivo and identified DPTP61F as the protein tyrosine phosphatase responsible for maintaining Dock in its non-phosphorylated state. The present study illustrates the versatility of RNAi in the identification of the physiological substrates for protein kinases and phosphatases.
Kurscheid, Sebastian; Lew-Tabor, Ala E; Rodriguez Valle, Manuel; Bruyeres, Anthea G; Doogan, Vivienne J; Munderloh, Ulrike G; Guerrero, Felix D; Barrero, Roberto A; Bellgard, Matthew I
2009-01-01
Background The Arthropods are a diverse group of organisms including Chelicerata (ticks, mites, spiders), Crustacea (crabs, shrimps), and Insecta (flies, mosquitoes, beetles, silkworm). The cattle tick, Rhipicephalus (Boophilus) microplus, is an economically significant ectoparasite of cattle affecting cattle industries world wide. With the availability of sequence reads from the first Chelicerate genome project (the Ixodes scapularis tick) and extensive R. microplus ESTs, we investigated evidence for putative RNAi proteins and studied RNA interference in tick cell cultures and adult female ticks targeting Drosophila homologues with known cell viability phenotype. Results We screened 13,643 R. microplus ESTs and I. scapularis genome reads to identify RNAi related proteins in ticks. Our analysis identified 31 RNAi proteins including a putative tick Dicer, RISC associated (Ago-2 and FMRp), RNA dependent RNA polymerase (EGO-1) and 23 homologues implicated in dsRNA uptake and processing. We selected 10 R. microplus ESTs with >80% similarity to D. melanogaster proteins associated with cell viability for RNAi functional screens in both BME26 R. microplus embryonic cells and female ticks in vivo. Only genes associated with proteasomes had an effect on cell viability in vitro. In vivo RNAi showed that 9 genes had significant effects either causing lethality or impairing egg laying. Conclusion We have identified key RNAi-related proteins in ticks and along with our loss-of-function studies support a functional RNAi pathway in R. microplus. Our preliminary studies indicate that tick RNAi pathways may differ from that of other Arthropods such as insects. PMID:19323841
RNA interference targets arbovirus replication in Culicoides cells.
Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain
2013-03-01
Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.
CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea
Marraffini, Luciano A.; Sontheimer, Erik J.
2010-01-01
Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085
Takahashi, Yuki; Nishikawa, Makiya; Kobayashi, Naoki; Takakura, Yoshinobu
2005-07-20
Silencing of oncogenes or other genes contributing to tumor malignancy or progression by RNA interference (RNAi) offers a promising approach to treating tumor patients. To achieve RNAi-based tumor therapy, a small interfering RNA (siRNA) or siRNA-expressing vector needs to be delivered to tumor cells, but little information about its in vivo delivery has been reported. In this study, we examined whether the expression of the target gene in tumor cells can be suppressed by the delivery of RNAi effectors to primary and metastatic tumor cells. To quantitatively evaluate the RNAi effects in tumor cells, mouse melanoma B16-BL6 cells were stably transfected with both firefly (a model target gene) and sea pansy (an internal standard gene) luciferase genes to obtain B16-BL6/dual Luc cells. The target gene expression in subcutaneous primary tumors of B16-BL6/dual Luc cells was significantly suppressed by direct injection of the RNAi effectors followed by electroporation. The expression in metastatic hepatic tumors was also significantly reduced by an intravenous injection of either RNAi effector by the hydrodynamics-based procedure. These results indicate that the both RNAi effectors have a potential to silence target gene in tumor cells in vivo when successfully delivered to tumor cells.
Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame
2014-04-20
A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.
A status report on RNAi therapeutics
2010-01-01
Fire and Mello initiated the current explosion of interest in RNA interference (RNAi) biology with their seminal work in Caenorhabditis elegans. These observations were closely followed by the demonstration of RNAi in Drosophila melanogaster. However, the full potential of these new discoveries only became clear when Tuschl and colleagues showed that 21-22 bp RNA duplexes with 3" overhangs, termed small interfering (si)RNAs, could reliably execute RNAi in a range of mammalian cells. Soon afterwards, it became clear that many different human cell types had endogenous machinery, the RNA-induced silencing complex (RISC), which could be harnessed to silence any gene in the genome. Beyond the availability of a novel way to dissect biology, an important target validation tool was now available. More importantly, two key properties of the RNAi pathway - sequence-mediated specificity and potency - suggested that RNAi might be the most important pharmacological advance since the advent of protein therapeutics. The implications were profound. One could now envisage selecting disease-associated targets at will and expect to suppress proteins that had remained intractable to inhibition by conventional methods, such as small molecules. This review attempts to summarize the current understanding on siRNA lead discovery, the delivery of RNAi therapeutics, typical in vivo pharmacological profiles, preclinical safety evaluation and an overview of the 14 programs that have already entered clinical practice. PMID:20615220
Choosing the Right Tool for the Job: RNAi, TALEN or CRISPR
Boettcher, Michael; McManus, Michael T.
2015-01-01
The most widely used approach for defining a genes’ function is to reduce or completely disrupt its normal expression. For over a decade, RNAi has ruled the lab, offering a magic bullet to disrupt gene expression in many organisms. However, new biotechnological tools - specifically CRISPR-based technologies - have become available and are squeezing out RNAi dominance in mammalian cell studies. These seemingly competing technologies leave research investigators with the question: ‘Which technology should I use in my experiment?’ This review offers a practical resource to compare and contrast these technologies, guiding the investigator when and where to use this fantastic array of powerful tools. PMID:26000843
He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi
2009-02-01
The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight and left ventricular weight/body weight were significantly lower in ACE-RNAi rats (3.12+/-0.23 mg/g and 2.24+/-0.19 mg/g) compared with the vehicle controls (4.29+/-0.24 mg/g and 3.21+/-0.13 mg/g; P<0.05) and the vector controls (4.43+/-0.19 mg/g and 3.13+/-0.12 mg/g; P<0.05). The conclusion of the present study is that ACE-silencing had significant antihypertensive effects and reversed hypertensive-induced cardiac hypertrophy in SHRs, and therefore RNAi might be a new strategy in controlling hypertension.
Caenorhabditis elegans ABCRNAi Transporters Interact Genetically With rde-2 and mut-7
Sundaram, Prema; Han, Wang; Cohen, Nancy; Echalier, Benjamin; Albin, John; Timmons, Lisa
2008-01-01
RNA interference (RNAi) mechanisms are conserved and consist of an interrelated network of activities that not only respond to exogenous dsRNA, but also perform endogenous functions required in the fine tuning of gene expression and in maintaining genome integrity. Not surprisingly, RNAi functions have widespread influences on cellular function and organismal development. Previously, we observed a reduced capacity to mount an RNAi response in nine Caenorhabditis elegans mutants that are defective in ABC transporter genes (ABCRNAi mutants). Here, we report an exhaustive study of mutants, collectively defective in 49 different ABC transporter genes, that allowed for the categorization of one additional transporter into the ABCRNAi gene class. Genetic complementation tests reveal functions for ABCRNAi transporters in the mut-7/rde-2 branch of the RNAi pathway. These second-site noncomplementation interactions suggest that ABCRNAi proteins and MUT-7/RDE-2 function together in parallel pathways and/or as multiprotein complexes. Like mut-7 and rde-2, some ABCRNAi mutants display transposon silencing defects. Finally, our analyses reveal a genetic interaction network of ABCRNAi gene function with respect to this part of the RNAi pathway. From our results, we speculate that the coordinated activities of ABCRNAi transporters, through their effects on endogenous RNAi-related mechanisms, ultimately affect chromosome function and integrity. PMID:18245353
Koch, Aline; Kogel, Karl-Heinz
2014-09-01
RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Ho, Hsiang; Milenković, Tijana; Memisević, Vesna; Aruri, Jayavani; Przulj, Natasa; Ganesan, Anand K
2010-06-15
RNA-mediated interference (RNAi)-based functional genomics is a systems-level approach to identify novel genes that control biological phenotypes. Existing computational approaches can identify individual genes from RNAi datasets that regulate a given biological process. However, currently available methods cannot identify which RNAi screen "hits" are novel components of well-characterized biological pathways known to regulate the interrogated phenotype. In this study, we describe a method to identify genes from RNAi datasets that are novel components of known biological pathways. We experimentally validate our approach in the context of a recently completed RNAi screen to identify novel regulators of melanogenesis. In this study, we utilize a PPI network topology-based approach to identify targets within our RNAi dataset that may be components of known melanogenesis regulatory pathways. Our computational approach identifies a set of screen targets that cluster topologically in a human PPI network with the known pigment regulator Endothelin receptor type B (EDNRB). Validation studies reveal that these genes impact pigment production and EDNRB signaling in pigmented melanoma cells (MNT-1) and normal melanocytes. We present an approach that identifies novel components of well-characterized biological pathways from functional genomics datasets that could not have been identified by existing statistical and computational approaches.
2010-01-01
Background RNA-mediated interference (RNAi)-based functional genomics is a systems-level approach to identify novel genes that control biological phenotypes. Existing computational approaches can identify individual genes from RNAi datasets that regulate a given biological process. However, currently available methods cannot identify which RNAi screen "hits" are novel components of well-characterized biological pathways known to regulate the interrogated phenotype. In this study, we describe a method to identify genes from RNAi datasets that are novel components of known biological pathways. We experimentally validate our approach in the context of a recently completed RNAi screen to identify novel regulators of melanogenesis. Results In this study, we utilize a PPI network topology-based approach to identify targets within our RNAi dataset that may be components of known melanogenesis regulatory pathways. Our computational approach identifies a set of screen targets that cluster topologically in a human PPI network with the known pigment regulator Endothelin receptor type B (EDNRB). Validation studies reveal that these genes impact pigment production and EDNRB signaling in pigmented melanoma cells (MNT-1) and normal melanocytes. Conclusions We present an approach that identifies novel components of well-characterized biological pathways from functional genomics datasets that could not have been identified by existing statistical and computational approaches. PMID:20550706
Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V
2012-10-01
The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.
Watanabe, Takahito; Noji, Sumihare; Mito, Taro
2014-08-15
Hemimetabolous, or incompletely metamorphosing, insects are phylogenetically basal. These insects include many deleterious species. The cricket, Gryllus bimaculatus, is an emerging model for hemimetabolous insects, based on the success of RNA interference (RNAi)-based gene-functional analyses and transgenic technology. Taking advantage of genome-editing technologies in this species would greatly promote functional genomics studies. Genome editing using transcription activator-like effector nucleases (TALENs) has proven to be an effective method for site-specific genome manipulation in various species. TALENs are artificial nucleases that are capable of inducing DNA double-strand breaks into specified target sequences. Here, we describe a protocol for TALEN-based gene knockout in G. bimaculatus, including a mutant selection scheme via mutation detection assays, for generating homozygous knockout organisms. Copyright © 2014 Elsevier Inc. All rights reserved.
Gene Silencing in Crustaceans: From Basic Research to Biotechnologies
Sagi, Amir; Manor, Rivka; Ventura, Tomer
2013-01-01
Gene silencing through RNA interference (RNAi) is gaining momentum for crustaceans, both in basic research and for commercial development. RNAi has proven instrumental in a growing number of crustacean species, revealing the functionality of novel crustacean genes essential among others to development, growth, metabolism and reproduction. Extensive studies have also been done on silencing of viral transcripts in crustaceans, contributing to the understanding of the defense mechanisms of crustaceans and strategies employed by viruses to overcome these. The first practical use of gene silencing in aquaculture industry has been recently achieved, through manipulation of a crustacean insulin-like androgenic gland hormone. This review summarizes the advancements in the use of RNAi in crustaceans, and assesses the advantages of this method, as well as the current hurdles that hinder its large-scale practice. PMID:24705266
Argonaute2 is the catalytic engine of mammalian RNAi.
Liu, Jidong; Carmell, Michelle A; Rivas, Fabiola V; Marsden, Carolyn G; Thomson, J Michael; Song, Ji-Joon; Hammond, Scott M; Joshua-Tor, Leemor; Hannon, Gregory J
2004-09-03
Gene silencing through RNA interference (RNAi) is carried out by RISC, the RNA-induced silencing complex. RISC contains two signature components, small interfering RNAs (siRNAs) and Argonaute family proteins. Here, we show that the multiple Argonaute proteins present in mammals are both biologically and biochemically distinct, with a single mammalian family member, Argonaute2, being responsible for messenger RNA cleavage activity. This protein is essential for mouse development, and cells lacking Argonaute2 are unable to mount an experimental response to siRNAs. Mutations within a cryptic ribonuclease H domain within Argonaute2, as identified by comparison with the structure of an archeal Argonaute protein, inactivate RISC. Thus, our evidence supports a model in which Argonaute contributes "Slicer" activity to RISC, providing the catalytic engine for RNAi.
In vivo therapeutic potential of Dicer-hunting siRNAs targeting infectious hepatitis C virus.
Watanabe, Tsunamasa; Hatakeyama, Hiroto; Matsuda-Yasui, Chiho; Sato, Yusuke; Sudoh, Masayuki; Takagi, Asako; Hirata, Yuichi; Ohtsuki, Takahiro; Arai, Masaaki; Inoue, Kazuaki; Harashima, Hideyoshi; Kohara, Michinori
2014-04-23
The development of RNA interference (RNAi)-based therapy faces two major obstacles: selecting small interfering RNA (siRNA) sequences with strong activity, and identifying a carrier that allows efficient delivery to target organs. Additionally, conservative region at nucleotide level must be targeted for RNAi in applying to virus because hepatitis C virus (HCV) could escape from therapeutic pressure with genome mutations. In vitro preparation of Dicer-generated siRNAs targeting a conserved, highly ordered HCV 5' untranslated region are capable of inducing strong RNAi activity. By dissecting the 5'-end of an RNAi-mediated cleavage site in the HCV genome, we identified potent siRNA sequences, which we designate as Dicer-hunting siRNAs (dh-siRNAs). Furthermore, formulation of the dh-siRNAs in an optimized multifunctional envelope-type nano device inhibited ongoing infectious HCV replication in human hepatocytes in vivo. Our efforts using both identification of optimal siRNA sequences and delivery to human hepatocytes suggest therapeutic potential of siRNA for a virus.
On future's doorstep: RNA interference and the pharmacopeia of tomorrow.
Gewirtz, Alan M
2007-12-01
Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.
Foda, Bardees M.; Singh, Upinder
2015-01-01
RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683
Delivery of RNAi reagents in murine models of obesity and diabetes.
Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T
2006-11-29
RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep
Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki
2009-01-01
Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024
Mukherjee, Krishanu; Campos, Henry; Kolaczkowski, Bryan
2013-03-01
RNA interference (RNAi) is a eukaryotic molecular system that serves two primary functions: 1) gene regulation and 2) protection against selfish elements such as viruses and transposable DNA. Although the biochemistry of RNAi has been detailed in model organisms, very little is known about the broad-scale patterns and forces that have shaped RNAi evolution. Here, we provide a comprehensive evolutionary analysis of the Dicer protein family, which carries out the initial RNA recognition and processing steps in the RNAi pathway. We show that Dicer genes duplicated and diversified independently in early animal and plant evolution, coincident with the origins of multicellularity. We identify a strong signature of long-term protein-coding adaptation that has continually reshaped the RNA-binding pocket of the plant Dicer responsible for antiviral immunity, suggesting an evolutionary arms race with viral factors. We also identify key changes in Dicer domain architecture and sequence leading to specialization in either gene-regulatory or protective functions in animal and plant paralogs. As a whole, these results reveal a dynamic picture in which the evolution of Dicer function has driven elaboration of parallel RNAi functional pathways in animals and plants.
Hydrophobization and bioconjugation for enhanced siRNA delivery and targeting
De Paula, Daniel; Bentley, M. Vitória L.B.; Mahato, Ram I.
2007-01-01
RNA interference (RNAi) is an evolutionarily conserved process by which double-stranded small interfering RNA (siRNA) induces sequence-specific, post-transcriptional gene silencing. Unlike other mRNA targeting strategies, RNAi takes advantage of the physiological gene silencing machinery. The potential use of siRNA as therapeutic agents has attracted great attention as a novel approach for treating severe and chronic diseases. RNAi can be achieved by either delivery of chemically synthesized siRNAs or endogenous expression of small hairpin RNA, siRNA, and microRNA (miRNA). However, the relatively high dose of siRNA required for gene silencing limits its therapeutic applications. This review discusses several strategies to improve therapeutic efficacy as well as to abrogate off-target effects and immunostimulation caused by siRNAs. There is an in-depth discussion on various issues related to the (1) mechanisms of RNAi, (2) methods of siRNA production, (3) barriers to RNAi-based therapies, (4) biodistribution, (5) design of siRNA molecules, (6) chemical modification and bioconjugation, (7) complex formation with lipids and polymers, (8) encapsulation into lipid particles, and (9) target specificity for enhanced therapeutic effectiveness. PMID:17329355
Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella
Hameed, Muhammad Salman; Wang, Zhengbing; Yang, Guang
2018-01-01
Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella (PxAgo3) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella. PMID:29677157
Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella.
Hameed, Muhammad Salman; Wang, Zhengbing; Vasseur, Liette; Yang, Guang
2018-04-20
Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella ( PxAgo3 ) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella .
Wang, Yi; Li, Quan; Wei, Xianzhao; Xu, Jie; Chen, Qi; Song, Shuang; Lu, Zhe; Wang, Zimin
2015-09-01
Subacromial bursitis (SAB) is the major source of pain in rotator cuff disease. Although multiple investigations have provided support for the role of inflammatory cytokines in SAB, few have focussed on the use these cytokines in the treatment of SAB. The aim of the present study was to observe the therapeutic efficacy of lentivirus‑mediated RNA interference (RNAi) on carrageenan‑induced SAB by injecting lentivirus‑tumor necrosis factor (TNF)‑α‑RNAi expressing TNF‑α small interfering (si)RNA. Using screened siRNA segments, an siRNA was designed. A lentivirus vector expressing siRNA was established and packed as lentivirus particles. A lentivirus that expressed the negative sequence was used as a lentivirus‑negative control (NC). The carrageenan‑induced SAB model was established in 32 male Sprague‑Dawley rats. The modeled rats were randomly assigned to four groups: Lentivirus‑RNAi treatment group, lentivirus‑NC group, SAB group and phosphate‑buffered saline (PBS) blank control group. The lentivirus was injected (1x10(7) transducing units) into the subacromial bursa of the rats in the lentivirus‑RNAi group and lentivirus‑NC group, whereas 100 µl PBS was injected at the same site in the SAB group and the PBS blank control group. At 5 weeks following injection, the animals were sacrificed and venous blood was obtained. The effect of TNF‑α interference and the expression of inflammatory cytokines were determined by reverse transcription‑quantitative polymerase chain reaction, western blotting, hematoxylin and eosin staining, Van Gieson's staining and immunofluorescence. The expression of TNF‑α was decreased in the lentivirus‑TNF‑α‑RNAi group compared with that in the SAB group. Morphological observations revealed that the number of inflammatory cells were reduced and damage to tendon fibers was attenuated in this group, suggesting that the downregulation of the protein expression levels of TNF‑α‑associated nuclear factor‑κB, matrix metalloproteinase (MMP)1, MMP9, cyclooxygenase (COX)‑1 and COX‑2 may exert a therapeutic effect on inflammation of the SAB caused by rheumatoid arthritis. It was also found that the expression of stromal cell‑derived growth factor‑1 was downregulated in the lentivirus‑TNF‑α‑RNAi group. Therefore, the present study demonstrated that lentivirus‑mediated TNF‑α RNAi effectively inhibited the inflammatory response in SAB, and that injection of a lentivirus vector into the affected region is an effective way of achieving RNAi in vivo.
[New advances in animal transgenic technology].
Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang
2010-06-01
Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.
Phylogenetic Origin and Diversification of RNAi Pathway Genes in Insects.
Dowling, Daniel; Pauli, Thomas; Donath, Alexander; Meusemann, Karen; Podsiadlowski, Lars; Petersen, Malte; Peters, Ralph S; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Niehuis, Oliver
2016-12-01
RNA interference (RNAi) refers to the set of molecular processes found in eukaryotic organisms in which small RNA molecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect Transcriptome Evolution) project as well as other resources such as i5K (5000 Insect Genome Project). Specifically, we traced the origin of the double stranded RNA binding protein R2D2 to the last common ancestor of winged insects (Pterygota), the loss of Sid-1/Tag-130 orthologs in Antliophora (fleas, flies and relatives, and scorpionflies in a broad sense), and confirm previous evidence for the splitting of the Argonaute proteins Aubergine and Piwi in Brachyceran flies (Diptera, Brachycera). Our study offers new reference points for future experimental research on RNAi-related pathway genes in insects. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Steiner, Jessica Kathryne; Tasaki, Junichi; Rouhana, Labib
2016-01-01
Few animals are known to lay eggs in the absence of ovulation or copulation, as it is presumably energetically wasteful and subjected to negative selection. Characterization of Smed-boule, a member of the DAZ family of germline RNA-binding proteins, revealed that egg capsule (or capsule) production and deposition occurs independently of the presence of gametes in the planarian flatworm Schmidtea mediterranea. Reduction of Smed-boule expression by RNA-interference (RNAi) causes ablation of spermatogonial stem cells and the inability of ovarian germline stem cells to undergo oogenesis. Although animals subjected to Smed-boule RNAi lose their gametes and become sterile, they continue to lay egg capsules. Production of sterile capsules is even observed in virgin Smed-boule(RNAi) and control planarians maintained in complete isolation, demonstrating that egg production in S. mediterranea occurs independently of ovulation, fertilization, or mating. Evidence suggests that this is a conserved feature amongst Platyhelminthes, and therefore relevant to the pathology and dissemination of parasitic flatworms. These findings demonstrate that Smed-boule functions at different stages during male and female germline stem cell development, and also demonstrate that egg capsule production by planarian flatworms occurs independently of signals produced by mating or ova. PMID:27149082
Steiner, Jessica Kathryne; Tasaki, Junichi; Rouhana, Labib
2016-05-01
Few animals are known to lay eggs in the absence of ovulation or copulation, as it is presumably energetically wasteful and subjected to negative selection. Characterization of Smed-boule, a member of the DAZ family of germline RNA-binding proteins, revealed that egg capsule (or capsule) production and deposition occurs independently of the presence of gametes in the planarian flatworm Schmidtea mediterranea. Reduction of Smed-boule expression by RNA-interference (RNAi) causes ablation of spermatogonial stem cells and the inability of ovarian germline stem cells to undergo oogenesis. Although animals subjected to Smed-boule RNAi lose their gametes and become sterile, they continue to lay egg capsules. Production of sterile capsules is even observed in virgin Smed-boule(RNAi) and control planarians maintained in complete isolation, demonstrating that egg production in S. mediterranea occurs independently of ovulation, fertilization, or mating. Evidence suggests that this is a conserved feature amongst Platyhelminthes, and therefore relevant to the pathology and dissemination of parasitic flatworms. These findings demonstrate that Smed-boule functions at different stages during male and female germline stem cell development, and also demonstrate that egg capsule production by planarian flatworms occurs independently of signals produced by mating or ova.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
Engineering functional inorganic-organic hybrid systems: advances in siRNA therapeutics.
Shen, Jianliang; Zhang, Wei; Qi, Ruogu; Mao, Zong-Wan; Shen, Haifa
2018-03-21
Cancer treatment still faces a lot of obstacles such as tumor heterogeneity, drug resistance and systemic toxicities. Beyond the traditional treatment modalities, exploitation of RNA interference (RNAi) as an emerging approach has immense potential for the treatment of various gene-caused diseases including cancer. The last decade has witnessed enormous research and achievements focused on RNAi biotechnology. However, delivery of small interference RNA (siRNA) remains a key challenge in the development of clinical RNAi therapeutics. Indeed, functional nanomaterials play an important role in siRNA delivery, which could overcome a wide range of sequential physiological and biological obstacles. Nanomaterial-formulated siRNA systems have potential applications in protection of siRNA from degradation, improving the accumulation in the target tissues, enhancing the siRNA therapy and reducing the side effects. In this review, we explore and summarize the role of functional inorganic-organic hybrid systems involved in the siRNA therapeutic advancements. Additionally, we gather the surface engineering strategies of hybrid systems to optimize for siRNA delivery. Major progress in the field of inorganic-organic hybrid platforms including metallic/non-metallic cores modified with organic shells or further fabrication as the vectors for siRNA delivery is discussed to give credit to the interdisciplinary cooperation between chemistry, pharmacy, biology and medicine.
Fagard, Mathilde; Boutet, Stéphanie; Morel, Jean-Benoit; Bellini, Catherine; Vaucheret, Hervé
2000-01-01
Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants. PMID:11016954
Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H
2000-10-10
Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A
2008-12-23
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells
Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-01-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720
DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.
Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan
2008-03-01
P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).
Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.
2008-01-01
In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934
Zhao, Ling-Ling; Hui, Kaimin; Wang, Yu-Qing; Wang, Yue; Ren, Qian; Li, Xin-Cang
2018-05-01
Galactoside-binding lectins, also known as galectins, play crucial roles in innate immune response in invertebrates. In this study, three cDNA sequences from Hyriopsis cumingii were identified and collectively called HcGalec genes. Each of the three deduced HcGalec proteins contained a galactose-binding lectin domain or a GLECT domain. All the three HcGalec genes are mainly present in the hepatopancreas and gills, and their expression is induced at 24 h after bacterial challenge. Three recombinant HcGalec proteins can bind and agglutinate (Ca 2+ -dependent) various microorganisms, including Gram-positive and Gram-negative bacteria. These proteins can attach to mannan and peptidoglycan. Meanwhile, the expression of the three HcGalec genes in the gills were significantly down-regulated after dsRNA interference (HcGalec1-RNAi, HcGalec2-RNAi, and HcGalec3-RNAi) and Vibrio parahaemolyticus injection. The expression levels of some antimicrobial peptides, including lysozyme 1 and lysozyme 2, were also markedly decreased after dsRNA interference. Overall, these results suggested that these three HcGalec proteins may function as potential receptors participating in the innate immune responses of H. cumingii against bacterial infection. Copyright © 2018 Elsevier Ltd. All rights reserved.
Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E
2010-05-01
The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.
Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells
2005-07-01
pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23. My initial studies
Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano
2015-03-25
RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.
Ruiz-Vázquez, Rosa M; Nicolás, Francisco E; Torres-Martínez, Santiago; Garre, Victoriano
2015-01-01
The basal fungus Mucor circinelloides has become, in recent years, a valuable model to study RNA-mediated gene silencing or RNA interference (RNAi). Serendipitously discovered in the late 1900s, the gene silencing in M. circinelloides is a landscape of consensus and dissents. Although similar to other classical fungal models in the basic design of the essential machinery that is responsible for silencing of gene expression, the existence of small RNA molecules of different sizes generated during this process and the presence of a mechanism that amplifies the silencing signal, give it a unique identity. In addition, M. circinelloides combines the components of RNAi machinery to carry out functions that not only limit themselves to the defense against foreign genetic material, but it uses some of these elements to regulate the expression of its own genes. Thus, different combinations of RNAi elements produce distinct classes of endogenous small RNAs (esRNAs) that regulate different physiological and developmental processes in response to environmental signals. The recent discovery of a new RNAi pathway involved in the specific degradation of endogenous mRNAs, using a novel RNase protein, adds one more element to the exciting puzzle of the gene silencing in M. circinelloides, in addition to providing hints about the evolutionary origin of the RNAi mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin
2017-07-18
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.
Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics
Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin
2017-01-01
RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023
Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses
Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.
2017-01-01
Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327
A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia
Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric
2014-01-01
In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163
Gao, Mai-cang; Jia, Xiao-di; Wu, Qi-fei; Cheng, Yan; Chen, Fen-rong; Zhang, Jun
2011-01-01
Aim: To investigate whether down-regulation of peroxiredoxin 1 (Prx1) and/or peroxiredoxin 5 (Prx5) sensitizes human esophageal cancer cells to ionizing radiation (IR). Methods: Human esophageal carcinoma cell lines Eca-109 and TE-1 were used. Prx mRNA expression profiles in Eca-109 and TE-1 cells were determined using RT-PCR. Two highly expressed isoforms of Prxs, Prx1 and Prx5, were silenced by RNA interference (RNAi). Following IR, intracellular reactive oxygen species (ROS) and apoptosis were measured using flow cytometry, the activities of catalase, superoxide dismutase and glutathione peroxidase were measured, and the radiosensitizing effect of RNAi was observed. Tumor xenograft model was also used to examine the radiosensitizing effect of RNAi in vivo. Results: Down-regulation of Prx1 and/or Prx5 by RNAi does not alter the activities of catalase, superoxide dismutase and glutathione peroxidase, but made human tumor cells more sensitive to IR-induced apoptosis both in vitro and in vivo. When the two isoforms were decreased simultaneously, intracellular ROS and apoptosis significantly increased after IR. Conclusion: Silencing Prx1 and/or Prx5 by RNAi sensitizes human Eca-109 and TE-1 cells to IR, and the intracellular ROS accumulation may contribute to the radiosensitizing effect of the RNAi. PMID:21468086
CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.
Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun
2014-09-05
Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.
Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.
Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G
2018-05-18
Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.
Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen
2018-05-04
Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.
Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin
2012-01-01
Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-01-01
SUMMARY The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used human Ago2 minimal RISC system to purify Sjögren’s syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. PMID:22055194
RNAi-mediated gene silencing as a principle of action of venoms and poisons.
Pereira, Tiago Campos; Lopes-Cendes, Iscia
2008-01-01
RNA interference (RNAi) is a natural phenomenon in which double-stranded RNA molecules (dsRNAs) promote silencing of genes with similar sequence. It is noteworthy that in some instances the effects of gene silencing are similar to those caused by venoms and natural poisons (e.g., hemorrhage and low blood pressure). This observation raises the possibility that venomous/poisonous species in fact produce dsRNAs in their venoms/poisons and leading to the deleterious effects in the victim by RNAi-mediated gene silencing. Two approaches could be used to test this hypothesis, first, the neutralization of the dsRNAs and comparing to a non-treated venom sample; and second, to identify the dsRNA present in the venom and attempt to artificially reproduce its effects in the laboratory. In addition, we present three innovative treatment strategies for accidental interactions with venomous or poisonous species. RNAi has several roles in biological systems: gene regulation, antiviral defense, transposon silencing and heterochromatin formation. The hypothesis presented here provides a new role: a natural attack mechanism.
Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy
2017-11-01
RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cui, Lei; Wang, Haiying; Ji, Yanxi; Yang, Jie; Xu, Shan; Huang, Xingyu; Wang, Zidao; Qin, Lei; Tien, Po; Zhou, Xi; Guo, Deyin; Chen, Yu
2015-09-01
RNA interference (RNAi) is a process of eukaryotic posttranscriptional gene silencing that functions in antiviral immunity in plants, nematodes, and insects. However, recent studies provided strong supports that RNAi also plays a role in antiviral mechanism in mammalian cells. To combat RNAi-mediated antiviral responses, many viruses encode viral suppressors of RNA silencing (VSR) to facilitate their replication. VSRs have been widely studied for plant and insect viruses, but only a few have been defined for mammalian viruses currently. We identified a novel VSR from coronaviruses, a group of medically important mammalian viruses including Severe acute respiratory syndrome coronavirus (SARS-CoV), and showed that the nucleocapsid protein (N protein) of coronaviruses suppresses RNAi triggered by either short hairpin RNAs or small interfering RNAs in mammalian cells. Mouse hepatitis virus (MHV) is closely related to SARS-CoV in the family Coronaviridae and was used as a coronavirus replication model. The replication of MHV increased when the N proteins were expressed in trans, while knockdown of Dicer1 or Ago2 transcripts facilitated the MHV replication in mammalian cells. These results support the hypothesis that RNAi is a part of the antiviral immunity responses in mammalian cells. IMPORTANCE RNAi has been well known to play important antiviral roles from plants to invertebrates. However, recent studies provided strong supports that RNAi is also involved in antiviral response in mammalian cells. An important indication for RNAi-mediated antiviral activity in mammals is the fact that a number of mammalian viruses encode potent suppressors of RNA silencing. Our results demonstrate that coronavirus N protein could function as a VSR through its double-stranded RNA binding activity. Mutational analysis of N protein allowed us to find out the critical residues for the VSR activity. Using the MHV-A59 as the coronavirus replication model, we showed that ectopic expression of SARS-CoV N protein could promote MHV replication in RNAi-active cells but not in RNAi-depleted cells. These results indicate that coronaviruses encode a VSR that functions in the replication cycle and provide further evidence to support that RNAi-mediated antiviral response exists in mammalian cells.
Shi, Ji-Feng; Xu, Qing-Yu; Sun, Qiang-Kun; Meng, Qing-Wei; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing
2016-10-01
Trehalose is proposed to serve multiple physiological roles in insects. However, its importance remains largely unconfirmed. In the present paper, we knocked down either a trehalose biosynthesis gene (trehalose-6-phosphate synthase, LdTPS) or each of three degradation genes (soluble trehalases LdTRE1a, LdTRE1b or membrane-bound LdTRE2) in Leptinotarsa decemlineata by RNA interference (RNAi). Knockdown of LdTPS decreased trehalose content and caused larval and pupal lethality. The LdTPS RNAi survivors consumed a greater amount of foliage, obtained a heavier body mass, accumulated more glycogen, lipid and proline, and had a smaller amount of chitin compared with the controls. Ingestion of trehalose but not glucose rescued the food consumption increase and larval mass rise, increased survivorship, and recovered glycogen, lipid and chitin to the normal levels. In contrast, silencing of LdTRE1a increased trehalose content and resulted in larval and pupal lethality. The surviving LdTRE1a RNAi hypomorphs fed a smaller quantity of food, had a lighter body weight, depleted lipid and several glucogenic amino acids, and contained a smaller amount of chitin. Neither trehalose nor glucose ingestion rescued these LdTRE1a RNAi defects. Silencing of LdTRE1b caused little effects. Knockdown of LdTRE2 caused larval death, increased trehalose contents in several tissues and diminished glycogen in the brain-corpora cardiaca-corpora allata complex (BCC). Feeding glucose but not trehalose partially rescued the high mortality rate and recovered glycogen content in the BCC. It seems that trehalose is involved in feeding regulation, sugar absorption, brain energy supply and chitin biosynthesis in L. decemlineata larvae. Copyright © 2016 Elsevier Ltd. All rights reserved.
The impact of HIV-1 genetic diversity on the efficacy of a combinatorial RNAi-based gene therapy.
Herrera-Carrillo, E; Berkhout, B
2015-06-01
A hurdle for human immunodeficiency virus (HIV-1) therapy is the genomic diversity of circulating viruses and the possibility that drug-resistant virus variants are selected. Although RNA interference (RNAi) is a powerful tool to stably inhibit HIV-1 replication by the expression of antiviral short hairpin RNAs (shRNAs) in transduced T cells, this approach is also vulnerable to pre-existing genetic variation and the development of viral resistance through mutation. To prevent viral escape, we proposed to combine multiple shRNAs against important regions of the HIV-1 RNA genome, which should ideally be conserved in all HIV-1 subtypes. The vulnerability of RNAi therapy to viral escape has been studied for a single subtype B strain, but it is unclear whether the antiviral shRNAs can inhibit diverse virus isolates and subtypes, including drug-resistant variants that could be present in treated patients. To determine the breadth of the RNAi gene therapy approach, we studied the susceptibility of HIV-1 subtypes A-E and drug-resistant variants. In addition, we monitored the evolution of HIV-1 escape variants. We demonstrate that the combinatorial RNAi therapy is highly effective against most isolates, supporting the future testing of this gene therapy in appropriate in vivo models.
Analysis of energetically biased transcripts of viruses and transposable elements
Secolin, Rodrigo; Pascoal, Vinícius D’Ávila Bitencourt; Lopes-Cendes, Iscia; Pereira, Tiago Campos
2012-01-01
RNA interference (RNAi) is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs) are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC) in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC). Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs. PMID:23271949
Logic integration of mRNA signals by an RNAi-based molecular computer.
Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov
2010-05-01
Synthetic in vivo molecular 'computers' could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that 'transduce' mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi 'computational' module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting.
Logic integration of mRNA signals by an RNAi-based molecular computer
Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov
2010-01-01
Synthetic in vivo molecular ‘computers’ could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that ‘transduce’ mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi ‘computational’ module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting. PMID:20194121
Yuan, Ji; Cheung, Paul K M; Zhang, Huifang M; Chau, David; Yang, Decheng
2005-02-01
Coxsackievirus B3 (CVB3) is the most common causal agent of viral myocarditis, but existing drug therapies are of limited value. Application of small interfering RNA (siRNA) in knockdown of gene expression is an emerging technology in antiviral gene therapy. To investigate whether RNA interference (RNAi) can protect against CVB3 infection, we evaluated the effects of RNAi on viral replication in HeLa cells and murine cardiomyocytes by using five CVB3-specific siRNAs targeting distinct regions of the viral genome. The most effective one is siRNA-4, targeting the viral protease 2A, achieving a 92% inhibition of CVB3 replication. The specific RNAi effects could last at least 48 h, and cell viability assay revealed that 90% of siRNA-4-pretreated cells were still alive and lacked detectable viral protein expression 48 h postinfection. Moreover, administration of siRNAs after viral infection could also effectively inhibit viral replication, indicating its therapeutic potential. Further evaluation by combination found that no enhanced inhibitory effects were observed when siRNA-4 was cotransfected with each of the other four candidates. In mutational analysis of the mechanisms of siRNA action, we found that siRNA functions by targeting the positive strand of virus and requires a perfect sequence match in the central region of the target, but mismatches were more tolerated near the 3' end than the 5' end of the antisense strand. These findings reveal an effective target for CVB3 silencing and provide a new possibility for antiviral intervention.
Lin, Dan; Gong, Xiu-li; Li, Wei; Guo, Xin-bing; Zhu, Yi-wen; Huang, Ying
2008-02-01
To establish a highly sensitive and specific dual-color fluorescence in situ hybridization (D-FISH) method used for chromosomal localization of foreign genes in double transgenic mice. Two strains of double transgenic mice were used in this experiment, one was integrated with the herpes simplex virus thymidine kinase (HSV-tk) and the enhanced green fluorescence protein (eGFP), the other was with the short hairpin RNA interference(RNAi) and beta(654). Splenic cells cultured in vitro were arrested in metaphase by colchicine and hybridized with digoxigenin-labeled and biotinylated DNA probes, then detected by rhodamine-conjugated avidin and FITC-conjugated anti-digoxigenin. Dual-color fluorescence signals were detected on the same metaphase in both transgenic mice strains. In HSV-tk/eGFP double transgenic mice, strong green fluorescence for HSV-tk and red for eGFP were observed and localized at 2E5-G3 and 8A2-A4 respectively. In beta(654)/RNAi mice, beta(654) was detected as red fluorescence on chromosome 7D3-E2, and RNAi showed random integration on chromosomes. It was detected as green fluorescence on chromosome 12B1 in one mouse, while on 1E2.3-1F and 3A3 in the other. Highly sensitive and specific D-FISH method was established using the self-prepared DNA probes, and chromosomal localization of the foreign genes was also performed in combination with G-banding in double transgenic mice. This technology will facilitate the researches in transgenic animals and gene therapy models.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kubo, Takanori, E-mail: kubo-t@yasuda-u.ac.jp; Yanagihara, Kazuyoshi; Division of Genetics, National Cancer Center Research Institute, 5-1-1 Tsukiji, Chuo-ku, Tokyo 104-0045
2012-10-05
Highlights: Black-Right-Pointing-Pointer SiRNAs conjugated with aromatic compounds (Ar-siRNAs) at 5 Prime -sense strand were synthesized. Black-Right-Pointing-Pointer Ar-siRNAs increased resistance against nuclease degradation. Black-Right-Pointing-Pointer Ar-siRNAs were thermodynamically stable compared with the unmodified siRNA. Black-Right-Pointing-Pointer High levels of cellular uptake and cytoplasmic localization were found. Black-Right-Pointing-Pointer Strong gene-silencing efficacy was exhibited in the Ar-siRNAs. -- Abstract: Short interference RNA (siRNA) is a powerful tool for suppressing gene expression in mammalian cells. In this study, we focused on the development of siRNAs conjugated with aromatic compounds in order to improve the potency of RNAi and thus to overcome several problems with siRNAs, suchmore » as cellular delivery and nuclease stability. The siRNAs conjugated with phenyl, hydroxyphenyl, naphthyl, and pyrenyl derivatives showed strong resistance to nuclease degradation, and were thermodynamically stable compared with unmodified siRNA. A high level of membrane permeability in HeLa cells was also observed. Moreover, these siRNAs exhibited enhanced RNAi efficacy, which exceeded that of locked nucleic acid (LNA)-modified siRNAs, against exogenous Renilla luciferase in HeLa cells. In particular, abundant cytoplasmic localization and strong gene-silencing efficacy were found in the siRNAs conjugated with phenyl and hydroxyphenyl derivatives. The novel siRNAs conjugated with aromatic compounds are promising candidates for a new generation of modified siRNAs that can solve many of the problems associated with RNAi technology.« less
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
The insect ecdysone receptor is a good potential target for RNAi-based pest control.
Yu, Rong; Xu, Xinping; Liang, Yongkang; Tian, Honggang; Pan, Zhanqing; Jin, Shouheng; Wang, Na; Zhang, Wenqing
2014-01-01
RNA interference (RNAi) has great potential for use in insect pest control. However, some significant challenges must be overcome before RNAi-based pest control can become a reality. One challenge is the proper selection of a good target gene for RNAi. Here, we report that the insect ecdysone receptor (EcR) is a good potential target for RNAi-based pest control in the brown planthopper Nilaparvata lugens, a serious insect pest of rice plants. We demonstrated that the use of a 360 bp fragment (NlEcR-c) that is common between NlEcR-A and NlEcR-B for feeding RNAi experiments significantly decreased the relative mRNA expression levels of NlEcR compared with those in the dsGFP control. Feeding RNAi also resulted in a significant reduction in the number of offspring per pair of N. lugens. Consequently, a transgenic rice line expressing NlEcR dsRNA was constructed by Agrobacterium- mediated transformation. The results of qRT-PCR showed that the total copy number of the target gene in all transgenic rice lines was 2. Northern blot analysis showed that the small RNA of the hairpin dsNlEcR-c was successfully expressed in the transgenic rice lines. After newly hatched nymphs of N. lugens fed on the transgenic rice lines, effective RNAi was observed. The NlEcR expression levels in all lines examined were decreased significantly compared with the control. In all lines, the survival rate of the nymphs was nearly 90%, and the average number of offspring per pair in the treated groups was significantly less than that observed in the control, with a decrease of 44.18-66.27%. These findings support an RNAi-based pest control strategy and are also important for the management of rice insect pests.
Hodgetts, Ross
2004-12-01
RNA interference might have evolved to minimize the deleterious impact of transposable elements and viruses on eukaryotic genomes, because mutations in genes within the RNAi pathway cause mobilization of transposons in nematodes and flies. Although the first examples of RNAi involved post-transcriptional gene silencing, recently the pathway has been shown to act at the transcriptional level. It does so by establishing a chromatin configuration on the target DNA that has many of the hallmarks of heterochromatin, thus preventing its transcription. Members of dispersed, repeated sequence families appear to have been utilized by the RNAi machinery to regulate nearby genes in yeast. The unusual genomic distribution of three repeated element families in the chicken, fruit-fly and nematode genomes prompts speculation that some of these repeats have been co-opted to control gene expression, either locally or over extended chromosomal domains.
Progress Toward In Vivo Use of siRNAs-II
Rettig, Garrett R; Behlke, Mark A
2012-01-01
RNA interference (RNAi) has been extensively employed for in vivo research since its use was first demonstrated in mammalian cells 10 years ago. Design rules have improved, and it is now routinely possible to obtain reagents that suppress expression of any gene desired. At the same time, increased understanding of the molecular basis of unwanted side effects has led to the development of chemical modification strategies that mitigate these concerns. Delivery remains the single greatest hurdle to widespread adoption of in vivo RNAi methods. However, exciting advances have been made and new delivery systems under development may help to overcome these barriers. This review discusses advances in RNAi biochemistry and biology that impact in vivo use and provides an overview of select publications that demonstrate interesting applications of these principles. Emphasis is placed on work with synthetic, small interfering RNAs (siRNAs) published since the first installment of this review which appeared in 2006. PMID:22186795
Zhang, Jiang; Khan, Sher Afzal; Hasse, Claudia; Ruf, Stephanie; Heckel, David G; Bock, Ralph
2015-02-27
Double-stranded RNAs (dsRNAs) targeted against essential genes can trigger a lethal RNA interference (RNAi) response in insect pests. The application of this concept in plant protection is hampered by the presence of an endogenous plant RNAi pathway that processes dsRNAs into short interfering RNAs. We found that long dsRNAs can be stably produced in chloroplasts, a cellular compartment that appears to lack an RNAi machinery. When expressed from the chloroplast genome, dsRNAs accumulated to as much as 0.4% of the total cellular RNA. Transplastomic potato plants producing dsRNAs targeted against the β-actin gene of the Colorado potato beetle, a notorious agricultural pest, were protected from herbivory and were lethal to its larvae. Thus, chloroplast expression of long dsRNAs can provide crop protection without chemical pesticides. Copyright © 2015, American Association for the Advancement of Science.
Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes
Kim, Kevin; Lee, Young Sik; Carthew, Richard W.
2007-01-01
In the Drosophila RNA interference (RNAi) pathway, small interfering RNAs (siRNAs) direct Argonaute2 (Ago2), an endonuclease, within the RNA-induced silencing complex (RISC) to cleave complementary mRNA targets. In vitro studies have shown that, for each siRNA duplex, RISC retains only one strand, the guide, and releases the other, the passenger, to form a holo-RISC complex. Here, we have isolated a new Ago2 mutant allele and provide, for the first time, in vivo evidence that endogenous Ago2 slicer activity is important to mount an RNAi response in Drosophila. We demonstrate in vivo that efficient removal of the passenger strand from RISC requires the cleavage activity of Ago2. We have also identified a new intermediate complex in the RISC assembly pathway, pre-RISC, in which Ago2 is stably bound to double-stranded siRNA. PMID:17123955
MicroRNAs as mediators of insect host-pathogen interactions and immunity.
Hussain, Mazhar; Asgari, Sassan
2014-11-01
Insects are the most successful group of animals on earth, owing this partly to their very effective immune responses to microbial invasion. These responses mainly include cellular and humoral responses as well as RNA interference (RNAi). Small non-coding RNAs (snRNAs) produced through RNAi are important molecules in the regulation of gene expression in almost all living organisms; contributing to important processes such as development, differentiation, immunity as well as host-microorganism interactions. The main snRNAs produced by the RNAi response include short interfering RNAs, microRNAs and piwi-interacting RNAs. In addition to the host snRNAs, some microorganisms encode snRNAs that affect the dynamics of host-pathogen interactions. In this review, we will discuss the latest developments in regards to the role of microRNA in insect host-pathogen interactions and provide some insights into this rapidly developing area of research. Copyright © 2014 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The reniform nematode, Rotylenchulus reniformis Linford & Oliveira, is a sedentary semi-endoparasitic roundworm that infects the roots of many economically important plant species. Engineered resistance to plant-parasitic nematodes (PPNs) via RNA-interference (RNAi) has shown promise in providing h...
Hamada, Aska; Miyawaki, Katsuyuki; Honda-sumi, Eri; Tomioka, Kenji; Mito, Taro; Ohuchi, Hideyo; Noji, Sumihare
2009-08-01
In order to explore a possibility that the cricket Gryllus bimaculatus would be a useful model to unveil molecular mechanisms of human diseases, we performed loss-of-function analyses of Gryllus genes homologous to human genes that are responsible for human disorders, fragile X mental retardation 1 (fmr1) and Dopamine receptor (DopR). We cloned cDNAs of their Gryllus homologues, Gb'fmr1, Gb'DopRI, and Gb'DopRII, and analyzed their functions with use of nymphal RNA interference (RNAi). For Gb'fmr1, three major phenotypes were observed: (1) abnormal wing postures, (2) abnormal calling song, and (3) loss of the circadian locomotor rhythm, while for Gb'DopRI, defects of wing posture and morphology were found. These results indicate that the cricket has the potential to become a novel model system to explore human neuronal pathogenic mechanisms and to screen therapeutic drugs by RNAi. Copyright (c) 2009 Wiley-Liss, Inc.
Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini
2014-06-19
The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.
Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad
2009-01-01
RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nicolas, Francisco E.; Vila, Ana; Moxon, Simon
Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less
Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...
2015-03-25
Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential and stationary growth phases and opens up an important avenue for in-depth study of genes involved in the regulation of physiological and developmental processes in this fungal model.« less
O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T
2005-01-01
Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR pathway components were qualified as targets for inhibition of AP-1 activation using RNAi and small molecule inhibitors. The combination of these two targeted agents was shown to increase the efficacy of EGFR and MEK-1 kinase inhibitors, leading to possible implications for overcoming or preventing drug resistance, lowering effective drug doses, and providing new strategies for interrogating cellular signalling pathways. PMID:16202132
Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA
USDA-ARS?s Scientific Manuscript database
Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...
Chen, Weizao; Liu, Mingqiu; Jiao, Ye; Yan, Weiyao; Wei, Xuefeng; Chen, Jiulian; Fei, Liang; Liu, Yang; Zuo, Xiaoping; Yang, Fugui; Lu, Yonggan; Zheng, Zhaoxin
2006-04-01
Foot-and-mouth disease virus (FMDV) infection is responsible for the heavy economic losses in stockbreeding each year. Because of the limited effectiveness of existing vaccines and antiviral drugs, the development of new strategies is needed. RNA interference (RNAi) is an effective means of suppressing virus replication in vitro. Here we demonstrate that treatment with recombinant, replication-defective human adenovirus type 5 (Ad5) expressing short-hairpin RNAs (shRNAs) directed against either structural protein 1D (Ad5-NT21) or polymerase 3D (Ad5-POL) of FMDV totally protects swine IBRS-2 cells from homologous FMDV infection, whereas only Ad5-POL inhibits heterologous FMDV replication. Moreover, delivery of these shRNAs significantly reduces the susceptibility of guinea pigs and swine to FMDV infection. Three of five guinea pigs inoculated with 10(6) PFU of Ad5-POL and challenged 24 h later with 50 50% infectious doses (ID50) of homologous virus were protected from the major clinical manifestation of disease: the appearance of vesicles on the feet. Two of three swine inoculated with an Ad5-NT21-Ad5-POL mixture containing 2 x 10(9) PFU each and challenged 24 h later with 100 ID50 of homologous virus were protected from the major clinical disease, but treatment with a higher dose of adenovirus mixture cannot promote protection of animals. The inhibition was rapid and specific because treatment with a control adenovirus construct (Ad5-LacZ) expressing Escherichia coli galactosidase-specific shRNA showed no marked antiviral activity. Our data highlight the in vivo potential of RNAi technology in the case of FMD.
Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.
2015-01-01
Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102
Paudel, Jamuna Risal; Davidson, Charlotte; Song, Jun; Maxim, Itkin; Aharoni, Asaph; Tai, Helen H
2017-11-01
Steroidal glycoalkaloids (SGAs) are major secondary metabolites constitutively produced in cultivated potato Solanum tuberosum, and α-solanine and α-chaconine are the most abundant SGAs. SGAs are toxic to humans at high levels but their role in plant protection against pests and pathogens is yet to be established. In this study, levels of SGAs in potato were reduced by RNA interference (RNAi)-mediated silencing of GLYCOALKALOID METABOLISM 4 (GAME4)-a gene encoding cytochrome P450, involved in an oxidation step in the conversion of cholesterol to SGA aglycones. Two GAME4 RNAi lines, T8 and T9, were used to investigate the effects of manipulation of the SGA biosynthetic pathway in potato. Growth and development of an insect pest, Colorado potato beetle (CPB), were affected in these lines. While no effect on CPB leaf consumption or weight gain was observed, early instar larval death and accelerated development of the insect was found while feeding on leaves of GAME4 RNAi lines. Modulation of SGA biosynthetic pathway in GAME4 RNAi plants was associated with a larger alteration to the metabolite profile, including increased levels of one or both the steroidal saponins or phytoecdysteroids, which could affect insect mortality as well as development time. Colonization by Verticillium dahliae on GAME4 RNAi plants was also tested. There were increased pathogen levels in the T8 GAME4 RNAi line but not in the T9. Metabolite differences between T8 and T9 were found and may have contributed to differences in V. dahliae infection. Drought responses created by osmotic stress were not affected by modulation of SGA biosynthetic pathway in potato.
He, Hongbin; Ding, Fangrong; Yang, Hongjun; Cheng, Lei; Liu, Wenhao; Zhong, Jifeng; Dai, Yunping; Li, Guangpeng; He, Chengqiang; Yu, Li; Li, Jianbin
2012-01-01
Background Although it is known that RNA interference (RNAi) targeting viral genes protects experimental animals, such as mice, from the challenge of Foot-and-mouth disease virus (FMDV), it has not been previously investigated whether shRNAs targeting FMDV in transgenic dairy cattle or primary transgenic bovine epithelium cells will confer resistance against FMDV challenge. Principal Finding Here we constructed three recombinant lentiviral vectors containing shRNA against VP2 (RNAi-VP2), VP3 (RNAi-VP3), or VP4 (RNAi-VP4) of FMDV, and found that all of them strongly suppressed the transient expression of a FLAG-tagged viral gene fusion protein in 293T cells. In BHK-21 cells, RNAi-VP4 was found to be more potent in inhibition of viral replication than the others with over 98% inhibition of viral replication. Therefore, recombinant lentiviral vector RNAi-VP4 was transfected into bovine fetal fibroblast cells to generate transgenic nuclear donor cells. With subsequent somatic cell cloning, we generated forty transgenic blastocysts, and then transferred them to 20 synchronized recipient cows. Three transgenic bovine fetuses were obtained after pregnant period of 4 months, and integration into chromosome in cloned fetuses was confirmed by Southern hybridization. The primary tongue epithelium cells of transgenic fetuses were isolated and inoculated with 100 TCID50 of FMDV, and it was observed that shRNA significantly suppressed viral RNA synthesis and inhibited over 91% of viral replication after inoculation of FMDV for 48 h. Conclusion RNAi-VP4 targeting viral VP4 gene appears to prevent primary epithelium cells of transgenic bovine fetus from FMDV infection, and it could be a candidate shRNA used for cultivation of transgenic cattle against FMDV. PMID:22905125
Two distinct roles of the yorkie/yap gene during homeostasis in the planarian Dugesia japonica.
Hwang, Byulnim; An, Yang; Agata, Kiyokazu; Umesono, Yoshihiko
2015-04-01
Adult planarians possess somatic pluripotent stem cells called neoblasts that give rise to all missing cell types during regeneration and homeostasis. Recent studies revealed that the Yorkie (Yki)/Yes-associated protein (YAP) transcriptional coactivator family plays an important role in the regulation of tissue growth during development and regeneration, and therefore we investigated the role of a planarian yki-related gene (termed Djyki) during regeneration and homeostasis of the freshwater planarian Dugesia japonica. We found that knockdown of the function of Djyki by RNA interference (RNAi) downregulated neoblast proliferation and caused regeneration defects after amputation. In addition, Djyki RNAi caused edema during homeostasis. These seemingly distinct defects induced by Djyki RNAi were rescued by simultaneous RNAi of a planarian mats-related gene (termed Djmats), suggesting an important role of Djmats in the negative regulation of Djyki, in accordance with the conservation of the functional relationship of these two genes during the course of evolution. Interestingly, Djyki RNAi did not prevent normal protonephridial structure, suggesting that Djyki RNAi induced the edema phenotype without affecting the excretory system. Further analyses revealed that increased expression of the D. japonica gene DjaquaporinA (DjaqpA), which belongs to a large gene family that encodes a water channel protein for the regulation of transcellular water flow, promoted the induction of edema, but not defects in neoblast dynamics, in Djyki(RNAi) animals. Thus, we conclude that Djyki plays two distinct roles in the regulation of active proliferation of stem cells and in osmotic water transport across the body surface in D. japonica. © 2015 The Authors Development, Growth & Differentiation published by Wiley Publishing Asia Pty Ltd on behalf of Japanese Society of Developmental Biologists.
Silencing honey bee naked cuticle (nkd) reduces Nosema ceranae replication and disease levels
USDA-ARS?s Scientific Manuscript database
Nosema ceranae is a new and emerging microsporidian parasite of European honey bees, Apis mellifera that has been implicated in alarming colony losses worldwide. RNA interference (RNAi), a post-transcriptional gene silencing mechanism, has emerged as a potent and specific strategy for controlling in...
Dietary risk assessment of v-ATPase A dsRNAs on monarch butterfly larvae
USDA-ARS?s Scientific Manuscript database
The goal of this study is to assess the risks of RNA interference (RNAi)-based genetically engineered crops on a non-target arthropod, monarch butterfly, Danaus plexippus. We hypothesize that an insecticidal double-stranded (ds) RNA targeting western corn rootworm, Diabrotica virgifera virgifera, ha...
In this study RNA interference (RNAi) screens were performed on 285 cell lines and combined with 216 lines previously screened, which were then analyzed together with DEMETER to discover genetic dependencies across the entire pool of cell lines. Read the abstract
USDA-ARS?s Scientific Manuscript database
Aflatoxin contamination is a major constraint in the food production worlwide. In peanut these aflatoxins are mainly produced by Aspergillus flavus (Link) and A. parasiticus (Speare). The use of RNA interference (RNAi) is a promising method to reduce or prevent the accumulation of aflatoxin in pean...
2010-01-01
Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH) prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs) enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA) protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi) to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the expression profiles of members of the anhydrobiotic gene set in A. avenae. It also demonstrates the potential of RNAi for the analysis of anhydrobiosis and provides the first genetic data to underline the importance of effective antioxidant systems in metazoan desiccation tolerance. PMID:20085654
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-09-03
Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management.
Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef
2017-02-01
The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.
Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun
2015-01-01
Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management. PMID:26333918
Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk
2013-01-01
As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077
Chen, C; Li, H; Zhou, X; Wong, S T C
2008-05-01
Image-based, high throughput genome-wide RNA interference (RNAi) experiments are increasingly carried out to facilitate the understanding of gene functions in intricate biological processes. Automated screening of such experiments generates a large number of images with great variations in image quality, which makes manual analysis unreasonably time-consuming. Therefore, effective techniques for automatic image analysis are urgently needed, in which segmentation is one of the most important steps. This paper proposes a fully automatic method for cells segmentation in genome-wide RNAi screening images. The method consists of two steps: nuclei and cytoplasm segmentation. Nuclei are extracted and labelled to initialize cytoplasm segmentation. Since the quality of RNAi image is rather poor, a novel scale-adaptive steerable filter is designed to enhance the image in order to extract long and thin protrusions on the spiky cells. Then, constraint factor GCBAC method and morphological algorithms are combined to be an integrated method to segment tight clustered cells. Compared with the results obtained by using seeded watershed and the ground truth, that is, manual labelling results by experts in RNAi screening data, our method achieves higher accuracy. Compared with active contour methods, our method consumes much less time. The positive results indicate that the proposed method can be applied in automatic image analysis of multi-channel image screening data.
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4
Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503
Gillet, François-Xavier; Garcia, Rayssa A.; Macedo, Leonardo L. P.; Albuquerque, Erika V. S.; Silva, Maria C. M.; Grossi-de-Sa, Maria F.
2017-01-01
Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil (Anthonomus grandis), we showed that the chimeric protein PTD-DRBD (peptide transduction domain—dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests. PMID:28503153
Gillet, François-Xavier; Garcia, Rayssa A; Macedo, Leonardo L P; Albuquerque, Erika V S; Silva, Maria C M; Grossi-de-Sa, Maria F
2017-01-01
Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil ( Anthonomus grandis ), we showed that the chimeric protein PTD-DRBD (peptide transduction domain-dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests.
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-11-04
The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.
viRome: an R package for the visualization and analysis of viral small RNA sequence datasets.
Watson, Mick; Schnettler, Esther; Kohl, Alain
2013-08-01
RNA interference (RNAi) is known to play an important part in defence against viruses in a range of species. Second-generation sequencing technologies allow us to assay these systems and the small RNAs that play a key role with unprecedented depth. However, scientists need access to tools that can condense, analyse and display the resulting data. Here, we present viRome, a package for R that takes aligned sequence data and produces a range of essential plots and reports. viRome is released under the BSD license as a package for R available for both Windows and Linux http://virome.sf.net. Additional information and a tutorial is available on the ARK-Genomics website: http://www.ark-genomics.org/bioinformatics/virome. mick.watson@roslin.ed.ac.uk.
EMMPRIN in gynecologic cancers: pathologic and therapeutic aspects.
Liu, Dan-tong
2015-07-01
The highly glycosylated transmembrane protein extracellular matrix metalloproteinase inducer (EMMPRIN) is associated with several pathological conditions, including various types of cancers. In different gynecological malignancies, such as ovarian, cervical, and endometrial cancers, EMMPRIN plays significant roles in cell adhesion modulation, tumor growth, invasion, angiogenesis, and metastasis by inducing the production of various molecules, including matrix metalloproteinases and vascular endothelial growth factor. Because of its high level of expression, EMMPRIN can possibly be used as a diagnostic marker of gynecological cancers. Recent studies have showed that targeting EMMPRIN, especially by RNA interference (RNAi) technology, has promising therapeutic potential in basic research on gynecological cancer treatments, which make a platform for the future clinical success. This review study focused on the association of EMMPRIN in gynecological cancers in the perspectives of pathogenesis, diagnosis, and therapeutics.
Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs
Lucchino, Marco
2018-01-01
RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296
Ifuku, Kentaro; Ikeda, Ken-ichi; Inoue, Kanako Ikeda; Park, Pyoyun; Tamoi, Masahiro; Inoue, Hironori; Sakamoto, Katsuhiko; Saito, Ryota
2016-01-01
Lipid-derived reactive carbonyl species (RCS) possess electrophilic moieties and cause oxidative stress by reacting with cellular components. Arabidopsis (Arabidopsis thaliana) has a chloroplast-localized alkenal/one oxidoreductase (AtAOR) for the detoxification of lipid-derived RCS, especially α,β-unsaturated carbonyls. In this study, we aimed to evaluate the physiological importance of AtAOR and analyzed AtAOR (aor) mutants, including a transfer DNA knockout, aor (T-DNA), and RNA interference knockdown, aor (RNAi), lines. We found that both aor mutants showed smaller plant sizes than wild-type plants when they were grown under day/night cycle conditions. To elucidate the cause of the aor mutant phenotype, we analyzed the photosynthetic rate and the respiration rate by gas-exchange analysis. Subsequently, we found that both wild-type and aor (RNAi) plants showed similar CO2 assimilation rates; however, the respiration rate was lower in aor (RNAi) than in wild-type plants. Furthermore, we revealed that phosphoenolpyruvate carboxylase activity decreased and starch degradation during the night was suppressed in aor (RNAi). In contrast, the phenotype of aor (RNAi) was rescued when aor (RNAi) plants were grown under constant light conditions. These results indicate that the smaller plant sizes observed in aor mutants grown under day/night cycle conditions were attributable to the decrease in carbon utilization during the night. Here, we propose that the detoxification of lipid-derived RCS by AtAOR in chloroplasts contributes to the protection of dark respiration and supports plant growth during the night. PMID:26884484
Takagi, Daisuke; Ifuku, Kentaro; Ikeda, Ken-Ichi; Inoue, Kanako Ikeda; Park, Pyoyun; Tamoi, Masahiro; Inoue, Hironori; Sakamoto, Katsuhiko; Saito, Ryota; Miyake, Chikahiro
2016-04-01
Lipid-derived reactive carbonyl species (RCS) possess electrophilic moieties and cause oxidative stress by reacting with cellular components. Arabidopsis (Arabidopsis thaliana) has a chloroplast-localized alkenal/one oxidoreductase (AtAOR) for the detoxification of lipid-derived RCS, especially α,β-unsaturated carbonyls. In this study, we aimed to evaluate the physiological importance of AtAOR and analyzed AtAOR (aor) mutants, including a transfer DNA knockout, aor (T-DNA), and RNA interference knockdown, aor (RNAi), lines. We found that both aor mutants showed smaller plant sizes than wild-type plants when they were grown under day/night cycle conditions. To elucidate the cause of the aor mutant phenotype, we analyzed the photosynthetic rate and the respiration rate by gas-exchange analysis. Subsequently, we found that both wild-type and aor (RNAi) plants showed similar CO2 assimilation rates; however, the respiration rate was lower in aor (RNAi) than in wild-type plants. Furthermore, we revealed that phosphoenolpyruvate carboxylase activity decreased and starch degradation during the night was suppressed in aor (RNAi). In contrast, the phenotype of aor (RNAi) was rescued when aor (RNAi) plants were grown under constant light conditions. These results indicate that the smaller plant sizes observed in aor mutants grown under day/night cycle conditions were attributable to the decrease in carbon utilization during the night. Here, we propose that the detoxification of lipid-derived RCS by AtAOR in chloroplasts contributes to the protection of dark respiration and supports plant growth during the night. © 2016 American Society of Plant Biologists. All Rights Reserved.
Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin
2015-09-01
Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.
Chen, Y; Redinbaugh, M G; Michel, A P
2015-06-01
Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.
Characterization of viral siRNA populations in honey bee colony collapse disorder.
Chejanovsky, Nor; Ophir, Ron; Schwager, Michal Sharabi; Slabezki, Yossi; Grossman, Smadar; Cox-Foster, Diana
2014-04-01
Colony Collapse Disorder (CCD), a special case of collapse of honey bee colonies, has resulted in significant losses for beekeepers. CCD-colonies show abundance of pathogens which suggests that they have a weakened immune system. Since honey bee viruses are major players in colony collapse and given the important role of viral RNA interference (RNAi) in combating viral infections we investigated if CCD-colonies elicit an RNAi response. Deep-sequencing analysis of samples from CCD-colonies from US and Israel revealed abundant small interfering RNAs (siRNA) of 21-22 nucleotides perfectly matching the Israeli acute paralysis virus (IAPV), Kashmir virus and Deformed wing virus genomes. Israeli colonies showed high titers of IAPV and a conserved RNAi-pattern of matching the viral genome. That was also observed in sample analysis from colonies experimentally infected with IAPV. Our results suggest that CCD-colonies set out a siRNA response that is specific against predominant viruses associated with colony losses. Copyright © 2014 Elsevier Inc. All rights reserved.
RNAi pathways in Mucor: A tale of proteins, small RNAs and functional diversity.
Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M
2016-05-01
The existence of an RNA-mediated silencing mechanism in the opportunistic fungal pathogen Mucor circinelloides was first described in the early 2000. Since then, Mucor has reached an outstanding position within the fungal kingdom as a model system to achieve a deeper understanding of regulation of endogenous functions by the RNA interference (RNAi) machinery. M. circinelloides combines diverse components of its RNAi machinery to carry out functions not only limited to the defense against invasive nucleic acids, but also to regulate expression of its own genes by producing different classes of endogenous small RNA molecules (esRNAs). The recent discovery of a novel RNase that participates in a new RNA degradation pathway adds more elements to the gene silencing-mediated regulation. This review focuses on esRNAs in M. circinelloides, the different pathways involved in their biogenesis, and their roles in regulating specific physiological and developmental processes in response to environmental signals, highlighting the complexity of silencing-mediated regulation in fungi. Copyright © 2015 Elsevier Inc. All rights reserved.
A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter
Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang
2009-01-01
RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553
The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo
Meerbrey, Kristen L.; Hu, Guang; Kessler, Jessica D.; Roarty, Kevin; Fang, Justin E.; Herschkowitz, Jason I.; Burrows, Anna E.; Ciccia, Alberto; Sun, Tingting; Schmitt, Earlene M.; Bernardi, Ronald J.; Fu, Xiaoyong; Bland, Christopher S.; Cooper, Thomas A.; Schiff, Rachel; Rosen, Jeffrey M.; Westbrook, Thomas F.; Elledge, Stephen J.
2011-01-01
The discovery of RNAi has revolutionized loss-of-function genetic studies in mammalian systems. However, significant challenges still remain to fully exploit RNAi for mammalian genetics. For instance, genetic screens and in vivo studies could be broadly improved by methods that allow inducible and uniform gene expression control. To achieve this, we built the lentiviral pINDUCER series of expression vehicles for inducible RNAi in vivo. Using a multicistronic design, pINDUCER vehicles enable tracking of viral transduction and shRNA or cDNA induction in a broad spectrum of mammalian cell types in vivo. They achieve this uniform temporal, dose-dependent, and reversible control of gene expression across heterogenous cell populations via fluorescence-based quantification of reverse tet-transactivator expression. This feature allows isolation of cell populations that exhibit a potent, inducible target knockdown in vitro and in vivo that can be used in human xenotransplantation models to examine cancer drug targets. PMID:21307310
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
New insights into siRNA amplification and RNAi.
Zhang, Chi; Ruvkun, Gary
2012-08-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.
[Components and assembly of RNA-induced silencing complex].
Song, Xue-Mei; Yan, Fei; Du, Li-Xin
2006-06-01
Degradation of homologous RNA in RNA interference is carried out by functional RNA-induced silencing complex (RISC). RISC contains Dicer, Argonaute proein, siRNA and other components. Researching structures and functions of these components is primary important for understanding assembly and functional mechanism of RISC, as well as the whole RNAi pathway. Recent research works showed that Dicer, containing RNaseIII domain, is responsible for production of siRNA at the beginning of RNAi, and guarantees the stability of RISC intermediate in assembly process. As the core component of RISC, Argonaute protein functions as slicer to cleave target RNA and offers the binding site of siRNA in RISC assembly, which are depended on PIWI domain and PAZ domain separately. Although there is only one strand of siRNA that is the guider of RISC, the double stranded structural character of siRNA is determinant of RNAi. Except those, there are still other components with unknown functions in RISC. The knowledge about RISC components and assembly now, is basis of a presumed RISC assembly model.
Shukla, Jayendra Nath; Palli, Subba Reddy
2012-01-01
Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109
Plant-specific multisubunit RNA polymerase in gene silencing.
Lahmy, Sylvie; Bies-Etheve, Natacha; Lagrange, Thierry
2010-01-01
In recent years, a major breakthrough in the study of epigenetic silencing in eukaryotes came with the discovery that the RNA-interference pathway (RNAi) is generally implicated in heterochromatin assembly and gene silencing. An important and paradoxical feature of the RNAi-mediated heterochromatin pathways is their requirement for some form of transcription. In fission yeast, Schizosaccharomyces pombe, centromeric siRNAs have been shown to derive from chromatin-bound nascent transcripts produced by RNA polymerase II (PolII) at the site of heterochromatin formation. Likewise, chromatin-bound nascent transcripts generated by a PolII-related DNA-dependent RNA polymerase, known as PolIVb/PolV, have recently been implicated in RNA-directed DNA methylation (RdDM), the prominent RNAi-mediated chromatin pathway in plants. In this review we discuss recent work on the plant-specific PolII variant enzymes and discuss the mechanistic convergences that have been observed in the role of these enzymes in their respective siRNA-mediated heterochromatin formation pathways.
16D10 siRNAs inhibit root-knot nematode infection in transgenic grape hairy roots
USDA-ARS?s Scientific Manuscript database
To develop a biotech-based solution for controlling Root-knot nematodes (RKNs) in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector gene, 16D10, for nematode resistance in transgenic grape hairy roots. Two hairpin-based silencing constru...
There is evidence that specificity protein 1 (Sp1) transcription factor (TF) regulates expression of long non-coding RNAs (lncRNAs) in hepatocellular carcinoma (HCC) cells. RNA interference (RNAi) studies showed that among several lncRNAs expressed in HepG2, SNU-449 and SK-Hep-1...
Misra, Ashish; Green, Michael R
2017-01-01
Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma
Xie, Yuran; Merkel, Olivia M
2015-01-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues has limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases and costimulatory factors that have been reported as targets of siRNA mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages and dendritic cells, which could potentially be applied in asthma therapy. PMID:26148454
Constitutive Expression of Short Hairpin RNA in Vivo Triggers Buildup of Mature Hairpin Molecules
Ahn, M.; Witting, S.R.; Ruiz, R.; Saxena, R.
2011-01-01
Abstract RNA interference (RNAi) has become the cornerstone technology for studying gene function in mammalian cells. In addition, it is a promising therapeutic treatment for multiple human diseases. Virus-mediated constitutive expression of short hairpin RNA (shRNA) has the potential to provide a permanent source of silencing molecules to tissues, and it is being devised as a strategy for the treatment of liver conditions such as hepatitis B and hepatitis C virus infection. Unintended interaction between silencing molecules and cellular components, leading to toxic effects, has been described in vitro. Despite the enormous interest in using the RNAi technology for in vivo applications, little is known about the safety of constitutively expressing shRNA for multiple weeks. Here we report the effects of in vivo shRNA expression, using helper-dependent adenoviral vectors. We show that gene-specific knockdown is maintained for at least 6 weeks after injection of 1 × 1011 viral particles. Nonetheless, accumulation of mature shRNA molecules was observed up to weeks 3 and 4, and then declined gradually, suggesting the buildup of mature shRNA molecules induced cell death with concomitant loss of viral DNA and shRNA expression. No evidence of well-characterized innate immunity activation (such as interferon production) or saturation of the exportin-5 pathway was observed. Overall, our data suggest constitutive expression of shRNA results in accumulation of mature shRNA molecules, inducing cellular toxicity at late time points, despite the presence of gene silencing. PMID:21780944
2010-01-01
Background Delivery of small interfering RNA (siRNA) to tumours remains a major obstacle for the development of RNA interference (RNAi)-based therapeutics. Following the promising pre-clinical and clinical results with the oncolytic herpes simplex virus (HSV) OncoVEXGM-CSF, we aimed to express RNAi triggers from oncolytic HSV, which although has the potential to improve treatment by silencing tumour-related genes, was not considered possible due to the highly oncolytic properties of HSV. Methods To evaluate RNAi-mediated silencing from an oncolytic HSV backbone, we developed novel replicating HSV vectors expressing short-hairpin RNA (shRNA) or artificial microRNA (miRNA) against the reporter genes green fluorescent protein (eGFP) and β-galactosidase (lacZ). These vectors were tested in non-tumour cell lines in vitro and tumour cells that are moderately susceptible to HSV infection both in vitro and in mice xenografts in vivo. Silencing was assessed at the protein level by fluorescent microscopy, x-gal staining, enzyme activity assay, and western blotting. Results Our results demonstrate that it is possible to express shRNA and artificial miRNA from an oncolytic HSV backbone, which had not been previously investigated. Furthermore, oncolytic HSV-mediated delivery of RNAi triggers resulted in effective and specific silencing of targeted genes in tumour cells in vitro and tumours in vivo, with the viruses expressing artificial miRNA being comprehensibly more effective. Conclusions This preliminary data provide the first demonstration of oncolytic HSV-mediated expression of shRNA or artificial miRNA and silencing of targeted genes in tumour cells in vitro and in vivo. The vectors developed in this study are being adapted to silence tumour-related genes in an ongoing study that aims to improve the effectiveness of oncolytic HSV treatment in tumours that are moderately susceptible to HSV infection and thus, potentially improve response rates seen in human clinical trials. PMID:20836854
The interaction of fungi with the environment orchestrated by RNAi.
Villalobos-Escobedo, José Manuel; Herrera-Estrella, Alfredo; Carreras-Villaseñor, Nohemí
2016-01-01
The fungal kingdom has been key in the investigation of the biogenesis and function of small RNAs (sRNAs). The discovery of phenomena such as quelling in Neurospora crassa represents pioneering work in the identification of the main elements of the RNA interference (RNAi) machinery. Recent discoveries in the regulatory mechanisms in some yeast and filamentous fungi are helping us reach a deeper understanding of the transcriptional and post-transcriptional gene-silencing mechanisms involved in genome protection against viral infections, DNA damage and transposon activity. Although most of these mechanisms are reasonably well understood, their role in the physiology, response to the environment and interaction of fungi with other organisms had remained elusive. Nevertheless, studies in fungi such as Mucor circinelloides, Magnaporthe oryzae, Cryptococcus neoformans, Trichoderma atroviride, Botrytis cinerea and others have started to shed light on the relevance of the RNAi pathway. In these fungi gene regulation by RNAi is important for growth, reproduction, control of viral infections and transposon activity, as well as in the development of antibiotic resistance and interactions with their hosts. Moreover, the increasing number of reports of the discovery of microRNA-like RNAs in fungi under different conditions highlights the importance of fungi as models for understanding adaptation to the environment using regulation by sRNAs. The goal of this review is to provide the reader with an up-to-date overview of the importance of RNAi in the interaction of fungi with their environment. © 2016 by The Mycological Society of America.
RNAi: a potential new class of therapeutic for human genetic disease.
Seyhan, Attila A
2011-11-01
Dominant negative genetic disorders, in which a mutant allele of a gene causes disease in the presence of a second, normal copy, have been challenging since there is no cure and treatments are only to alleviate the symptoms. Current therapies involving pharmacological and biological drugs are not suitable to target mutant genes selectively due to structural indifference of the normal variant of their targets from the disease-causing mutant ones. In instances when the target contains single nucleotide polymorphism (SNP), whether it is an enzyme or structural or receptor protein are not ideal for treatment using conventional drugs due to their lack of selectivity. Therefore, there is a need to develop new approaches to accelerate targeting these previously inaccessible targets by classical therapeutics. Although there is a cooling trend by the pharmaceutical industry for the potential of RNA interference (RNAi), RNAi and other RNA targeting drugs (antisense, ribozyme, etc.) still hold their promise as the only drugs that provide an opportunity to target genes with SNP mutations found in dominant negative disorders, genes specific to pathogenic tumor cells, and genes that are critical for mediating the pathology of various other diseases. Because of its exquisite specificity and potency, RNAi has attracted a considerable interest as a new class of therapeutic for genetic diseases including amyotrophic lateral sclerosis, Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), spinocerebellar ataxia, dominant muscular dystrophies, and cancer. In this review, progress and challenges in developing RNAi therapeutics for genetic diseases will be discussed.
Toll immune signal activates cellular immune response via eicosanoids.
Shafeeq, Tahir; Ahmed, Shabbir; Kim, Yonggyun
2018-07-01
Upon immune challenge, insects recognize nonself. The recognition signal will propagate to nearby immune effectors. It is well-known that Toll signal pathway induces antimicrobial peptide (AMP) gene expression. Eicosanoids play crucial roles in mediating the recognition signal to immune effectors by enhancing humoral immune response through activation of AMP synthesis as well as cellular immune responses, suggesting a functional cross-talk between Toll and eicosanoid signals. This study tested a cross-talk between these two signals. Two signal transducing factors (MyD88 and Pelle) of Toll immune pathway were identified in Spodoptera exigua. RNA interference (RNAi) of either SeMyD88 or SePelle expression interfered with the expression of AMP genes under Toll signal pathway. Bacterial challenge induced PLA 2 enzyme activity. However, RNAi of these two immune factors significantly suppressed the induction of PLA 2 enzyme activity. Furthermore, RNAi treatment prevented gene expression of cellular PLA 2 . Inhibition of PLA 2 activity reduced phenoloxidase activity and subsequent suppression in cellular immune response measured by hemocyte nodule formation. However, immunosuppression induced by RNAi of Toll signal molecules was significantly reversed by addition of arachidonic acid (AA), a catalytic product of PLA 2 . The addition also significantly reduced the enhanced fungal susceptibility of S. exigua treated by RNAi against two Toll signal molecules. These results indicate that there is a cross-talk between Toll and eicosanoid signals in insect immunity. Copyright © 2018 Elsevier Ltd. All rights reserved.
Current issues of RNAi therapeutics delivery and development.
Haussecker, D
2014-12-10
12 years following the discovery of the RNAi mechanism in Man, a number of RNAi therapeutics development candidates have emerged with profiles suggesting that they could become drugs of significant medical importance for diseases like TTR amyloidosis, HBV, solid cancers, and hemophilia. Despite this robust progress, the perception of RNAi therapeutics has been on a roller-coaster ride driven not only by science, but also regulatory trends, the stock markets, and Big Pharma business development decisions [1]. This presentation provides an update on the current state of RNAi therapeutics development with a particular focus on what RNAi delivery can achieve today and key challenges to be overcome to expand therapeutic opportunities. The delivery of RNAi triggers to disease-relevant cell types clearly represents the rate-limiting factor in broadly expanding the applicability of RNAi therapeutics. Today, with at least 3 delivery options (lipid nanoparticles/LNPs, GalNAc-siRNA conjugates, Dynamic PolyConjugates/DPCs) for which profound gene knockdowns have been demonstrated in non-human primates and in the clinic, RNAi therapeutics should in principle be able to address most diseases related to gene expression in the liver. Given the central importance of the liver in systemic physiology, this already represents a significant therapeutic and commercial opportunity rivaling that of e.g. monoclonal antibodies. Beyond the liver, there is a reason to believe that current RNAi therapeutics technologies can address a number of solid tumors (e.g. LNPs), diseases of the eye (e.g. self-delivering RNAi triggers) as well as diseases involving the respiratory epithelium (e.g. aerosolized LNPs), certain phagocytic cells (LNPs), hematopoietic stem cells and their progeny (lentiviral DNA-directed RNAi), vascular endothelial cells (cationic lipoplexes), and certain cell types in the kidney (self-delivering RNAi triggers, DPCs; Table 1). Despite this success, there has been a sense that the applications of RNAi therapeutics are rather limited. This is largely based on the observation that the biodistribution of RNAi formulations is typically more limited compared to small molecules and oral administration is not possible with current technologies. Similarly, the utility of a given RNAi formulation is limited to a few cell types and tissues at most and a universal delivery strategy should remain elusive for the foreseeable future. Therefore, to further expand on the therapeutic utility and patient convenience of RNAi, it is important to overcome a number of delivery-related technical and scientific challenges which will be discussed in this presentation. For systemic applications, these include the necessity for extended blood circulation times, vascular escape (probably the most rewarding inquiry currently), tissue penetration, cellular uptake, and escape into the cytoplasm. In terms of safety, it is important that these formulations do not accumulate in the body, do not cause excessive off-targeting due to 'chemical stickiness' (often useful for purposes of biodistribution), and overcome the physical/biological barriers in a controlled manner. The time for realizing the therapeutic potential of RNAi has come. At the same time, it is important to lay the foundations for the next leg of value creation by overcoming the challenges of delivering RNAi to new cell types. Based on results from exploratory research, the renewed interest in RNAi therapeutics and capital infusion, there is a reason to be optimistic that this can be achieved. Copyright © 2014 Elsevier B.V. All rights reserved.
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
Sekihara, Sanae; Shibata, Toshio; Hyakkendani, Mai; Kawabata, Shun-ichiro
2016-01-01
We recently reported that transglutaminase (TG) suppresses immune deficiency pathway-controlled antimicrobial peptides (IMD-AMPs), thereby conferring immune tolerance to gut microbes, and that RNAi of the TG gene in flies decreases the lifespan compared with non-TG-RNAi flies. Here, analysis of the bacterial composition of the Drosophila gut by next-generation sequencing revealed that gut microbiota comprising one dominant genus of Acetobacter in non-TG-RNAi flies was shifted to that comprising two dominant genera of Acetobacter and Providencia in TG-RNAi flies. Four bacterial strains, including Acetobacter persici SK1 and Acetobacter indonesiensis SK2, Lactobacillus pentosus SK3, and Providencia rettgeri SK4, were isolated from the midgut of TG-RNAi flies. SK1 exhibited the highest resistance to the IMD-AMPs Cecropin A1 and Diptericin among the isolated bacteria. In contrast, SK4 exhibited considerably lower resistance against Cecropin A1, whereas SK4 exhibited high resistance to hypochlorous acid. The resistance of strains SK1–4 against IMD-AMPs in in vitro assays could not explain the shift of the microbiota in the gut of TG-RNAi flies. The lifespan was reduced in gnotobiotic flies that ingested both SK4 and SK1, concomitant with the production of reactive oxygen species and apoptosis in the midgut, whereas the survival rate was not altered in gnotobiotic flies that mono-ingested either SK4 or SK1. Interestingly, significant amounts of reactive oxygen species were detected in the midgut of gnotobiotic flies that ingested SK4 and SK2, concomitant with no significant apoptosis in the midgut. In gnotobiotic flies that co-ingested SK4 and SK1, an additional unknown factor(s) may be required to cause midgut apoptosis. PMID:27760824
Frost, Christopher J; Nyamdari, Batbayar; Tsai, Chung-Jui; Harding, Scott A
2012-01-01
The Populus sucrose (Suc) transporter 4 (PtaSUT4), like its orthologs in other plant taxa, is tonoplast localized and thought to mediate Suc export from the vacuole into the cytosol. In source leaves of Populus, SUT4 is the predominantly expressed gene family member, with transcript levels several times higher than those of plasma membrane SUTs. A hypothesis is advanced that SUT4-mediated tonoplast sucrose fluxes contribute to the regulation of osmotic gradients between cellular compartments, with the potential to mediate both sink provisioning and drought tolerance in Populus. Here, we describe the effects of PtaSUT4-RNA interference (RNAi) on sucrose levels and raffinose family oligosaccharides (RFO) induction, photosynthesis, and water uptake, retention and loss during acute and chronic drought stresses. Under normal water-replete growing conditions, SUT4-RNAi plants had generally higher shoot water contents than wild-type plants. In response to soil drying during a short-term, acute drought, RNAi plants exhibited reduced rates of water uptake and delayed wilting relative to wild-type plants. SUT4-RNAi plants had larger leaf areas and lower photosynthesis rates than wild-type plants under well-watered, but not under chronic water-limiting conditions. Moreover, the magnitude of shoot water content, height growth, and photosynthesis responses to contrasting soil moisture regimes was greater in RNAi than wild-type plants. The concentrations of stress-responsive RFOs increased in wild-type plants but were unaffected in SUT4-RNAi plants under chronically dry conditions. We discuss a model in which the subcellular compartmentalization of sucrose mediated by PtaSUT4 is regulated in response to both sink demand and plant water status in Populus.
Nagy, Peter D.
2017-01-01
Reconstituted antiviral defense pathway in surrogate host yeast is used as an intracellular probe to further our understanding of virus-host interactions and the role of co-opted host factors in formation of membrane-bound viral replicase complexes in protection of the viral RNA against ribonucleases. The inhibitory effect of the RNA interference (RNAi) machinery of S. castellii, which only consists of the two-component DCR1 and AGO1 genes, was measured against tomato bushy stunt virus (TBSV) in wild type and mutant yeasts. We show that deletion of the co-opted ESCRT-I (endosomal sorting complexes required for transport I) or ESCRT-III factors makes TBSV replication more sensitive to the RNAi machinery in yeast. Moreover, the lack of these pro-viral cellular factors in cell-free extracts (CFEs) used for in vitro assembly of the TBSV replicase results in destruction of dsRNA replication intermediate by a ribonuclease at the 60 min time point when the CFE from wt yeast has provided protection for dsRNA. In addition, we demonstrate that co-opted oxysterol-binding proteins and membrane contact sites, which are involved in enrichment of sterols within the tombusvirus replication compartment, are required for protection of viral dsRNA. We also show that phosphatidylethanolamine level influences the formation of RNAi-resistant replication compartment. In the absence of peroxisomes in pex3Δ yeast, TBSV subverts the ER membranes, which provide as good protection for TBSV dsRNA against RNAi or ribonucleases as the peroxisomal membranes in wt yeast. Altogether, these results demonstrate that co-opted protein factors and usurped lipids are exploited by tombusviruses to build protective subcellular environment against the RNAi machinery and possibly other cellular ribonucleases. PMID:28759634
Caraus, Iurie; Alsuwailem, Abdulaziz A; Nadon, Robert; Makarenkov, Vladimir
2015-11-01
Significant efforts have been made recently to improve data throughput and data quality in screening technologies related to drug design. The modern pharmaceutical industry relies heavily on high-throughput screening (HTS) and high-content screening (HCS) technologies, which include small molecule, complementary DNA (cDNA) and RNA interference (RNAi) types of screening. Data generated by these screening technologies are subject to several environmental and procedural systematic biases, which introduce errors into the hit identification process. We first review systematic biases typical of HTS and HCS screens. We highlight that study design issues and the way in which data are generated are crucial for providing unbiased screening results. Considering various data sets, including the publicly available ChemBank data, we assess the rates of systematic bias in experimental HTS by using plate-specific and assay-specific error detection tests. We describe main data normalization and correction techniques and introduce a general data preprocessing protocol. This protocol can be recommended for academic and industrial researchers involved in the analysis of current or next-generation HTS data. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.
Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.
2014-01-01
Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931
Multiple Neuropeptide-Coding Genes Involved in Planarian Pharynx Extension.
Shimoyama, Seira; Inoue, Takeshi; Kashima, Makoto; Agata, Kiyokazu
2016-06-01
Planarian feeding behavior involves three steps: moving toward food, extending the pharynx from their planarian's ventral side after arriving at the food, and ingesting the food through the pharynx. Although pharynx extension is a remarkable behavior, it remains unknown what neuronal cell types are involved in its regulation. To identify neurons involved in regulating pharynx extension, we quantitatively analyzed pharynx extension and sought to identify these neurons by RNA interference (RNAi) and in situ hybridization. This assay, when performed using planarians with amputation of various body parts, clearly showed that the head portion is indispensable for inducing pharynx extension. We thus tested the effects of knockdown of brain neurons such as serotonergic, GABAergic, and dopaminergic neurons by RNAi, but did not observe any effects on pharynx extension behavior. However, animals with RNAi of the Prohormone Convertase 2 (PC2, a neuropeptide processing enzyme) gene did not perform the pharynx extension behavior, suggesting the possible involvement of neuropeptide(s in the regulation of pharynx extension. We screened 24 neuropeptide-coding genes, analyzed their functions by RNAi using the pharynx extension assay system, and identified at least five neuropeptide genes involved in pharynx extension. These was expressed in different cells or neurons, and some of them were expressed in the brain, suggesting complex regulation of planarian feeding behavior by the nervous system.
A Re-Examination of Global Suppression of RNA Interference by HIV-1
Sanghvi, Viraj R.; Steel, Laura F.
2011-01-01
The nature of the interaction between replicating HIV-1 and the cellular RNAi pathway has been controversial, but it is clear that it can be complex and multifaceted. It has been proposed that the interaction is bi-directional, whereby cellular silencing pathways can restrict HIV-1 replication, and in turn, HIV-1 can suppress silencing pathways. Overall suppression of RNAi has been suggested to occur via direct binding and inhibition of Dicer by the HIV-1 Tat protein or through sequestration of TRBP, a Dicer co-factor, by the structured TAR element of HIV-1 transcripts. The role of Tat as an inhibitor of Dicer has been questioned and our results support and extend the conclusion that Tat does not inhibit RNAi that is mediated by either exogenous or endogenous miRNAs. Similarly, we find no suppression of silencing pathways in cells with replicating virus, suggesting that viral products such as the TAR RNA elements also do not reduce the efficacy of cellular RNA silencing. However, knockdown of Dicer does allow increased viral replication and this occurs at a post-transcriptional level. These results support the idea that although individual miRNAs can act to restrict HIV-1 replication, the virus does not counter these effects through a global suppression of RNAi synthesis or processing. PMID:21386885
Catta-Preta, Carolina Moura Costa; Dos Santos Pascoalino, Bruno; de Souza, Wanderley; Mottram, Jeremy C; Motta, Maria Cristina M; Schenkman, Sergio
2016-11-01
In the last two decades, RNA interference pathways have been employed as a useful tool for reverse genetics in trypanosomatids. Angomonas deanei is a nonpathogenic trypanosomatid that maintains an obligatory endosymbiosis with a bacterium related to the Alcaligenaceae family. Studies of this symbiosis can help us to understand the origin of eukaryotic organelles. The recent elucidation of both the A. deanei and the bacterium symbiont genomes revealed that the host protozoan codes for the enzymes necessary for RNAi activity in trypanosomatids. Here, we tested the functionality of the RNAi machinery by transfecting cells with dsRNA to a reporter gene (green fluorescent protein), which had been previously expressed in the parasite and to α-tubulin, an endogenous gene. In both cases, protein expression was reduced by the presence of specific dsRNA, inducing, respectively, a decreased GFP fluorescence and the formation of enlarged cells with modified arrangement of subpellicular microtubules. Furthermore, symbiont division was impaired. These results indicate that the RNAi system is active in A. deanei and can be used to further explore gene function in symbiont-containing trypanosomatids and to clarify important aspects of symbiosis and cell evolution. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.
Potato plants with genetically engineered tropane alkaloid precursors.
Küster, Nadine; Rosahl, Sabine; Dräger, Birgit
2017-02-01
Solanum tuberosum tropinone reductase I reduced tropinone in vivo. Suppression of tropinone reductase II strongly reduced calystegines in sprouts. Overexpression of putrescine N -methyltransferase did not alter calystegine accumulation. Calystegines are hydroxylated alkaloids formed by the tropane alkaloid pathway. They accumulate in potato (Solanum tuberosum L., Solanaceae) roots and sprouting tubers. Calystegines inhibit various glycosidases in vitro due to their sugar-mimic structure, but functions of calystegines in plants are not understood. Enzymes participating in or competing with calystegine biosynthesis, including putrescine N-methyltransferase (PMT) and tropinone reductases (TRI and TRII), were altered in their activity in potato plants by RNA interference (RNAi) and by overexpression. The genetically altered potato plants were investigated for the accumulation of calystegines and for intermediates of their biosynthesis. An increase in N-methylputrescine provided by DsPMT expression was not sufficient to increase calystegine accumulation. Overexpression and gene knockdown of StTRI proved that S. tuberosum TRI is a functional tropinone reductase in vivo, but no influence on calystegine accumulation was observed. When StTRII expression was suppressed by RNAi, calystegine formation was severely compromised in the transformed plants. Under phytochamber and green house conditions, the StTRII RNAi plants did not show phenotypic alterations. Further investigation of calystegines function in potato plants under natural conditions is enabled by the calystegine deprived StTRII RNAi plants.
Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke
2014-01-01
In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938
Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS
USDA-ARS?s Scientific Manuscript database
Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...
USDA-ARS?s Scientific Manuscript database
RNAi-mediated knockdown of target transcripts offers great potential, both in terms of insect functional genomics and the development of novel insect pest management strategies. Frequently, dsRNAs targeting transcripts of interest are introduced orally to the target organism via feeding. This delive...
USDA-ARS?s Scientific Manuscript database
Mycotoxin contamination in food and feed crops is a major concern worldwide. Fungal pathogens of the genera Aspergillus, Fusarium, and Penicillium are a major threat to food and feed crops due to production of mycotoxins such as aflatoxins, 4-deoxynivalenol, patulin, and numerous other toxic seconda...
USDA-ARS?s Scientific Manuscript database
Aflatoxins are among the most powerful carcinogens in nature. The major aflatoxin-producing fungi are Aspergillus flavus and A. parasiticus. Numerous crops, including peanut, are susceptible to aflatoxin contamination by these fungi. There has been an increased use of RNA interference (RNAi) technol...
Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B
2014-01-01
HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.
Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.
Hernández, Armando R; Peterson, Larryn W; Kool, Eric T
2012-08-17
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.
Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases
Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.
2012-01-01
Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660
Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko
2018-01-01
Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.
RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds
Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.
2012-01-01
Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571
Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.
Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P
2016-04-27
Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing. These animals also exhibited abnormal neural plasticity after training, which may be a mechanism for why some children with dyslexia do not respond to intervention. These results are in stark contrast to our previous work with a different candidate gene, which caused a different set of deficits. Our results shed some light on possible neural and genetic mechanisms causing heterogeneity in the dyslexic population. Copyright © 2016 the authors 0270-6474/16/364895-12$15.00/0.
Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams
Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.
2016-01-01
Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing. These animals also exhibited abnormal neural plasticity after training, which may be a mechanism for why some children with dyslexia do not respond to intervention. These results are in stark contrast to our previous work with a different candidate gene, which caused a different set of deficits. Our results shed some light on possible neural and genetic mechanisms causing heterogeneity in the dyslexic population. PMID:27122044
Ely, Abdullah; ul Islam, Rafique; Barichievy, Samantha; Bloom, Kristie; Weinberg, Marc S; van Otterlo, Willem AL; de Koning, Charles B; Salazar, Felix; Marion, Patricia; Roesch, Eric B; LeMaitre, Marc; Herdewijn, Piet
2010-01-01
Chronic infection with the hepatitis B virus (HBV) occurs in approximately 6% of the world's population and carriers of the virus are at risk for complicating hepatocellular carcinoma. Current treatment options have limited efficacy and chronic HBV infection is likely to remain a significant global medical problem for many years to come. Silencing HBV gene expression by harnessing RNA interference (RNAi) presents an attractive option for development of novel and effective anti HBV agents. However, despite significant and rapid progress, further refinement of existing technologies is necessary before clinical application of RNAi-based HBV therapies is realized. Limiting off target effects, improvement of delivery efficiency, dose regulation and preventing reactivation of viral replication are some of the hurdles that need to be overcome. To address this, we assessed the usefulness of the recently described class of altritol-containing synthetic siRNAs (ANA siRNAs), which were administered as lipoplexes and tested in vivo in a stringent HBV transgenic mouse model. Our observations show that ANA siRNAs are capable of silencing of HBV replication in vivo. Importantly, non specific immunostimulation was observed with unmodified siRNAs and this undesirable effect was significantly attenuated by ANA modification. Inhibition of HBV replication of approximately 50% was achieved without evidence for induction of toxicity. These results augur well for future application of ANA siRNA therapeutic lipoplexes. PMID:21687523
Gilbert, Matthew K; Majumdar, Rajtilak; Rajasekaran, Kanniah; Chen, Zhi-Yuan; Wei, Qijian; Sickler, Christine M; Lebar, Matthew D; Cary, Jeffrey W; Frame, Bronwyn R; Wang, Kan
2018-06-01
Expressing an RNAi construct in maize kernels that targets the gene for alpha-amylase in Aspergillus flavus resulted in suppression of alpha-amylase (amy1) gene expression and decreased fungal growth during in situ infection resulting in decreased aflatoxin production. Aspergillus flavus is a saprophytic fungus and pathogen to several important food and feed crops, including maize. Once the fungus colonizes lipid-rich seed tissues, it has the potential to produce toxic secondary metabolites, the most dangerous of which is aflatoxin. The pre-harvest control of A. flavus contamination and aflatoxin production is an area of intense research, which includes breeding strategies, biological control, and the use of genetically-modified crops. Host-induced gene silencing, whereby the host crop produces siRNA molecules targeting crucial genes in the invading fungus and targeting the gene for degradation, has shown to be promising in its ability to inhibit fungal growth and decrease aflatoxin contamination. Here, we demonstrate that maize inbred B104 expressing an RNAi construct targeting the A. flavus alpha-amylase gene amy1 effectively reduces amy1 gene expression resulting in decreased fungal colonization and aflatoxin accumulation in kernels. This work contributes to the development of a promising technology for reducing the negative economic and health impacts of A. flavus growth and aflatoxin contamination in food and feed crops.
Mutisya, Daniel; Hardcastle, Travis; Cheruiyot, Samwel K.; Pallan, Pradeep S.; Kennedy, Scott D.; Egli, Martin; Kelley, Melissa L.; Smith, Anja van Brabant
2017-01-01
Abstract While the use of RNA interference (RNAi) in molecular biology and functional genomics is a well-established technology, in vivo applications of synthetic short interfering RNAs (siRNAs) require chemical modifications. We recently found that amides as non-ionic replacements for phosphodiesters may be useful modifications for optimization of siRNAs. Herein, we report a comprehensive study of systematic replacement of a single phosphate with an amide linkage throughout the guide strand of siRNAs. The results show that amides are surprisingly well tolerated in the seed and central regions of the guide strand and increase the silencing activity when placed between nucleosides 10 and 12, at the catalytic site of Argonaute. A potential explanation is provided by the first crystal structure of an amide-modified RNA–DNA with Bacillus halodurans RNase H1. The structure reveals how small changes in both RNA and protein conformation allow the amide to establish hydrogen bonding interactions with the protein. Molecular dynamics simulations suggest that these alternative binding modes may compensate for interactions lost due to the absence of a phosphodiester moiety. Our results suggest that an amide can mimic important hydrogen bonding interactions with proteins required for RNAi activity and may be a promising modification for optimization of biological properties of siRNAs. PMID:28854734
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mutisya, Daniel; Hardcastle, Travis; Cheruiyot, Samwel K.
While the use of RNA interference (RNAi) in molecular biology and functional genomics is a well-established technology, in vivo applications of synthetic short interfering RNAs (siRNAs) require chemical modifications. We recently found that amides as non-ionic replacements for phosphodiesters may be useful modifications for optimization of siRNAs. Herein, we report a comprehensive study of systematic replacement of a single phosphate with an amide linkage throughout the guide strand of siRNAs. The results show that amides are surprisingly well tolerated in the seed and central regions of the guide strand and increase the silencing activity when placed between nucleosides 10 andmore » 12, at the catalytic site of Argonaute. A potential explanation is provided by the first crystal structure of an amide-modified RNA–DNA with Bacillus halodurans RNase H1. The structure reveals how small changes in both RNA and protein conformation allow the amide to establish hydrogen bonding interactions with the protein. Molecular dynamics simulations suggest that these alternative binding modes may compensate for interactions lost due to the absence of a phosphodiester moiety. Our results suggest that an amide can mimic important hydrogen bonding interactions with proteins required for RNAi activity and may be a promising modification for optimization of biological properties of siRNAs.« less
siRNAs and piRNAs Collaborate for Transposon Control in the Two-Spotted Spider Mite.
Mondal, Mosharrof; Mansfield, Kody; Flynt, Alex
2018-04-20
RNAi has revolutionized genetic research, and is being commercialized as an insect pest control technology. Mechanisms exploited for this purpose are antiviral and therefore rapidly evolving. Ideally, RNAi will also be used for non-insect pests, however, differences in RNAi biology makes this uncertain. Tetranychus urticae (two-spotted spider mite) is a destructive non-insect pest, which has a proclivity to develop pesticide resistance. Here we provide a comprehensive study of the endogenous RNAi pathways of spider mites to inform design of exogenous RNAi triggers. This effort revealed unexpected roles for small RNAs and novel genome surveillance pathways. Spider mites have an expanded RNAi machinery relative to insects, encoding RNA dependent RNA polymerase (Rdrp) and extra Piwi-class effectors. Through analyzing T. urticae transcriptome data we explored small RNA biogenesis, and discovered five siRNA loci that appear central to genome surveillance. These RNAs are expressed in the gonad, which we hypothesize to trigger production of piRNAs for control of transposable elements (TEs). This work highlights the need to investigate endogenous RNAi biology as lessons from model organisms may not hold in other species, impacting development of an RNAi strategy. Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen
2013-01-01
RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449
RNAi and Antiviral Defense in the Honey Bee.
Brutscher, Laura M; Flenniken, Michelle L
2015-01-01
Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans.
New insights into siRNA amplification and RNAi
Zhang, Chi; Ruvkun, Gary
2012-01-01
In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C
2015-01-29
Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi
Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.
2015-01-01
SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455
Suppression of RND3 activity by AES downregulation promotes cancer cell proliferation and invasion.
Xia, Hongwei; Li, Mingxing; Chen, Liang; Leng, Weibing; Yuan, Dandan; Pang, Xiaohui; Chen, Liu; Li, Ronghui; Tang, Qiulin; Bi, Feng
2013-05-01
Amino-terminal enhancer of split (AES) is a member of the Groucho/TLE family. Although it has no DNA-binding site, AES can regulate transcriptional activity by interacting with transcriptional factors. Emerging evidence indicates that AES may play an important role in tumor metastasis, but the molecular mechanism is still poorly understood. In this study, we found that knockdown of AES by RNA interference (RNAi) downregulated RND3 expression at the mRNA and protein levels in MDA-MB-231 and HepG2, two cancer cell lines. Furthermore, luciferase assays showed that overexpression of AES significantly enhanced RND3 promoter activity. Moreover, inhibition of AES both in MDA-MB-231 and HepG2 cells by RNAi significantly promoted cell proliferation, cell cycle progression and invasion, consistent with the effects of RNAi-mediated RND3 knockdown in these cells. For the first time, data are presented showing that alteration of the malignant behavior of cancer cells by AES is related to RND3 regulation, and these findings also provide new insights into the mechanism of AES action in regulating tumor malignancy.
Integrated Network Analyses for Functional Genomic Studies in Cancer
Wilson, Jennifer L.; Hemann, Michael T.; Fraenkel, Ernest; Lauffenburger, Douglas A.
2013-01-01
RNA-interference (RNAi) studies hold great promise for functional investigation of the significance of genetic variations and mutations, as well as potential synthetic lethalities, for understanding and treatment of cancer, yet technical and conceptual issues currently diminish the potential power of this approach. While numerous research groups are usefully employing this kind of functional genomic methodology to identify molecular mediators of disease severity, response, and resistance to treatment, findings are generally confounded by “off-target” effects. These effects arise from a variety of issues beyond non-specific reagent behavior, such as biological cross-talk and feedback processes so thus can occur even with specific perturbation. Interpreting RNAi results in a network framework instead of merely as individual “hits” or “targets” leverages contributions from all hit/target contributions to pathways via their relationships with other network nodes. This interpretation can ameliorate dependence on individual reagent performance and increase confidence in biological validation. Here we provide background on RNAi studies in cancer applications, review key challenges with functional genomics, and motivate the use of network models grounded in pathway analyses. PMID:23811269
RNAi and Antiviral Defense in the Honey Bee
Brutscher, Laura M.; Flenniken, Michelle L.
2015-01-01
Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans. PMID:26798663
Schirtzinger, Erin E; Andrade, Christy C; Devitt, Nicholas; Ramaraj, Thiruvarangan; Jacobi, Jennifer L; Schilkey, Faye; Hanley, Kathryn A
2015-02-01
RNA interference (RNAi) is the major defense of many arthropods against arthropod-borne RNA viruses (arboviruses), but the role of RNAi in vertebrate immunity to arboviruses is not clear. RNA viruses can trigger RNAi in vertebrate cells, but the vertebrate interferon response may obscure this interaction. We quantified virus-derived small RNAs (vRNAs) generated by mosquito (U4.4) cells and interferon-deficient (Vero) and interferon-competent (HuH-7) mammalian cells infected with a single isolate of mosquito-borne dengue virus. Mosquito cells produced significantly more vRNAs than mammalian cells, and mosquito cell vRNAs were derived from both the positive- and negative-sense dengue genomes whereas mammalian cell vRNAs were derived primarily from positive-sense genome. Mosquito cell vRNAs were predominantly 21 nucleotides in length whereas mammalian cell vRNAs were between 12 and 36 nucleotides with a modest peak at 24 nucleotides. Hot-spots, regions of the virus genome that generated a disproportionate number of vRNAs, overlapped among the cell lines. Copyright © 2014 Elsevier Inc. All rights reserved.
Functional diversification of Argonautes in nematodes: an expanding universe.
Buck, Amy H; Blaxter, Mark
2013-08-01
In the last decade, many diverse RNAi (RNA interference) pathways have been discovered that mediate gene silencing at epigenetic, transcriptional and post-transcriptional levels. The diversity of RNAi pathways is inherently linked to the evolution of Ago (Argonaute) proteins, the central protein component of RISCs (RNA-induced silencing complexes). An increasing number of diverse Agos have been identified in different species. The functions of most of these proteins are not yet known, but they are generally assumed to play roles in development, genome stability and/or protection against viruses. Recent research in the nematode Caenorhabditis elegans has expanded the breadth of RNAi functions to include transgenerational epigenetic memory and, possibly, environmental sensing. These functions are inherently linked to the production of secondary siRNAs (small interfering RNAs) that bind to members of a clade of WAGOs (worm-specific Agos). In the present article, we review briefly what is known about the evolution and function of Ago proteins in eukaryotes, including the expansion of WAGOs in nematodes. We postulate that the rapid evolution of WAGOs enables the exceptional functional plasticity of nematodes, including their capacity for parasitism.
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
NASA Astrophysics Data System (ADS)
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
Therapeutic gene targeting approaches for the treatment of dyslipidemias and atherosclerosis.
Mäkinen, Petri I; Ylä-Herttuala, Seppo
2013-04-01
Despite improved therapies, cardiovascular diseases are the leading cause of morbidity and mortality worldwide. Therefore, new therapeutic approaches are still needed. In the gene therapy field, RNA interference (RNAi) and regulation of microRNAs (miRNAs) have gained a lot of attention in addition to traditional overexpression based strategies. Here, recent findings in therapeutic gene silencing and modulation of small RNA expression related to atherogenesis and dyslipidemia are summarized. Novel gene therapy approaches for the treatment of hyperlipidemia have been addressed. Antisense oligonucleotide and RNAi-based therapies against apolipoprotein B100 and proprotein convertase subtilisin/kexin type 9 have shown already efficacy in preclinical and clinical trials. In addition, several miRNAs dysregulated in atherosclerotic lesions and regulating cholesterol homeostasis have been found, which may represent novel targets for future therapies. New therapies for lowering lipid levels are now being tested in clinical trials, and both antisense oligonucleotide and RNAi-based therapies have shown promising results in lowering cholesterol levels. However, the modulation of inflammatory component in atherosclerosis by gene therapy and targeting of the effects to plaques are still difficult challenges.
Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A
2013-08-01
Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Yu, Xiudao; Gowda, Siddarame; Killiny, Nabil
2017-09-01
Asian citrus psyllid, Diaphorina citri Kuwayama, is the most important economic pest of citrus because it transmits Candidatus Liberibacter asiaticus (CLas), the causal agent of huanglongbing (HLB). Silencing genes by RNA interference (RNAi) is a promising approach for controlling D. citri. RNAi-based insect management strategies depend on the selection of suitable target genes. The muscle protein 20 gene DcMP20 was characterized from D. citri in an effort to impair proper muscle development through RNAi. Phylogenetic analysis showed that DcMP20 was more closely related to MP20 from Drosophila compared with its counterpart from other insect species. Developmental expression analysis revealed that transcription of DcMP20 was development dependent and reached a maximum level in the last instar (fourth-fifth) of the nymphal stage. The extent of RNAi in D. citri was dose dependent, with dsRNA-DcMP20 at 75 ng µL -1 being sufficient to knock down endogenous DcMP20 expression, which resulted in significant mortality and reduced body weight that positively correlated with the silencing of DcMP20. No effect was found when dsRNA-GFP or water was used, indicating the specific effect of dsRNA-DcMP20. Our results suggest that dsRNA can be delivered to D. citri through soaking, and DcMP20 is an effective RNAi target to be used in the management of D. citri. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
ERIC Educational Resources Information Center
Harrison, Jason Gordon
2013-01-01
Quantum mechanical (QM) and molecular docking methods are used to probe systems of biological and synthetic interest. Probing interactions of nucleobases within proteins, and properly modeling said interactions toward novel nucleobase development, is extremely difficult, and of great utility in RNA interference (RNAi) therapeutics. The issues in…
USDA-ARS?s Scientific Manuscript database
Root-knot nematodes (RKNs) infect many annual and perennial crops and are the most devastating soil-born pests in vineyards. To develop a biotech-based solution for controlling RKNs in grapes, we evaluated the efficacy of plant-derived RNA interference (RNAi) silencing of a conserved RKN effector ge...
USDA-ARS?s Scientific Manuscript database
If validated, diet-derived foreign microRNA absorption and function in consuming vertebrates would drastically alter our understanding of nutrition and ecology. RNA interference (RNAi) mechanisms of Caenorhabditis elegans are enhanced by uptake of environmental RNA and amplification and systemic dis...
Evidence for a Role of Connexin 43 in Trigeminal Pain Using RNA Interference In Vivo
Ohara, Peter T.; Vit, Jean-Philippe; Bhargava, Aditi; Jasmin, Luc
2008-01-01
The importance of glial cells in the generation and maintenance of neuropathic pain is becoming widely accepted. We examined the role of glial-specific gap junctions in nociception in the rat trigeminal ganglion in nerve-injured and -uninjured states. The connexin 43 (Cx43) gap-junction subunit was found to be confined to the satellite glial cells (SGCs) that tightly envelop primary sensory neurons in the trigeminal ganglion and we therefore used Cx43 RNA interference (RNAi) to alter gap-junction function in SGCs. Using behavioral evaluation, together with immunocytochemical and Western blot monitoring, we show that Cx43 increased in the trigeminal ganglion in rats with a chronic constriction injury (CCI) of the infraorbital nerve. Reducing Cx43 expression using RNAi in CCI rats reduced painlike behavior, whereas in non-CCI rats, reducing Cx43 expression increased painlike behavior. The degree of painlike behavior in CCI rats and intact, Cx43-silenced rats was similar. Our results support previous suggestions that increases in glial gap junctions after nerve injury increases nociceptive behavior but paradoxically the reduction of gap junctions in normal ganglia also increases nociceptive behavior, possibly a reflection of the multiple functions performed by glia. PMID:18715894
Evaluation and control of miRNA-like off-target repression for RNA interference.
Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook
2018-03-01
RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.
Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-04-01
Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.
Zhang, Huanmin; Bacon, Larry D; Fadly, Aly M
2008-09-01
Primary chicken embryo fibroblasts (CEF) from special specific pathogen-free chicken lines are used for detection of contamination of adult or embryonic tissues, meconium, or tissue culture fluids with avian leukosis viruses (ALV). The suitability and efficiency of such tests depend on the susceptibility of CEF to the various subgroups of exogenous as well as endogenous ALV. The ideal CEF for such tests should be not only susceptible to all retroviruses, but also free of endogenous viruses so that such tests are immune to any interference that may occur between the endogenous and the tested (exogenous) viruses. CEF and/or chickens free of endogenous viruses are also desirable for gene transfer studies using retroviral vectors, such as RNA interference (RNAi) experiments and transgenic work. The absence of ev genes in CEF or chickens can empower clean detection of successful RNAi construct delivery or gene transfer. CEF free of ev genes are also essential reagents routinely used in growing and detecting unknown retroviruses in varied viral assays. This report documents the development of a new line of chickens, 0.TVB*S1, that is free of endogenous viruses and susceptible to all subgroups of ALV identified in chickens.
Pulmonary Delivery of siRNA via Polymeric Vectors as Therapies of Asthma.
Xie, Yuran; Merkel, Olivia M
2015-10-01
Asthma is a chronic inflammatory disease. Despite the fact that current therapies, such as the combination of inhaled corticosteroids and β2-agonists, can control the symptoms of asthma in most patients, there is still an urgent need for an alternative anti-inflammatory therapy for patients who suffer from severe asthma but lack acceptable response to conventional therapies. Many molecular factors are involved in the inflammatory process in asthma, and thus blocking the function of these factors could efficiently alleviate airway inflammation. RNA interference (RNAi) is often thought to be the answer in the search for more efficient and biocompatible treatments. However, difficulties of efficient delivery of small interference RNA (siRNA), the key factor in RNAi, to target cells and tissues have limited its clinical application. In this review, we summarize cytokines and chemokines, transcription factors, tyrosine kinases, and costimulatory factors that have been reported as targets of siRNA-mediated treatment in experimental asthma. Additionally, we conclude several targeted delivery systems of siRNA to specific cells such as T cells, macrophages, and dendritic cells, which could potentially be applied in asthma therapy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W
2004-01-01
We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.
Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris
2014-01-01
Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493
Conversations between kingdoms: small RNAs.
Weiberg, Arne; Bellinger, Marschal; Jin, Hailing
2015-04-01
Humans, animals, and plants are constantly under attack from pathogens and pests, resulting in severe consequences on global human health and crop production. Small RNA (sRNA)-mediated RNA interference (RNAi) is a conserved regulatory mechanism that is involved in almost all eukaryotic cellular processes, including host immunity and pathogen virulence. Recent evidence supports the significant contribution of sRNAs and RNAi to the communication between hosts and some eukaryotic pathogens, pests, parasites, or symbiotic microorganisms. Mobile silencing signals—most likely sRNAs—are capable of translocating from the host to its interacting organism, and vice versa. In this review, we will provide an overview of sRNA communications between different kingdoms, with a primary focus on the advances in plant-pathogen interaction systems. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jang, Bora; Kim, Boyoung; Kim, Hyunsook; Kwon, Hyokyoung; Kim, Minjeong; Seo, Yunmi; Colas, Marion; Jeong, Hansaem; Jeong, Eun Hye; Lee, Kyuri; Lee, Hyukjin
2018-06-08
Enzymatic synthesis of RNA nanostructures is achieved by isothermal rolling circle transcription (RCT). Each arm of RNA nanostructures provides a functional role of Dicer substrate RNA inducing sequence specific RNA interference (RNAi). Three different RNAi sequences (GFP, RFP, and BFP) are incorporated within the three-arm junction RNA nanostructures (Y-RNA). The template and helper DNA strands are designed for the large-scale in vitro synthesis of RNA strands to prepare self-assembled Y-RNA. Interestingly, Dicer processing of Y-RNA is highly influenced by its physical structure and different gene silencing activity is achieved depending on its arm length and overhang. In addition, enzymatic synthesis allows the preparation of various Y-RNA structures using a single DNA template offering on demand regulation of multiple target genes.
RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1
Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.
2014-01-01
Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610
Raman, Pravrutha; Zaghab, Soriayah M.; Traver, Edward C.
2017-01-01
Abstract Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. PMID:28541563
Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K
2018-03-22
Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.
Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L
2014-01-01
Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280
PsOr1, a potential target for RNA interference-based pest management.
Zhao, Y Y; Liu, F; Yang, G; You, M S
2011-02-01
Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.
Badisco, Liesbeth; Marchal, Elisabeth; Van Wielendaele, Pieter; Verlinden, Heleen; Vleugels, Rut; Vanden Broeck, Jozef
2011-03-01
The 'classic' insect hormones, juvenile hormone and 20-hydroxyecdysone, can stimulate vitellogenesis and/or ovarian development in adult females of several insect species. Accumulating evidence also indicates a crucial role in female reproductive physiology for peptide hormones, such as insulin-related peptides (IRPs) and neuroparsins (NPs). Especially in dipteran species, IRP signaling has been shown to regulate female reproductive events. The first NP was originally identified from the migratory locust (Locusta migratoria) as an antigonadotropic factor that delayed vitellogenesis. Moreover, NP family members display sequence similarities with the N-terminal domain of vertebrate insulin-like growth factor binding proteins (IGFBPs). In the current study, RNA interference (RNAi) was employed to investigate the possible involvement of IRP and NPs in the control of the female desert locust (Schistocerca gregaria) reproductive system. The cDNAs encoding an IRP (Scg-IRP) and four NPs (Scg-NPs) had previously been cloned from S. gregaria. An RNAi-mediated knock-down of either Scg-NP or Scg-IRP transcript levels was induced in adult female desert locusts and the subsequent effects were analyzed. Knock-down of the Scg-NPs or Scg-IRP affected vitellogenin transcript levels and oocyte growth in a positive and negative way, respectively. The current findings are indicative for a role of Scg-NPs and Scg-IRP in the control of vitellogenin synthesis. A plausible hypothesis is that Scg-IRP may act as a sensor of the nutritional and metabolic status that determines whether vitellogenesis can occur. That the same processes were affected in opposite ways in both RNAi experiments offers an extra argument for antagonizing roles of Scg-NPs and Scg-IRP. Copyright © 2010 Elsevier Inc. All rights reserved.
Mesoporous silica nanorods toward efficient loading and intracellular delivery of siRNA
NASA Astrophysics Data System (ADS)
Chen, Lijue; She, Xiaodong; Wang, Tao; Shigdar, Sarah; Duan, Wei; Kong, Lingxue
2018-02-01
The technology of RNA interference (RNAi) that uses small interfering RNA (siRNA) to silence the gene expression with complementary messenger RNA (mRNA) sequence has great potential for the treatment of cancer in which certain genes were usually found overexpressed. However, the carry and delivery of siRNA to the target site in the human body can be challenging for this technology to be used clinically to silence the cancer-related gene expression. In this work, rod shaped mesoporous silica nanoparticles (MSNs) were developed as siRNA delivery system for specific intracellular delivery. The rod MSNs with an aspect ratio of 1.5 had a high surface area of 934.28 m2/g and achieved a siRNA loading of more than 80 mg/g. With the epidermal growth factor (EGF) grafted on the surface of the MSNs, siRNA can be delivered to the epidermal growth factor receptor (EGFR) overexpressed colorectal cancer cells with high intracellular concentration compared to MSNs without EGF and lead to survivin gene knocking down to less than 30%.
Yuan, Meng-Ke; Tao, Yong; Yu, Wen-Zhen; Kai, Wang; Jiang, Yan-Rong
2010-08-25
To explore the in vivo anti-angiogenesis effects resulting from lentivirus-mediated RNAi of vascular endothelial growth factor (VEGF) in monkeys with iris neovascularization (INV). Five specific recombinant lentiviral vectors for RNA interference, targeting Macaca mulatta VEGFA, were designed and the one with best knock down efficacy (LV-GFP-VEGFi1) in H1299 cells and RF/6A cells was selected by real-time PCR for in vivo use. A laser-induced retinal vein occlusion model was established in one eye of seven cynomolgus monkeys. In monkeys number 1, 3, and 5 (Group 1), the virus (1x10(8) particles) was intravitreally injected into the preretinal space of the animal's eye immediately after laser coagulation; and in monkeys number 2, 4, and 6 (Group 2), the virus (1x10(8) particles) was injected at 10 days after laser coagulation. In monkey number 7, a blank control injection was performed. In monkeys number 1 and 2, virus without RNAi sequence was used; in monkeys number 3 and 4, virus with nonspecific RNAi sequence was used; and in monkeys 5 and 6, LV-GFP-VEGFi1 was used. In monkey number 5, at 23 days after laser treatment, no obvious INV was observed, while fluorescein angiography of the iris revealed high fluorescence at the margin of pupil and point posterior synechiae. At 50 days after laser treatment, only a slight ectropion uvea was found. However, in the other eyes, obvious INV or hyphema was observed. The densities of new iridic vessels all significantly varied: between monkey number 5 and number 3 (36.01+/-4.49/mm(2) versus 48.68+/-9.30/mm(2), p=0.025), between monkey number 3 and monkey number 7 (48.68+/-9.30/mm(2) versus 74.38+/-9.23/mm(2), p=0.002), and between monkey number 5 and number 7 (36.01+/-4.49/mm(2) versus 74.38+/-9.23/mm(2), p<0.001). Lentivirus-mediated RNAi of VEGF may be a new strategy to treat iris neovascularization, while further studies are needed to investigate the long-term effect.
RNAi for functional genomics in plants.
McGinnis, Karen M
2010-03-01
RNAi refers to several different types of gene silencing mediated by small, dsRNA molecules. Over the course of 20 years, the scientific understanding of RNAi has developed from the initial observation of unexpected expression patterns to a sophisticated understanding of a multi-faceted, evolutionarily conserved network of mechanisms that regulate gene expression in many organisms. It has also been developed as a genetic tool that can be exploited in a wide range of species. Because transgene-induced RNAi has been effective at silencing one or more genes in a wide range of plants, this technology also bears potential as a powerful functional genomics tool across the plant kingdom. Transgene-induced RNAi has indeed been shown to be an effective mechanism for silencing many genes in many organisms, but the results from multiple projects which attempted to exploit RNAi on a genome-wide scale suggest that there is a great deal of variation in the silencing efficacy between transgenic events, silencing targets and silencing-induced phenotype. The results from these projects indicate several important variables that should be considered in experimental design prior to the initiation of functional genomics efforts based on RNAi silencing. In recent years, alternative strategies have been developed for targeted gene silencing, and a combination of approaches may also enhance the use of targeted gene silencing for functional genomics.
Swevers, Luc; Liu, Jisheng; Huvenne, Hanneke; Smagghe, Guy
2011-01-01
RNA interference (RNAi), an RNA-dependent gene silencing process that is initiated by double-stranded RNA (dsRNA) molecules, has been applied with variable success in lepidopteran insects, in contrast to the high efficiency achieved in the coleopteran Tribolium castaneum. To gain insight into the factors that determine the efficiency of RNAi, a survey was carried out to check the expression of factors that constitute the machinery of the small interfering RNA (siRNA) and microRNA (miRNA) pathways in different tissues and stages of the silkmoth, Bombyx mori. It was found that the dsRNA-binding protein R2D2, an essential component in the siRNA pathway in Drosophila, was expressed at minimal levels in silkmoth tissues. The silkmoth-derived Bm5 cell line was also deficient in expression of mRNA encoding full-length BmTranslin, an RNA-binding factor that has been shown to stimulate the efficiency of RNAi. However, despite the lack of expression of the RNA-binding proteins, silencing of a luciferase reporter gene was observed by co-transfection of luc dsRNA using a lipophilic reagent. In contrast, gene silencing was not detected when the cells were soaked in culture medium supplemented with dsRNA. The introduction of an expression construct for Tribolium R2D2 (TcR2D2) did not influence the potency of luc dsRNA to silence the luciferase reporter. Immunostaining experiments further showed that both TcR2D2 and BmTranslin accumulated at defined locations within the cytoplasm of transfected cells. Our results offer a first evaluation of the expression of the RNAi machinery in silkmoth tissues and Bm5 cells and provide evidence for a functional RNAi response to intracellular dsRNA in the absence of R2D2 and Translin. The failure of TcR2D2 to stimulate the intracellular RNAi pathway in Bombyx cells is discussed. PMID:21637842
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development.
Xiong, Zhiyong; Chen, Chunli; Wang, Lijun; Yu, Jingyin; Lu, Changming; Wei, Wenhui
2012-01-01
BnAP2, an APETALA2 (AP2)-like gene, has been isolated from Brassica napus cultivar Zhongshuang 9. The cDNA of BnAP2, with 1, 299 bp in length, encoded a transcription factor comprising of 432 amino acid residues. Results from complementary experiment indicated that BnAP2 was completely capable of restoring the phenotype of Arabidopsis ap2-11 mutant. Together with the sequence and expression data, the complementation data suggested that BnAP2 encodes the ortholog of AtAP2. To address the transcriptional activation of BnAP2, we performed transactivation assays in yeast. Fusion protein of BnAP2 with GAL4 DNA binding domain strongly activated transcription in yeast, and the transactivating activity of BnAP2 was localized to the N-terminal 100 amino acids. To further study the function of BnAP2 involved in the phenotype of B. napus, we used a transgenic approach that involved targeted RNA interference (RNAi) repression induced by ihp-RNA. Floral various phenotype defectives and reduced female fertility were observed in B. napus BnAP2-RNAi lines. Loss of the function of BnAP2 gene also resulted in delayed sepal abscission and senescence with the ethylene-independent pathway. In the strong BnAP2-RNAi lines, seeds showed defects in shape, structure and development and larger size. Strong BnAP2-RNAi and wild-type seeds initially did not display a significant difference in morphology at 10 DAF, but the development of BnAP2-RNAi seeds was slower than that of wild type at 20 DAF, and further at 30 DAF, wild-type seeds were essentially at their final size, whereas BnAP2-RNAi seeds stopped growing and developing and gradually withered. PMID:22479468
Yan, Xiaohong; Zhang, Lei; Chen, Bo; Xiong, Zhiyong; Chen, Chunli; Wang, Lijun; Yu, Jingyin; Lu, Changming; Wei, Wenhui
2012-01-01
BnAP2, an APETALA2 (AP2)-like gene, has been isolated from Brassica napus cultivar Zhongshuang 9. The cDNA of BnAP2, with 1, 299 bp in length, encoded a transcription factor comprising of 432 amino acid residues. Results from complementary experiment indicated that BnAP2 was completely capable of restoring the phenotype of Arabidopsis ap2-11 mutant. Together with the sequence and expression data, the complementation data suggested that BnAP2 encodes the ortholog of AtAP2. To address the transcriptional activation of BnAP2, we performed transactivation assays in yeast. Fusion protein of BnAP2 with GAL4 DNA binding domain strongly activated transcription in yeast, and the transactivating activity of BnAP2 was localized to the N-terminal 100 amino acids. To further study the function of BnAP2 involved in the phenotype of B. napus, we used a transgenic approach that involved targeted RNA interference (RNAi) repression induced by ihp-RNA. Floral various phenotype defectives and reduced female fertility were observed in B. napus BnAP2-RNAi lines. Loss of the function of BnAP2 gene also resulted in delayed sepal abscission and senescence with the ethylene-independent pathway. In the strong BnAP2-RNAi lines, seeds showed defects in shape, structure and development and larger size. Strong BnAP2-RNAi and wild-type seeds initially did not display a significant difference in morphology at 10 DAF, but the development of BnAP2-RNAi seeds was slower than that of wild type at 20 DAF, and further at 30 DAF, wild-type seeds were essentially at their final size, whereas BnAP2-RNAi seeds stopped growing and developing and gradually withered.
Killiny, Nabil; Hajeri, Subhas; Tiwari, Siddharth; Gowda, Siddarame; Stelinski, Lukasz L.
2014-01-01
Silencing of genes through RNA interference (RNAi) in insects has gained momentum during the past few years. RNAi has been used to cause insect mortality, inhibit insect growth, increase insecticide susceptibility, and prevent the development of insecticide resistance. We investigated the efficacy of topically applied dsRNA to induce RNAi for five Cytochrome P450 genes family 4 (CYP4) in Diaphorina citri. We previously reported that these CYP4 genes are associated with the development of insecticide resistance in D. citri. We targeted five CYP4 genes that share a consensus sequence with one dsRNA construct. Quantitative PCR confirmed suppressed expression of the five CYP4 genes as a result of dsRNA topically applied to the thoracic region of D. citri when compared to the expression levels in a control group. Western blot analysis indicated a reduced signal of cytochrome P450 proteins (45 kDa) in adult D. citri treated with the dsRNA. In addition, oxidase activity and insecticide resistance were reduced for D. citri treated with dsRNA that targeted specific CYP4 genes. Mortality was significantly higher in adults treated with dsRNA than in adults treated with water. Our results indicate that topically applied dsRNA can penetrate the cuticle of D. citri and induce RNAi. These results broaden the scope of RNAi as a mechanism to manage pests by targeting a broad range of genes. The results also support the application of RNAi as a viable tool to overcome insecticide resistance development in D. citri populations. However, further research is needed to develop grower-friendly delivery systems for the application of dsRNA under field conditions. Considering the high specificity of dsRNA, this tool can also be used for management of D. citri by targeting physiologically critical genes involved in growth and development. PMID:25330026
Hymyc1 downregulation promotes stem cell proliferation in Hydra vulgaris.
Ambrosone, Alfredo; Marchesano, Valentina; Tino, Angela; Hobmayer, Bert; Tortiglione, Claudia
2012-01-01
Hydra is a unique model for studying the mechanisms underlying stem cell biology. The activity of the three stem cell lineages structuring its body constantly replenishes mature cells lost due to normal tissue turnover. By a poorly understood mechanism, stem cells are maintained through self-renewal while concomitantly producing differentiated progeny. In vertebrates, one of many genes that participate in regulating stem cell homeostasis is the protooncogene c-myc, which has been recently identified also in Hydra, and found expressed in the interstitial stem cell lineage. In the present paper, by developing a novel strategy of RNA interference-mediated gene silencing (RNAi) based on an enhanced uptake of small interfering RNAi (siRNA), we provide molecular and biological evidence for an unexpected function of the Hydra myc gene (Hymyc1) in the homeostasis of the interstitial stem cell lineage. We found that Hymyc1 inhibition impairs the balance between stem cell self renewal/differentiation, as shown by the accumulation of stem cell intermediate and terminal differentiation products in genetically interfered animals. The identical phenotype induced by the 10058-F4 inhibitor, a disruptor of c-Myc/Max dimerization, demonstrates the specificity of the RNAi approach. We show the kinetic and the reversible feature of Hymyc1 RNAi, together with the effects displayed on regenerating animals. Our results show the involvement of Hymyc1 in the control of interstitial stem cell dynamics, provide new clues to decipher the molecular control of the cell and tissue plasticity in Hydra, and also provide further insights into the complex myc network in higher organisms. The ability of Hydra cells to uptake double stranded RNA and to trigger a RNAi response lays the foundations of a comprehensive analysis of the RNAi response in Hydra allowing us to track back in the evolution and the origin of this process.
Hymyc1 Downregulation Promotes Stem Cell Proliferation in Hydra vulgaris
Ambrosone, Alfredo; Marchesano, Valentina; Tino, Angela; Hobmayer, Bert; Tortiglione, Claudia
2012-01-01
Hydra is a unique model for studying the mechanisms underlying stem cell biology. The activity of the three stem cell lineages structuring its body constantly replenishes mature cells lost due to normal tissue turnover. By a poorly understood mechanism, stem cells are maintained through self-renewal while concomitantly producing differentiated progeny. In vertebrates, one of many genes that participate in regulating stem cell homeostasis is the protooncogene c-myc, which has been recently identified also in Hydra, and found expressed in the interstitial stem cell lineage. In the present paper, by developing a novel strategy of RNA interference-mediated gene silencing (RNAi) based on an enhanced uptake of small interfering RNAi (siRNA), we provide molecular and biological evidence for an unexpected function of the Hydra myc gene (Hymyc1) in the homeostasis of the interstitial stem cell lineage. We found that Hymyc1 inhibition impairs the balance between stem cell self renewal/differentiation, as shown by the accumulation of stem cell intermediate and terminal differentiation products in genetically interfered animals. The identical phenotype induced by the 10058-F4 inhibitor, a disruptor of c-Myc/Max dimerization, demonstrates the specificity of the RNAi approach. We show the kinetic and the reversible feature of Hymyc1 RNAi, together with the effects displayed on regenerating animals. Our results show the involvement of Hymyc1 in the control of interstitial stem cell dynamics, provide new clues to decipher the molecular control of the cell and tissue plasticity in Hydra, and also provide further insights into the complex myc network in higher organisms. The ability of Hydra cells to uptake double stranded RNA and to trigger a RNAi response lays the foundations of a comprehensive analysis of the RNAi response in Hydra allowing us to track back in the evolution and the origin of this process. PMID:22292012
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and addressed the safety concerns of the marker genes in transgenic plants on the environments.
Complete In Vitro Life Cycle of Trypanosoma congolense: Development of Genetic Tools
Plazolles, Nicolas; Baltz, Théo
2010-01-01
Background Animal African trypanosomosis, a disease mainly caused by the protozoan parasite Trypanosoma congolense, is a major constraint to livestock productivity and has a significant impact in the developing countries of Africa. RNA interference (RNAi) has been used to study gene function and identify drug and vaccine targets in a variety of organisms including trypanosomes. However, trypanosome RNAi studies have mainly been conducted in T. brucei, as a model for human infection, largely ignoring livestock parasites of economical importance such as T. congolense, which displays different pathogenesis profiles. The whole T. congolense life cycle can be completed in vitro, but this attractive model displayed important limitations: (i) genetic tools were currently limited to insect forms and production of modified infectious BSF through differentiation was never achieved, (ii) in vitro differentiation techniques lasted several months, (iii) absence of long-term bloodstream forms (BSF) in vitro culture prevented genomic analyses. Methodology/Principal Findings We optimized culture conditions for each developmental stage and secured the differentiation steps. Specifically, we devised a medium adapted for the strenuous development of stable long-term BSF culture. Using Amaxa nucleofection technology, we greatly improved the transfection rate of the insect form and designed an inducible transgene expression system using the IL3000 reference strain. We tested it by expression of reporter genes and through RNAi. Subsequently, we achieved the complete in vitro life cycle with dramatically shortened time requirements for various wild type and transgenic strains. Finally, we established the use of modified strains for experimental infections and underlined a host adaptation phase requirement. Conclusions/Significance We devised an improved T. congolense model, which offers the opportunity to perform functional genomics analyses throughout the whole life cycle. It represents a very useful tool to understand pathogenesis mechanisms and to study potential therapeutic targets either in vitro or in vivo using a mouse model. PMID:20209144
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi.
Choi, Jaeyoung; Kim, Ki-Tae; Jeon, Jongbum; Wu, Jiayao; Song, Hyeunjeong; Asiegbu, Fred O; Lee, Yong-Hwan
2014-01-01
RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi.
Zhang, Nan; Membreno, Edward; Raj, Susan; Zhang, Hongjie; Khan, Liakot A; Gobel, Verena
2017-10-03
The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.
Blakqori, Gjon; Delhaye, Sophie; Habjan, Matthias; Blair, Carol D; Sánchez-Vargas, Irma; Olson, Ken E; Attarzadeh-Yazdi, Ghassem; Fragkoudis, Rennos; Kohl, Alain; Kalinke, Ulrich; Weiss, Siegfried; Michiels, Thomas; Staeheli, Peter; Weber, Friedemann
2007-05-01
La Crosse virus (LACV) is a mosquito-transmitted member of the Bunyaviridae family that causes severe encephalitis in children. For the LACV nonstructural protein NSs, previous overexpression studies with mammalian cells had suggested two different functions, namely induction of apoptosis and inhibition of RNA interference (RNAi). Here, we demonstrate that mosquito cells persistently infected with LACV do not undergo apoptosis and mount a specific RNAi response. Recombinant viruses that either express (rLACV) or lack (rLACVdelNSs) the NSs gene similarly persisted and were prone to the RNAi-mediated resistance to superinfection. Furthermore, in mosquito cells overexpressed LACV NSs was unable to inhibit RNAi against Semliki Forest virus. In mammalian cells, however, the rLACVdelNSs mutant virus strongly activated the antiviral type I interferon (IFN) system, whereas rLACV as well as overexpressed NSs suppressed IFN induction. Consequently, rLACVdelNSs was attenuated in IFN-competent mouse embryo fibroblasts and animals but not in systems lacking the type I IFN receptor. In situ analyses of mouse brains demonstrated that wild-type and mutant LACV mainly infect neuronal cells and that NSs is able to suppress IFN induction in the central nervous system. Thus, our data suggest little relevance of the NSs-induced apoptosis or RNAi inhibition for growth or pathogenesis of LACV in the mammalian host and indicate that NSs has no function in the insect vector. Since deletion of the viral NSs gene can be fully complemented by inactivation of the host's IFN system, we propose that the major biological function of NSs is suppression of the mammalian innate immune response.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
Corrêa, Régis L; Steiner, Florian A; Berezikov, Eugene; Ketting, René F
2010-04-08
RNA interference (RNAi) is a post-transcriptional silencing process, triggered by double-stranded RNA (dsRNA), leading to the destabilization of homologous mRNAs. A distinction has been made between endogenous RNAi-related pathways and the exogenous RNAi pathway, the latter being essential for the experimental use of RNAi. Previous studies have shown that, in Caenorhabditis elegans, a complex containing the enzymes Dicer and the Argonaute RDE-1 process dsRNA. Dicer is responsible for cleaving dsRNA into short interfering RNAs (siRNAs) while RDE-1 acts as the siRNA acceptor. RDE-1 then guides a multi-protein complex to homologous targets to trigger mRNA destabilization. However, endogenous role(s) for RDE-1, if any, have remained unexplored. We here show that RDE-1 functions as a scavenger protein, taking up small RNA molecules from many different sources, including the microRNA (miRNA) pathway. This is in striking contrast to Argonaute proteins functioning directly in the miRNA pathway, ALG-1 and ALG-2: these proteins exclusively bind miRNAs. While playing no significant role in the biogenesis of the main pool of miRNAs, RDE-1 binds endogenous miRNAs and triggers RdRP activity on at least one perfectly matching, endogenous miRNA target. The resulting secondary siRNAs are taken up by a set of Argonaute proteins known to act as siRNA acceptors in exogenous RNAi, resulting in strong mRNA destabilization. Our results show that RDE-1 in an endogenous setting is actively screening the transcriptome using many different small RNAs, including miRNAs, as a guide, with implications for the evolution of transcripts with a potential to be recognized by Dicer.
Guo, Xunyang; Zhang, Rui; Wang, Jeffrey; Lu, Rui
2013-10-01
Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein.
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests. PMID:29261729
Brettmann, Erin A; Shaik, Jahangheer S; Zangger, Haroun; Lye, Lon-Fye; Kuhlmann, F Matthew; Akopyants, Natalia S; Oschwald, Dayna M; Owens, Katherine L; Hickerson, Suzanne M; Ronet, Catherine; Fasel, Nicolas; Beverley, Stephen M
2016-10-25
Many Leishmania (Viannia) parasites harbor the double-stranded RNA virus Leishmania RNA virus 1 (LRV1), which has been associated with increased disease severity in animal models and humans and with drug treatment failures in humans. Remarkably, LRV1 survives in the presence of an active RNAi pathway, which in many organisms controls RNA viruses. We found significant levels (0.4 to 2.5%) of small RNAs derived from LRV1 in both Leishmania braziliensis and Leishmania guyanensis, mapping across both strands and with properties consistent with Dicer-mediated cleavage of the dsRNA genome. LRV1 lacks cis- or trans-acting RNAi inhibitory activities, suggesting that virus retention must be maintained by a balance between RNAi activity and LRV1 replication. To tilt this balance toward elimination, we targeted LRV1 using long-hairpin/stem-loop constructs similar to those effective against chromosomal genes. LRV1 was completely eliminated, at high efficiency, accompanied by a massive overproduction of LRV1-specific siRNAs, representing as much as 87% of the total. For both L. braziliensis and L. guyanensis, RNAi-derived LRV1-negative lines were no longer able to induce a Toll-like receptor 3-dependent hyperinflammatory cytokine response in infected macrophages. We demonstrate in vitro a role for LRV1 in virulence of L. braziliensis, the Leishmania species responsible for the vast majority of mucocutaneous leishmaniasis cases. These findings establish a targeted method for elimination of LRV1, and potentially of other Leishmania viruses, which will facilitate mechanistic dissection of the role of LRV1-mediated virulence. Moreover, our data establish a third paradigm for RNAi-viral relationships in evolution: one of balance rather than elimination.
Splice isoform-specific suppression of the CaV2.1 variant underlying Spinocerebellar ataxia type 6
Tsou, Wei-Ling; Soong, Bing-Wen; Paulson, Henry L.; Rodríguez-Lebrón, Edgardo
2011-01-01
Spinocerebellar ataxia type 6 (SCA6) is an inherited neurodegenerative disease caused by a polyglutamine (polyQ) expansion in the CaV2.1 voltage-gated calcium channel subunit (CACNA1A). There is currently no treatment for this debilitating disorder and thus a pressing need to develop preventative therapies. RNA interference (RNAi) has proven effective at halting disease progression in several models of spinocerebellar ataxia (SCA), including SCA types 1 and 3. However, in SCA6 and other dominantly inherited neurodegenerative disorders, RNAi-based strategies that selectively suppress expression of mutant alleles may be required. Using a CaV2.1 mini-gene reporter system, we found that pathogenic CAG expansions in CaV2.1 enhance splicing activity at the 3′end of the transcript, leading to a CAG repeat length-dependent increase in the levels of a polyQ-encoding CaV2.1 mRNA splice isoform and the resultant disease protein. Taking advantage of this molecular phenomenon, we developed a novel splice isoform-specific (SIS)-RNAi strategy that selectively targets the polyQ-encoding CaV2.1 splice variant. Selective suppression of transiently expressed and endogenous polyQ-encoding CaV2.1 splice variants was achieved in a variety of cell-based models including a human neuronal cell line, using a new artificial miRNA-like delivery system. Moreover, the efficacy of gene silencing correlated with effective intracellular recognition and processing of SIS-RNAi miRNA mimics. These results lend support to the preclinical development of SIS-RNAi as a potential therapy for SCA6 and other dominantly inherited diseases. PMID:21550405
Splice isoform-specific suppression of the Cav2.1 variant underlying spinocerebellar ataxia type 6.
Tsou, Wei-Ling; Soong, Bing-Wen; Paulson, Henry L; Rodríguez-Lebrón, Edgardo
2011-09-01
Spinocerebellar ataxia type 6 (SCA6) is an inherited neurodegenerative disease caused by a polyglutamine (polyQ) expansion in the Ca(V)2.1 voltage-gated calcium channel subunit (CACNA1A). There is currently no treatment for this debilitating disorder and thus a pressing need to develop preventative therapies. RNA interference (RNAi) has proven effective at halting disease progression in several models of spinocerebellar ataxia (SCA), including SCA types 1 and 3. However, in SCA6 and other dominantly inherited neurodegenerative disorders, RNAi-based strategies that selectively suppress expression of mutant alleles may be required. Using a Ca(V)2.1 mini-gene reporter system, we found that pathogenic CAG expansions in Ca(V)2.1 enhance splicing activity at the 3'end of the transcript, leading to a CAG repeat length-dependent increase in the levels of a polyQ-encoding Ca(V)2.1 mRNA splice isoform and the resultant disease protein. Taking advantage of this molecular phenomenon, we developed a novel splice isoform-specific (SIS)-RNAi strategy that selectively targets the polyQ-encoding Ca(V)2.1 splice variant. Selective suppression of transiently expressed and endogenous polyQ-encoding Ca(V)2.1 splice variants was achieved in a variety of cell-based models including a human neuronal cell line, using a new artificial miRNA-like delivery system. Moreover, the efficacy of gene silencing correlated with effective intracellular recognition and processing of SIS-RNAi miRNA mimics. These results lend support to the preclinical development of SIS-RNAi as a potential therapy for SCA6 and other dominantly inherited diseases. Copyright © 2011 Elsevier Inc. All rights reserved.
Guo, Xunyang; Zhang, Rui; Wang, Jeffrey
2013-01-01
Small interfering RNAs (siRNAs) processed from double-stranded RNA (dsRNA) of virus origins mediate potent antiviral defense through a process referred to as RNA interference (RNAi) or RNA silencing in diverse organisms. In the simple invertebrate Caenorhabditis elegans, the RNAi process is initiated by a single Dicer, which partners with the dsRNA binding protein RDE-4 to process dsRNA into viral siRNAs (viRNAs). Notably, in C. elegans this RNA-directed viral immunity (RDVI) also requires a number of worm-specific genes for its full antiviral potential. One such gene is rsd-2 (RNAi spreading defective 2), which was implicated in RDVI in our previous studies. In the current study, we first established an antiviral role by showing that rsd-2 null mutants permitted higher levels of viral RNA accumulation, and that this enhanced viral susceptibility was reversed by ectopic expression of RSD-2. We then examined the relationship of rsd-2 with other known components of RNAi pathways and established that rsd-2 functions in a novel pathway that is independent of rde-4 but likely requires the RNA-dependent RNA polymerase RRF-1, suggesting a critical role for RSD-2 in secondary viRNA biogenesis, likely through coordinated action with RRF-1. Together, these results suggest that RDVI in the single-Dicer organism C. elegans depends on the collective actions of both RDE-4-dependent and RDE-4-independent mechanisms to produce RNAi-inducing viRNAs. Our study reveals, for the first time, a novel siRNA-producing mechanism in C. elegans that bypasses the need for a dsRNA-binding protein. PMID:23885080
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
High throughput RNAi assay optimization using adherent cell cytometry.
Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W
2011-04-25
siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.
High throughput RNAi assay optimization using adherent cell cytometry
2011-01-01
Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450
RNA therapeutics targeting osteoclast-mediated excessive bone resorption
Wang, Yuwei; Grainger, David W
2011-01-01
RNA interference (RNAi) is a sequence-specific post-transcriptional gene silencing technique developed with dramatically increasing utility for both scientific and therapeutic purposes. Short interfering RNA (siRNA) is currently exploited to regulate protein expression relevant to many therapeutic applications, and commonly used as a tool for elucidating disease-associated genes. Osteoporosis and their associated osteoporotic fragility fractures in both men and women are rapidly becoming a global healthcare crisis as average life expectancy increases worldwide. New therapeutics are needed for this increasing patient population. This review describes the diversity of molecular targets suitable for RNAi-based gene knock-down in osteoclasts to control osteoclast-mediated excessive bone resorption. We identify strategies for developing targeted siRNA delivery and efficient gene silencing, and describe opportunities and challenges of introducing siRNA as a therapeutic approach to hard and connective tissue disorders. PMID:21945356