Sample records for interleukin-12 p40 homodimer

  1. The localisation of the heparin binding sites of human and murine interleukin-12 within the carboxyterminal domain of the P40 subunit.

    PubMed

    Garnier, Pascale; Mummery, Rosemary; Forster, Mark J; Mulloy, Barbara; Gibbs, Roslyn V; Rider, Christopher C

    2018-05-09

    We have previously shown that the heterodimeric cytokine interleukin-12, and the homodimer of its larger subunit p40, both bind to heparin and heparan sulfate with relatively high affinity. In the present study we characterised these interactions using a series of chemically modified heparins as competitive inhibitors. Human interleukin-12 and p40 homodimer show indistinguishable binding profiles with a panel of heparin derivatives, but that of murine interleukin-12 is distinct. Heparin markedly protects the human and murine p40 subunits, but not the p35 subunits, from cleavage by the bacterial endoprotease LysC, further implicating the larger subunit as the location of the heparin binding site. Moreover the essential role of the carboxyterminal D3 domain in heparin binding is established by the failure of a truncated construct of the p40 subunit lacking this domain to bind. Predictive docking calculations indicate that a cluster of basic residues at the tip of the exposed C'D' loop within D3 is important in heparin binding. However since the human and murine C'D' loops differ considerably in length, the mode and three dimensional orientation of heparin binding are likely to differ substantially between the human and murine p40s. Thus overall the binding of IL-12 via its p40 subunit to heparin-related polysaccharides of the extracellular matrix appears to be functionally important since it has been conserved across mammalian species despite this structural divergence. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Interferon induced protein 35 exacerbates H5N1 influenza disease through the expression of IL-12p40 homodimer.

    PubMed

    Gounder, Anshu P; Yokoyama, Christine C; Jarjour, Nicholas N; Bricker, Traci L; Edelson, Brian T; Boon, Adrianus C M

    2018-04-01

    Pro-inflammatory cytokinemia is a hallmark of highly pathogenic H5N1 influenza virus (IAV) disease yet little is known about the role of host proteins in modulating a pathogenic innate immune response. The host Interferon Induced Protein 35 (Ifi35) has been implicated in increased susceptibility to H5N1-IAV infection. Here, we show that Ifi35 deficiency leads to reduced morbidity in mouse models of highly pathogenic H5N1- and pandemic H1N1-IAV infection. Reduced weight loss in Ifi35-/- mice following H5N1-IAV challenge was associated with reduced cellular infiltration and decreased production of specific cytokines and chemokines including IL-12p40. Expression of Ifi35 by the hematopoietic cell compartment in bone-marrow chimeric mice contributed to increased immune cell recruitment and IL-12p40 production. In addition, Ifi35 deficient primary macrophages produce less IL-12p40 following TLR-3, TLR-4, and TLR-7 stimulation in vitro. Decreased levels of IL-12p40 and its homodimer, IL-12p80, were found in bronchoalveolar lavage fluid of H5N1-IAV infected Ifi35 deficient mice. Specific antibody blockade of IL-12p80 ameliorated weight loss and reduced cellular infiltration following H5N1-IAV infection in wild-type mice; suggesting that increased levels of IL-12p80 alters the immune response to promote inflammation and IAV disease. These data establish a role for Ifi35 in modulating cytokine production and exacerbating inflammation during IAV infection.

  3. Allograft dendritic cell p40 homodimers activate donor-reactive memory CD8+ T cells

    PubMed Central

    Tsuda, Hidetoshi; Su, Charles A.; Tanaka, Toshiaki; Ayasoufi, Katayoun; Min, Booki; Valujskikh, Anna; Fairchild, Robert L.

    2018-01-01

    Recipient endogenous memory T cells with donor reactivity pose an important barrier to successful transplantation and costimulatory blockade–induced graft tolerance. Longer ischemic storage times prior to organ transplantation increase early posttransplant inflammation and negatively impact early graft function and long-term graft outcome. Little is known about the mechanisms enhancing endogenous memory T cell activation to mediate tissue injury within the increased inflammatory environment of allografts subjected to prolonged cold ischemic storage (CIS). Endogenous memory CD4+ and CD8+ T cell activation is markedly increased within complete MHC-mismatched cardiac allografts subjected to prolonged versus minimal CIS, and the memory CD8+ T cells directly mediate CTLA-4Ig–resistant allograft rejection. Memory CD8+ T cell activation within allografts subjected to prolonged CIS requires memory CD4+ T cell stimulation of graft DCs to produce p40 homodimers, but not IL-12 p40/p35 heterodimers. Targeting p40 abrogates memory CD8+ T cell proliferation within the allografts and their ability to mediate CTLA-4Ig–resistant allograft rejection. These findings indicate a critical role for memory CD4+ T cell–graft DC interactions to increase the intensity of endogenous memory CD8+ T cell activation needed to mediate rejection of higher-risk allografts subjected to increased CIS. PMID:29467328

  4. Cloning, promoter analysis and expression in response to bacterial exposure of sea bass (Dicentrarchus labrax L.) interleukin-12 p40 and p35 subunits.

    PubMed

    Nascimento, Diana S; do Vale, Ana; Tomás, Ana M; Zou, Jun; Secombes, Christopher J; dos Santos, Nuno M S

    2007-03-01

    Interleukin-12 (IL-12) is a heterodimeric cytokine pivotal in resistance to microbial and viral infections. In the search for immunoregulatory genes in sea bass the genes for the two IL-12 subunits p40 and p35 were cloned and sequenced. Molecular characterization of these two genes was performed at both the cDNA and genomic levels. Sea bass IL-12 p40 and p35 conserve most cysteines involved in the intra-chain disulfide bonds of human IL-12 subunits as well as the important structural residues for human IL-12 heterodimerization. The gene organization of sea bass IL-12 p40 is similar to the human orthologue, whilst the sea bass IL-12 p35 gene structure, as reported for pufferfish, differs from the human one in containing an additional exon and lacking a second copy of a duplicated exon present in the mammalian genes. The promoter analysis of both sea bass and pufferfish IL-12 genes showed the presence of the main cis-acting elements involved in the transcriptional regulation of human and mouse orthologues. The involvement of IL-12 in sea bass anti-bacterial immune responses was demonstrated by investigating the expression profiles of IL-1beta, IL-12 p40 and p35 in the head-kidney and spleen following intraperitoneal injection of UV-killed and live Photobacterium damselae ssp. piscicida (Phdp). Finally, the importance of nuclear factor (NF)-kappaB on UV-killed Phdp-induced IL-12 p40 and p35 gene transcription was shown by the use of pyrrolidine dithiocarbamate (PDTC).

  5. Tumor Necrosis Factor-α, Interleukins-12(p40), 6, and 10 levels in cerebrospinal fluid and outcome prediction in Ossimi sheep with encephalitic listeriosis.

    PubMed

    Abdlla, Ossama A; Elboshy, Mohamed E; Reisha, Engy F; Gadlla, Hossam A; El-Khodery, Sabry A

    2015-06-01

    Encephalitic listeriosis in sheep is a life-threatening disease. However, little is known about the cytokine response and their predictive value in this disease. The aim of present study was to assess the prognostic significance of Tumor Necrosis Factor-α (TNF-α), Interleukin-12(p40) (IL-12 p40), Interleukin-6 (IL-6), and Interleukin 10 (IL-10) levels in cerebrospinal fluid (CSF) in sheep with encephalitic listeriosis. Fifty-nine ewes in 14 flocks were diagnosed clinically as having listeriosis. CSF was collected and subjected to bacteriological examination and estimation of selected cytokines. Twenty-eight ewes were confirmed to be infected with Listeria monocytogenes. Based on antimicrobial sensitivity test, sheep were treated and the outcome was recorded as survivors (n=10) and non-survivors (n=18). Cutoff points for CSF cytokines were determined by Receiver operating characteristic analysis (ROC). Association between levels of CSF cytokines and outcome of listeriosis was assessed by logistic regression. TNF-α, IL-6 and IL-12(p40) levels as well as TNF-α/IL-10 ratio were significantly higher in non-survivors than survivors (p=0.002, 0.0021, 0.0033, and 0.001, respectively). However, IL-10 level was significantly lower in non-survivors than survivors (p=0.0058). ROC analysis revealed that IL-6 and TNF-α/IL-10 ratio had the highest AUC values (0.98, 0.984, respectively). Final multivariate logistic regression model showed that TNF-α/IL-10 ratio was the only variable that has predictive value for mortality in diseased sheep (p: 0.001; OR: 7.2; 95% CI: 5.7-9.8). TNF-α showed a positive correlation with IL-12β (r=0.917) and IL-6 (r=0.965). IL-12 (p40) showed also a positive correlation with IL-6 (r=0.906). However, IL-10 showed a negative correlation with TNF-α (r=-0.915), IL-12(p40) (r=-0.790), and IL-6 (r=-0.902). In conclusion, TNF-α/IL-10 ratio may provide predictive information about outcome of encephalitic listeriosis in sheep. Copyright © 2015

  6. The secreted form of the p40 subunit of interleukin (IL)-12 inhibits IL-23 functions and abrogates IL-23-mediated antitumour effects

    PubMed Central

    Shimozato, Osamu; Ugai, Shin-ichi; Chiyo, Masako; Takenobu, Hisanori; Nagakawa, Hiroyasu; Wada, Akihiko; Kawamura, Kiyoko; Yamamoto, Hiroshi; Tagawa, Masatoshi

    2006-01-01

    Interleukin (IL)-23 is a heterodimeric cytokine consisting of a novel p19 molecule and the p40 subunit of IL-12. Since secreted p40 can act as an antagonist for IL-12, we investigated whether p40 also inhibited IL-23-mediated immunological functions. p40 did not induce interferon (IFN)-γ or IL-17 production from splenocytes but impaired IL-23-induced cytokine production by competitive binding to the IL-23 receptors. Furthermore, a mixed population of murine colon carcinoma Colon 26 cells transduced with the p40 gene and those transduced with the IL-23 gene developed tumours in syngenic mice, whereas the IL-23-expressing Colon 26 cells were completely rejected. p40 also suppressed IFN-γ production of antigen-stimulated splenocytes and IL-23-mediated cytotoxic T-lymphocyte activities in the mice that rejected Colon 26 cells expressing IL-23. p40 can thereby antagonize IL-23 and is a possible therapeutic agent for suppression of IL-23 functions. PMID:16423037

  7. Synergistic regulation of the human interleukin-12 p40 promoter by NFkappaB and Ets transcription factors in Epstein-Barr virus-transformed B cells and macrophages.

    PubMed

    Gri, G; Savio, D; Trinchieri, G; Ma, X

    1998-03-13

    Monocytes/macrophages produce interleukin-12 (IL-12) in response to pathogenic stimulation, whereas most Epstein-Barr virus-transformed (EBV+) B cells constitutively secrete IL-12. The molecular mechanism regulating the constitutive IL-12 gene expression in EBV+ B cells has not been addressed. In this study, using the EBV+ B cell line RPMI-8866, we localized to the human IL-12 p40 promoter two essential cis elements, the NFkappaB site and the Ets site. The NFkappaB site was shown to interact with members of the NFkappaB family: p50 and c-Rel. The Ets site constitutively bound a multi-component Ets-2-containing complex. While the NFkappaB and Ets sites appear equally critical for inducible p40 promoter activity in macrophage cell lines, NFkappaB plays a more dominant role in the constitutive p40 promoter activity in EBV+ B cells. Transient expression of Ets-2 and c-Rel in B, T, and monocytic cell lines synergistically activated the IL-12 p40 promoter, apparently overcoming the requirement for cell type- or stimulant-specific transcription factors. These data provide new evidence that full activation of the human IL-12 p40 promoter may result primarily from the interplay between NFkappaB and Ets family members.

  8. The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

    PubMed Central

    Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

    2013-01-01

    IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

  9. Rock bream (Oplegnathus fasciatus) IL-12p40: identification, expression, and effect on bacterial infection.

    PubMed

    Zhang, Lu; Zhang, Bao-Cun; Hu, Yong-Hua

    2014-08-01

    IL-12p40, also called IL-12β, is a subunit of the proinflammatory cytokines interleukin (IL)-12 and IL-23. In teleost, IL-12p40 homologues have been identified in several species, however, the biological function of fish IL-12p40 is essentially unknown. In this work, we reported the identification and analysis of an IL-12p40, OfIL-12p40, from rock bream (Oplegnathus fasciatus). OfIL-12p40 is composed of 361 amino acids and possesses a conserved IL-12p40 domain and a WSxWS signature motif characteristic of known IL-12p40. Constitutive expression of OfIL-12p40 occurred in multiple tissues and was highest in kidney. Experimental infection with bacterial pathogen upregulated the expression of OfIL-12p40 in kidney and spleen in a time-dependent manner. Purified recombinant OfIL-12p40 (rOfIL-12p40) stimulated the respiratory burst activity of peripheral blood leukocytes in a dose-dependent manner. rOfIL-12p40 also enhanced the resistance of rock bream against bacterial infection and upregulated the expression of innate immune genes in kidney. Taken together, these results indicate that OfIL-12p40 possesses cytokine-like property and plays a role in immune defense against bacterial infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. IL-12p40 impairs mesenchymal stem cell-mediated bone regeneration via CD4+ T cells

    PubMed Central

    Xu, Jiajia; Wang, Yiyun; Li, Jing; Zhang, Xudong; Geng, Yiyun; Huang, Yan; Dai, Kerong; Zhang, Xiaoling

    2016-01-01

    Severe or prolonged inflammatory response caused by infection or biomaterials leads to delayed healing or bone repair failure. This study investigated the important roles of the proinflammatory cytokines of the interleukin-12 (IL-12) family, namely, IL-12 and IL-23, in the inflammation-mediated inhibition of bone formation in vivo. IL-12p40−/− mice lacking IL-12 and IL-23 exhibited enhanced bone formation. IL-12 and IL-23 indirectly inhibited bone marrow mesenchymal stem cell (BMMSC) differentiation by stimulating CD4+ T cells to increase interferon γ (IFN-γ) and IL-17 levels. Mechanistically, IL-17 synergistically enhanced IFN-γ-induced BMMSC apoptosis. Moreover, INF-γ and IL-17 exerted proapoptotic effects by upregulating the expression levels of Fas and tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), as well as by activating the caspase cascade in BMMSCs. IL-12p40 depletion in mice could promote ectopic bone formation. Thus, IL-12p40 is an attractive therapeutic target to overcome the inflammation-mediated inhibition of bone formation in vivo. PMID:27472064

  11. [Tobacco--a producer of recombinant interleukins].

    PubMed

    Budzianowski, Jaromir

    2012-01-01

    Interleukins are cytokines of highly pleiotropic activity and they have high potential for application in the treatment of cancer and autoimmune diseases. Trials of recombinant interleukin production in plants relate almost exclusively to tobacco, where through the transformation of the nuclear genome (agroinfection) monomeric (IL-2, IL-4, IL-13, IL-18), homodimeric (IL-10) and single-chain heterodimeric (IL-12) interleukins have been obtained. The expression of IL-10 as a homodimer in the chloroplast genome could not be reached. Expression of the given interleukin was obtained in the leaves, cell culture and culture of hairy roots of tobacco. Interleukins obtained in tobacco showed similar in vitro biological activity as commercial ILs produced mostly in E. coli. Glycosylated IL-13 obtained in tobacco was much more resistant to proteolytic digestion than commercial non-glycosylated IL-13; therefore in the case of sufficiently large production it could be suitable for oral administration in the treatment of type I diabetes.

  12. Human Leukocyte Antigen and Interleukin 2, 10 and 12p40 Cytokine Responses to Measles: Is There Evidence of the HLA Effect?

    PubMed Central

    Ovsyannikova, Inna G.; Ryan, Jenna E.; Jacobson, Robert M.; Vierkant, Robert A.; Pankratz, V. Shane; Poland, Gregory A.

    2007-01-01

    HLA class I and class II associations were examined in relation to measles virus-specific cytokine responses in 339 healthy children who had received two doses of live attenuated measles vaccine. Multivariate linear regression modeling analysis revealed suggestions of associations between the expression of DPA1*0201 (p=0.03) and DPA1*0202 (p=0.09) alleles and interleukin-2 (IL-2) cytokine production (global p-value 0.06). Importantly, cytokine production and DQB1 allele associations (global p-value 0.04) revealed that the alleles with the strongest association with IL-10 secretion were DQB1*0302 (p=0.02), DQB1*0303 (p=0.07) and DQB1*0502 (p=0.06). Measles-specific IL-10 secretion associations approached significance with DRB1 and DQA1 loci (both global p-values 0.08). Specifically, suggestive associations were found between DRB1*0701 (p=0.07), DRB1*1103 (p=0.06), DRB1*1302 (p=0.08), DRB1*1303 (p=0.06), DQA1*0101 (p=0.08), and DQA1*0201 (p=0.04) alleles and measles-induced IL-10 secretion. Further, suggestive association was observed between specific DQA1*0505 (p=0.002) alleles and measles-specific IL-12p40 secretion (global p-value 0.09) indicating that cytokine responses to measles antigens are predominantly influenced by HLA class II genes. We found no associations between any of the alleles of HLA A, B, and Cw loci and cytokine secretion. These novel findings suggest that HLA class II genes may influence the level of cytokine production in the adaptive immune responses to measles vaccine. PMID:17234427

  13. 40 CFR 721.10425 - Substituted alkylamides (generic) (P-12-51 and P-12-52).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Substituted alkylamides (generic) (P-12-51 and P-12-52). 721.10425 Section 721.10425 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10425 Substituted alkylamides (generic) (P-12-51 and P...

  14. 40 CFR 721.10425 - Substituted alkylamides (generic) (P-12-51 and P-12-52).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Substituted alkylamides (generic) (P-12-51 and P-12-52). 721.10425 Section 721.10425 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10425 Substituted alkylamides (generic) (P-12-51 and P...

  15. 40 CFR 721.10425 - Substituted alkylamides (generic) (P-12-51 and P-12-52).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Substituted alkylamides (generic) (P-12-51 and P-12-52). 721.10425 Section 721.10425 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10425 Substituted alkylamides (generic) (P-12-51 and P...

  16. Differential regulation of interleukin 12 and interleukin 23 production in human dendritic cells

    PubMed Central

    Gerosa, Franca; Baldani-Guerra, Barbara; Lyakh, Lyudmila A.; Batoni, Giovanna; Esin, Semih; Winkler-Pickett, Robin T.; Consolaro, Maria Rita; De Marchi, Mario; Giachino, Daniela; Robbiano, Angela; Astegiano, Marco; Sambataro, Angela; Kastelein, Robert A.; Carra, Giuseppe; Trinchieri, Giorgio

    2008-01-01

    We analyzed interleukin (IL) 12 and IL-23 production by monocyte-derived dendritic cells (mono-DCs). Mycobacterium tuberculosis H37Rv and zymosan preferentially induced IL-23. IL-23 but not IL-12 was efficiently induced by the combination of nucleotide-binding oligodimerization domain and Toll-like receptor (TLR) 2 ligands, which mimics activation by M. tuberculosis, or by the human dectin-1 ligand β-glucan alone or in combination with TLR2 ligands, mimicking induction by zymosan. TLR2 ligands inhibited IL-12 and increased IL-23 production. DC priming with interferon (IFN) γ strongly increased IL-12 production, but was not required for IL-23 production and inhibited IL-23 production induced by β-glucan. The pattern of IL-12 and IL-23 induction was reflected in accumulation of the IL-12p35 and IL-23p19 transcripts, respectively, but not IL-12/23p40. Although IL-23, transforming growth factor β, and IL-6 contained in the supernatants of activated mono-DCs played a role in the induction of IL-17 by human CD4+ T cells, IL-1β, in combination with one or more of those factors, was required for IL-17 production, and its production determined the differential ability of the stimuli used to elicit mono-DCs to produce soluble factors directing IL-17 production. Thus, the differential ability of pathogens to induce antigen-presenting cells to produce cytokines regulates the immune response to infection. PMID:18490488

  17. Interleukin-10 functions in vitro and in vivo to inhibit bacterial DNA-induced secretion of interleukin-12.

    PubMed

    Anitescu, M; Chace, J H; Tuetken, R; Yi, A K; Berg, D J; Krieg, A M; Cowdery, J S

    1997-12-01

    Bacterial DNA (bDNA) has a number of biologic properties, including the ability to induce interleukin-12 (IL-12) production by macrophages. We studied the role of the regulatory cytokine IL-10 as a potential inhibitor of bDNA-induced IL-12 production. IL-10 concentrations as low as 0.3 ng/ml profoundly inhibited bDNA-induced macrophage IL-12 production as measured by Elispot analysis of IL-12 p40-secreting cells. Additionally, we found that IL-10 inhibited bDNA-induced IL-12 secretion by the macrophage cell lines J774 and RAW 264. Preincubation of splenic adherent cells with IL-10 markedly reduced bDNA-induced transcription of IL-12 p40 mRNA. Interestingly, after 2 h of exposure, bDNA also induces transcription of IL-10 mRNA by splenic adherent cells. The importance of IL-10 in the in vivo regulation of bDNA-induced cytokine secretion was illustrated by the response of mice with disrupted IL-10 genes (IL-10 ko mice) to i.v. bDNA challenge. Compared to +/+ mice, IL-10 knockout (ko) mice exhibited increased numbers of IL-12 and interferon-gamma (IFN-gamma)-secreting cells following either single or repeated challenge with bDNA. These findings indicate that IL-10 plays a key role in regulating bDNA-induced production of inflammatory cytokines.

  18. Fasting metabolism modulates the interleukin-12/interleukin-10 cytokine axis

    PubMed Central

    Kernbauer, Elisabeth; Hölzl, Markus A.; Hofer, Johannes; Gualdoni, Guido A.; Schmetterer, Klaus G.; Miftari, Fitore; Sobanov, Yury; Meshcheryakova, Anastasia; Mechtcheriakova, Diana; Witzeneder, Nadine; Greiner, Georg; Ohradanova-Repic, Anna; Waidhofer-Söllner, Petra; Säemann, Marcus D.; Decker, Thomas

    2017-01-01

    A crucial role of cell metabolism in immune cell differentiation and function has been recently established. Growing evidence indicates that metabolic processes impact both, innate and adaptive immunity. Since a down-stream integrator of metabolic alterations, mammalian target of rapamycin (mTOR), is responsible for controlling the balance between pro-inflammatory interleukin (IL)-12 and anti-inflammatory IL-10, we investigated the effect of upstream interference using metabolic modulators on the production of pro- and anti-inflammatory cytokines. Cytokine release and protein expression in human and murine myeloid cells was assessed after toll-like receptor (TLR)-activation and glucose-deprivation or co-treatment with 5′-adenosine monophosphate (AMP)-activated protein kinase (AMPK) activators. Additionally, the impact of metabolic interference was analysed in an in-vivo mouse model. Glucose-deprivation by 2-deoxy-D-glucose (2-DG) increased the production of IL-12p40 and IL-23p19 in monocytes, but dose-dependently inhibited the release of anti-inflammatory IL-10. Similar effects have been observed using pharmacological AMPK activation. Consistently, an inhibition of the tuberous sclerosis complex-mTOR pathway was observed. In line with our in vitro observations, glycolysis inhibition with 2-DG showed significantly reduced bacterial burden in a Th2-prone Listeria monocytogenes mouse infection model. In conclusion, we showed that fasting metabolism modulates the IL-12/IL-10 cytokine balance, establishing novel targets for metabolism-based immune-modulation. PMID:28742108

  19. Expression of biologically active recombinant porcine interleukin-12 from Escherichia coli.

    PubMed

    Morris, K R; Bruce, M P; Janardhana, V; Thomas, J D; Bean, A G D; Strom, D G

    2008-12-15

    The control of viral infections is of critical importance to livestock industries worldwide and is highlighted by costly infection outbreaks, such as that seen with foot and mouth disease virus. To ameliorate the impact of increasing problems with viral infections, new vaccine and anti-viral strategies are required and a greater understanding of the anti-viral response is essential. Furthermore, in pigs, evidence is still being gathered on the components of a defined anti-viral immune response. However, this has been greatly improved by the recent cloning and expression of critical cytokines involved in the anti-viral response. To assess the use of recombinant porcine interleukin-12 (rPoIL-12) as an immunotherapeutic and immunomodulator of swine, we have cloned and expressed rPoIL-12 as a single-chain fusion protein from Esherichia coli (E. coli). The fusion encodes the p40 and p35 subunits, linked by a glycine-serine linker and expressed as a C-terminal 6xHis tagged protein. rPoIL-12 stimulated the proliferation of human lymphoblasts and its activity on porcine cells was demonstrated by the ability of rPoIL-12 to increase the mRNA expression of porcine interleukin-18 receptor-alpha (poIL-18Ralpha) from porcine peripheral blood mononuclear cells (PoPMBCs). This data supports the inclusion of E. coli produced rPoIL-12 in immunomodulation strategies in the pig.

  20. Identification of a single p19 gene and three p40 paralogues in grass carp (Ctenopharyngodon idellus): Their potential for the formation of interleukin 23 and inducible expression in vitro and in vivo.

    PubMed

    Wang, Xinyan; Qin, Lei; Du, Linyong; Chen, Di; Zhang, Anying; Yang, Kun; Zhou, Hong

    2017-12-01

    Interleukin (IL-) 23, a member of IL-12 family, is a composite cytokine with the subunits of p19 and p40. Although IL-12 and IL-23 share the p40 subunit, they play vastly different roles in immune regulation. In teleost, much emphasis has been placed on the identification of IL-12, but evidence for the existence of IL-23 is still lacking. In the present study, a p19 gene and three p40 paralogues were isolated and identified from grass carp, suggesting multiple assembly of IL-23 molecules in fish species. To address this issue, the existence of different p19/p40 heterodimers were examined by Co-Immunoprecipitation (Co-IP) assay, showing that only co-expression of p19 and each p40 subunit could produce the soluble proteins corresponding to three IL-23 isoforms. Additionally, bacterial infection could up-regulate the mRNA expression of p19, p40a and p40b but not p40c in head kidney, indicating distinct expression patterns of three p40 paralogues. Moreover, in vitro experiments demonstrated that both B-cell stimulator, LPS and T-cell mitogen, PHA markedly increased the mRNA levels of p19 and three p40 paralogues in grass carp periphery blood lymphocytes (PBLs). The simultaneous up-regulation of mRNA expression of p19 and p40 paralogues in response to immune stimuli supports the idea that p19 may form heterodimeric molecules with three p40 subunits in grass carp under immune activation. These findings for the first time highlight the potential of p19 and p40 for dimerization in fish, particularly the existence of three IL-23 isoforms as soluble heterodimeric cytokines in grass carp, thereby providing the basis for further investigating the function of IL-23 in fish immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Functional analyses of the interaction of chicken interleukin 23 subunit p19 with IL-12 subunit p40 to form the IL-23 complex.

    PubMed

    Truong, Anh Duc; Hoang, Cong Thanh; Hong, Yeojin; Lee, Janggeun; Lee, Kyungbaek; Lillehoj, Hyun S; Hong, Yeong Ho

    2017-12-01

    This study represents the first description of the cloning of chicken IL-23p19 (ChIL-23α) and the function of the IL-23 complex in birds. Multiple alignment of ChIL-23α with other known IL-23α amino acid sequences revealed regions of amino acid conservation. The homologies of ChIL-23α, IL-12p35, and similar mammalian subunits ranged between 26% and 42%. ChIL-23α consisted of four exons and three introns; similar to those in humans and mice, and limited conservation of synteny between the human and chicken genomes was observed. Using bioinformatics tools, we identified the NF-κB, C/EBPα-β, c-Jun, c-Rel, AP-1, GATA-1, and ER promoter sites in ChIL-23α. Moreover, IL-23α mRNA was more highly expressed than IL-12p40 and IL-12p35 mRNA in several organs of chickens infected with Salmonella. In addition, ChIL-23 complex are associated with IL-23R, IL-12Rβ1 receptors; activate the JAK2/TYK2, STAT1/3, SOCS1 genes, and induced proinflammatory cytokines in immune cells. Collectively, these results indicate that ChIL-23 is a member of the IL-12 family, has proinflammatory properties related to IL-23R and IL-12Rβ1 receptor expression, and activates the JAK/STAT signaling pathway that results in the interaction of ChIL-23α with ChIL-12p40 to form the novel ChIL-23 complex. Our results provide novel insights into the regulation of immunity, inflammation, and immunopathology. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus.

    PubMed

    Cortés-Vieyra, Ricarda; Silva-García, Octavio; Oviedo-Boyso, Javier; Huante-Mendoza, Alejandro; Bravo-Patiño, Alejandro; Valdez-Alarcón, Juan J; Finlay, B Brett; Baizabal-Aguirre, Víctor M

    2015-01-01

    Glycogen synthase kinase 3 (GSK3) is a constitutively active regulatory enzyme that is important in cancer, diabetes, and cardiovascular, neurodegenerative, and psychiatric diseases. While GSK3α is usually important in neurodegenerative and psychiatric diseases GSK3β is fundamental in the inflammatory response caused by bacterial components. Peptidoglycan (PGN), one of the most abundant cell-wall structures of Gram-positive bacteria, is an important inducer of inflammation. To evaluate whether inhibition of GSK3α and GSK3β activity in bovine endothelial cells (BEC) regulates the expression of the pro-inflammatory cytokine IL-12p40, we treated BEC with SDS-purified PGN from Staphylococcus aureus. We found that PGN triggered a TLR2/PI3K/Akt-dependent phosphorylation of GSK3α at Ser21, GSK3β at Ser9, and NF-κB p65 subunit (p65) at Ser536, and the phosphorylation of GSK3α was consistently higher than that of GSK3β. The expression of IL-12p40 was inhibited in BEC stimulated with PGN and pre-treated with a specific neutralizing anti-TLR2 antibody that targets the extracellular domain of TLR2 or by the addition of Akt-i IV (an Akt inhibitor). Inhibition of GSK3α and GSK3β with LiCl or SB216763 induced an increase in IL-12p40 mRNA and protein. The effect of each isoform on IL-12p40 expression was evaluated by siRNA-gene expression silencing of GSK3α and GSK3β. GSK3α gene silencing resulted in a marked increase in IL-12p40 mRNA and protein while GSK3β gene silencing had the opposite effect on IL-12p40 expression. These results indicate that the TLR2/PI3K/Akt-dependent inhibition of GSK3α activity also plays an important role in the inflammatory response caused by stimulation of BEC with PGN from S. aureus.

  3. Influence of interleukin 12 on p53 peptide vaccination against established Meth A sarcoma.

    PubMed Central

    Noguchi, Y; Richards, E C; Chen, Y T; Old, L J

    1995-01-01

    BALB/c murine sarcoma Meth A is known to have three missense point mutations in p53. We previously reported that a nonamer peptide containing the codon 234 mutational product (designated 234CM) elicited 234CM-specific cytotoxic T cells and that immunization with 234CM in adjuvant before tumor challenge inhibited Meth A growth. Because interleukin 12 (IL-12) has been shown to have antitumor activity against established tumors and immuno-modulatory activities, we analyzed its effect on p53 peptide immunization and Meth A growth. Multiple injections of IL-12 alone (4 times a week for 2 weeks) caused regression of established Meth A sarcoma, and this effect was dose dependent. IL-12 treatment prior to Meth A challenge had little or no antitumor activity. To evaluate the effect of IL-12 on the generation of 234CM-specific cytotoxic T lymphocytes, spleen cells from BALB/c mice immunized with 234CM in adjuvant and injected with various doses of IL-12 were sensitized with 234CM in vitro. Multiple injections of 1 ng of IL-12 induced the highest cytotoxicity against target cells pulsed with 234CM. Higher doses of IL-12 suppressed 234CM-specific cytotoxic T-cell generation. Mice immunized with 234CM in QS-21 adjuvant and treated with 1 ng of IL-12 rejected established Meth A sarcoma. Mice comparably treated with 1 ng of IL-12 but immunized with 234CW peptide (the wild-type counterpart to 234CM) in QS-21 or with QS-21 alone showed progressive tumor growth. PMID:7892250

  4. Trastuzumab has preferential activity against breast cancers driven by HER2 homodimers

    PubMed Central

    Ghosh, Ritwik; Narasanna, Archana; Wang, Shizhen Emily; Liu, Shuying; Chakrabarty, Anindita; Balko, Justin M.; González-Angulo, Ana María; Mills, Gordon B.; Penuel, Elicia; Winslow, John; Sperinde, Jeff; Dua, Rajiv; Pidaparthi, Sailaja; Mukherjee, Ali; Leitzel, Kim; Kostler, Wolfgang J.; Lipton, Allan; Bates, Michael; Arteaga, Carlos L.

    2011-01-01

    In breast cancer cells with HER2 gene amplification, HER2 receptors exist on the cell surface as monomers, homodimers and heterodimers with EGFR/HER3. The therapeutic antibody trastuzumab, an approved therapy for HER2+ breast cancer, cannot block ligand-induced HER2 heterodimers, suggesting it cannot effectively inhibit HER2 signaling. Hence, HER2 oligomeric states may predict the odds of a clinical response to trastuzumab in HER2-driven tumors. To test this hypothesis, we generated non-transformed human MCF10A mammary epithelial cells stably expressing a chimeric HER2-FKBP molecule that could be conditionally induced to homodimerize by adding the FKBP ligand AP1510, or instead induced to heterodimerize with EGFR or HER3 by adding the heterodimer ligands EGF/TGFα or heregulin. AP1510, EGF, and heregulin each induced growth of MCF10A cells expressing HER2-FKBP. As expected, trastuzumab inhibited homodimer-mediated but not heterodimer-mediated cell growth. In contrast, the HER2 antibody pertuzumab, which blocks HER2 heterodimerization, inhibited growth induced by heregulin but not AP1510. Lastly, HER2/EGFR tyrosine kinase inhibitor lapatinib blocked both homodimer- and heterodimer-induced growth. AP1510 triggered phosphorylation of Erk1/2 but not AKT, whereas trastuzumab inhibited AP1510-induced Erk1/2 phosphorylation and Shc-HER2 homodimer binding, but not TGFα-induced AKT phosphorylation. Consistent with these observations, high levels of HER2 homodimers correlated with longer time to progression following trastuzumab therapy in a cohort of HER2-overexpressing patients. Together, our findings corroborate the hypothesis that HER2 oligomeric states regulate HER2 signaling, also arguing that trastuzumab sensitivity of homodimers reflects an inability to activate the PI3K/AKT pathway. One of the most important clinical implications of our results is that high levels of HER2 homodimers may predict a positive response to trastuzumab. PMID:21324925

  5. Activation of RelA homodimers by tumour necrosis factor α: a possible transcriptional activator in human vascular endothelial cells

    PubMed Central

    2005-01-01

    In vascular endothelial cells, cytokines induce genes that are expressed in inflammatory lesions partly through the activation of transcription factor NF-κB (nuclear factor-κB). Among the members of the NF-κB/rel protein family, homodimers of the RelA subunit of NF-κB can also function as strong transactivators when expressed in cells. However, the functional role of endogenous RelA homodimers has not been clearly elucidated. We investigated whether RelA homodimers are induced in cytokine-treated vascular endothelial cells. Gel mobility-shift and supershift assays revealed that a cytokine TNFα (tumour necrosis factor α) activated both NF-κB1/RelA heterodimers and RelA homodimers that bound to a canonical κB sequence, IgκB (immunoglobulin κB), in SV40 (simian virus 40) immortalized HMEC-1 (human dermal microvascular endothelial cell line 1). In HMEC-1 and HUVEC (human umbilical-vein endothelial cells), TNFα also induced RelA homodimers that bound to the sequence 65-2κB, which specifically binds to RelA homodimers but not to NF-κB1/RelA heterodimers in vitro. Deoxycholic acid, a detergent that can dissociate the NF-κB–IκB complex (where IκB stands for inhibitory κB), induced the binding of the RelA homodimers to 65-2κB from the cytosolic fraction of resting HMEC-1. Furthermore, TNFα induced the transcriptional activity of a reporter gene that was driven by 65-2κB in HMEC-1. These results suggest that in addition to NF-κB1/RelA heterodimers, TNFα also induces RelA homodimers that are functionally active. Thus RelA homodimers may actively participate in cytokine regulation of gene expression in human vascular endothelial cells. PMID:15876188

  6. Signaling pathways of interleukin-1 actions in the brain: anatomical distribution of phospho-ERK1/2 in the brain of rat treated systemically with interleukin-1beta.

    PubMed

    Nadjar, A; Combe, C; Busquet, P; Dantzer, R; Parnet, P

    2005-01-01

    Interleukin-1beta is released at the periphery during infection and acts on the nervous system to induce fever, neuroendocrine activation, and behavioral changes. These effects are mediated by brain type I IL-1 receptors. In vitro studies have shown the ability of interleukin-1beta to activate mitogen-activated protein kinase signaling pathways including p38, c-Jun N-terminal kinase and extracellular signal-regulated protein kinase 1 and 2 (ERK1/2). In contrast to other mitogen-activated protein kinases, little is known about ERK1/2 activation in the rat brain in response to interleukin-1beta. The aim of the present study was therefore to investigate spatial and temporal activation of ERK1/2 in the rat brain after peripheral administration of interleukin-1beta using immunohistochemistry to detect the phosphorylated form of the kinase. In non-stimulated conditions, phosphorylated ERK1/2 immunoreactivity was observed in neurons throughout the brain. Administration of interleukin-1beta (60 microg/kg, i.p.) induced the phosphorylation of ERK1/2 in areas at the interface between brain and blood or cerebrospinal fluid: meninges, circumventricular organs, endothelial like cells of the blood vessels, and in brain nuclei involved in behavioral depression, fever and neuroendocrine activation: paraventricular nucleus of the hypothalamus, supraoptic nucleus, central amygdala and arcuate nucleus. Double labeling of phosphorylated ERK1/2 and cell markers revealed the expression of phosphorylated ERK1/2 in neurons, astrocytes and microglia. Since phosphorylated ERK1/2 was found in structures in which type I IL-1 receptor has already been identified as well as in structures lacking this receptor, activation of ERK1/2 is likely to occur in response to both direct and indirect action of interleukin-1beta on its target cells.

  7. Structural changes of homodimers in the PDB.

    PubMed

    Koike, Ryotaro; Amemiya, Takayuki; Horii, Tatsuya; Ota, Motonori

    2018-04-01

    Protein complexes are involved in various biological phenomena. These complexes are intrinsically flexible, and structural changes are essential to their functions. To perform a large-scale automated analysis of the structural changes of complexes, we combined two original methods. An application, SCPC, compares two structures of protein complexes and decides the match of binding mode. Another application, Motion Tree, identifies rigid-body motions in various sizes and magnitude from the two structural complexes with the same binding mode. This approach was applied to all available homodimers in the Protein Data Bank (PDB). We defined two complex-specific motions: interface motion and subunit-spanning motion. In the former, each subunit of a complex constitutes a rigid body, and the relative movement between subunits occurs at the interface. In the latter, structural parts from distinct subunits constitute a rigid body, providing the relative movement spanning subunits. All structural changes were classified and examined. It was revealed that the complex-specific motions were common in the homodimers, detected in around 40% of families. The dimeric interfaces were likely to be small and flat for interface motion, while large and rugged for subunit-spanning motion. Interface motion was accompanied by a drastic change in contacts at the interface, while the change in the subunit-spanning motion was moderate. These results indicate that the interface properties of homodimers correlated with the type of complex-specific motion. The study demonstrates that the pipeline of SCPC and Motion Tree is useful for the massive analysis of structural change of protein complexes. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. IL-12p40-dependent agonistic effects on the development of protective innate and adaptive immunity against Salmonella enteritidis.

    PubMed

    Lehmann, J; Bellmann, S; Werner, C; Schröder, R; Schütze, N; Alber, G

    2001-11-01

    To study a potential IL-12p40-dependent but IL-12p75-independent agonistic activity regulating the immune response against Salmonella Enteritidis, the course of infection in IL-12p35-deficient mice (IL-12p35(-/-), capable of producing IL-12p40) was compared with that of IL-12p40(-/-) mice. Mice lacking IL-12p40 revealed a higher mortality rate and higher bacterial organ burden than mice capable of producing IL-12p40. This phenotype was found in both genetically susceptible (BALB/c, Ity(s)) and resistant mice (129Sv/Ev, Ity(r)) indicating Ity-independent mechanisms. The more effective control of bacteria in the IL-12p35(-/-) mice was associated with elevated serum IFN-gamma and TNF-alpha levels. In contrast, IL-12p40(-/-) mice showed reduced IFN-gamma production, which was associated with significantly elevated serum IgE levels. Early during infection (days 3 and 4 postinfection), as well as late (day 20 postinfection), the number of infected phagocytes was strongly increased in the absence of IL-12p40 indicating impaired bactericidal activity when IL-12p40 was missing. Liver histopathology revealed a decreased number of mononuclear granulomas in IL-12p40(-/-) mice. Depletion of CD4(+) or CD8(+) T lymphocytes in vivo suggested that both T cell subpopulations contribute to the IL-12p40-dependent protective functions. Analysis of IL-12p40 vs IL-23p19 mRNA expression revealed an up-regulation of only IL-12p40 mRNA during Salmonella infection. Together these data indicate that IL-12p40 can induce protective mechanisms during both the innate and the adaptive type 1 immune response in Salmonella infection. This novel activity of IL-12p40 complements the well described dominant and essential role of IL-12p75 in protective immunity to Salmonella infection.

  9. YKL-40-Induced Inhibition of miR-590-3p Promotes Interleukin-18 Expression and Angiogenesis of Endothelial Progenitor Cells

    PubMed Central

    Li, Te-Mao; Liu, Shan-Chi; Huang, Ya-Hsin; Huang, Chien-Chung; Hsu, Chin-Jung; Tsai, Chun-Hao; Wang, Shih-Wei; Tang, Chih-Hsin

    2017-01-01

    YKL-40, also known as human cartilage glycoprotein-39 or chitinase-3-like-1, is a pro-inflammatory protein that is highly expressed in rheumatoid arthritis (RA) patients. Angiogenesis is a critical step in the pathogenesis of RA, promoting the infiltration of inflammatory cells into joints and providing oxygen and nutrients to RA pannus. In this study, we examined the effects of YKL-40 in the production of the pro-inflammatory cytokine interleukin-18 (IL-18), and the stimulation of angiogenesis and accumulation of osteoblasts. We observed that YKL-40 induces IL-18 production in osteoblasts and thereby stimulates angiogenesis of endothelial progenitor cells (EPCs). We found that this process occurs through the suppression of miR-590-3p via the focal adhesion kinase (FAK)/PI3K/Akt signaling pathway. YKL-40 inhibition reduced angiogenesis in in vivo models of angiogenesis: the chick embryo chorioallantoic membrane (CAM) and Matrigel plug models. We report that YKL-40 stimulates IL-18 expression in osteoblasts and facilitates EPC angiogenesis. PMID:28448439

  10. YKL-40-Induced Inhibition of miR-590-3p Promotes Interleukin-18 Expression and Angiogenesis of Endothelial Progenitor Cells.

    PubMed

    Li, Te-Mao; Liu, Shan-Chi; Huang, Ya-Hsin; Huang, Chien-Chung; Hsu, Chin-Jung; Tsai, Chun-Hao; Wang, Shih-Wei; Tang, Chih-Hsin

    2017-04-27

    YKL-40, also known as human cartilage glycoprotein-39 or chitinase-3-like-1, is a pro-inflammatory protein that is highly expressed in rheumatoid arthritis (RA) patients. Angiogenesis is a critical step in the pathogenesis of RA, promoting the infiltration of inflammatory cells into joints and providing oxygen and nutrients to RA pannus. In this study, we examined the effects of YKL-40 in the production of the pro-inflammatory cytokine interleukin-18 (IL-18), and the stimulation of angiogenesis and accumulation of osteoblasts. We observed that YKL-40 induces IL-18 production in osteoblasts and thereby stimulates angiogenesis of endothelial progenitor cells (EPCs). We found that this process occurs through the suppression of miR-590-3p via the focal adhesion kinase (FAK)/PI3K/Akt signaling pathway. YKL-40 inhibition reduced angiogenesis in in vivo models of angiogenesis: the chick embryo chorioallantoic membrane (CAM) and Matrigel plug models. We report that YKL-40 stimulates IL-18 expression in osteoblasts and facilitates EPC angiogenesis.

  11. Identification and expression analysis of two interleukin-23α (p19) isoforms, in rainbow trout Oncorhynchus mykiss and Atlantic salmon Salmo salar.

    PubMed

    Jiang, Yousheng; Husain, Mansourah; Qi, Zhitao; Bird, Steve; Wang, Tiehui

    2015-08-01

    Interleukin (IL)-23 is a heterodimeric IL-12 family cytokine composed of a p19 α-chain, linked to a p40 β-chain that is shared with IL-12. IL-23 is distinguished functionally from IL-12 by its ability to induce the production of IL-17, and differentiation of Th17 cells in mammals. Three isoforms of p40 (p40a, p40b and p40c) have been found in some 3R teleosts. Salmonids also possess three p40 isoforms (p40b1, p40b2 and p40c) although p40a is missing, and two copies (paralogues) of p40b are present that have presumably been retained following the 4R duplication in this fish lineage. Teleost p19 has been discovered recently in zebrafish, but to date there is limited information on expression and modulation of this molecule. In this report we have cloned two p19 paralogues (p19a and p19b) in salmonids, suggesting that a salmonid can possess six potential IL-23 isoforms. Whilst Atlantic salmon has two active p19 genes, the rainbow trout p19b gene may have been pseudogenized. The salmonid p19 translations share moderate identities (22.8-29.9%) to zebrafish and mammalian p19 molecules, but their identity was supported by structural features, a conserved 4 exon/3 intron gene organisation, and phylogenetic tree analysis. The active salmonid p19 genes are highly expressed in blood and gonad. Bacterial (Yersinia ruckeri) and viral infection in rainbow trout induces the expression of p19a, suggesting pathogen-specific induction of IL-23 isoforms. Trout p19a expression was also induced by PAMPs (poly IC and peptidoglycan) and the proinflammatory cytokine IL-1β in primary head kidney macrophages. These data may indicate diverse functional roles of trout IL-23 isoforms in regulating the immune response in fish. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Sigma Receptor 1 activation attenuates release of inflammatory cytokines MIP1γ, MIP2, MIP3α and IL12 (p40/p70) by retinal Müller glial cells

    PubMed Central

    Shanmugam, A.; Wang, J.; Markand, S.; Perry, R.L.; Tawfik, A.; Zorrilla, E.; Ganapathy, V.; Smith, S.B.

    2015-01-01

    The high affinity Sigma Receptor 1 (σR1) ligand (+)-pentazocine ((+)-PTZ) affords profound retinal neuroprotection in vitro and in vivo by a yet-unknown mechanism. A common feature of retinal disease is Müller cell reactive gliosis, which includes cytokine release. Here we investigated whether LPS stimulates cytokine release by primary mouse Müller cells and whether (+)-PTZ alters release. Using a highly sensitive inflammatory antibody array we observed significant release of macrophage inflammatory proteins (MIP1γ, MIP2, MIP3α) and interleukin-12 (IL12 (p40/p70)) in LPS-treated cells compared to controls, and a significant decrease in secretion upon (+)-PTZ treatment. Müller cells from σR1 knockout mice demonstrated increased MIP1γ, MIP2, MIP3α and IL12 (p40/p70) secretion when exposed to LPS compared to LPS-stimulated WT cells. We investigated whether cytokine secretion was accompanied by cytosolic-to-nuclear NFκB translocation and whether endothelial cell adhesion/migration was altered by released cytokines. Cells exposed to LPS demonstrated increased NFκB nuclear location, which was reduced significantly in (+)-PTZ-treated cells. Media conditioned by LPS-stimulated-Müller cells induced leukocyte-endothelial cell adhesion and endothelial cell migration, which was attenuated by (+)-PTZ treatment. The findings suggest that release of certain inflammatory cytokines by Müller cells can be attenuated by σR1 ligands providing insights into the retinal neuroprotective role of this receptor. PMID:25439327

  13. TRANSCRIPTIONAL INHIBITION OF INTERLEUKIN-12 PROMOTER ACTIVITY IN LEISHMANIA SPP.-INFECTED MACROPHAGES

    PubMed Central

    Jayakumar, Asha; Widenmaier, Robyn; Ma, Xiaojing; McDowell, Mary Ann

    2009-01-01

    To establish and persist within a host, Leishmania spp. parasites delay the onset of cell-mediated immunity by suppressing interleukin-12 (IL-12) production from host macrophages. Although it is established that Leishmania spp.-infected macrophages have impaired IL-12 production, the mechanisms that account for this suppression remain to be completely elucidated. Using a luciferase reporter assay assessing IL-12 transcription, we report here that Leishmania major, Leishmania donovani, and Leishmania chagasi inhibit IL-12 transcription in response to interferon-gamma, lipopolysaccharide, and CD40 ligand and that Leishmania spp. lipophosphoglycan, phosphoglycans, and major surface protein are not necessary for inhibition. In addition, all the Leishmania spp. strains and life-cycle stages tested inhibited IL-12 promoter activity. Our data further reveal that autocrine-acting host factors play no role in the inhibitory response and that phagocytosis signaling is necessary for inhibition of IL-12. PMID:18372625

  14. Continuous release of interleukin 12 from microencapsulated engineered cells for colon cancer therapy

    PubMed Central

    Zheng, Shu; Xiao, Zuo-Xiang; Pan, Yue-Long; Han, Ming-Yong; Dong, Qi

    2003-01-01

    AIM: To explore the anti-tumor immunity against CT26 colon tumor of the microencapsulated cells modified with murine interleukine-12 (mIL-12) gene. METHODS: Mouse fibroblasts (NIH3T3) were stably transfected to express mIL-12 using expression plasmids carrying mIL-12 gene (p35 and p40), and NIH3T3-mIL-12 cells were encapsulated in alginate microcapsules for long-term delivery of mIL-12. mIL-12 released from the microencapsulated NIH3T3-mIL-12 cells was confirmed using ELISA assay. Transplantation of the microencapsulated NIH3T3-mIL-12 cells was performed in the tumor-bearing mice with CT26 cells. The anti-tumor responses and the anti-tumor activities of the microencapsulated NIH3T3-mIL-12 cells were evaluated. RESULTS: Microencapsulated NIH3T3-mIL-12 cells could release mIL-12 continuously and stably for a long time. After the microencapsulated NIH3T3-mIL-12 cells were transplanted subcutaneously into the tumor-bearing mice for 21 d, the serum concentrations of mIL-12, mIL-2 and mIFN-γ, the cytotoxicity of the CTL from the splenocytes and the NK activity in the treatment group were significantly higher than those in the controls. Moreover, mIL-12 released from the microencapsulated NIH3T3-mIL-12 cells resulted in a significant inhibition of tumor proliferation and a prolonged survival of tumor-bearing mice. CONCLUSION: The microencapsulated NIH3T3-mIL-12 cells have a significant therapeutic effect on the experimental colon tumor by activating anti-tumor immune responses in vivo. Microencapsulated and genetically engineered cells may be an extremely versatile tool for tumor gene therapy. PMID:12717836

  15. Receptor homodimerization plays a critical role in a novel dominant negative P2RY12 variant identified in a family with severe bleeding.

    PubMed

    Mundell, S J; Rabbolini, D; Gabrielli, S; Chen, Q; Aungraheeta, R; Hutchinson, J L; Kilo, T; Mackay, J; Ward, C M; Stevenson, W; Morel-Kopp, M-C

    2018-01-01

    Essentials Three dominant variants for the autosomal recessive bleeding disorder type-8 have been described. To date, there has been no phenotype/genotype correlation explaining their dominant transmission. Proline plays an important role in P2Y12R ligand binding and signaling defects. P2Y12R homodimer formation is critical for the receptor function and signaling. Background Although inherited platelet disorders are still underdiagnosed worldwide, advances in molecular techniques are improving disease diagnosis and patient management. Objective To identify and characterize the mechanism underlying the bleeding phenotype in a Caucasian family with an autosomal dominant P2RY12 variant. Methods Full blood counts, platelet aggregometry, flow cytometry and western blotting were performed before next-generation sequencing (NGS). Detailed molecular analysis of the identified variant of the P2Y12 receptor (P2Y12R) was subsequently performed in mammalian cells overexpressing receptor constructs. Results All three referred individuals had markedly impaired ADP-induced platelet aggregation with primary wave only, despite normal total and surface P2Y12R expression. By NGS, a single P2RY12:c.G794C substitution (p.R265P) was identified in all affected individuals, and this was confirmed by Sanger sequencing. Mammalian cell experiments with the R265P-P2Y12R variant showed normal receptor surface expression versus wild-type (WT) P2Y12R. Agonist-stimulated R265P-P2Y12R function (both signaling and surface receptor loss) was reduced versus WT P2Y12R. Critically, R265P-P2Y12R acted in a dominant negative manner, with agonist-stimulated WT P2Y12R activity being reduced by variant coexpression, suggesting dramatic loss of WT homodimers. Importantly, platelet P2RY12 cDNA cloning and sequencing in two affected individuals also revealed three-fold mutant mRNA overexpression, decreasing even further the likelihood of WT homodimer formation. R265 located within extracellular loop 3 (EL3) is

  16. Computational design and experimental verification of a symmetric protein homodimer.

    PubMed

    Mou, Yun; Huang, Po-Ssu; Hsu, Fang-Ciao; Huang, Shing-Jong; Mayo, Stephen L

    2015-08-25

    Homodimers are the most common type of protein assembly in nature and have distinct features compared with heterodimers and higher order oligomers. Understanding homodimer interactions at the atomic level is critical both for elucidating their biological mechanisms of action and for accurate modeling of complexes of unknown structure. Computation-based design of novel protein-protein interfaces can serve as a bottom-up method to further our understanding of protein interactions. Previous studies have demonstrated that the de novo design of homodimers can be achieved to atomic-level accuracy by β-strand assembly or through metal-mediated interactions. Here, we report the design and experimental characterization of a α-helix-mediated homodimer with C2 symmetry based on a monomeric Drosophila engrailed homeodomain scaffold. A solution NMR structure shows that the homodimer exhibits parallel helical packing similar to the design model. Because the mutations leading to dimer formation resulted in poor thermostability of the system, design success was facilitated by the introduction of independent thermostabilizing mutations into the scaffold. This two-step design approach, function and stabilization, is likely to be generally applicable, especially if the desired scaffold is of low thermostability.

  17. Effects of interleukins 2 and 12 on TBT-induced alterations of MAP kinases p38 and p44/42 in human natural killer cells.

    PubMed

    Aluoch, Aloice O; Whalen, Margaret M

    2006-01-01

    NK cells are lymphocytes in the non-adaptive immune system that protect the body against intracellular pathogens and eliminate tumor cells. Tributyltin (TBT) is a toxic chemical that has been detected in human foods as well as in human blood. The role of TBT in immunosuppression has been described, including inhibition of the human NK-cell cytotoxic function. Previous studies indicated that exposure of NK cells to TBT for 1 h induced progressive and irreversible inhibition of cytotoxic function. However, it was found that if NK cells were incubated in TBT-free media with either IL-2 or IL-12, loss of cytotoxic function was prevented/reversed within 24 h. Molecular studies established that loss of cytotoxic function is accompanied by alteration of MAP kinases (MAPKs) p38 and p44/42 phosphorylation. This study examined whether interleukin-mediated recovery of cytotoxicity involved reversal of tributyltin-altered p38 and p44/42 phosphorylation. The results indicated that there was no substantial IL-2 prevention/reversal of the TBT-induced alteration of phosphorylation of either p38 or p44/42 after either a 24 or 48 h recovery period. Additionally, IL-12 caused no substantial prevention/reversal of the TBT-induced alteration of phosphorylation of the MAPKs seen after either 24 or 48 h. These data suggest that IL-2 and/or IL-12-mediated recovery of NK cytotoxic function is not a result of prevention/reversal of TBT-induced phosphorylation of p38 and p44/42 MAPKs at the 24 or 48 h time points. Copyright 2005 John Wiley & Sons, Ltd.

  18. Murine bone marrow-derived mesenchymal stem cells as vehicles for interleukin-12 gene delivery into Ewing sarcoma tumors.

    PubMed

    Duan, Xiaoping; Guan, Hui; Cao, Ying; Kleinerman, Eugenie S

    2009-01-01

    This study evaluated the therapeutic efficacy of interleukin 12 (IL-12) gene therapy in Ewing sarcoma and whether murine mesenchymal stem cells (MSCs) could serve as vehicles for IL-12 gene delivery. MSCs were isolated from murine bone marrow cells. Cells were phenotyped using flow cytometry. Cultured MSCs differentiated into osteocytes and adipocytes using the appropriate media. Freshly isolated MSCs were transfected with adenoviral vectors containing either the beta-galactosidase (Ad:beta-gal) or the IL-12 (Ad:IL-12) gene. Expression of IL-12 was confirmed using reverse transcription polymerase chain reaction. Mice with TC71 Ewing sarcoma tumors were then treated intravenously with MSCs transfected with Ad:beta-gal or Ad:IL-12. Tumors were measured and analyzed by immunohistochemical analysis for expression of IL-12 protein. Expression of both p35 and p40 IL-12 subunits was demonstrated in MSCs transfected in vitro with Ad:IL-12. IL-12 expression was seen in tumors from mice treated with MSCs transfected with Ad:IL-12. Tumor growth was also significantly inhibited compared with that in mice treated with MSCs transfected with Ad:beta-gal. MSCs can be transfected with the IL-12 gene. These transfected cells localize to tumors after intravenous injection and induce local IL-12 protein production and the regression of established tumors. Copyright (c) 2008 American Cancer Society.

  19. Structural and Functional Characterization of a Hole-Hole Homodimer Variant in a "Knob-Into-Hole" Bispecific Antibody.

    PubMed

    Zhang, Hui-Min; Li, Charlene; Lei, Ming; Lundin, Victor; Lee, Ho Young; Ninonuevo, Milady; Lin, Kevin; Han, Guanghui; Sandoval, Wendy; Lei, Dongsheng; Ren, Gang; Zhang, Jennifer; Liu, Hongbin

    2017-12-19

    Bispecific antibodies have great potential to be the next-generation biotherapeutics due to their ability to simultaneously recognize two different targets. Compared to conventional monoclonal antibodies, knob-into-hole bispecific antibodies face unique challenges in production and characterization due to the increase in variant possibilities, such as homodimerization in covalent and noncovalent forms. In this study, a storage- and pH-sensitive hydrophobic interaction chromatography (HIC) profile change was observed for the hole-hole homodimer, and the multiple HIC peaks were explored and shown to be conformational isomers. We combined traditional analytical methods with hydrogen/deuterium exchange mass spectrometry (HDX MS), native mass spectrometry, and negative-staining electron microscopy to comprehensively characterize the hole-hole homodimer. HDX MS revealed conformational changes at the resolution of a few amino acids overlapping the C H 2-C H 3 domain interface. Conformational heterogeneity was also assessed by HDX MS isotopic distribution. The hole-hole homodimer was demonstrated to adopt a more homogeneous conformational distribution during storage. This conformational change is likely caused by a lack of C H 3 domain dimerization (due to the three "hole" point mutations), resulting in a unique storage- and pH-dependent conformational destabilization and refolding of the hole-hole homodimer Fc. Compared with the hole-hole homodimer under different storage conditions, the bispecific heterodimer, guided by the knob-into-hole assembly, proved to be a stable conformation with homogeneous distribution, confirming its high quality as a desired therapeutic. Functional studies by antigen binding and neonatal Fc receptor (FcRn) binding correlated very well with the structural characterization. Comprehensive interpretation of the results has provided a better understanding of both the homodimer variant and the bispecific molecule.

  20. Assembly and Molecular Architecture of the Phosphoinositide 3-Kinase p85α Homodimer.

    PubMed

    LoPiccolo, Jaclyn; Kim, Seung Joong; Shi, Yi; Wu, Bin; Wu, Haiyan; Chait, Brian T; Singer, Robert H; Sali, Andrej; Brenowitz, Michael; Bresnick, Anne R; Backer, Jonathan M

    2015-12-18

    Phosphoinositide 3-kinases (PI3Ks) are a family of lipid kinases that are activated by growth factor and G-protein-coupled receptors and propagate intracellular signals for growth, survival, proliferation, and metabolism. p85α, a modular protein consisting of five domains, binds and inhibits the enzymatic activity of class IA PI3K catalytic subunits. Here, we describe the structural states of the p85α dimer, based on data from in vivo and in vitro solution characterization. Our in vitro assembly and structural analyses have been enabled by the creation of cysteine-free p85α that is functionally equivalent to native p85α. Analytical ultracentrifugation studies showed that p85α undergoes rapidly reversible monomer-dimer assembly that is highly exothermic in nature. In addition to the documented SH3-PR1 dimerization interaction, we identified a second intermolecular interaction mediated by cSH2 domains at the C-terminal end of the polypeptide. We have demonstrated in vivo concentration-dependent dimerization of p85α using fluorescence fluctuation spectroscopy. Finally, we have defined solution conditions under which the protein is predominantly monomeric or dimeric, providing the basis for small angle x-ray scattering and chemical cross-linking structural analysis of the discrete dimer. These experimental data have been used for the integrative structure determination of the p85α dimer. Our study provides new insight into the structure and assembly of the p85α homodimer and suggests that this protein is a highly dynamic molecule whose conformational flexibility allows it to transiently associate with multiple binding proteins. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Effects of Caffeine Supplementation on Plasma and Blood Mononuclear Cell Interleukin-10 Levels After Exercise.

    PubMed

    Tauler, Pedro; Martinez, Sonia; Martinez, Pau; Lozano, Leticia; Moreno, Carlos; Aguiló, Antoni

    2016-02-01

    This study compared the response of interleukin (IL)-10, and also of IL-6 and IL-12 p40, to exercise and caffeine supplementation between plasma and blood mononuclear cells (BMNCs). Participants in the study (n = 28) were randomly allocated in a double-blind fashion to either caffeine (n = 14) or placebo (n = 14) treatments. One hour before completing a 15-km run competition, athletes took 6 mg/kg body mass of caffeine or a placebo. Plasma and BMNCs were purified from blood samples taken before and after competition. Concentrations of interleukins (IL-10, IL-6, and IL-12 p40), cyclic adenosine monophosphate (cAMP), caffeine, adrenaline, and cortisol were measured in plasma. IL-10, IL-6, and IL-12 p40 and cAMP levels were also determined in BMNCs. Exercise induced significant increases in IL-6 and IL-10 plasma levels, with higher increases in the caffeine-supplemented group. After 2-hr recovery, these levels returned to almost preexercise values. However, no effect of caffeine on BMNC cytokines was observed. IL-10, IL-6, and IL-12 p40 levels in BMNCs increased mainly at 2 hr postexercise. cAMP levels increased postexercise in plasma and after recovery in BMNCs, but no effects of caffeine were observed. In conclusion, caffeine did not modify cytokine levels in BMNCs in response to exercise. However, higher increases of IL-10 were observed in plasma after exercise in the supplemented participants, which could suppose an enhancement of the anti-inflammatory properties of exercise.

  2. An HLA-B27 Homodimer Specific Antibody Recognizes a Discontinuous Mixed-Disulfide Epitope as Identified by Affinity-Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Iuraşcu, Marius-Ionuţ; Marroquin Belaunzanar, Osiris; Cozma, Claudia; Petrausch, Ulf; Renner, Christoph; Przybylski, Michael

    2016-06-01

    HLA-B27 homodimer formation is believed to be a hallmark of HLA-B27 associated spondyloarthritides. Recently, we have generated a homodimer-specific monoclonal antibody (HD6) and have demonstrated that HLA-B27 homodimer complexes are present on monocytes of healthy HLA-B27 gene carriers at low levels, with significantly increased levels at active disease. The capability of the HD6 antibody to discriminate between correctly formed HLA-B27 heterotrimers and pathology-associated homodimers is striking and cannot be explained by the primary structure of HLA-B27. We hypothesized that HD6 accesses a unique epitope and used affinity-mass spectrometry for its identification. The HD6 antibody was immobilized on an activated sepharose affinity column, and HLA-B27 homodimer characterized for affinity. The epitope was identified by proteolytic epitope excision and MALDI mass spectrometry, and shown to comprise a discontinuous Cys-203- 257-Cys mixed-disulfide peptide structure that is not accessible in HLA-B27 heterotrimers due to protection by noncovalently linked β2-microglobulin. The epitope peptides were synthesized by solid phase peptide synthesis, and the two monomeric peptide components, HLA-B27(203-219) and HLA-B27(257-273), as well as the homo- and hetero-dimeric disulfide linked combinations prepared. The affinity binding constants KD towards the antibodies were determined using a surface acoustic wave (SAW) biosensor, and showed the highest affinity with a KD of approximately 40 nM to the HD6 antibody for the (203-219)-SS-(257-273) mixed disulfide epitope.

  3. Systematic review of interleukin-12, interleukin-17, and interleukin-23 pathway inhibitors for the treatment of moderate-to-severe chronic plaque psoriasis: ustekinumab, briakinumab, tildrakizumab, guselkumab, secukinumab, ixekizumab, and brodalumab.

    PubMed

    Tausend, William; Downing, Christopher; Tyring, Stephen

    2014-01-01

    Monoclonal antibodies known as biologic agents specifically targeted against interleukin-12 (IL-12), interleukin-17A (IL-17), and interleukin-23 (IL-23) have been the focus of research for moderate-to-severe chronic plaque psoriasis in recent years. To discuss the immune-mediated model of psoriasis and to summarize current knowledge of the clinical efficacy and safety of new biologic agents for moderate-to-severe chronic plaque psoriasis. The PubMed database was searched for relevant articles on ustekinumab, briakinumab, tildrakizumab (MK-322), guselkumab, secukinumab, ixekizumab, and brodalumab published between January 2005 and July 2013. Fifty-five articles were identified. These studies suggest that the biologic agents specifically targeting IL-12, IL-17, and IL-23 are efficacious and safe in the treatment of moderate-to-severe psoriasis in adults. Current data from clinical trials suggest that biologic agents targeting IL-12, IL-17, and IL-23 are safe and efficacious drugs for use in moderate-to-severe chronic plaque psoriasis. Long-term data still need to be established.

  4. Neutrophil elastase enhances IL-12p40 production by lipopolysaccharide-stimulated macrophages via transactivation of the PAR-2/EGFR/TLR4 signaling pathway.

    PubMed

    Yamaguchi, Rui; Yamamoto, Takatoshi; Sakamoto, Arisa; Narahara, Shinji; Sugiuchi, Hiroyuki; Yamaguchi, Yasuo

    2016-07-01

    Proteinase-activated receptor 2 (PAR-2) and toll-like receptor 4 (TLR4) are involved in innate immune responses and signaling cross-talk between these receptor molecules has the potential to augment an ongoing inflammatory response. The aim of this study was to evaluate the possible cooperative influence of PAR-2 and TLR4 on IL-12p40 production by macrophages after stimulation with lipopolysaccharide (LPS). During culture, GM-CSF upregulated PAR-2 expression by macrophages in a time-dependent manner. Stimulation with LPS enhanced IL-12p40 production by macrophages in a concentration-dependent manner. While human neutrophil elastase (HNE) did not induce IL-12p40 production, pretreatment of macrophages with HNE synergistically increased the IL-12p40 protein level after LPS exposure. Silencing of TLR4 with small interfering RNA blunted the synergistic enhancement of IL-12p40 by HNE combined with LPS. Silencing of β-arrestin 2, p22phox, or ERK1/2 also inhibited an increase of IL-12p40. Interestingly, transfection of macrophages with small interfering RNA duplexes for DUOX-2, EGFR, TLR4, or TRAF6 significantly blunted the increase of IL-12p40 in response to treatment with HNE plus LPS. U73122 and Rottlerin also inhibited the increased production of IL-12p40. In conclusion, HNE is involved in transactivation of TLR4 through activation of DUOX-2/EGFR and synergistically enhances IL-12p40 production by macrophages stimulated with LPS. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Macrophage IL-12p70 Signaling Prevents HSV-1–Induced CNS Autoimmunity Triggered by Autoaggressive CD4+ Tregs

    PubMed Central

    Mott, Kevin R.; Gate, David; Zandian, Mandana; Allen, Sariah J.; Rajasagi, Naveen Kumar; van Rooijen, Nico; Chen, Shuang; Arditi, Moshe; Rouse, Barry T.; Flavell, Richard A.; Town, Terrence; Ghiasi, Homayon

    2011-01-01

    Purpose. CD4+CD25+FoxP3+ naturally occurring regulatory T cells (Tregs) maintain self-tolerance and function to suppress overly exuberant immune responses. However, it is unclear whether innate immune cells modulate Treg function. Here the authors examined the role of innate immunity in lymphomyeloid homeostasis. Methods. The involvement of B cells, dendritic cells (DCs), macrophages, natural killer (NK) cells, and T cells in central nervous system (CNS) demyelination in different strains of mice infected ocularly with herpes simplex virus type 1 (HSV-1) was investigated. Results. The authors found that depletion of macrophages, but not DCs, B cells, NK cells, CD4+ T cells, or CD8+ T cells, induced CNS demyelination irrespective of virus or mouse strain. As with macrophage depletion, mice deficient in interleukin (IL)-12p35 or IL-12p40 showed CNS demyelination after HSV-1 infection, whereas demyelination was undetectable in HSV-1–infected, IL-23p19–deficient, or Epstein-Barr virus–induced gene 3-deficient mice. Demyelination could be rescued in macrophage-depleted mice after the injection of IL-12p70 DNA and in IL-12p35−/− or IL-12p40−/− mice after injection with IL-12p35 or IL-12p40 DNA or with recombinant viruses expressing IL-12p35 or IL-12p40. Using FoxP3-, CD4-, CD8-, or CD25-depletion and gene-deficient mouse approaches, the authors demonstrated that HSV-1–induced demyelination was blocked in the absence of CD4, CD25, or FoxP3 in macrophage-depleted mice. Flow cytometry showed an elevation of CD4+CD25+FoxP3+ T cells in the spleens of infected macrophage-depleted mice, and adoptive transfer of CD4+CD25+ T cells to infected macrophage-depleted severe combined immunodeficient mice induced CNS demyelination. Conclusions. The authors demonstrated that macrophage IL-12p70 signaling plays an important role in maintaining immune homeostasis in the CNS by preventing the development of autoaggressive CD4+ Tregs. PMID:21220560

  6. Interleukin-12 Induces a Th1-Like Response to Burkholderia mallei and Limited Protection in BALB/c Mice

    DTIC Science & Technology

    2006-01-01

    sublethal and lethal intraperitoneal glanders ( Burkholderia mallei ). Vet Pathol 2000;37:626–36. [34] Jankovic D, Caspar P, Zweig M, Garcia-Moll M...Vaccine 24 (2006) 1413–1420 Interleukin-12 induces a Th1-like response to Burkholderia mallei and limited protection in BALB/c mice Kei Amemiya...IL)-12 on the immune response to Burkholderia mallei in BALB/c mice. Mice were vaccinated with non-viable B. mallei cells with or without IL-12

  7. Synthetic Deletion of the Interleukin 23 Receptor (IL-23R) Stalk Region Led to Autonomous IL-23R Homodimerization and Activation.

    PubMed

    Hummel, Thorben M; Ackfeld, Theresa; Schönberg, Marco; Ciupka, Gregor; Schulz, Falk; Oberdoerster, Anne; Grötzinger, Joachim; Scheller, Jürgen; Floss, Doreen M

    2017-09-01

    Interleukin 23 (IL-23) regulates the development of TH17 cells, which are important for antimicrobial and antifungal responses and autoimmune and chronic inflammatory diseases. IL-23-induced Jak/STAT signaling is mediated via the heterodimeric IL-23 receptor (IL-23R)-IL-12 receptor β1 (IL-12Rβ1) complex. The typical signal-transducing receptor of the IL-6/IL-12 family contains three extracellular-membrane-proximal fibronectin type III (FNIII) domains, which are not involved in cytokine binding but are mandatory for signal transduction. In place of FNIII-type domains, IL-23R has a structurally undefined stalk. We hypothesized that the IL-23R stalk acts as a spacer to position the cytokine binding domains at a defined distance from the plasma membrane to enable signal transduction. Minor deletions of the murine, but not of the human, IL-23R stalk resulted in unresponsiveness to IL-23. Complete deletion of the human IL-23R stalk and the extended murine IL-23R stalk, including a 20-amino-acid-long duplication of domain 3, however, induced ligand-independent, autonomous receptor activation, as determined by STAT3 phosphorylation and cell proliferation. Ligand-independent, autonomous activity was caused by IL-23R homodimers and was independent of IL-12Rβ1. Our data show that deletion of the stalk results in biologically active IL-23R homodimers, thereby creating an as-yet-undescribed receptor complex of the IL-6/IL-12 cytokine family. Copyright © 2017 American Society for Microbiology.

  8. Nicotinamidase/pyrazinamidase of Mycobacterium tuberculosis forms homo-dimers stabilized by disulfide bonds

    PubMed Central

    Rueda, Daniel; Sheen, Patricia; Gilman, Robert H.; Bueno, Carlos; Santos, Marco; Pando-Robles, Victoria; Batista, Cesar V.; Zimic, Mirko

    2014-01-01

    Recombinant wild-pyrazinamidase from H37Rv M. tuberculosis was analyzed by gel electrophoresis under differential reducing conditions to evaluate its quaternary structure. PZAse was fractionated by size exclusion chromatography under non-reducing conditions. PZAse activity was measured and mass spectrometry analysis was performed to determine the identity of proteins by de novo sequencing and to determine the presence of disulfide bonds. This study confirmed that M. tuberculosis wild type PZAse was able to form homo-dimers in vitro. Homo-dimers showed a slightly lower specific PZAse activity compared to monomeric PZAse. PZAse dimers were dissociated into monomers in response to reducing conditions. Mass spectrometry analysis confirmed the existence of disulfide bonds (C72-C138 and C138-C138) stabilizing the quaternary structure of the PZAse homo-dimer. PMID:25199451

  9. Structural reorganization of the interleukin-7 signaling complex

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McElroy, Craig A.; Holland, Paul J.; Zhao, Peng

    2012-06-29

    We report here an unliganded receptor structure in the common gamma-chain ({gamma}{sub c}) family of receptors and cytokines. The crystal structure of the unliganded form of the interleukin-7 alpha receptor (IL-7R{alpha}) extracellular domain (ECD) at 2.15 {angstrom} resolution reveals a homodimer forming an 'X' geometry looking down onto the cell surface with the C termini of the two chains separated by 110 {angstrom} and the dimer interface comprising residues critical for IL-7 binding. Further biophysical studies indicate a weak association of the IL-7R{alpha} ECDs but a stronger association between the {gamma}{sub c}/IL-7R{alpha} ECDs, similar to previous studies of the full-lengthmore » receptors on CD4{sup +} T cells. Based on these and previous results, we propose a molecular mechanism detailing the progression from the inactive IL-7R{alpha} homodimer and IL-7R{alpha}-{gamma}{sub c} heterodimer to the active IL-7-IL-7R{alpha}-{gamma}{sub c} ternary complex whereby the two receptors undergo at least a 90{sup o} rotation away from the cell surface, moving the C termini of IL-7R{alpha} and {gamma}{sub c} from a distance of 110 {angstrom} to less than 30 {angstrom} at the cell surface. This molecular mechanism can be used to explain recently discovered IL-7- and {gamma}{sub c}-independent gain-of-function mutations in IL-7R{alpha} from B- and T-cell acute lymphoblastic leukemia patients. The mechanism may also be applicable to other {gamma}{sub c} receptors that form inactive homodimers and heterodimers independent of their cytokines.« less

  10. Mortality Benefit of Recombinant Human Interleukin-1 Receptor Antagonist for Sepsis Varies by Initial Interleukin-1 Receptor Antagonist Plasma Concentration.

    PubMed

    Meyer, Nuala J; Reilly, John P; Anderson, Brian J; Palakshappa, Jessica A; Jones, Tiffanie K; Dunn, Thomas G; Shashaty, Michael G S; Feng, Rui; Christie, Jason D; Opal, Steven M

    2018-01-01

    Plasma interleukin-1 beta may influence sepsis mortality, yet recombinant human interleukin-1 receptor antagonist did not reduce mortality in randomized trials. We tested for heterogeneity in the treatment effect of recombinant human interleukin-1 receptor antagonist by baseline plasma interleukin-1 beta or interleukin-1 receptor antagonist concentration. Retrospective subgroup analysis of randomized controlled trial. Multicenter North American and European clinical trial. Five hundred twenty-nine subjects with sepsis and hypotension or hypoperfusion, representing 59% of the original trial population. Random assignment of placebo or recombinant human interleukin-1 receptor antagonist × 72 hours. We measured prerandomization plasma interleukin-1 beta and interleukin-1 receptor antagonist and tested for statistical interaction between recombinant human interleukin-1 receptor antagonist treatment and baseline plasma interleukin-1 receptor antagonist or interleukin-1 beta concentration on 28-day mortality. There was significant heterogeneity in the effect of recombinant human interleukin-1 receptor antagonist treatment by plasma interleukin-1 receptor antagonist concentration whether plasma interleukin-1 receptor antagonist was divided into deciles (interaction p = 0.046) or dichotomized (interaction p = 0.028). Interaction remained present across different predicted mortality levels. Among subjects with baseline plasma interleukin-1 receptor antagonist above 2,071 pg/mL (n = 283), recombinant human interleukin-1 receptor antagonist therapy reduced adjusted mortality from 45.4% to 34.3% (adjusted risk difference, -0.12; 95% CI, -0.23 to -0.01), p = 0.044. Mortality in subjects with plasma interleukin-1 receptor antagonist below 2,071 pg/mL was not reduced by recombinant human interleukin-1 receptor antagonist (adjusted risk difference, +0.07; 95% CI, -0.04 to +0.17), p = 0.230. Interaction between plasma interleukin-1 beta concentration and recombinant human

  11. Analysis of the activation profile of dendritic cells derived from the bone marrow of interleukin-12/interleukin-23-deficient mice

    PubMed Central

    Bastos, Karina R B; de Deus Vieira de Moraes, Luciana; Zago, Cláudia A; Marinho, Cláudio R F; Russo, Momtchilo; Alvarez, José M M; D'Império Lima, Maria R

    2005-01-01

    We have previously shown that macrophages from interleukin (IL)-12p40 gene knockout (IL-12/IL-23−/−) mice have a bias towards the M2 activation profile, spontaneously secreting large quantities of transforming growth factor-β1 (TGF-β1) and producing low levels of nitric oxide (NO) in response to lipopolysaccharide (LPS) and interferon-γ (IFN-γ). To verify whether the activation profile of dendritic cells (DCs) is also influenced by the absence of IL-12/IL-23, bone marrow-derived DCs from IL-12/IL-23−/− and C57BL/6 mice were evaluated. At first we noticed that ≈ 50% of the C57BL/6 DCs were dead after LPS-induced maturation, whereas the mortality of IL-12/IL-23−/− DCs was < 10%, a protective effect that diminished when recombinant IL-12 (rIL-12) was added during maturation. Similarly to macrophages, mature IL-12/IL-23−/− DCs (mDCs) produced higher levels of TGF-β1 and lower levels of NO than C57BL/6 mDCs. NO release was IFN-γ-dependent, as evidenced by the poor response of IFN-γ−/− and IL-12/IL-23−/−IFN-γ−/− mDCs. Nevertheless, IFN-γ deficiency was not the sole reason for the weak NO response observed in the absence of IL-12/IL-23. The high level of TGF-β1 secretion by IL-12/IL-23−/− mDCs could explain why exogenous IFN-γ partially restored the NO production of IFN-γ−/− mDCs, while IL-12/IL-23−/− IFN-γ−/− mDCs remained unresponsive. We also showed that CD4+ T-cell proliferation was inhibited by C57BL/6 mDCs, but not by IL-12/IL-23−/− mDCs. IFN-γ and NO appear to mediate this antiproliferative effect because this effect was not observed in the presence of mDCs from IFN-γ−/− or IL-12/IL-23−/− IFN-γ−/− mice and it was attenuated by aminoguanidine. We conclude that the presence of IL-12/IL-23 during LPS-induced maturation influences the activation profile of DCs by a mechanism that is, only in part, IFN-γ dependent. PMID:15804287

  12. Interleukin-12 plasmid DNA delivery using l-thyroxine-conjugated polyethylenimine nanocarriers

    NASA Astrophysics Data System (ADS)

    Dehshahri, Ali; Sadeghpour, Hossein; Kazemi Oskuee, Reza; Fadaei, Mahin; Sabahi, Zahra; Alhashemi, Samira Hossaini; Mohazabieh, Erfaneh

    2014-05-01

    In this study, l-thyroxine was covalently grafted on 25 kDa branched polyethylenimine (PEI), and the ability of the nano-sized polyplexes for transferring plasmid encoding interleukin-12 (IL-12) gene was evaluated. As there are several problems in systemic administration of recombinant IL-12 protein, local expression of the plasmid encoding IL-12 gene inside the tumor tissue has been considered as an effective alternative approach. The l-thyroxine-conjugated PEI polyplexes were prepared using pUMVC3-hIL12 plasmid, and their transfection activity was determined in HepG2 human liver carcinoma and Neuro2A neuroblastoma cell lines. The polyplexes characterized in terms of DNA condensation ability, particle size, zeta potential, and buffering capacity as well as cytotoxicity and resistance to enzyme digestion. The results revealed that l-thyroxine conjugation of PEI increased gene transfer ability by up to two fold relative to unmodified 25 kDa PEI, the gold standard for non-viral gene delivery, with the highest increase occurring at degrees of conjugation around 10 %. pDNA condensation tests and dynamic light scattering measurements exhibited the ability of PEI conjugates to optimally condense the plasmid DNA into polyplexes in the size range around 200 nm. The modified polymers showed remarkable buffering capacity and protection against enzymatic degradation comparable to that of unmodified PEI. These results suggest that l-thyroxine conjugation of PEI is a simple modification strategy for future investigations aimed at developing a targeting gene vehicle.

  13. Clinical features of Candidiasis in patients with inherited interleukin 12 receptor β1 deficiency.

    PubMed

    Ouederni, Monia; Sanal, Ozden; Ikinciogullari, Aydan; Tezcan, Ilhan; Dogu, Figen; Sologuren, Ithaisa; Pedraza-Sánchez, Sigifredo; Keser, Melike; Tanir, Gonul; Nieuwhof, Chris; Colino, Elena; Kumararatne, Dinakantha; Levy, Jacov; Kutukculer, Necil; Aytekin, Caner; Herrera-Ramos, Estefanía; Bhatti, Micah; Karaca, Neslihan; Barbouche, Ridha; Broides, Arnon; Goudouris, Ekaterini; Franco, José Luis; Parvaneh, Nima; Reisli, Ismail; Strickler, Alexis; Shcherbina, Anna; Somer, Ayper; Segal, Anthony; Angel-Moreno, Alfonso; Lezana-Fernandez, José Luis; Bejaoui, Mohamed; Bobadilla-Del Valle, Miriam; Kachboura, Salem; Sentongo, Timothy; Ben-Mustapha, Imen; Bustamante, Jacinta; Picard, Capucine; Puel, Anne; Boisson-Dupuis, Stéphanie; Abel, Laurent; Casanova, Jean-Laurent; Rodríguez-Gallego, Carlos

    2014-01-01

    Interleukin 12Rβ1 (IL-12Rβ1)-deficient patients are prone to clinical disease caused by mycobacteria, Salmonella, and other intramacrophagic pathogens, probably because of impaired interleukin 12-dependent interferon γ production. About 25% of patients also display mucocutaneous candidiasis, probably owing to impaired interleukin 23-dependent interleukin 17 immunity. The clinical features and outcome of candidiasis in these patients have not been described before, to our knowledge. We report here the clinical signs of candidiasis in 35 patients with IL-12Rβ1 deficiency. Most (n = 71) of the 76 episodes of candidiasis were mucocutaneous. Isolated oropharyngeal candidiasis (OPC) was the most common presentation (59 episodes, 34 patients) and was recurrent or persistent in 26 patients. Esophageal candidiasis (n = 7) was associated with proven OPC in 2 episodes, and cutaneous candidiasis (n = 2) with OPC in 1 patient, whereas isolated vulvovaginal candidiasis (VVC; n = 3) was not. Five episodes of proven invasive candidiasis were documented in 4 patients; 1 of these episodes was community acquired in the absence of any other comorbid condition. The first episode of candidiasis occurred earlier in life (median age±standard deviation, 1.5 ± 7.87 years) than infections with environmental mycobacteria (4.29 ± 11.9 years), Mycobacterium tuberculosis (4 ± 3.12 years), or Salmonella species (4.58 ± 4.17 years) or other rare infections (3 ± 11.67 years). Candidiasis was the first documented infection in 19 of the 35 patients, despite the vaccination of 10 of these 19 patients with live bacille Calmette-Guérin. Patients who are deficient in IL-12Rβ1 may have candidiasis, usually mucocutaneous, which is frequently recurrent or persistent. Candidiasis may be the first clinical manifestation in these patients.

  14. Clinical Features of Candidiasis in Patients With Inherited Interleukin 12 Receptor β1 Deficiency

    PubMed Central

    Ouederni, Monia; Sanal, Ozden; Ikincioğullari, Aydan; Tezcan, Ilhan; Dogu, Figen; Sologuren, Ithaisa; Pedraza-Sánchez, Sigifredo; Keser, Melike; Tanir, Gonul; Nieuwhof, Chris; Colino, Elena; Kumararatne, Dinakantha; Levy, Jacov; Kutukculer, Necil; Aytekin, Caner; Herrera-Ramos, Estefanía; Bhatti, Micah; Karaca, Neslihan; Barbouche, Ridha; Broides, Arnon; Goudouris, Ekaterini; Franco, José Luis; Parvaneh, Nima; Reisli, Ismail; Strickler, Alexis; Shcherbina, Anna; Somer, Ayper; Segal, Anthony; Angel-Moreno, Alfonso; Lezana-Fernandez, José Luis; Bejaoui, Mohamed; Bobadilla-Del Valle, Miriam; Kachboura, Salem; Sentongo, Timothy; Ben-Mustapha, Imen; Bustamante, Jacinta; Picard, Capucine; Puel, Anne; Boisson-Dupuis, Stéphanie; Abel, Laurent; Casanova, Jean-Laurent; Rodríguez-Gallego, Carlos

    2014-01-01

    Background. Interleukin 12Rβ1 (IL-12Rβ1)–deficient patients are prone to clinical disease caused by mycobacteria, Salmonella, and other intramacrophagic pathogens, probably because of impaired interleukin 12–dependent interferon γ production. About 25% of patients also display mucocutaneous candidiasis, probably owing to impaired interleukin 23–dependent interleukin 17 immunity. The clinical features and outcome of candidiasis in these patients have not been described before, to our knowledge. We report here the clinical signs of candidiasis in 35 patients with IL-12Rβ1 deficiency. Results. Most (n = 71) of the 76 episodes of candidiasis were mucocutaneous. Isolated oropharyngeal candidiasis (OPC) was the most common presentation (59 episodes, 34 patients) and was recurrent or persistent in 26 patients. Esophageal candidiasis (n = 7) was associated with proven OPC in 2 episodes, and cutaneous candidiasis (n = 2) with OPC in 1 patient, whereas isolated vulvovaginal candidiasis (VVC; n = 3) was not. Five episodes of proven invasive candidiasis were documented in 4 patients; 1 of these episodes was community acquired in the absence of any other comorbid condition. The first episode of candidiasis occurred earlier in life (median age±standard deviation, 1.5 ± 7.87 years) than infections with environmental mycobacteria (4.29 ± 11.9 years), Mycobacterium tuberculosis (4 ± 3.12 years), or Salmonella species (4.58 ± 4.17 years) or other rare infections (3 ± 11.67 years). Candidiasis was the first documented infection in 19 of the 35 patients, despite the vaccination of 10 of these 19 patients with live bacille Calmette-Guérin. Conclusions. Patients who are deficient in IL-12Rβ1 may have candidiasis, usually mucocutaneous, which is frequently recurrent or persistent. Candidiasis may be the first clinical manifestation in these patients. PMID:24186907

  15. Expression, purification and characterisation of recombinant Escherichia coli derived chicken interleukin-12.

    PubMed

    Thomas, Jesse D; Morris, Kirsten R; Godfrey, Dale I; Lowenthal, John W; Bean, Andrew G D

    2008-12-15

    Zoonotic viruses, such as H5N1 Avian Influenza, pose major threats to both animals and humans, and with this in mind there is a need for the development of new anti-viral strategies. The cytokine interleukin-12 (IL-12) is known to play a pivotal regulatory role in the anti-viral response due to its role in the induction of the key anti-viral cytokine IFN-gamma. Therefore, strategies which provide a means for the production of therapeutic quantities of IL-12 may be of major benefit. Here we describe the development of biologically active Escherichia coli (E. coli) derived chicken IL-12 (ChIL-12). The single chain ChIL-12 gene was cloned into the pET32b expression vector, transformed into the BL-21 E. coli strain and expression induced with IPTG. Over expressed protein was solubilised with zwittergent detergent and isolated utilising Nickel ion affinity chromatography. Biological activity was determined as ChIL-12 stimulated proliferation of pre-treated T-cells in vitro. This study is the first example of a biologically active E. coli derived IL-12 from a non-mammalian vertebrate subsequently providing a means for testing the anti-viral therapeutic potential of ChIL-12 in an in vivo model.

  16. Role of interleukin 12 in experimental neonatal sepsis caused by group B streptococci.

    PubMed Central

    Mancuso, G; Cusumano, V; Genovese, F; Gambuzza, M; Beninati, C; Teti, G

    1997-01-01

    Cytokines are suspected to play an important role in systemic infections by group B streptococci (GBS), an important cause of neonatal sepsis. This work was undertaken to determine if interleukin 12 (IL-12) is produced in mouse pups infected with GBS and has a role in this sepsis model. IL-12 elevations were measured by both an enzyme-linked immunosorbent assay and a bioassay in plasma samples obtained from 12 to 72 h after GBS challenge. Pretreatment with neutralizing anti-IL-12 antibodies significantly increased lethality and blood CFU (P < 0.05). Conversely, either prophylactically or therapeutically administered recombinant IL-12 (rIL-12) significantly improved survival time and decreased blood CFU. Since these beneficial effects were associated with increased spleen gamma interferon (IFN-gamma) production, we examined whether the latter cytokine mediated the observed rIL-12 effects. Pretreatment with neutralizing anti-IFN-gamma monoclonal antibodies significantly counteracted the beneficial effects of rIL-12 on lethality. Our data indicate that rIL-12 is a possible candidate for treatment of GBS sepsis and that its activities in this model are at least partially mediated by IFN-gamma. PMID:9284145

  17. Combined Stimulation with Interleukin-18 and Interleukin-12 Potently Induces Interleukin-8 Production by Natural Killer Cells.

    PubMed

    Poznanski, Sophie M; Lee, Amanda J; Nham, Tina; Lusty, Evan; Larché, Margaret J; Lee, Dean A; Ashkar, Ali A

    2017-01-01

    The combination of interleukin (IL)-18 and IL-12 (IL-18+IL-12) potently stimulates natural killer (NK) cells, triggering an innate immune response to infections and cancers. Strategies exploiting the effects of IL-18+IL-12 have shown promise for cancer immunotherapy. However, studies have primarily characterized the NK cell response to IL-18+IL-12 in terms of interferon (IFN)-γ production, with little focus on other cytokines produced. IL-8 plays a critical role in activating and recruiting immune cells, but it also has tumor-promoting functions. IL-8 is classically produced by regulatory NK cells; however, cytotoxic NK cells do not typically produce IL-8. In this study, we uncover that stimulation with IL-18+IL-12 induces high levels of IL-8 production by ex vivo expanded and freshly isolated NK cells and NK cells in peripheral blood mononuclear cells. We further report that tumor necrosis factor (TNF)-α, produced by NK cells following IL-18+IL-12 stimulation, regulates IL-8 production. The IL-8 produced is in turn required for maximal IFN-γ and TNF-α production. These findings may have important implications for the immune response to infections and cancer immunotherapies. This study broadens our understanding of NK cell function and IL-18+IL-12 synergy by uncovering an unprecedented ability of IL-18+IL-12-activated peripheral blood NK cells to produce elevated levels of IL-8 and identifying the requirement for intermediates induced by IL-18+IL-12 for maximal cytokine production following stimulation. © 2017 S. Karger AG, Basel.

  18. Reevaluating αE-catenin monomer and homodimer functions by characterizing E-cadherin/αE-catenin chimeras

    PubMed Central

    Bianchini, Julie M.; Kitt, Khameeka N.; Gloerich, Martijn; Pokutta, Sabine; Weis, William I.

    2015-01-01

    As part of the E-cadherin–β-catenin–αE-catenin complex (CCC), mammalian αE-catenin binds F-actin weakly in the absence of force, whereas cytosolic αE-catenin forms a homodimer that interacts more strongly with F-actin. It has been concluded that cytosolic αE-catenin homodimer is not important for intercellular adhesion because E-cadherin/αE-catenin chimeras thought to mimic the CCC are sufficient to induce cell–cell adhesion. We show that, unlike αE-catenin in the CCC, these chimeras homodimerize, bind F-actin strongly, and inhibit the Arp2/3 complex, all of which are properties of the αE-catenin homodimer. To more accurately mimic the junctional CCC, we designed a constitutively monomeric chimera, and show that E-cadherin–dependent cell adhesion is weaker in cells expressing this chimera compared with cells in which αE-catenin homodimers are present. Our results demonstrate that E-cadherin/αE-catenin chimeras used previously do not mimic αE-catenin in the native CCC, and imply that both CCC-bound monomer and cytosolic homodimer αE-catenin are required for strong cell–cell adhesion. PMID:26416960

  19. Structure of the beta 2 homodimer of bacterial luciferase from Vibrio harveyi: X-ray analysis of a kinetic protein folding trap.

    PubMed Central

    Thoden, J. B.; Holden, H. M.; Fisher, A. J.; Sinclair, J. F.; Wesenberg, G.; Baldwin, T. O.; Rayment, I.

    1997-01-01

    Luciferase, as isolated from Vibrio harveyi, is an alpha beta heterodimer. When allowed to fold in the absence of the alpha subunit, either in vitro or in vivo, the beta subunit of enzyme will form a kinetically stable homodimer that does not unfold even after prolonged incubation in 5 M urea at pH 7.0 and 18 degrees C. This form of the beta subunit, arising via kinetic partitioning on the folding pathway, appears to constitute a kinetically trapped alternative to the heterodimeric enzyme (Sinclair JF, Ziegler MM, Baldwin TO. 1994. Kinetic partitioning during protein folding yields multiple native states. Nature Struct Biol 1: 320-326). Here we describe the X-ray crystal structure of the beta 2 homodimer of luciferase from V. harveyi determined and refined at 1.95 A resolution. Crystals employed in the investigational belonged to the orthorhombic space group P2(1)2(1)2(1) with unit cell dimensions of a = 58.8 A, b = 62.0 A, and c = 218.2 A and contained one dimer per asymmetric unit. Like that observed in the functional luciferase alpha beta heterodimer, the major tertiary structural motif of each beta subunit consists of an (alpha/beta)8 barrel (Fisher AJ, Raushel FM, Baldwin TO, Rayment I. 1995. Three-dimensional structure of bacterial luciferase from Vibrio harveyi at 2.4 A resolution. Biochemistry 34: 6581-6586). The root-mean-square deviation of the alpha-carbon coordinates between the beta subunits of the hetero- and homodimers is 0.7 A. This high resolution X-ray analysis demonstrated that "domain" or "loop" swapping has not occurred upon formation of the beta 2 homodimer and thus the stability of the beta 2 species to denaturation cannot be explained in such simple terms. In fact, the subunit:subunit interfaces observed in both the beta 2 homodimer and alpha beta heterodimer are remarkably similar in hydrogen-bonding patterns and buried surface areas. PMID:9007973

  20. Interleukin-12 Induces a Th1-like Response to Burkholderia mallei and Limited Protection in BALB/c Mice

    DTIC Science & Technology

    2005-09-02

    protection from a lethal challenge. 15. SUBJECT TERMS Burkholderia mallei , glanders , cytokines, immune response, humoral, cellular, laboratory animals...model of sublethal and lethal intraperitoneal glanders ( Burkholderia mallei ). Vet Pathol 2000;37:626–36. [34] Jankovic D, Caspar P, Zweig M, Garcia...Vaccine 24 (2006) 1413–1420 Interleukin-12 induces a Th1-like response to Burkholderia mallei and limited protection in BALB/c mice Kei Amemiya

  1. Tristetraprolin regulation of interleukin 23 mRNA stability prevents a spontaneous inflammatory disease

    PubMed Central

    Molle, Céline; Zhang, Tong; Ysebrant de Lendonck, Laure; Gueydan, Cyril; Andrianne, Mathieu; Sherer, Félicie; Van Simaeys, Gaetan; Blackshear, Perry J.; Leo, Oberdan

    2013-01-01

    Interleukin (IL) 12 and IL23 are two related heterodimeric cytokines produced by antigen-presenting cells. The balance between these two cytokines plays a crucial role in the control of Th1/Th17 responses and autoimmune inflammation. Most studies focused on their transcriptional regulation. Herein, we explored the role of the adenine and uridine–rich element (ARE)–binding protein tristetraprolin (TTP) in influencing mRNA stability of IL12p35, IL12/23p40, and IL23p19 subunits. LPS-stimulated bone marrow–derived dendritic cells (BMDCs) from TTP−/− mice produced normal levels of IL12/23p40. Production of IL12p70 was modestly increased in these conditions. In contrast, we observed a strong impact of TTP on IL23 production and IL23p19 mRNA stability through several AREs in the 3′ untranslated region. TTP−/− mice spontaneously develop an inflammatory syndrome characterized by cachexia, myeloid hyperplasia, dermatitis, and erosive arthritis. We observed IL23p19 expression within skin lesions associated with exacerbated IL17A and IL22 production by infiltrating γδ T cells and draining lymph node CD4 T cells. We demonstrate that the clinical and immunological parameters associated with TTP deficiency were completely dependent on the IL23–IL17A axis. We conclude that tight control of IL23 mRNA stability by TTP is critical to avoid severe inflammation. PMID:23940256

  2. Tristetraprolin regulation of interleukin 23 mRNA stability prevents a spontaneous inflammatory disease.

    PubMed

    Molle, Céline; Zhang, Tong; Ysebrant de Lendonck, Laure; Gueydan, Cyril; Andrianne, Mathieu; Sherer, Félicie; Van Simaeys, Gaetan; Blackshear, Perry J; Leo, Oberdan; Goriely, Stanislas

    2013-08-26

    Interleukin (IL) 12 and IL23 are two related heterodimeric cytokines produced by antigen-presenting cells. The balance between these two cytokines plays a crucial role in the control of Th1/Th17 responses and autoimmune inflammation. Most studies focused on their transcriptional regulation. Herein, we explored the role of the adenine and uridine-rich element (ARE)-binding protein tristetraprolin (TTP) in influencing mRNA stability of IL12p35, IL12/23p40, and IL23p19 subunits. LPS-stimulated bone marrow-derived dendritic cells (BMDCs) from TTP(-/-) mice produced normal levels of IL12/23p40. Production of IL12p70 was modestly increased in these conditions. In contrast, we observed a strong impact of TTP on IL23 production and IL23p19 mRNA stability through several AREs in the 3' untranslated region. TTP(-/-) mice spontaneously develop an inflammatory syndrome characterized by cachexia, myeloid hyperplasia, dermatitis, and erosive arthritis. We observed IL23p19 expression within skin lesions associated with exacerbated IL17A and IL22 production by infiltrating γδ T cells and draining lymph node CD4 T cells. We demonstrate that the clinical and immunological parameters associated with TTP deficiency were completely dependent on the IL23-IL17A axis. We conclude that tight control of IL23 mRNA stability by TTP is critical to avoid severe inflammation.

  3. Regulation of Memory T Cells by Interleukin-23.

    PubMed

    Li, Yanchun; Wang, Hongbo; Lu, Honghua; Hua, Shucheng

    2016-01-01

    Interleukin-23 (IL-23), a member of the IL-12 family of cytokines, is a heterodimeric cytokine. It is composed of subunits p40 (shared with IL-12) and p19 (an IL-12 p35-related subunit) and is secreted by several types of immune cells, such as natural killer cells and dendritic cells. The IL-23 receptor is composed of the subunit IL-12Rβ1 and the IL-23-specific subunit IL-23R. The binding of IL-23 to its specific cell surface receptor regulates a number of functions, including proliferation and differentiation of cells and secretion of cell factors. Memory T cells are a subset of T cells that secrete numerous important cell factors, and they function in the immune response to infection and diseases like cancer, autoimmune disease and bronchial asthma. IL-23R is expressed on the surface of memory T cells, which suggests that it can specifically regulate memory T cell function. IL-23 has been widely used as a clinical indicator in immune-related diseases and shows potential for use in disease treatment. Here we review the current progress in the study of the role of IL-23 in the regulation of memory T cells. © 2016 S. Karger AG, Basel.

  4. Isotope shift of 40,42,44,48Ca in the 4s 2S1/2 → 4p 2P3/2 transition

    NASA Astrophysics Data System (ADS)

    Gorges, C.; Blaum, K.; Frömmgen, N.; Geppert, Ch; Hammen, M.; Kaufmann, S.; Krämer, J.; Krieger, A.; Neugart, R.; Sánchez, R.; Nörtershäuser, W.

    2015-12-01

    We report on improved isotope shift measurements of the isotopes {}{40,42,{44,48}}Ca in the 4{{s}}{ }2{{{S}}}1/2\\to 4{{p}}{ }2{{{P}}}3/2 (D2) transition using collinear laser spectroscopy. Accurately known isotope shifts in the 4{{s}}{ }2{{{S}}}1/2\\to 4{{p}}{ }2{{{P}}}1/2(D1) transition were used to calibrate the ion beam energy with an uncertainty of {{Δ }}U≈ +/- 0.25 {{V}}. The accuracy in the D2 transition was improved by a factor of 5-10. A King-plot analysis of the two transitions revealed that the field shift factor in the D2 line is about 1.8(13)% larger than in the D1 transition which is ascribed to relativistic contributions of the 4{{{p}}}1/2 wave function.

  5. [Allergic asthma and interleukins 2, 4, 5, 6 and 12 and gamma interferon levels].

    PubMed

    Bastida Segura, Diana Lyzbeth; López Velásquez, Benjamin; Castrejón Vázquez, María Isabel; Galicia Tapía, Jorge; Cano Altamirano, Silvia; Miranda Feria, Alfonso Javier

    2004-01-01

    Asthma is an inflammatory chronic illness, in which mastocyt cells, basophils, T lymphocytes, eosinophils and cytokines play a role. Its association with the production of TH2 cytokines is not well known, but it is considered an aberrant immune response, yielding the activation and recruitment of a number of effector cells (mastocyts/eosinophils) and the appearance of clinical symptoms. To determine the serum values of the interleukins 2, 4, 5, 6 and 12 and gamma interferon in relation to the severity degree of asthma and the time of immunotherapy in patients with stable chronic allergic bronchial asthma. Clinical records of allergic asthmatic patients from the external consultation at Servicio de Alergia e Immunología Clínica were reviewed in a period of 12 months (1st January 2002 to 1st January 2003) and those of healthy volunteers, forming three groups: Group 1, allergic asthmatics with immunotherapy less than 24 months; Group 2, allergic asthmatics with more than 24 months of immunotherapy, and Group 3, healthy volunteers (control group). Previous informed consent, a serum sample was taken of all subjects. Ninety-two subjects were included: 41 (45%) allergic asthmatics and 51 (55%) healthy volunteers. Significant differences were found in interleukins 2, 4, 5, 6 and 12 levels between healthy volunteers and asthmatics without relating the immunotherapy time. In the total group gamma interferon levels were not found. A relation of interleukins Th2 levels with the severity degree of asthma was not found. Differences of serum interleukins Th1 and Th2 in allergic patients related to immunotherapy time were not significant; even though, irrespective of immunotherapy time, IgG levels were always high. Patients with allergic asthma have a predominance of serum interleukins Th2 and, despite of the immunotherapy, in the maintaining phase, these continue high, which may be due to an immune system dysregulation maybe including other factors. Immunotherapy continues

  6. Interleukin-1 Receptor Antagonist and Interleukin-4 Genes Variable Number Tandem Repeats Are Associated with Adiposity in Malaysian Subjects

    PubMed Central

    Kok, Yung-Yean; Ong, Hing-Huat

    2017-01-01

    Interleukin-1 receptor antagonist (IL1RA) intron 2 86 bp repeat and interleukin-4 (IL4) intron 3 70 bp repeat are variable number tandem repeats (VNTRs) that have been associated with various diseases, but their role in obesity is elusive. The objective of this study was to investigate the association of IL1RA and IL4 VNTRs with obesity and adiposity in 315 Malaysian subjects (128 M/187 F; 23 Malays/251 ethnic Chinese/41 ethnic Indians). The allelic distributions of IL1RA and IL4 were significantly different among ethnicities, and the alleles were associated with total body fat (TBF) classes. Individuals with IL1RA I/II genotype or allele II had greater risk of having higher overall adiposity, relative to those having the I/I genotype or I allele, respectively, even after controlling for ethnicity [Odds Ratio (OR) of I/II genotype = 12.21 (CI = 2.54, 58.79; p = 0.002); II allele = 5.78 (CI = 1.73, 19.29; p = 0.004)]. However, IL4 VNTR B2 allele was only significantly associated with overall adiposity status before adjusting for ethnicity [OR = 1.53 (CI = 1.04, 2.23; p = 0.03)]. Individuals with IL1RA II allele had significantly higher TBF than those with I allele (31.79 ± 2.52 versus 23.51 ± 0.40; p = 0.005). Taken together, IL1RA intron 2 VNTR seems to be a genetic marker for overall adiposity status in Malaysian subjects. PMID:28293435

  7. Interleukin-1 Receptor Antagonist and Interleukin-4 Genes Variable Number Tandem Repeats Are Associated with Adiposity in Malaysian Subjects.

    PubMed

    Kok, Yung-Yean; Ong, Hing-Huat; Say, Yee-How

    2017-01-01

    Interleukin-1 receptor antagonist ( IL1RA ) intron 2 86 bp repeat and interleukin-4 ( IL4 ) intron 3 70 bp repeat are variable number tandem repeats (VNTRs) that have been associated with various diseases, but their role in obesity is elusive. The objective of this study was to investigate the association of IL1RA and IL4 VNTRs with obesity and adiposity in 315 Malaysian subjects (128 M/187 F; 23 Malays/251 ethnic Chinese/41 ethnic Indians). The allelic distributions of IL1RA and IL4 were significantly different among ethnicities, and the alleles were associated with total body fat (TBF) classes. Individuals with IL1RA I/II genotype or allele II had greater risk of having higher overall adiposity, relative to those having the I/I genotype or I allele, respectively, even after controlling for ethnicity [Odds Ratio (OR) of I/II genotype = 12.21 (CI = 2.54, 58.79; p = 0.002); II allele = 5.78 (CI = 1.73, 19.29; p = 0.004)]. However, IL4 VNTR B2 allele was only significantly associated with overall adiposity status before adjusting for ethnicity [OR = 1.53 (CI = 1.04, 2.23; p = 0.03)]. Individuals with IL1RA II allele had significantly higher TBF than those with I allele (31.79 ± 2.52 versus 23.51 ± 0.40; p = 0.005). Taken together, IL1RA intron 2 VNTR seems to be a genetic marker for overall adiposity status in Malaysian subjects.

  8. New Interleukins in Psoriasis and Psoriatic Arthritis Patients: The Possible Roles of Interleukin-33 to Interleukin-38 in Disease Activities and Bone Erosions.

    PubMed

    Li, Jiang; Liu, Lei; Rui, Wenlong; Li, Xiangyu; Xuan, Dandan; Zheng, Shucong; Yu, Yiyun; Zhang, Jiong; Kong, Ning; Zhu, Xiaoxia; Zou, Hejian; Wan, Weiguo; Xue, Yu

    2017-01-01

    New interleukins (ILs), especially members of IL-1 and IL-12 families, have recently been reported to be involved in the development and regulation of autoimmune and inflammatory diseases. In this study, we aimed to explore the impact of these new ILs in psoriasis (Ps) and psoriatic arthritis (PsA). Forty PsA patients, 20 Ps patients, and 20 healthy controls (HCs) were recruited. Blood samples were obtained for detecting the levels of ILs, IL-12/23p40, and tumor necrosis factor α (TNF-α). The severity of skin lesions was assessed by the Psoriasis Area and Severity Index (PASI). Arthritis activities of PsA patients were assessed by the PsA Joint Activity Index. For PsA patients, circulating osteoclastogenesis-related cytokines (osteoprotegerin and receptor activator of nuclear factor-κB ligand) and numbers of osteoclast precursors were evaluated. Radiographic features of affected joints in these patients were scored for erosion, joint-space narrowing, osteolysis, and new bone formation. Correlations among levels of these ILs, Ps, and PsA disease activities and bone erosions were studied. Ps and PsA patients had higher serum levels of TNF-α, IL-12/23p40, and IL-33. Serum levels of IL-34 and IL-35 were higher in PsA patients than in Ps patients and HCs. Patients with pustular Ps had higher serum levels of IL-36α and IL-38 than patients with Ps vulgaris or HCs. Increased serum levels of IL-36α were positively correlated with PASI. Certain ILs were elevated in the circulation of patients with Ps and PsA, which might contribute to the pathogenesis of skin lesions and arthritis. © 2017 S. Karger AG, Basel.

  9. 22 CFR 40.12-40.19 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false [Reserved] 40.12-40.19 Section 40.12-40.19 Foreign Relations DEPARTMENT OF STATE VISAS REGULATIONS PERTAINING TO BOTH NONIMMIGRANTS AND IMMIGRANTS UNDER THE IMMIGRATION AND NATIONALITY ACT, AS AMENDED Medical Grounds of Ineligibility §§ 40.12-40.19...

  10. Preparation and characterization of human interleukin-5 expressed in recombinant Escherichia coli.

    PubMed Central

    Proudfoot, A E; Fattah, D; Kawashima, E H; Bernard, A; Wingfield, P T

    1990-01-01

    The gene coding for human interleukin-5 was synthesized and expressed in Escherichia coli under control of a heat-inducible promoter. High-level expression, 10-15% of total cellular protein, was achieved in E. coli. The protein was produced in an insoluble state. A simple extraction, renaturation and purification scheme is described. The recombinant protein was found to be a homodimer, similar to the natural murine-derived protein. Despite the lack of glycosylation, high specific activities were obtained in three 'in vitro' biological assays. Physical characterization of the protein showed it to be mostly alpha-helical, supporting the hypothesis that a conformational similarity exists among certain cytokines. Images Fig. 1. Fig. 3. PMID:2205201

  11. Myxoma Virus Expressing Human Interleukin-12 Does Not Induce Myxomatosis in European Rabbits▿

    PubMed Central

    Stanford, Marianne M.; Barrett, John W.; Gilbert, Philippe-Alexandre; Bankert, Richard; McFadden, Grant

    2007-01-01

    Myxoma virus (MV) is a candidate for oncolytic virotherapy due to its ability to selectively infect and kill tumor cells, yet MV is a species-specific pathogen that causes disease only in European rabbits. To assess the ability of MV to deliver cytokines to tumors, we created an MV (vMyxIL-12) that expresses human interleukin-12 (IL-12). vMyxIL-12 replicates similarly to wild-type MV, and virus-infected cells secrete bioactive IL-12. Yet, vMyxIL-12 does not cause myxomatosis, despite expressing the complete repertoire of MV proteins. Thus, vMyxIL-12 exhibits promise as an oncolytic candidate and is safe in all known vertebrate hosts, including lagomorphs. PMID:17728229

  12. Myxoma virus expressing human interleukin-12 does not induce myxomatosis in European rabbits.

    PubMed

    Stanford, Marianne M; Barrett, John W; Gilbert, Philippe-Alexandre; Bankert, Richard; McFadden, Grant

    2007-11-01

    Myxoma virus (MV) is a candidate for oncolytic virotherapy due to its ability to selectively infect and kill tumor cells, yet MV is a species-specific pathogen that causes disease only in European rabbits. To assess the ability of MV to deliver cytokines to tumors, we created an MV (vMyxIL-12) that expresses human interleukin-12 (IL-12). vMyxIL-12 replicates similarly to wild-type MV, and virus-infected cells secrete bioactive IL-12. Yet, vMyxIL-12 does not cause myxomatosis, despite expressing the complete repertoire of MV proteins. Thus, vMyxIL-12 exhibits promise as an oncolytic candidate and is safe in all known vertebrate hosts, including lagomorphs.

  13. Interleukin-1beta-induced hyperresponsiveness to [Sar9,Met(O2)11]substance P in isolated human bronchi.

    PubMed

    Barchasz, E; Naline, E; Molimard, M; Moreau, J; Georges, O; Emonds-Alt, X; Advenier, C

    1999-08-20

    Interleukin-1beta has been reported to induce airway hyperresponsiveness in several animal models. In this study, we have investigated whether interleukin-1beta was able to potentiate the contractions of human isolated small bronchi (internal diameter < or = 1 mm) provoked by a specific tachykinin NK1 receptor agonist, [Sar9,Met(O2)11]substance P. Pre-incubation of human isolated small bronchi with interleukin-1beta (10 ng/ml, in Krebs-Henseleit solution, at 21 degrees C for 15 h) potentiated the contractile response to [Sar9,Met(O2)11]substance P. It also increased the [Sar9,Met(O2)11]substance P-induced release of thromboxane B2, the stable metabolite of thromboxane A2. Indomethacin (10(-6) M), a non-specific cyclooxygenase inhibitor, or GR 32191 ((1R-(1alpha(Z)),2beta,3beta,5alpha))-(+)-7-(5-(((1,1' -biphenyl)-4-yl)-methoxy)-3-hydroxy-2-(1-piperidinyl)cyclopentyl)-4-hept enoic acid, hydrochloride) (10(-6) M), a prostanoid TP-receptor antagonist, blocked the contractions induced by [Sar9,Met(O2)11]substance P both in control experiments and after interleukin-1beta pre-treatment, indicating that prostanoids and thromboxane receptors are directly implicated in the [Sar9,Met(O2)11]substance P-induced contractile response. The thromboxane mimetic U-46619 (10(-8)-10(-6) M) (9,11-dideoxy-11alpha,9alpha-epoxymethano-prostaglandin F2alpha)-induced contractions of human isolated small bronchi were not enhanced by interleukin-1beta pre-treatment, suggesting that no up-regulation of thromboxane receptors occurred. Furthermore, the cyclooxygenase-2 inhibitor CGP 28238 (6-(2,4-difluorophenoxy)-5-methyl-sulfonylamino-1-indanon e) (10(-6) M) had no direct effect on [Sar9,Met(O2)11]substance P-provoked contractions, but inhibited the interleukin-1beta-induced potentiation of [Sar9,Met(O2)11]substance P response. In conclusion, our results show that interleukin-1beta pre-treatment is able to potentiate the contractions of isolated human small bronchi provoked by [Sar9,Met(O2

  14. Organization of the mitochondrial apoptotic BAK pore: oligomerization of the BAK homodimers.

    PubMed

    Aluvila, Sreevidya; Mandal, Tirtha; Hustedt, Eric; Fajer, Peter; Choe, Jun Yong; Oh, Kyoung Joon

    2014-01-31

    The multidomain pro-apoptotic Bcl-2 family proteins BAK and BAX are believed to form large oligomeric pores in the mitochondrial outer membrane during apoptosis. Formation of these pores results in the release of apoptotic factors including cytochrome c from the intermembrane space into the cytoplasm, where they initiate the cascade of events that lead to cell death. Using the site-directed spin labeling method of electron paramagnetic resonance (EPR) spectroscopy, we have determined the conformational changes that occur in BAK when the protein targets to the membrane and forms pores. The data showed that helices α1 and α6 disengage from the rest of the domain, leaving helices α2-α5 as a folded unit. Helices α2-α5 were shown to form a dimeric structure, which is structurally homologous to the recently reported BAX "BH3-in-groove homodimer." Furthermore, the EPR data and a chemical cross-linking study demonstrated the existence of a hitherto unknown interface between BAK BH3-in-groove homodimers in the oligomeric BAK. This novel interface involves the C termini of α3 and α5 helices. The results provide further insights into the organization of the BAK oligomeric pores by the BAK homodimers during mitochondrial apoptosis, enabling the proposal of a BAK-induced lipidic pore with the topography of a "worm hole."

  15. Phosphorylated Nuclear Receptor CAR Forms a Homodimer To Repress Its Constitutive Activity for Ligand Activation

    PubMed Central

    Shizu, Ryota; Osabe, Makoto; Perera, Lalith; Moore, Rick; Sueyoshi, Tatsuya

    2017-01-01

    ABSTRACT The nuclear receptor CAR (NR1I3) regulates hepatic drug and energy metabolism as well as cell fate. Its activation can be a critical factor in drug-induced toxicity and the development of diseases, including diabetes and tumors. CAR inactivates its constitutive activity by phosphorylation at threonine 38. Utilizing receptor for protein kinase 1 (RACK1) as the regulatory subunit, protein phosphatase 2A (PP2A) dephosphorylates threonine 38 to activate CAR. Here we demonstrate that CAR undergoes homodimer-monomer conversion to regulate this dephosphorylation. By coexpression of two differently tagged CAR proteins in Huh-7 cells, mouse primary hepatocytes, and mouse livers, coimmunoprecipitation and two-dimensional gel electrophoresis revealed that CAR can form a homodimer in a configuration in which the PP2A/RACK1 binding site is buried within its dimer interface. Epidermal growth factor (EGF) was found to stimulate CAR homodimerization, thus constraining CAR in its inactive form. The agonistic ligand CITCO binds directly to the CAR homodimer and dissociates phosphorylated CAR into its monomers, exposing the PP2A/RACK1 binding site for dephosphorylation. Phenobarbital, which is not a CAR ligand, binds the EGF receptor, reversing the EGF signal to monomerize CAR for its indirect activation. Thus, the homodimer-monomer conversion is the underlying molecular mechanism that regulates CAR activation, by placing phosphorylated threonine 38 as the common target for both direct and indirect activation of CAR. PMID:28265001

  16. Insulin resistance and serum levels of interleukin-17 and interleukin-18 in normal pregnancy.

    PubMed

    Jahromi, Abdolreza Sotoodeh; Shojaei, Mohammad; Ghobadifar, Mohamed Amin

    2014-06-01

    We performed this study to evaluate the role of Interleukin-17 (IL-17) and Interleukin-18 (IL-18) in insulin resistance during normal pregnancy. This descriptive cross sectional study was carried out on 97 healthy pregnant women including 32, 25, and 40 individuals in the first, second, and third trimesters, respectively, and on 28 healthy non pregnant women between the autumn of 2012 and the spring of 2013. We analyzed the serum concentrations of IL-17 and IL-18 by using the enzyme linked immunosorbent assay (ELISA). Insulin resistance was measured by homeostasis model assessment of insulin resistance equation. No significant differences between the demographic data of the pregnant and non pregnant groups were observed. Insulin resistant in pregnant women was significantly higher than the controls (p=0.006). Serum IL-17 concentration was significantly different in non pregnant women and pregnant women in all gestational ages (p<0.05). Serum IL-18 level was significantly lower in subjects with first, second, and third trimesters of pregnancy in compared to non pregnant women (p<0.05). No significant correlations were found between serum IL-17 and IL-18 levels with insulin resistance (r=0.08, p=0.34 vs. r=0.01, p=0.91, respectively). Our data suggested that IL-17 and IL-18 do not appear to attribute greatly to pregnancy deduced insulin resistance during normal pregnancy.

  17. The diphtheria toxin transmembrane domain as a pH sensitive membrane anchor for human interleukin-2 and murine interleukin-3.

    PubMed

    Liger, D; Nizard, P; Gaillard, C; vanderSpek, J C; Murphy, J R; Pitard, B; Gillet, D

    1998-11-01

    We have constructed two fusion proteins T-hIL-2 and T-mIL-3 in which human interleukin-2 (hIL-2) or murine interleukin-3 (mIL-3) are fused to the C-terminus of the diphtheria toxin transmembrane domain (T domain). Two additional fusion proteins, T-(Gly4-Ser)2-hIL-2 and T-(Gly4-Ser)2-mIL-3, were derived by introduction of the (Gly4-Ser)2 spacer between the T domain and cytokine components. Recognition of the hIL-2 receptor or the mIL-3 receptor by the corresponding recombinant proteins was demonstrated by their capacity to stimulate cytokine-dependent cell lines. All proteins retained the capacity of the T domain to insert into phospholipid membranes at acidic pH. Finally, anchoring of both cytokines to the membrane of lipid vesicles or living cells was assessed by specific antibody recognition. Our results show that the T domain fused to the N-terminus of a given protein can function as a pH sensitive membrane anchor for that protein.

  18. Recombinant interleukin-12 and interleukin-18 antitumor therapy in a guinea-pig hepatoma cell implant model.

    PubMed

    Shiratori, Ikuo; Suzuki, Yasuhiko; Oshiumi, Hiroyuki; Begum, Nasim A; Ebihara, Takashi; Matsumoto, Misako; Hazeki, Kaoru; Kodama, Ken; Kashiwazaki, Yasuo; Seya, Tsukasa

    2007-12-01

    Interleukin (IL)-12 and IL-18 are secreted by myeloid cells activated with adjuvants such as Bacillus Calmette-Guérin (BCG) cell wall. They induce T-helper 1 polarization in the host immune system and upregulate production of lymphocyte interferon-gamma, which leads to the induction of an antitumor gene program. It has been reported that humans have an immune system that more closely resembles that of the guinea pig in adjuvant-response features rather than the mouse system, which prevents the mouse results being extrapolated to human immunotherapy. Here we have constructed a tumor-implant system in guinea pigs to evaluate the antitumor potential of guinea pig IL-12 (gpIL-12) and guinea pig IL-18 (gpIL-18). Purified recombinant gpIL-12 and gpIL-18 were prepared and applied intraperitoneally to tumor-bearing (line 10 hepatoma) guinea pigs as the basis of the adjuvant immunotherapy. Intraperitoneal administration of gpIL-12 and gpIL-18 led to retardation of primary tumor growth and suppression of lymph-node metastasis in tumor-bearing guinea pigs. The permissible range of IL-12 appeared wider in guinea pigs than in mice. Even at an IL-12 dose higher than that in mice, there was no evidence of side-effects until day 26, when the guinea pigs were killed. gpIL-18 augmented the antitumor effect of gpIL-12 but exerted less ability to suppress lymph-node metastasis. The effects of gpIL-12 and gpIL-18 on the tumors implanted in guinea pigs will encourage us to use IL-12- and IL-18-inducible adjuvants for immunotherapy in human patients with solid cancer.

  19. Human monocytes and gingival fibroblasts release tumor necrosis factor-alpha, interleukin-1 alpha and interleukin-6 in response to particulate and soluble fractions of Prevotella melaninogenica and Fusobacterium nucleatum.

    PubMed

    Rossano, F; Rizzo, A; Sanges, M R; Cipollaro de L'Ero, G; Tufano, M A

    1993-01-01

    In this study we provide evidence that structural and soluble components of periodontopathogenic bacteria, such as Prevotella melaninogenica and Fusobacterium nucleatum, induce the release of cytokines in vitro known to cause in vivo necrotic inflammatory phenomena and bone resorption (tumor necrosis factor-alpha, interleukin-1 alpha and interleukin-6). Human monocytes and gingival fibroblasts were cultivated in vitro in the presence of both particulate and soluble bacterial fractions. A dose-dependent production of tumor necrosis factor-alpha by monocytes and gingival fibroblasts was observed in the presence of fractions of P. melaninogenica and F. nucleatum. Interleukin-1 alpha was produced in approximately the same quantities in the presence of soluble fractions of either P. melaninogenica or F. nucleatum, but in greater quantities in response to particulate fractions of P. melaninogenica. Monocytes released larger amounts of interleukin-1 alpha (about 3000 pg/ml) than gingival fibroblasts (about 1500 pg/ml). Interleukin-6 was released in greater quantities by monocytes in the presence of the pellet fraction of P. melaninogenica (about 5.5 ng/ml), but gingival fibroblasts released larger amounts of interleukin-6, especially in the presence of particulate and soluble components of F. nucleatum (about 12 ng/ml). The ability to induce the release of these cytokines notably increases the pathogenic potential of the bacteria involved in the damage of periodontal tissue.

  20. [Experimental study of interleukin-12 gene vaccines in the treatment of low-load malignant lymphoma (EL4)].

    PubMed

    Jiang, Q; Da, W; Ou, Y

    2001-11-01

    Two kinds of murine interleukin-12 (mIL-12) fusion gene vaccines were used to treat the murine low-load malignant T cell lymphoma EL4 as minimal residual disease (MRD) model. C57BL/6 synergistical mice were subcutaneously inoculated with 1 x 10(6) wild-type (wt) EL4 tumor cells as low-load lymphoma model treated with two mIL-12 gene vaccines. Package cell line PA317/12 producing mIL-12 retrovirus (RV) was used as in vivo vaccine and EL4 tumor cells transferred with mIL-12 gene as ex vivo vaccine. In both mIL-12 gene vaccine-treated groups, there was no tumor growth in 50% mice 60 days after inoculation. Nine of these no tumor growth mice were re-challenged with 5 x 10(5) wt EL4 cells, and 5 of them survived without tumors in another 60 days. All control mice died with tumors within one month after inoculation. Among those developed tumors in both vaccine-treated groups, the development of tumors was delayed, the survival period prolonged (P < 0.01), and the tumors size at death smaller (P < 0.05) as compared with the controls. In the long-survived vaccine-treated mice, no residual tumor cells were found by morphological examination. Both IL-12 gene vaccines can efficiently eliminate wt EL4 MRD in C57BL/6 mice.

  1. Generation and characterization of a potent fully human monoclonal antibody against the interleukin-23 receptor.

    PubMed

    Sasaki-Iwaoka, Haruna; Ohori, Makoto; Imasato, Akira; Taguchi, Katsunari; Minoura, Kyoko; Saito, Tetsu; Kushima, Kiyoshi; Imamura, Emiko; Kubo, Satoshi; Furukawa, Shigetada; Morokata, Tatsuaki

    2018-06-05

    Interleukin (IL)-12 and IL-23 share a common subunit (p40) and function in T-helper (Th) 1 and Th17 immunity, respectively. Anti-IL-12/23p40 and specific anti-IL-23 antibodies are currently in clinical use for psoriasis and undergoing trials for autoimmune diseases. Since expression levels of the IL-23 receptor are likely to be much lower than those of IL-23, an anti-IL-23 receptor antibody might offer greater promise in inhibiting the IL-23-IL-17 pathways involved in inflammatory disorders. To our knowledge, no anti-IL-23 receptor antibody has been trialed in clinical studies to date. This study describes the generation and characterization of AS2762900-00, a fully human monoclonal antibody against the IL-23 receptor. AS2762900-00 bound both human and cynomolgus monkey IL-23 receptors. AS2762900-00 showed potent inhibitory effects on IL-23-induced Kit-225 cell proliferation compared to the existing anti-IL-12/23p40 antibody, ustekinumab. In a single dose administration pharmacodynamics study in cynomolgus monkeys, 1 mg/kg of AS2762900-00 significantly inhibited (> 85%) IL-23-induced STAT3 phosphorylation in blood for up to 84 days. Therefore, AS2762900-00 represents a potent novel IL-23-IL-17 pathway inhibitor with the potential to be developed into a new therapy for the treatment of autoimmune diseases. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. 40 CFR 721.2584 - Dodecanoic acid, 12-amino-.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Dodecanoic acid, 12-amino-. 721.2584... Substances § 721.2584 Dodecanoic acid, 12-amino-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as dodecanoic acid, 12-amino- (PMN P-98-0823; CAS No. 693...

  3. 40 CFR 721.2584 - Dodecanoic acid, 12-amino-.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Dodecanoic acid, 12-amino-. 721.2584... Substances § 721.2584 Dodecanoic acid, 12-amino-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as dodecanoic acid, 12-amino- (PMN P-98-0823; CAS No. 693...

  4. Cancer Therapeutic Based on T Cell Receptors Designed to Regiospecifically Release Interleukin-12 | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute's Surgery Branch is seeking statements of capability or interest from parties interested in collaborative research to further develop, evaluate, or commercialize a potential cancer therapeutic based on T cells genetically engineered to express the human interleukin 12 (IL-12) cytokine only in the tumor environment.

  5. Hypothermia increases interleukin-6 and interleukin-10 in juvenile endotoxemic mice.

    PubMed

    Stewart, Corrine R; Landseadel, Jessica P; Gurka, Matthew J; Fairchild, Karen D

    2010-01-01

    To develop a juvenile mouse model to establish effects of in vivo hypothermia on expression of the inflammation-modulating cytokines tumor necrosis factor-alpha, interleukin-1beta, interleukin-6, and interleukin-10. Although induced hypothermia is neuroprotective in some patients, the mechanisms of protection are not well understood and concerns remain over potential detrimental effects, particularly in the setting of infection. We previously showed that in vitro hypothermia increases production of tumor necrosis factor-alpha and interleukin-1beta in lipopolysaccharide-treated monocytes. : Laboratory investigation. Research laboratory. Juvenile (4-wk) male C57BL/6 mice. : Mice were given chlorpromazine to suspend thermoregulation and lipopolysaccharide to stimulate cytokine production. Core temperature was maintained at 32 degrees C or 37 degrees C for 6 hrs by adjusting environmental temperature. In separate experiments, lipopolysaccharide-treated mice were kept in a cooling chamber without chlorpromazine treatment. Plasma and organs were collected for cytokine quantitation. Chlorpromazine-treated hypothermic mice had 2.3-fold and 1.8-fold higher plasma interleukin-6 and interleukin-10 levels at 6 hrs compared with identically treated normothermic mice (p < .05), whereas plasma tumor necrosis factor-alpha and interleukin-1beta were not significantly different at 2 hrs or 6 hrs. Liver tumor necrosis factor-alpha and interleukin-6 were significantly higher in hypothermic vs. normothermic mice, but lung and brain cytokines were not different. Lipopolysaccharide-treated mice kept in a cooling chamber without chlorpromazine treatment developed varying degrees of hypothermia with associated increases in plasma interleukin-6 and interleukin-10. A nonspecific marker of stress (plasma corticosterone) was not affected by hypothermia in lipopolysaccharide-treated mice. Further studies are necessary to determine the mechanism and physiologic consequences of augmented systemic

  6. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs a and burs ß), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. ...

  7. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.

    2009-03-15

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium (St UPh) was determined with high accuracy. The structure was refined at 1.80 A resolution to R{sub work} = 16.1% and R{sub free} = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 A, 1.042{sup o}, and 0.071{sup o}, respectively. The coordinate error estimated by the Luzzati plot is 0.166 A. The coordinate error based on the maximum likelihood is 0.199 A. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure ofmore » the homodimer St UPh in the complex with a K{sup +} ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).« less

  8. Dexamethasone inhibits IL-12p40 production in lipopolysaccharide-stimulated human monocytic cells by down-regulating the activity of c-Jun N-terminal kinase, the activation protein-1, and NF-kappa B transcription factors.

    PubMed

    Ma, Wei; Gee, Katrina; Lim, Wilfred; Chambers, Kelly; Angel, Jonathan B; Kozlowski, Maya; Kumar, Ashok

    2004-01-01

    IL-12 plays a critical role in the development of cell-mediated immune responses and in the pathogenesis of inflammatory and autoimmune disorders. Dexamethasone (DXM), an anti-inflammatory glucocorticoid, has been shown to inhibit IL-12p40 production in LPS-stimulated monocytic cells. In this study, we investigated the molecular mechanism by which DXM inhibits IL-12p40 production by studying the role of the mitogen-activated protein kinases (MAPKs), and the key transcription factors involved in human IL-12p40 production in LPS-stimulated monocytic cells. A role for c-Jun N-terminal kinase (JNK) MAPK in LPS-induced IL-12p40 regulation in a promonocytic THP-1/CD14 cell line was demonstrated by using specific inhibitors of JNK activation, SP600125 and a dominant-negative stress-activated protein/extracellular signal-regulated kinase kinase-1 mutant. To identify transcription factors regulating IL-12p40 gene transcription, extensive deletion analyses of the IL-12p40 promoter was performed. The results revealed the involvement of a sequence encompassing the AP-1-binding site, in addition to that of NF-kappaB. The role of AP-1 in IL-12p40 transcription was confirmed by using antisense c-fos and c-jun oligonucleotides. Studies conducted to understand the regulation of AP-1 and NF-kappaB activation by JNK MAPK revealed that both DXM and SP600125 inhibited IL-12p40 gene transcription by inhibiting the activation of AP-1 and NF-kappaB transcription factors as revealed by luciferase reporter and gel mobility shift assays. Taken together, our results suggest that DXM may inhibit IL-12p40 production in LPS-stimulated human monocytic cells by down-regulating the activation of JNK MAPK, the AP-1, and NF-kappaB transcription factors.

  9. Measurement of Rate Constants for Homodimer Subunit Exchange Using Double Electron-Electron Resonance and Paramagnetic Relaxation Enhancements

    PubMed Central

    Yang, Yunhuang; Ramelot, Theresa A.; Ni, Shuisong; McCarrick, Robert M.; Kennedy, Michael A.

    2013-01-01

    Here, we report novel methods to measure rate constants for homodimer subunit exchange using double electron-electron resonance (DEER) electron paramagnetic resonance spectroscopy measurements and nuclear magnetic resonance spectroscopy based paramagnetic relaxation enhancement (PRE) measurements. The techniques were demonstrated using the homodimeric protein Dsy0195 from the strictly anaerobic bacterium Desulfitobacterium hafniense Y51. At specific times following mixing site-specific MTSL-labeled Dsy0195 with uniformly 15N-labeled Dsy0195, the extent of exchange was determined either by monitoring the decrease of MTSL-labeled homodimer from the decay of the DEER modulation depth or by quantifying the increase of MTSL-labeled/15N-labeled heterodimer using PREs. Repeated measurements at several time points following mixing enabled determination of the homodimer subunit dissociation rate constant, k−1;, which was 0.037 ± 0.005 min−1 derived from DEER experiments with a corresponding half-life time of 18.7 minutes. These numbers agreed with independent measurements obtained from PRE experiments. These methods can be broadly applied to protein-protein and protein-DNA complex studies. PMID:23180051

  10. CXCR1/2 antagonism with CXCL8/Interleukin-8 analogue CXCL8(3–72)K11R/G31P restricts lung cancer growth by inhibiting tumor cell proliferation and suppressing angiogenesis

    PubMed Central

    Khan, Muhammad Noman; Wang, Bing; Wei, Jing; Zhang, Yingqiu; Li, Qiang; Luan, Xuelin; Cheng, Jya-Wei; Gordon, John R.; Li, Fang; Liu, Han

    2015-01-01

    CXCR1 and CXCR2 together with cognate chemokines are significantly upregulated in a number of cancers, where they act as key regulators of tumor cell proliferation, metastasis, and angiogenesis. We have previously reported a mutant protein of CXCL8/Interleukin-8, CXCL8(3–72)K11R/G31P (G31P), which can act as a selective antagonist towards CXCR1/2 with therapeutic efficacy in both inflammatory diseases and malignancies. In this study, we investigated the effect of this ELR-CXC chemokine antagonist G31P on human non-small cell lung cancer cells and lung tumor progression in an orthotopic xenograft model. We report increased mRNA levels of CXCR1 and CXCR2 in human lung cancer tissues compared to normal counterparts. Expression levels of CXCR1/2 cognate ligands was determined by ELISA. CXCR1/2 receptor antagonism via G31P leads to decreased H460 and A549 cell proliferation and migration in a dose-dependent manner. G31P also enhanced apoptosis in lung cancer cells as determined by elevated levels of cleaved PARP, Caspase-8, and Bax, together with a reduced expression of the anti-apoptotic protein Bcl-2. In an in vivo orthotopic xenograft mouse model of human lung cancer, G31P treatment suppressed tumor growth, metastasis, and angiogenesis. At the molecular level, G31P treatment was correlated with decreased expression of VEGF and NFкB-p65, in addition to reduced phosphorylation of ERK1/2 and AKT. Our results suggest that G31P blockage of CXCR1 and CXCR2 can inhibit human lung cancer cell growth and metastasis, which offers potential therapeutic opportunities. PMID:26087179

  11. 10 CFR 40.12 - Carriers.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Carriers. 40.12 Section 40.12 Energy NUCLEAR REGULATORY COMMISSION DOMESTIC LICENSING OF SOURCE MATERIAL Exemptions § 40.12 Carriers. (a) Except as specified in... in section 62 of the Act to the extent that they transport or store source material in the regular...

  12. Liposomal Doxorubicin Plus Interleukin-12 for AIDS-Related Kaposi’s Sarcoma | Center for Cancer Research

    Cancer.gov

    Kaposi’s sarcoma (KS), a disease characterized by the development of malignant tumors usually in the lower extremities, is a major complication of HIV/AIDS. KS continues to be a problem even with the use of highly active antiretroviral therapy (HAART), today’s standard of care for patients with HIV/AIDS. CCR investigators recently investigated the effects of interleukin-12

  13. Liposomal Doxorubicin Plus Interleukin-12 for AIDS-Related Kaposi’s Sarcoma | Center for Cancer Research

    Cancer.gov

    Kaposi’s sarcoma (KS), a disease characterized by the development of malignant tumors usually in the lower extremities, is a major complication of HIV/AIDS. KS continues to be a problem even with the use of highly active antiretroviral therapy (HAART), today’s standard of care for patients with HIV/AIDS. CCR investigators recently investigated the effects of interleukin-12 (IL-12) on this malignancy in HIV/AIDS patients when combined with pegylated liposomal doxorubicin, an anthracycline. The findings appear in the September 10, 2007, online edition of Blood.

  14. Thalidomide reduces tumour necrosis factor alpha and interleukin 12 production in patients with chronic active Crohn's disease.

    PubMed

    Bauditz, J; Wedel, S; Lochs, H

    2002-02-01

    Thalidomide improves clinical symptoms in patients with therapy refractory Crohn's disease, as shown in two recent studies. The mechanism of this effect however is still unknown. Suppression of tumour necrosis factor alpha (TNF-alpha) by thalidomide has been suggested as a possible mechanism. However, effects on other cytokines have not been adequately investigated. The aim of our study was to investigate the effects of thalidomide on cytokine production in patients with inflammatory bowel disease (IBD). Ten patients with therapy refractory IBD (nine Crohn's disease, one ulcerative colitis) received thalidomide 300 mg daily in a 12 week open label study. Production of TNF-alpha, interleukin (IL)-1 beta, IL-6, and IL-12 was investigated in short term cultures of stimulated colonic lamina propria mononuclear cells (LPMC) and peripheral blood monocytes (PBMC) before and after 12 weeks of treatment. LPMC were also cultured with graded doses of thalidomide. Three patients discontinued treatment because of sedative side effects. In the other patients, disease activity decreased significantly, with four patients achieving remission. Production of TNF-alpha and IL-12 decreased during treatment with thalidomide: LPMC (TNF-alpha: 42.3 (8.3) pg/ml v 16.4 (6.3); IL-12: 9.7 (3.3) v 5.0 (2.5); p<0.04) and PBMC (TNF-alpha: 62.8 (14.6) v 22.5 (9.2); p<0.02). Production of IL-1 beta and IL-6 did not change significantly. Culturing of LPMC with thalidomide showed a dose dependent decrease in TNF-alpha and IL-12 production. The clinical effects of thalidomide in Crohn's disease may be mediated by reduction of both TNF-alpha and IL-12.

  15. Neural stem cells promote nerve regeneration through IL12-induced Schwann cell differentiation.

    PubMed

    Lee, Don-Ching; Chen, Jong-Hang; Hsu, Tai-Yu; Chang, Li-Hsun; Chang, Hsu; Chi, Ya-Hui; Chiu, Ing-Ming

    2017-03-01

    Regeneration of injured peripheral nerves is a slow, complicated process that could be improved by implantation of neural stem cells (NSCs) or nerve conduit. Implantation of NSCs along with conduits promotes the regeneration of damaged nerve, likely because (i) conduit supports and guides axonal growth from one nerve stump to the other, while preventing fibrous tissue ingrowth and retaining neurotrophic factors; and (ii) implanted NSCs differentiate into Schwann cells and maintain a growth factor enriched microenvironment, which promotes nerve regeneration. In this study, we identified IL12p80 (homodimer of IL12p40) in the cell extracts of implanted nerve conduit combined with NSCs by using protein antibody array and Western blotting. Levels of IL12p80 in these conduits are 1.6-fold higher than those in conduits without NSCs. In the sciatic nerve injury mouse model, implantation of NSCs combined with nerve conduit and IL12p80 improves motor recovery and increases the diameter up to 4.5-fold, at the medial site of the regenerated nerve. In vitro study further revealed that IL12p80 stimulates the Schwann cell differentiation of mouse NSCs through the phosphorylation of signal transducer and activator of transcription 3 (Stat3). These results suggest that IL12p80 can trigger Schwann cell differentiation of mouse NSCs through Stat3 phosphorylation and enhance the functional recovery and the diameter of regenerated nerves in a mouse sciatic nerve injury model. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Hemoadsorption removes tumor necrosis factor, interleukin-6, and interleukin-10, reduces nuclear factor-kappaB DNA binding, and improves short-term survival in lethal endotoxemia.

    PubMed

    Kellum, John A; Song, Mingchen; Venkataraman, Ramesh

    2004-03-01

    Previous studies have shown that inflammatory mediators can be removed from the circulation with hemofiltration and that adsorption plays an important role. Because adsorptive capacity of hollow-fiber dialyzers is limited, we sought to determine whether hemoadsorption using high surface area beads would result in greater mediator removal and improved survival in experimental sepsis. Randomized controlled laboratory experiment. University laboratory. Sixty-six adult Sprague-Dawley rats. We conducted two ex vivo and two in vivo experiments. For in vivo experiments, we administered Escherichia coli endotoxin (20 mg/kg) by intravenous infusion and then randomized each animal to receive either hemoadsorption or a sham circuit for 4 hrs. Hemoadsorption was performed for 4 hrs using an arterial-venous circuit and a CytoSorb cartridge containing 10 g of polystyrene divinyl benzene copolymer beads with a biocompatible polyvinylpyrrolidone coating. Survival time was measured to a maximum of 12 hrs. In a separate set of experiments, we studied 12 animals using the same protocol except that we killed all animals at 4 hrs and removed standardized sections of liver for analysis of nuclear factor-kappaB DNA binding. Mean survival time among hemoadsorption-treated animals was 629+/-114 vs. 518+/-120 mins for sham-treated animals (p <.01). Overall survival (defined at 12 hrs) was also significantly better in the hemoadsorption group, seven of 20 vs. one of 20 (p <.05). Plasma interleukin-6 and interleukin-10 concentrations and liver nuclear factor-kappaB DNA binding were significantly reduced by hemoadsorption. Ex vivo experiments showed no endotoxin adsorption but strengthened our in vivo observations by showing rapid adsorption of tumor necrosis factor, interleukin-6, and interleukin-10. Hemoadsorption was associated with reduced inflammation and improved survival in this murine model of septic shock.

  17. Interleukin-10 (IL-10) mediated suppression of IL-12 production in RAW 264.7 cells also involves c-rel transcription factor

    PubMed Central

    Rahim, Sheikh Showkat; Khan, Nooruddin; Boddupalli, Chandra Sekhar; Hasnain, Seyed E; Mukhopadhyay, Sangita

    2005-01-01

    Interleukin-10 (IL-10) is known to inhibit IL-12 production in macrophages primarily at the transcriptional level with the involvement of p50 and p65 nuclear factor-κB (NF-κB). We demonstrate that the c-rel transcription factor also plays a major role in IL-10-mediated IL-12 suppression. Treatment of macrophages with recombinant IL-10 inhibited nuclear c-rel levels, whereas addition of neutralizing anti-IL-10 antibody up-regulated both nuclear c-rel levels and IL-12 production by macrophages. Decreased nuclear c-rel was associated with a reduction in phosphorylation of inhibitory kappa B alpha (IκBα) in the cytoplasm, indicating that IL-10 prevents degradation of IκBα and the subsequent translocation of c-rel into the nucleus. Treatment with leptomycin B, a known inhibitor of c-rel at a concentration of 10 nm, when used with anti-IL-10 antibody, resulted in reduced expression of IL-12. In a complementary experiment, in vitro transient expression of p65 NF-κB could not rescue the inhibitory effect of IL-10 on IL-12 production, suggesting that NF-κB alone was not sufficient to restore IL-12 production during IL-10 treatment. However, over-expression of c-rel resulted in IL-12 restoration upon stimulation with lipopolysaccharide plus interferon-γ during IL-10 treatment. Our studies highlight the involvement of c-rel in IL-10-mediated IL-12 regulation. PMID:15720433

  18. Activation and cytokine profile of monocyte derived dendritic cells in leprosy: in vitro stimulation by sonicated Mycobacterium leprae induces decreased level of IL-12p70 in lepromatous leprosy.

    PubMed

    Braga, André Flores; Moretto, Daniela Ferraz; Gigliotti, Patrícia; Peruchi, Mariela; Vilani-Moreno, Fátima Regina; Campanelli, Ana Paula; Latini, Ana Carla Pereira; Iyer, Anand; Das, Pranab Kumar; Souza, Vânia Nieto Brito de

    2015-08-01

    Dendritic cells (DCs) play a pivotal role in the connection of innate and adaptive immunity of hosts to mycobacterial infection. Studies on the interaction of monocyte-derived DCs (MO-DCs) using Mycobacterium leprae in leprosy patients are rare. The present study demonstrated that the differentiation of MOs to DCs was similar in all forms of leprosy compared to normal healthy individuals. In vitro stimulation of immature MO-DCs with sonicated M. leprae induced variable degrees of DC maturation as determined by the increased expression of HLA-DR, CD40, CD80 and CD86, but not CD83, in all studied groups. The production of different cytokines by the MO-DCs appeared similar in all of the studied groups under similar conditions. However, the production of interleukin (IL)-12p70 by MO-DCs from lepromatous (LL) leprosy patients after in vitro stimulation with M. leprae was lower than tuberculoid leprosy patients and healthy individuals, even after CD40 ligation with CD40 ligand-transfected cells. The present cumulative findings suggest that the MO-DCs of LL patients are generally a weak producer of IL-12p70 despite the moderate activating properties ofM. leprae. These results may explain the poor M. leprae-specific cell-mediated immunity in the LL type of leprosy.

  19. Treatment of psoriasis with interleukin-12/23 monoclonal antibody: a systematic review.

    PubMed

    Wu, Yan; Chen, Jing; Li, Yuan-Hong; Ma, Guo-Zhang; Chen, John Z S; Gao, Xing-Hua; Chen, Hong-Duo

    2012-01-01

    To systematically review the efficacy and safety of interleukin-12/23 monoclonal antibody (IL-12/23 mAb) on psoriasis. Relevant randomized controlled trials (RCTs) were identified by systematic literature searches in MEDLINE, OVID, EMBASE, Cochrane Library, and the metaRegister of Controlled Trials. The efficacy outcomes and adverse effects of included RCTs were critically assessed. A total of 3365 participants in 5 multicenter RCTs were included. The RRs of most efficacy outcomes showed significant differences between i) IL-12/23 mAb and placebo at week 12/16; ii) IL-12/23 mAb and etanercept at week 12; iii) IL-12/23 mAb in high dose and IL-12/23 mAb in low dose at week 24/28. Increasing treatment times did not obviously provide additional benefit to efficacy improvement. The adverse events of IL-12/23 mAb were similar to those of controls. Antibodies to IL-12/23 mAb were mostly undetected or shown at low titer. Treatment with IL-12/23 mAb did not influence related biochemical markers. IL-12/23 mAb was effective in the treatment of psoriasis on skin lesions, health-related quality of life and psoriatic arthritis in the short-term. The increase in treatment time points was not associated with additional efficacy and dose-dependence was observed with the ongoing treatment up to week 24/28. The adverse effects were minimal and tolerable.

  20. Interleukin-12 up-regulates perforin- and Fas-mediated lymphokine-activated killer activity by intestinal intraepithelial lymphocytes

    PubMed Central

    EBERT, E C

    2004-01-01

    Human intraepithelial lymphocytes (IELs) comprise a unique compartment of memory T cell receptor (TCR)-αβ+CD8+ T lymphocytes interspersed between intestinal epithelial cells. They develop potent lymphokine-activated killer (LAK) activity with interleukin (IL)-15, a cytokine that is found in excess in certain mucosal inflammatory states. IL-12, released by activated antigen-presenting cells, is known to potentiate perforin-induced cytotoxicity. This study evaluates the mechanism by which IL-12 up-regulates LAK activity. When IELs were stimulated with IL-15, the CD94+ IEL subset expanded and carried out cytotoxic activity in redirected lysis against P815 cells as well as Fas ligand (FL)- and tumour necrosis factor (TNF)-α-mediated lysis of Jurkat and WEHI cells, respectively. IL-12 enhanced the perforin- and FL-, but not TNF-α-mediated events. In addition, the up-regulated killing of HT-29 cells by IL-12 was reduced by concanamycin (which targets perforin) and antibody neutralizing FL but not by anti-TNF-α antibody. Furthermore, IL-12 augmented IL-15-stimulated release of serine esterases as well as expression of perforin and FL by IELs, but not TNF-α. This study shows that LAK activity, carried out by the CD94+ IELs, involves perforin, FL and TNF-α. IL-12 up-regulates the first two mechanisms of action, showing for the first time its effect on FL production and lytic activity. PMID:15498035

  1. Moxibustion inhibits interleukin-12 and tumor necrosis factor alpha and modulates intestinal flora in rat with ulcerative colitis

    PubMed Central

    Wang, Xiao-Mei; Lu, Yuan; Wu, Lu-Yi; Yu, Shu-Guang; Zhao, Bai-Xiao; Hu, Hong-Yi; Wu, Huan-Gan; Bao, Chun-Hui; Liu, Hui-Rong; Wang, Jin-Hai; Yao, Yi; Hua, Xue-Gui; Guo, Hui-Ying; Shen, Li-Rong

    2012-01-01

    AIM: To investigate the effect of moxibustion on intestinal flora and release of interleukin-12 (IL-12) and tumor necrosis factor-α (TNF-α) from the colon in rat with ulcerative colitis (UC). METHODS: A rat model of UC was established by local stimulation of the intestine with supernatant from colonic contents harvested from human UC patients. A total of 40 male Sprague-Dawley rats were randomly divided into the following groups: normal (sham), model (UC), herb-partition moxibustion (HPM-treated), and positive control sulfasalazine (SA-treated). Rats treated with HPM received HPM at acupuncture points ST25 and RN6, once a day for 15 min, for a total of 8 d. Rats in the SA group were perfused with SA twice a day for 8 d. The colonic histopathology was observed by hematoxylin-eosin. The levels of intestinal flora, including Bifidobacterium, Lactobacillus, Escherichia coli (E. coli), and Bacteroides fragilis (B. fragilis), were tested by real-time quantitative polymerase chain reaction to detect bacterial 16S rRNA/DNA in order to determine DNA copy numbers of each specific species. Immunohistochemical assays were used to observe the expression of TNF-α and IL-12 in the rat colons. RESULTS: HPM treatment inhibited immunopathology in colonic tissues of UC rats; the general morphological score and the immunopathological score were significantly decreased in the HPM and SA groups compared with the model group [3.5 (2.0-4.0), 3.0 (1.5-3.5) vs 6.0 (5.5-7.0), P < 0.05 for the general morphological score, and 3.00 (2.00-3.50), 3.00 (2.50-3.50) vs 5.00 (4.50-5.50), P < 0.01 for the immunopathological score]. As measured by DNA copy number, we found that Bifidobacterium and Lactobacillus, which are associated with a healthy colon, were significantly higher in the HPM and SA groups than in the model group (1.395 ± 1.339, 1.461 ± 1.152 vs 0.045 ± 0.036, P < 0.01 for Bifidobacterium, and 0.395 ± 0.325, 0.851 ± 0.651 vs 0.0015 ± 0.0014, P < 0.01 for Lactobacillus). On the

  2. Thalidomide reduces tumour necrosis factor α and interleukin 12 production in patients with chronic active Crohn's disease

    PubMed Central

    Bauditz, J; Wedel, S; Lochs, H

    2002-01-01

    Background: Thalidomide improves clinical symptoms in patients with therapy refractory Crohn's disease, as shown in two recent studies. The mechanism of this effect however is still unknown. Suppression of tumour necrosis factor α (TNF-α) by thalidomide has been suggested as a possible mechanism. However, effects on other cytokines have not been adequately investigated. Aim: The aim of our study was to investigate the effects of thalidomide on cytokine production in patients with inflammatory bowel disease (IBD). Methods: Ten patients with therapy refractory IBD (nine Crohn's disease, one ulcerative colitis) received thalidomide 300 mg daily in a 12 week open label study. Production of TNF-α, interleukin (IL)-1β, IL-6, and IL-12 was investigated in short term cultures of stimulated colonic lamina propria mononuclear cells (LPMC) and peripheral blood monocytes (PBMC) before and after 12 weeks of treatment. LPMC were also cultured with graded doses of thalidomide. Results: Three patients discontinued treatment because of sedative side effects. In the other patients, disease activity decreased significantly, with four patients achieving remission. Production of TNF-α and IL-12 decreased during treatment with thalidomide: LPMC (TNF-α: 42.3 (8.3) pg/ml v 16.4 (6.3); IL-12: 9.7 (3.3) v 5.0 (2.5); p<0.04) and PBMC (TNF-α: 62.8 (14.6) v 22.5 (9.2); p<0.02). Production of IL-1β and IL-6 did not change significantly. Culturing of LPMC with thalidomide showed a dose dependent decrease in TNF-α and IL-12 production. Conclusion: The clinical effects of thalidomide in Crohn's disease may be mediated by reduction of both TNF-α and IL-12. PMID:11788559

  3. 28 CFR 12.40 - Public examination.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 28 Judicial Administration 1 2011-07-01 2011-07-01 false Public examination. 12.40 Section 12.40 Judicial Administration DEPARTMENT OF JUSTICE REGISTRATION OF CERTAIN PERSONS HAVING KNOWLEDGE OF FOREIGN ESPIONAGE, COUNTERESPIONAGE, OR SABOTAGE MATTERS UNDER THE ACT OF AUGUST 1, 1956 § 12.40 Public examination...

  4. 28 CFR 12.40 - Public examination.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 28 Judicial Administration 1 2014-07-01 2014-07-01 false Public examination. 12.40 Section 12.40 Judicial Administration DEPARTMENT OF JUSTICE REGISTRATION OF CERTAIN PERSONS HAVING KNOWLEDGE OF FOREIGN ESPIONAGE, COUNTERESPIONAGE, OR SABOTAGE MATTERS UNDER THE ACT OF AUGUST 1, 1956 § 12.40 Public examination...

  5. 28 CFR 12.40 - Public examination.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 28 Judicial Administration 1 2012-07-01 2012-07-01 false Public examination. 12.40 Section 12.40 Judicial Administration DEPARTMENT OF JUSTICE REGISTRATION OF CERTAIN PERSONS HAVING KNOWLEDGE OF FOREIGN ESPIONAGE, COUNTERESPIONAGE, OR SABOTAGE MATTERS UNDER THE ACT OF AUGUST 1, 1956 § 12.40 Public examination...

  6. 28 CFR 12.40 - Public examination.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 28 Judicial Administration 1 2013-07-01 2013-07-01 false Public examination. 12.40 Section 12.40 Judicial Administration DEPARTMENT OF JUSTICE REGISTRATION OF CERTAIN PERSONS HAVING KNOWLEDGE OF FOREIGN ESPIONAGE, COUNTERESPIONAGE, OR SABOTAGE MATTERS UNDER THE ACT OF AUGUST 1, 1956 § 12.40 Public examination...

  7. 28 CFR 12.40 - Public examination.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Public examination. 12.40 Section 12.40... ESPIONAGE, COUNTERESPIONAGE, OR SABOTAGE MATTERS UNDER THE ACT OF AUGUST 1, 1956 § 12.40 Public examination. Registration statements shall be available for public examination at the offices of the Registration Unit...

  8. A comparative study on the B12N12, Al12N12, B12P12 and Al12P12 fullerene-like cages.

    PubMed

    Beheshtian, Javad; Bagheri, Zargham; Kamfiroozi, Mohammad; Ahmadi, Ali

    2012-06-01

    The stability, geometry and electronic structure of the title nanoclusters were compared by using density functional theory (DFT) calculations. Their electrical property analysis showed that the relative magnitude of the HOMO-LUMO gaps (eV) that are average values from the calculated results with five different DFT functionals is as follows: B12N12(7:02)>Al12N12(4.09)>B12P12(3.80)>Al12P12(3.39). Computing the standard enthalpy and the Gibbs free energy of formation, it was found that the B(12)N(12) structure is thermodynamically stable at 298 K and 1 atmosphere of pressure, while the Al(12)N(12) structure may be stable at low temperatures. Due to positive values of change of enthalpy and entropy of formation for both the B(12)P(12) and Al(12)P(12) clusters, it seems that their formation from the consisting atoms is not spontaneous at any temperature.

  9. 40 CFR 721.10366 - Benzene, 4-bromo-1,2-dimethyl-.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Benzene, 4-bromo-1,2-dimethyl-. 721... Substances § 721.10366 Benzene, 4-bromo-1,2-dimethyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzene, 4-bromo-1,2-dimethyl-(PMN P-10-76...

  10. 40 CFR 721.10366 - Benzene, 4-bromo-1,2-dimethyl-.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Benzene, 4-bromo-1,2-dimethyl-. 721... Substances § 721.10366 Benzene, 4-bromo-1,2-dimethyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzene, 4-bromo-1,2-dimethyl-(PMN P-10-76...

  11. 40 CFR 721.10366 - Benzene, 4-bromo-1,2-dimethyl-.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Benzene, 4-bromo-1,2-dimethyl-. 721... Substances § 721.10366 Benzene, 4-bromo-1,2-dimethyl-. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as benzene, 4-bromo-1,2-dimethyl-(PMN P-10-76...

  12. Synergistic stimulation of interleukin 6 release and gene expression by phorbol esters and interleukin 1 beta in rat cortical astrocytes: role of protein kinase C activation and blockade.

    PubMed

    Grimaldi, M; Arcone, R; Ciliberto, G; Schettini, G

    1995-05-01

    The involvement of protein kinase C and its interaction with interleukin 1 beta in the control of interleukin 6 release by cortical astrocytes was studied. The blockade of protein kinase C catalytic domain, by staurosporine, as well as the desensitization of protein kinase C by short-term phorbol 12-myristate 13-acetate pretreatment, increased the basal release of interleukin 6 by rat cortical astrocytes, whereas calphostin C, an antagonist of phorbol ester binding on protein kinase C regulatory domain, did not affect the basal release of the cytokine. The activation of protein kinase C by phorbol 12-myristate 13-acetate enhanced concentration- and time-dependently interleukin 6 release. This stimulatory action of phorbol 12-myristate 13-acetate was significantly reduced by staurosporine, by calphostin C and by the desensitization of protein kinase C. Interleukin 1 beta increased interleukin 6 release in a concentration-related manner. Protein kinase C inhibition, by staurosporine or desensitization, potentiated severalfold, whereas calphostin C reduced interleukin 1 beta stimulation of interleukin 6 release. The treatment of cortical astrocytes with both interleukin 1 beta (3 ng/ml) and phorbol 12-myristate 13-acetate (10 nM) caused a synergistic stimulation of interleukin 6 release and its gene expression, an effect that was not relieved by either 20 nM staurospine or by calphostin C but was slightly affected by protein kinase C desensitization. In conclusion, our data show that in rat cortical astrocytes the basal release of interleukin 6 is under a tonic inhibition exerted by a protein kinase C isoform or isoforms sensitive to blockade by staurosporine and desensitization but insensitive to calphostin C.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Cross section asymmetry of two-body carbon disintegration 12C (γ , p)11B with polarized photons at energy 40-50 MeV

    NASA Astrophysics Data System (ADS)

    Burdeinyi, D.; Brudvik, J.; Fissum, K.; Ganenko, V.; Hansen, K.; Isaksson, L.; Livingston, K.; Lundin, M.; Nilsson, B.; Schroder, B.

    2017-01-01

    The cross section asymmetry of 12C (γ ,p01)11B and 12C (γ ,p2-6)11B reactions has been studied at the energy range 40-55 MeV, using linearly polarized tagged photons of the MAX-lab facility. The asymmetry of the 12C (γ ,p01)11B processes, which assume the one-body mechanism of the reaction, is Σ ≈ 0.82 ± 0.05 for photon energies 45-50 MeV. The asymmetry for the 12C (γ ,p2-6)11B reactions, which produce a maximum at excitation energy ∼ 6 MeV, is Σ ≈ 0.53 ± 0.13 for a photon energy 49 MeV. It is close to the asymmetry of reaction of the free deuteron photodisintegration, and can be resulted from the two-body mechanism of the photon absorption.

  14. Effects of Interleukin-12 and Interleukin-15 on Measles-Specific T-Cell Responses in Vaccinated Infants

    PubMed Central

    YASUKAWA, LINDA L.; ZHANG, CATHRYN Z.; WAKIM, RIMA HANNA; RINKI, MARY; DEHOVITZ, ROSS; ARVIN, ANN M.

    2008-01-01

    Abstract Understanding the infant host response to measles vaccination is important because of their increased mortality from measles and the need to provide effective protection during the first year of life. Measles-specific T- and B-cell responses are lower in infants after measles vaccination than in adults. To define potential mechanisms, we investigated age-related differences in measles-specific T-cell proliferation, CD40-L expression, and IFN-γ production after measles immunization, and the effects of rhIL-12 and rhIL-15 on these responses. Measles-specific T-cell proliferation and mean IFN-γ release from infant PBMCs were significantly lower when compared with responses of vaccinated children and adults. Infant responses increased to ranges observed in children and adults when both rhIL-12 and rhIL-15 were added to PBMC cultures. Furthermore, a significant rise in T-cell proliferation and IFN-γ release was observed when infant PBMCs were stimulated with measles antigen in the presence of rhIL-12 and rhIL-15 compared to measles antigen alone. CD40-L expression by infant and adult T cells stimulated with measles antigen was comparable, but fewer infant CD40-L+ T cells expressed IFN-γ. These observations suggest that lower measles-specific T-cell immune responses elicited by measles vaccine in infants may be due to diminished levels of key cytokines. PMID:18419254

  15. Localization in human interleukin 2 of the binding site to the alpha chain (p55) of the interleukin 2 receptor.

    PubMed Central

    Sauvé, K; Nachman, M; Spence, C; Bailon, P; Campbell, E; Tsien, W H; Kondas, J A; Hakimi, J; Ju, G

    1991-01-01

    Human interleukin 2 (IL-2) analogs with defined amino acid substitutions were used to identify specific residues that interact with the 55-kDa subunit (p55) or alpha chain of the human IL-2 receptor. Analog proteins containing specific substitutions for Lys-35, Arg-38, Phe-42, or Lys-43 were inactive in competitive binding assays for p55. All of these analogs retained substantial competitive binding to the intermediate-affinity p70 subunit (beta chain) of the receptor complex. The analogs varied in ability to interact with the high-affinity p55/p70 receptor. Despite the lack of binding to p55, all analogs exhibited significant biological activity, as assayed on the murine CTLL cell line. The dissociation constants of Arg-38 and Phe-42 analogs for p70 were consistent with intermediate-affinity binding; the Kd values were not significantly affected by the presence of p55 in binding to the high-affinity IL-2 receptor complex. These results confirm the importance of the B alpha-helix in IL-2 as the locus for p55-receptor binding and support a revised model of IL-2-IL-2 receptor interaction. PMID:2052547

  16. Antitumor effects of a tumor cell vaccine expressing a membrane-bound form of the IL-12 p35 subunit.

    PubMed

    Lim, Ho Yong; Ju, Hee Young; Chung, Hee-Yong; Kim, Young Sang

    2010-08-15

    We investigated whether expression of the IL-12 p35 subunit in membrane-bound form in tumor cells enhanced their immunogenicity. Since p35 is only secreted when associated with the IL-12 p40 subunit, we generated tumor cells expressing membrane-bound forms of p35 and p40 as chimeras with the transmembrane/cytoplasmic region of TNFα (mbIL-12p35 and mbIL-12p40). The relevant vectors were transfected into MethA fibrosarcoma cells, and mbIL-12p35 or mbIL-12p40-expressing tumor clones were isolated and their ability to induce antitumor immunity studied. Cells of the mbIL-12p35 tumor clone induced CD69 expression and IFNγ production in purified CD8(+) T cells in vitro, and their in vivo tumorigenicity was reduced. Cells of the mbIL-12p40 tumor clone failed to show either of these activities. Mice that had rejected cells of the mbIL-12p35 tumor clone possessed systemic antitumor immunity to wild type tumor cells. The growth rate of mbIL-12p35 tumor cells was greater in CD8(+) T cell-depleted mice than in CD4(+) T-cell- and NK cell-depleted mice or normal mice, suggesting that CD8(+) T cells were mainly responsible for the antitumor immunity. These results indicate that expression of mbIL-12p35 on tumor cells enhances their immunogenicity by increasing their ability to activate CD8(+) T cells, possibly by direct priming.

  17. 40 CFR 721.10212 - 1,2-Ethanediol, reaction products with epichlorohydrin.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false 1,2-Ethanediol, reaction products with... Specific Chemical Substances § 721.10212 1,2-Ethanediol, reaction products with epichlorohydrin. (a... 1,2-ethanediol, reaction products with epichlorohydrin (PMN P-09-241; CAS No. 705265-31-2) is...

  18. Anti-Interleukin-31 Receptor A Antibody for Atopic Dermatitis.

    PubMed

    Ruzicka, Thomas; Hanifin, Jon M; Furue, Masutaka; Pulka, Grazyna; Mlynarczyk, Izabela; Wollenberg, Andreas; Galus, Ryszard; Etoh, Takafumi; Mihara, Ryosuke; Yoshida, Hiroki; Stewart, Jonathan; Kabashima, Kenji

    2017-03-02

    Interleukin-31 may play a role in the pathobiologic mechanism of atopic dermatitis and pruritus. We wanted to assess the efficacy and safety of nemolizumab (CIM331), a humanized antibody against interleukin-31 receptor A, in the treatment of atopic dermatitis. In this phase 2, randomized, double-blind, placebo-controlled, 12-week trial, we assigned adults with moderate-to-severe atopic dermatitis that was inadequately controlled by topical treatments to receive subcutaneous nemolizumab (at a dose of 0.1 mg, 0.5 mg, or 2.0 mg per kilogram of body weight) or placebo every 4 weeks or an exploratory dose of 2.0 mg of nemolizumab per kilogram every 8 weeks. The primary end point was the percentage improvement from baseline in the score on the pruritus visual-analogue scale (on which a negative change indicates improvement) at week 12. Secondary end points included changes in the score on the Eczema Area and Severity Index (EASI, on which a negative change indicates improvement), and body-surface area of atopic dermatitis. Of 264 patients who underwent randomization, 216 (82%) completed the study. At week 12, among the patients who received nemolizumab every 4 weeks, changes on the pruritus visual-analogue scale were -43.7% in the 0.1-mg group, -59.8% in the 0.5-mg group, and -63.1% in the 2.0-mg group, versus -20.9% in the placebo group (P<0.01 for all comparisons). Changes on the EASI were -23.0%, -42.3%, and -40.9%, respectively, in the nemolizumab groups, versus -26.6% in the placebo group. Respective changes in body-surface area affected by atopic dermatitis were -7.5%, -20.0%, and -19.4% with nemolizumab, versus -15.7% with placebo. Among the patients receiving nemolizumab every 4 weeks, treatment discontinuations occurred in 9 of 53 patients (17%) in the 0.1-mg group, in 9 of 54 (17%) in the 0.5-mg group, and in 7 of 52 (13%) in the 2.0-mg group, versus in 9 of 53 (17%) in the placebo group. In this phase 2 trial, nemolizumab at all monthly doses significantly

  19. Specific growth stimulation of cultured smooth muscle cells from spontaneously hypertensive rats by platelet-derived growth factor A-chain homodimer.

    PubMed Central

    Resink, T J; Scott-Burden, T; Hahn, A W; Rouge, M; Hosang, M; Powell, J S; Bühler, F R

    1990-01-01

    Cultured vascular smooth muscle cells (VSMC)1 from spontaneously hypertensive rats (SHR) possess specific cell surface receptors for both homodimeric forms of platelet-derived growth factor (PDGF-AA and PDGF-BB), in contrast to cells from normotensive Wistar Kyoto (WKY) animals, which express receptors only for the B-chain form of PDGF. Stimulation of quiescent VSMC from SHR with PDGF-AA resulted in activation of S6-kinase and induction of phosphoinositide catabolism, as well as cellular proliferation when cultures were maintained for prolonged periods with daily supplementation of the growth factor. WKY-derived VSMC showed no response to PDGF-AA, which was consistent with their lack of specific receptors for this homodimer. The responsiveness of quiescent cells from SHR and WKY to the B-chain homodimer was similar. The enhanced growth responsiveness of SHR-derived cells to fetal calf serum, as compared with cells from their normotensive counterparts, may be accounted for in part by their expression of receptors for the AA homodimer of PDGF. PMID:1965150

  20. Correlation between IL-17A/F, IL-23, IL-35 and IL-12/-23 (p40) levels in peripheral blood lymphocyte cultures and disease activity in Behcet's patients.

    PubMed

    Sonmez, Cemile; Yucel, Aysegul Atak; Yesil, Turan Hilmi; Kucuk, Hamit; Sezgin, Berna; Mercan, Ridvan; Yucel, Ahmet Eftal; Demirel, Gulderen Yanikkaya

    2018-03-20

    Behcet's disease is a chronic multisystemic disease with remissions and relapses. Several studies have shown that immune mechanisms play an important role in the development of the disease. In order to assess the association of disease activity with IL-17A/F, IL-23, IL-12/23 (p40) and IL-35 expression, we aimed to investigate production of these cytokines in peripheral blood mononuclear cells (PBMCs) from Behcet's patients and normal controls. Furthermore, we included Systemic Lupus Erythematosus (SLE) as disease control to evaluate the specificity of our data for immunopathogenesis of BD. Totally 15 active, 15 inactive Behcet's patients, 12 active and 12 inactive SLE patients and 12 healthy volunteers were enrolled in the study. Peripheral blood mononuclear cells were separated, lymphocyte cultures were performed and IL-17A/F, IL-12/23 p(40), IL-23, IL-35 cytokine levels were measured by ELISA in culture supernatants in the presence or absence of phytohemagglutinin (PHA) on time-dependent manner. IL-17 A/F levels increased parallel to IL-23 levels in Behcet's and SLE patients. Compared to healthy controls, IL-17 A/F levels were higher in active Behcet's and SLE patients; on the contrary, levels of IL-35 were lower. IL-17A/F, IL-12/23 (p40) and IL-23 levels were detectable most frequently in active Behcet's patients followed by active SLE patients. Our results indicate that IL-17 A/F, IL-23 and IL-12/23 (p40) may play role in the immunopathogenesis of BD so as Th17 and Th1 cell responses. Since IL-35 levels were lower in active Behcet's patients compared to inactive patients and healthy controls, there may be a plasticity between Th17 and Treg cells according to the state of disease activity.

  1. The P-T-fO 2 stability of deerite, Fe{12/2+}Fe{6/3+}[Si12O40](OH)10

    NASA Astrophysics Data System (ADS)

    Lattard, Dominique; Le Breton, Nicole

    1994-02-01

    New equilibrium experiments have been performed in the 20 27 kbar range to determine the upper thermal stability limit of endmember deerite, Fe{12/2+}Fe{6/3+}[Si12O40](OH)10. In this pressure range, the maximum thermal stability limit is represented by the oxygen-conserving reaction: deerite(De)=9 ferrosilite(Fs)+3 magnetite(Mag)+3 quartz(Qtz)+5 H2O(W) (1). Under the oxygen fugacities of the Ni-NiO buffer the breakdown-reduction reaction: De=12 Fs+2 Mag+5 W+1/2 O2 (10) takes place at lower temperatures (e.g. ΔT=63° at 27 kbar). The experimental brackets can be fitted using thermodynamic data for ferrosilite, magnetite and quartz from Berman (1988) and the following 1 bar, 298 K data for deerite (per gfw): Vo=55.74 J.bar-1, So=1670 J.K-1, ΔH{f/o}=-18334 kJ, α=2.5x10-5K-1, β=-0.18x10-5 bar-1. Using these data in conjunction with literature data on coesite, grunerite, minnesotaite, and greenalite, the P-T stability field of endmember deerite has been calculated for P s= P H 2O. This field is limited by 6 univariant oxygenconserving dehydration curves, from which three have positive d P/d T slopes, the other three negative slopes. The lower pressure end of the stability field of endmember deerite is thus located at an invariant point at 250±70°C and 10+-1.5 kbar. Deerite rich in the endmember can thus appear only in environments with geothermal gradients lower than 10°C/km and at pressures higher than about 10 kbar, which is in agreement with 4 out of 5 independent P-T estimates for known occurrences. The presence of such deerite places good constraints on minimum pressure and maximum temperature conditions. From log f O 2- T diagrams constructed with the same data base at different pressures, it appears that endmember deerite is, at temperatures near those of its upper stability limit, stable only over a narrow range of oxygen fugacities within the magnetite field. With decreasing temperatures, deerite becomes stable towards slightly higher oxygen fugacities

  2. Effects of human interleukin-18 and interleukin-12 treatment on human lymphocyte engraftment in NOD-scid mouse

    PubMed Central

    Senpuku, Hidenobu; Asano, Toshihiko; Matin, Khairul; Salam, M Abdus; Tsuha, Yuzo; Horibata, Shigeo; Shimazu, Yoshihito; Soeno, Yuichi; Aoba, Takaaki; Sata, Tetsutaro; Hanada, Nobuhiro; Honda, Mitsuo

    2002-01-01

    NOD/LtSz-prkdcscid/prkdcscid (non-obese diabetic-severe combine immunodeficiency; NOD-scid) mice grafted with human peripheral blood lymphoid cells have been used as an in vivo humanized mouse model in various studies. However, cytotoxic human T cells are induced in this model during immune responses, which gives misleading results. To assist in grafting of human lymphocytes without the induction of cytotoxic human T cells, we investigated the effects of T helper type 1 (Th1) and Th2 cytokines on human lymphocyte grafting and migration, as well as the production of immunoglobulin deposited in glomeruli and human immunodeficiency virus-1 (HIV-1) infection using NOD-scid mice. Administration of interleukin-18 (IL-18) and IL-12 enhanced the grafting of human CD4+ and CD8+ T cells in the mice, whereas co-administration prevented grafting due to interferon-γ-dependent apoptosis. Immunoglobulin A (IgA) deposits were observed in mice treated with IL-18 alone, but not in those given phosphate-buffered saline, IL-12 alone, or IL-18 + IL-12. A high rate of HIV infection was also observed in the IL-18-treated group. Together, these results indicate that IL-18 may be effective for the grafting and migration of CD4+ and CD8+ T cells, except for the induction of apoptosis and regulation of class-switching IgA. IL-18-administered NOD-scid mice provide a useful small humanized model for the study of HIV infection and IgA nephropathy. PMID:12383203

  3. Evaluation of selected interleukins in patients with different gastric neoplasms: a preliminary report.

    PubMed

    Madej-Michniewicz, Anna; Budkowska, Marta; Sałata, Daria; Dołęgowska, Barbara; Starzyńska, Teresa; Błogowski, Wojciech

    2015-10-21

    Abnormal interactions between cytokines may be an overlooked mechanism linking the development of different types of gastric neoplasms. In this study a comprehensive analysis of the systemic levels of interleukins (IL-1,IL-6, IL-8,IL-10 and IL-12) was performed in 75 patients with different gastric neoplasms (cancer, gastrointestinal stromal tumors, neuroendocrine neoplasms, lymphomas) and 40 healthy volunteers. Patients with gastric cancer (GC) have significantly higher IL-6 levels, and lower IL-8 and IL-10 concentrations, in comparison to controls and patients with other gastric neoplasms. Analogous results were observed in terms of IL-6/IL-8 and IL-6/IL-10 ratios, whose values were also higher in GC patients. In GC patients no associations were detected between the systemic levels/values of interleukins (ratios) and TNM staging. IL-6, IL-10, IL-6/IL-8 and IL-6/IL-10 ratios appeared to hold diagnostic potential in confirming/excluding the presence of GC. Their sensitivity/specificity in GC detection/exclusion was approximately 54-72%. In conclusion, disturbed systemic biochemical balance in multiple interleukins exists at the earliest stages of and appears to be specific to GC. The interleukin ratios proposed here seem to be more promising indicators of GC in humans than direct systemic levels of interleukins, and probably possess the potential to be applied as a supporting factor for techniques routinely used.

  4. 40 CFR 721.10007 - Alcohols, C12-14-secondary, ethoxylated propoxylated.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Alcohols, C12-14-secondary... New Uses for Specific Chemical Substances § 721.10007 Alcohols, C12-14-secondary, ethoxylated... identified as alcohols, C12-14- secondary, ethoxylated propoxylated (PMN P-00-11; CAS No. 103331-86-8) is...

  5. Neutralization or Absence of the Interleukin-23 Pathway Does Not Compromise Immunity to Mycobacterial Infection▿

    PubMed Central

    Chackerian, Alissa A.; Chen, Shi-Juan; Brodie, Scott J.; Mattson, Jeanine D.; McClanahan, Terrill K.; Kastelein, Robert A.; Bowman, Edward P.

    2006-01-01

    Interleukin-23 (IL-23), a member of the IL-12 family, is a heterodimeric cytokine that is composed of the p40 subunit of IL-12 plus a unique p19 subunit. IL-23 is critical for autoimmune inflammation, in part due to its stimulation of the proinflammatory cytokine IL-17A. It is less clear, however, if IL-23 is required during the immune response to pathogens. We examined the role of IL-23 during Mycobacterium bovis BCG infection. We found that IL-23 reduces the bacterial burden and promotes granuloma formation when IL-12 is absent. However, IL-23 does not contribute substantially to host resistance when IL-12 is present, as the ability to control bacterial growth and form granulomata is not affected in IL-23p19-deficient mice and mice treated with a specific anti-IL-23p19 antibody. IL-23p19-deficient mice are also able to mount an effective memory response to secondary infection with BCG. While IL-23p19-deficient mice do not produce IL-17A, this cytokine is not necessary for effective control of infection, and antibody blocking of IL-17A in both wild-type and IL-12-deficient mice also has little effect on the bacterial burden. These data suggest that IL-23 by itself does not play an essential role in the protective immune response to BCG infection; however, the presence of IL-23 can partially compensate for the absence of IL-12. Furthermore, neutralization of IL-23 or IL-17A does not increase susceptibility to mycobacterial BCG infection. PMID:16923792

  6. Polymorphisms in genes of interleukin 12 and its receptors and their association with protection against severe malarial anaemia in children in western Kenya.

    PubMed

    Zhang, Lyna; Prather, Donald; Vanden Eng, Jodi; Crawford, Sara; Kariuki, Simon; ter Kuile, Feiko; Terlouw, Dianne; Nahlen, Bernard; Lal, Altaf A; Slutsker, Laurence; Udhayakumar, Venkatachalam; Shi, Ya Ping

    2010-03-29

    Malarial anaemia is characterized by destruction of malaria infected red blood cells and suppression of erythropoiesis. Interleukin 12 (IL12) significantly boosts erythropoietic responses in murine models of malarial anaemia and decreased IL12 levels are associated with severe malarial anaemia (SMA) in children. Based on the biological relevance of IL12 in malaria anaemia, the relationship between genetic polymorphisms of IL12 and its receptors and SMA was examined. Fifty-five tagging single nucleotide polymorphisms covering genes encoding two IL12 subunits, IL12A and IL12B, and its receptors, IL12RB1 and IL12RB2, were examined in a cohort of 913 children residing in Asembo Bay region of western Kenya. An increasing copy number of minor variant (C) in IL12A (rs2243140) was significantly associated with a decreased risk of SMA (P = 0.006; risk ratio, 0.52 for carrying one copy of allele C and 0.28 for two copies). Individuals possessing two copies of a rare variant (C) in IL12RB1 (rs429774) also appeared to be strongly protective against SMA (P = 0.00005; risk ratio, 0.18). In addition, children homozygous for another rare allele (T) in IL12A (rs22431348) were associated with reduced risk of severe anaemia (SA) (P = 0.004; risk ratio, 0.69) and of severe anaemia with any parasitaemia (SAP) (P = 0.004; risk ratio, 0.66). In contrast, AG genotype for another variant in IL12RB1 (rs383483) was associated with susceptibility to high-density parasitaemia (HDP) (P = 0.003; risk ratio, 1.21). This study has shown strong associations between polymorphisms in the genes of IL12A and IL12RB1 and protection from SMA in Kenyan children, suggesting that human genetic variants of IL12 related genes may significantly contribute to the development of anaemia in malaria patients.

  7. 40 CFR 721.1500 - 1,2-Benzenediamine, 4-ethoxy, sulfate.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false 1,2-Benzenediamine, 4-ethoxy, sulfate... Substances § 721.1500 1,2-Benzenediamine, 4-ethoxy, sulfate. (a) Chemical substance and significant new use...-benzenediamine, 4-ethoxy, sulfate, PMN P-83-105. (2) The significant new use is: Manufacture, import, or...

  8. 40 CFR 721.1500 - 1,2-Benzenediamine, 4-ethoxy, sulfate.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false 1,2-Benzenediamine, 4-ethoxy, sulfate... Substances § 721.1500 1,2-Benzenediamine, 4-ethoxy, sulfate. (a) Chemical substance and significant new use...-benzenediamine, 4-ethoxy, sulfate, PMN P-83-105. (2) The significant new use is: Manufacture, import, or...

  9. 40 CFR 721.1500 - 1,2-Benzenediamine, 4-ethoxy, sulfate.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false 1,2-Benzenediamine, 4-ethoxy, sulfate... Substances § 721.1500 1,2-Benzenediamine, 4-ethoxy, sulfate. (a) Chemical substance and significant new use...-benzenediamine, 4-ethoxy, sulfate, PMN P-83-105. (2) The significant new use is: Manufacture, import, or...

  10. 40 CFR 721.1500 - 1,2-Benzenediamine, 4-ethoxy, sulfate.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false 1,2-Benzenediamine, 4-ethoxy, sulfate... Substances § 721.1500 1,2-Benzenediamine, 4-ethoxy, sulfate. (a) Chemical substance and significant new use...-benzenediamine, 4-ethoxy, sulfate, PMN P-83-105. (2) The significant new use is: Manufacture, import, or...

  11. 40 CFR 721.1500 - 1,2-Benzenediamine, 4-ethoxy, sulfate.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false 1,2-Benzenediamine, 4-ethoxy, sulfate... Substances § 721.1500 1,2-Benzenediamine, 4-ethoxy, sulfate. (a) Chemical substance and significant new use...-benzenediamine, 4-ethoxy, sulfate, PMN P-83-105. (2) The significant new use is: Manufacture, import, or...

  12. Beta2-adrenergic receptor homodimers: Role of transmembrane domain 1 and helix 8 in dimerization and cell surface expression.

    PubMed

    Parmar, Vikas K; Grinde, Ellinor; Mazurkiewicz, Joseph E; Herrick-Davis, Katharine

    2017-09-01

    Even though there are hundreds of reports in the published literature supporting the hypothesis that G protein-coupled receptors (GPCR) form and function as dimers this remains a highly controversial area of research and mechanisms governing homodimer formation are poorly understood. Crystal structures revealing homodimers have been reported for many different GPCR. For adrenergic receptors, a potential dimer interface involving transmembrane domain 1 (TMD1) and helix 8 (H8) was identified in crystal structures of the beta 1 -adrenergic (β 1 -AR) and β 2 -AR. The purpose of this study was to investigate a potential role for TMD1 and H8 in dimerization and plasma membrane expression of functional β 2 -AR. Charged residues at the base of TMD1 and in the distal portion of H8 were replaced, singly and in combination, with non-polar residues or residues of opposite charge. Wild type and mutant β 2 -AR, tagged with YFP and expressed in HEK293 cells, were evaluated for plasma membrane expression and function. Homodimer formation was evaluated using bioluminescence resonance energy transfer, bimolecular fluorescence complementation, and fluorescence correlation spectroscopy. Amino acid substitutions at the base of TMD1 and in the distal portion of H8 disrupted homodimer formation and caused receptors to be retained in the endoplasmic reticulum. Mutations in the proximal region of H8 did not disrupt dimerization but did interfere with plasma membrane expression. This study provides biophysical evidence linking a potential TMD1/H8 interface with ER export and the expression of functional β 2 -AR on the plasma membrane. This article is part of a Special Issue entitled: Interactions between membrane receptors in cellular membranes edited by Kalina Hristova. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Interleukin-12 induces a Th1-like response to Burkholderia mallei and limited protection in BALB/c mice.

    PubMed

    Amemiya, Kei; Meyers, Jennifer L; Trevino, Sylvia R; Chanh, Tran C; Norris, Sarah L; Waag, David M

    2006-02-27

    We evaluated the effect of interleukin (IL)-12 on the immune response to Burkholderia mallei in BALB/c mice. Mice were vaccinated with non-viable B. mallei cells with or without IL-12. There was a seven- to nine-fold increase in IgG2a levels, and a significant increase in the proliferative response and interferon (IFN)-gamma production by splenocytes from mice that received B. mallei and IL-12. We saw an increase in survivors in the groups of mice that received B. mallei and IL-12 when challenged, compared to mice that received only B. mallei or IL-12. The results suggest that IL-12 can enhance the Th1-like immune response to B. mallei and mediate limited protection from a lethal challenge.

  14. Interleukin-12 in patients with cancer is synthesized by peripheral helper T lymphocytes.

    PubMed

    Michelin, Marcia A; Montes, Leticia; Nomelini, Rosekeila S; Abdalla, Douglas R; Aleixo, Andre A R; Murta, Eddie F C

    2015-09-01

    The production of cytokines by helper T lymphocytes is a critical event in the immune response, as alterations in the regulation of this process may result in an appropriate immune response, persistent infection or the development of autoimmune disease. Previously, this group has used flow cytometry to demonstrate the expression of interleukin-12 (IL-12) in peripheral blood CD4+ T lymphocytes from patients and mice with advanced cancer. The aim of the present study was to investigate whether CD4+ T lymphocytes from the peripheral blood (PB) of patients with cancer produce IL-12, using molecular approaches, flow cytometry and cellular imaging techniques. CD3+ and CD4+ cells, and cells producing IL-12, were isolated from the PB obtained from patients with cancer, using a cell sorting flow cytometry technique. The positivity of cells for CD3, CD4 and IL-12, which were identified by cell sorting, was visualized using immunofluorescent cellular imaging. Total RNA was extracted from the CD3+CD4+IL-12+ cells, obtained by cell sorting, for confirmation of the presence of IL-12 mRNA, using reverse transcription-polymerase chain reaction (RT-PCR). RT-PCR demonstrated the presence of IL-12 mRNA in all patients (n=14), in contrast to the control group, in whom IL-12 expression was not detected. Immunofluorescent analysis of CD4+ T lymphocytes showed positive intracytoplasmatic IL-12 staining. These results demonstrated that CD3+CD4+ T lymphocytes in the PB of patients with cancer have the capacity to synthesize and express IL-12.

  15. Interleukin-12 in patients with cancer is synthesized by peripheral helper T lymphocytes

    PubMed Central

    MICHELIN, MARCIA A.; MONTES, LETICIA; NOMELINI, ROSEKEILA S.; ABDALLA, DOUGLAS R.; ALEIXO, ANDRE A. R.; MURTA, EDDIE F. C.

    2015-01-01

    The production of cytokines by helper T lymphocytes is a critical event in the immune response, as alterations in the regulation of this process may result in an appropriate immune response, persistent infection or the development of autoimmune disease. Previously, this group has used flow cytometry to demonstrate the expression of interleukin-12 (IL-12) in peripheral blood CD4+ T lymphocytes from patients and mice with advanced cancer. The aim of the present study was to investigate whether CD4+ T lymphocytes from the peripheral blood (PB) of patients with cancer produce IL-12, using molecular approaches, flow cytometry and cellular imaging techniques. CD3+ and CD4+ cells, and cells producing IL-12, were isolated from the PB obtained from patients with cancer, using a cell sorting flow cytometry technique. The positivity of cells for CD3, CD4 and IL-12, which were identified by cell sorting, was visualized using immunofluorescent cellular imaging. Total RNA was extracted from the CD3+CD4+IL-12+ cells, obtained by cell sorting, for confirmation of the presence of IL-12 mRNA, using reverse transcription-polymerase chain reaction (RT-PCR). RT-PCR demonstrated the presence of IL-12 mRNA in all patients (n=14), in contrast to the control group, in whom IL-12 expression was not detected. Immunofluorescent analysis of CD4+ T lymphocytes showed positive intracytoplasmatic IL-12 staining. These results demonstrated that CD3+CD4+ T lymphocytes in the PB of patients with cancer have the capacity to synthesize and express IL-12. PMID:26622702

  16. Increased Expression of Interleukin-18 mRNA is Associated with Carotid Artery Stenosis

    PubMed

    Arapi, Berk; Bayoğlu, Burcu; Cengiz, Müjgan; Dirican, Ahmet; Deser, Serkan Burç; Junusbekov, Yerik; Arslan, Caner

    2018-05-29

    Carotid artery stenosis is the atherosclerotic narrowing of the proximal internal carotid artery and one of the primary causes of stroke. Elevated expression of the pleiotropic proinflammatory cytokine interleukin-18 has been demonstrated in human atherosclerotic plaques. To investigate whether the mRNA expression levels of interleukin-18 and interleukin-18-binding protein and interleukin-18 −137 G/C (rs187238) variants are associated with carotid artery stenosis development. Case-control study. The mRNA expression levels of interleukin-18 and interleukin-18-binding protein and interleukin-18 rs187238 variants were evaluated by quantitative real-time polymerase chain reaction and real-time polymerase chain reaction, respectively, in the peripheral blood mononuclear cells of 70 patients with carotid artery stenosis (36 symptomatic, 34 asymptomatic) and 75 healthy controls. Interleukin-18 mRNA expression was significantly increased in carotid artery stenosis patients compared to that in healthy controls (p=0.01). However, no significant difference was observed between interleukin-18-binding protein mRNA expression levels in patients with carotid artery stenosis and those in controls (p=0.101). Internal carotid artery stenosis severity was significantly higher in symptomatic patients than that in asymptomatic patients (p<0.001). A significant relationship was identified between interleukin-18 expression and internal carotid artery stenosis severity in patients with carotid artery stenosis (p=0.051). Interleukin-18 rs187238 polymorphism genotype frequencies did not significantly differ between patients with carotid artery stenosis and controls (p=0.246). A significant difference was identified between interleukin-18-binding protein gene expression and symptomatic and asymptomatic patients (p=0.026), but there was no difference in interleukin-18 expression between the symptomatic and asymptomatic subgroups (p=0.397). Interleukin-18 mRNA expression may affect carotid

  17. Interleukin-12 Preserves the Cutaneous Physical and Immunological Barrier after Radiation Exposure

    PubMed Central

    Gerber, Scott A.; Cummings, Ryan J.; Judge, Jennifer L.; Barlow, Margaret L.; Nanduri, Julee; Milano Johnson, Doug E.; Palis, James; Pentland, Alice P.; Lord, Edith M.; Ryan, Julie L.

    2015-01-01

    The United States continues to be a prime target for attack by terrorist organizations in which nuclear detonation and dispersal of radiological material are legitimate threats. Such attacks could have devastating consequences to large populations, in the form of radiation injury to various human organ systems. One of these at risk organs is the cutaneous system, which forms both a physical and immunological barrier to the surrounding environment and is particularly sensitive to ionizing radiation. Therefore, increased efforts to develop medical countermeasures for treatment of the deleterious effects of cutaneous radiation exposure are essential. Interleukin-12 (IL-12) was shown to elicit protective effects against radiation injury on radiosensitive systems such as the bone marrow and gastrointestinal tract. In this article, we examined if IL-12 could protect the cutaneous system from a combined radiation injury in the form of sublethal total body irradiation and beta-radiation burn (β-burn) directly to the skin. Combined radiation injury resulted in a breakdown in skin integrity as measured by transepidermal water loss, size of β-burn lesion and an exacerbated loss of surveillant cutaneous dendritic cells. Interestingly, intradermal administration of IL-12 48 h postirradiation reduced transepidermal water loss and burn size, as well as retention of cutaneous dendritic cells. Our data identify IL-12 as a potential mitigator of radiation-induced skin injury and argue for the further development of this cytokine as a radiation countermeasure. PMID:25564716

  18. Interleukin-12 (IL-12)-driven alloimmune responses in vitro and in vivo: requirement for beta1 subunit of the IL-12 receptor.

    PubMed

    Piccotti, J R; Li, K; Chan, S Y; Eichwald, E J; Bishop, D K

    1999-06-15

    Interleukin-12 (IL-12) mediates its biologic activities via binding high-affinity receptors on T and natural killer cells. Although emphasis has been placed on the requirement for IL-12Rbeta2 in IL-12 bioactivity, the role of IL-12Rbeta1 is less well defined. The current study evaluated the effects of exogenous IL-12 on alloantigen-specific immune responses and determined the requirement for IL-12Rbeta1 in IL-12-mediated alloimmunity. The mouse heterotopic cardiac transplant model was employed to evaluate the effects of IL-12 on alloantigen-specific immune responses in vivo. In addition, IFN-gamma production in mixed lymphocyte cultures (MLC) supplemented with IL-12 was measured to assess the effects of IL-12 on Th1 function in vitro. Mice deficient in IL-12Rbeta1 (IL-12Rbeta1-/-) were used to determine the requirement for this receptor component in IL-12-driven alloimmune responses. Addition of IL-12 to MLC consisting of wild-type splenocytes enhanced alloantigen-specific proliferative responses and Th1 development. In contrast, IL-12 did not alter these in vitro immune parameters in IL-12Rbeta1-/- MLC. Treatment of wild-type cardiac allograft recipients with IL-12 resulted in high concentrations of serum interferon-gamma (IFN-gamma) and a 10-fold increase in IFN-gamma production by recipient splenocytes after restimulation in vitro. However, this fulminate Th1 response did not accelerate allograft rejection. Importantly, IL-12 had no effect on serum IFN-gamma or in vivo priming of Thl in IL-12Rbeta1-/- recipients. Finally, administration of IL-12 to WT allograft recipients resulted in a bimodal alloantibody response: antibody production was suppressed at high doses of IL-12, and enhanced at lower doses. IL-12 markedly enhances alloantigen-specific immune function; however, these exaggerated Th1-driven responses do not culminate in accelerated allograft rejection. Further, these data indicate that IL-12Rbeta1 is essential for the enhancement of both in vitro and

  19. Evidence that P12, a specific variant of P16{sup INK4A}, plays a suppressive role in human pancreatic carcinogenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poi, Ming J.; Knobloch, Thomas J.; Division of Environmental Health Sciences, College of Public Health, The Ohio State University, Columbus, OH 43210

    2013-06-28

    Highlights: •P12, a variant of P16{sup INK4A}, inhibits the proliferation of pancreatic cancer cells. •P12 is distinct from P16 in function and structure. •Genetic alterations of p12 are prevalent in human pancreatic carcinoma. •P12 represents a potential pancreas-specific tumor suppressor. -- Abstract: The INK4a-ARF locus plays a central role in the development of pancreatic tumors as evidenced by the fact that up to 98% of pancreatic tumor specimens harbored genetic alterations at the INK4a-ARF locus. Interestingly, in addition to the well-known P16{sup INK4A} (P16) and P14ARF tumor suppressors, the INK4a-ARF locus in pancreas encodes another protein, P12, whose structure, function,more » and contributions to pancreatic carcinogenesis remain to be elucidated. In the current study, we demonstrated that over-expression of p12 in human pancreatic cancer cells led to cell arrest at the G1 phase and such cell cycle arrest was related to down-regulation of a number of oncogenes, such as c-Jun, Fos, and SEI1. Furthermore, unlike P16, P12 did not retain any cyclin-dependent kinase 4 (CDK4)-inhibitory activity. Instead, P12 exhibited a transactivating activity not found in P16. We also examined the genetic status of p12 in a cohort of 40 pancreatic tumor specimens and found that p12 alteration was prevalent in pancreatic tumors with an incidence of 70% (28/40). These results support that P12 is a tumor suppressive protein distinct from P16, and its genetic inactivation is associated with pancreatic carcinogenesis.« less

  20. Evaluation of selected interleukins in patients with different gastric neoplasms: a preliminary report

    PubMed Central

    Madej-Michniewicz, Anna; Budkowska, Marta; Sałata, Daria; Dołęgowska, Barbara; Starzyńska, Teresa; Błogowski, Wojciech

    2015-01-01

    Abnormal interactions between cytokines may be an overlooked mechanism linking the development of different types of gastric neoplasms. In this study a comprehensive analysis of the systemic levels of interleukins (IL-1,IL-6, IL-8,IL-10 and IL-12) was performed in 75 patients with different gastric neoplasms (cancer, gastrointestinal stromal tumors, neuroendocrine neoplasms, lymphomas) and 40 healthy volunteers. Patients with gastric cancer (GC) have significantly higher IL-6 levels, and lower IL-8 and IL-10 concentrations, in comparison to controls and patients with other gastric neoplasms. Analogous results were observed in terms of IL-6/IL-8 and IL-6/IL-10 ratios, whose values were also higher in GC patients. In GC patients no associations were detected between the systemic levels/values of interleukins (ratios) and TNM staging. IL-6, IL-10, IL-6/IL-8 and IL-6/IL-10 ratios appeared to hold diagnostic potential in confirming/excluding the presence of GC. Their sensitivity/specificity in GC detection/exclusion was approximately 54–72%. In conclusion, disturbed systemic biochemical balance in multiple interleukins exists at the earliest stages of and appears to be specific to GC. The interleukin ratios proposed here seem to be more promising indicators of GC in humans than direct systemic levels of interleukins, and probably possess the potential to be applied as a supporting factor for techniques routinely used. PMID:26486258

  1. Interleukin-12 Immunomodulation Delays the Onset of Lethal Peritoneal Disease of Ovarian Cancer.

    PubMed

    Cohen, Courtney A; Shea, Amanda A; Heffron, C Lynn; Schmelz, Eva M; Roberts, Paul C

    2016-01-01

    The omental fat band (OFB) is the predominant site for metastatic seeding of ovarian cancer. Previously, we highlighted the influx and accumulation of neutrophils and macrophages in the OFB following syngeneic ovarian cancer cell seeding as an important factor in the development of a protumorigenic cascade. Here we investigated localized immunomodulation as a means of promoting a successful protective response. As an important TH1-type immunomodulator, interleukin (IL)-12 has previously been investigated clinically as an anticancer therapeutic. However, systemic IL-12 administration was associated with serious side effects, galvanizing the development of immune or accessory cells engineered to express secreted or membrane-bound IL-12 (mbIL-12). Using an mbIL-12-expressing cell variant, we demonstrate that localized IL-12 in the tumor microenvironment significantly delays disease development. The mbIL-12-mediated decrease in tumor burden was associated with a significant reduction in neutrophil and macrophage infiltration in the OFB, and correlated with a reduced expression of neutrophil and macrophage chemoattractants (CXCL1, -2, -3 and CCL2, -7). Vaccination with mitotically impaired tumor cells did not confer protection against subsequent tumor challenge, indicating that IL-12 did not impact the immunogenicity of the cancer cells. Our findings are in agreement with previous reports suggesting that IL-12 may hold promise when delivered in a targeted and sustained manner to the omental microenvironment. Furthermore, resident cells within the omental microenvironment may provide a reservoir that can be activated and mobilized to prevent metastatic seeding within the peritoneum and, therefore, may be targets for chemotherapeutics.

  2. Interleukin-12 Immunomodulation Delays the Onset of Lethal Peritoneal Disease of Ovarian Cancer

    PubMed Central

    Cohen, Courtney A.; Shea, Amanda A.; Heffron, C. Lynn

    2016-01-01

    The omental fat band (OFB) is the predominant site for metastatic seeding of ovarian cancer. Previously, we highlighted the influx and accumulation of neutrophils and macrophages in the OFB following syngeneic ovarian cancer cell seeding as an important factor in the development of a protumorigenic cascade. Here we investigated localized immunomodulation as a means of promoting a successful protective response. As an important TH1-type immunomodulator, interleukin (IL)-12 has previously been investigated clinically as an anticancer therapeutic. However, systemic IL-12 administration was associated with serious side effects, galvanizing the development of immune or accessory cells engineered to express secreted or membrane-bound IL-12 (mbIL-12). Using an mbIL-12-expressing cell variant, we demonstrate that localized IL-12 in the tumor microenvironment significantly delays disease development. The mbIL-12-mediated decrease in tumor burden was associated with a significant reduction in neutrophil and macrophage infiltration in the OFB, and correlated with a reduced expression of neutrophil and macrophage chemoattractants (CXCL1, -2, -3 and CCL2, -7). Vaccination with mitotically impaired tumor cells did not confer protection against subsequent tumor challenge, indicating that IL-12 did not impact the immunogenicity of the cancer cells. Our findings are in agreement with previous reports suggesting that IL-12 may hold promise when delivered in a targeted and sustained manner to the omental microenvironment. Furthermore, resident cells within the omental microenvironment may provide a reservoir that can be activated and mobilized to prevent metastatic seeding within the peritoneum and, therefore, may be targets for chemotherapeutics. PMID:26430781

  3. Interleukin Expression after Injury and the Effects of Interleukin-1 Receptor Antagonist

    PubMed Central

    Chamberlain, Connie S.; Leiferman, Ellen M.; Frisch, Kayt E.; Brickson, Stacey L.; Murphy, William L.; Baer, Geoffrey S.; Vanderby, Ray

    2013-01-01

    Ligament healing follows a series of complex coordinated events involving various cell types, cytokines, as well as other factors, producing a mechanically inferior tissue more scar-like than native tissue. Macrophages provide an ongoing source of cytokines to modulate inflammatory cell adhesion and migration as well as fibroblast proliferation. Studying interleukins inherent to ligament healing during peak macrophage activation and angiogenesis may elucidate inflammatory mediators involved in subsequent scar formation. Herein, we used a rat healing model assayed after surgical transection of their medial collateral ligaments (MCLs). On days 3 and 7 post-injury, ligaments were collected and used for microarray analysis. Of the 12 significantly modified interleukins, components of the interleukin-1 family were significantly up-regulated. We therefore examined the influence of interleukin-1 receptor antagonist (IL-1Ra) on MCL healing. Transected rat MCLs received PBS or IL-1Ra at the time of surgery. Inhibition of IL-1 activation decreased pro-inflammatory cytokines (IL-1α, IL-1β, IL-12, IL-2, and IFN-γ), myofibroblasts, and proliferating cells, as well as increased anti-inflammatory cytokines (IL-10), endothelial cells/blood vessel lumen, M2 macrophages, and granulation tissue size without compromising the mechanical properties. These results support the concept that IL-1Ra modulates MCL-localized granulation tissue components and cytokine production to create a transient environment that is less inflammatory. Overall, IL-1Ra may have therapeutic potential early in the healing cascade by stimulating the M2 macrophages and altering the granulation tissue components. However, the single dose of IL-1Ra used in this study was insufficient to maintain the more regenerative early response. Due to the transient influence on most of the healing components tested, IL-1Ra may have greater therapeutic potential with sustained delivery. PMID:23936523

  4. Mycobacterium tuberculosis PPE44 (Rv2770c) is involved in response to multiple stresses and promotes the macrophage expression of IL-12 p40 and IL-6 via the p38, ERK, and NF-κB signaling axis.

    PubMed

    Yu, Zhaoxiao; Zhang, Chenhui; Zhou, Mingliang; Li, Qiming; Li, Hui; Duan, Wei; Li, Xue; Feng, Yonghong; Xie, Jianping

    2017-09-01

    Tuberculosis (TB), caused by Mycobacterium tuberculosis, remains a formidable threat to global public health. The successful intracellular persistence of M. tuberculosis significantly contributes to the intractability of tuberculosis. Proline-glutamic acid (PE) and proline-proline-glutamic acid (PPE) are mycobacterial exclusive protein families that widely reported to be involved in the bacterial virulence, physiology and interaction with host. Rv2770c (PPE44), a predicted virulence factor, was up-regulated upon the infected guinea pig lungs. To investigate the role of Rv2770c, we heterologously expressed the PPE44 in the nonpathogenic fast-growing M. smegmatis strain. Subcellular location analysis demonstrated that Rv2770c is a cell wall associated protein, suggestive of a potential candidate involved in host-pathogen interaction. The Rv2770c can enhance M. smegmatis survival within macrophages and under stresses such as H 2 O 2 , SDS, diamide exposure, and low pH condition. M. smegmatis expressing Rv2770c is more virulent as testified by the increased death of macrophages and the increased expression of interlukin-6 (IL-6) and interlukin-12p40 (IL-12p40). Moreover, Rv2770c altered the secretion of IL-6 and IL-12p40 of macrophages via NF-κB, ERK1/2 and p38 MAPK axis. Taken together, this study implicated that Rv2770c was a virulent factor actively engaged in the interaction with host macrophage. Copyright © 2017. Published by Elsevier B.V.

  5. Stability and structure in [alpha]- and [beta]-keggin heteropolytungstates, [Xn+W12O40](8-n)-, X = p-block cation

    Treesearch

    Wade A. Neiwert; Jennifer J. Cowan; Kenneth I. Hardcastle; Craig L. Hill; Ira A. Weinstock

    2002-01-01

    [Beta]-[SiW12O40]4- (C3v symmetry) is sufficiently higher in energy than its [alpha]-isomer analogue that effectively complete conversion to [alpha]-[SiW12O40]4- (Td) is observed. By contrast, [beta]- and [alpha]-[AlW12O40]5- ([beta]- and [alpha]-1; C3v and Td, respectively) are sufficiently close in energy that both isomers are readily seen in 27Al NMR spectra of...

  6. 40 CFR 141.12 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false [Reserved] 141.12 Section 141.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) NATIONAL PRIMARY DRINKING WATER REGULATIONS Maximum Contaminant Levels § 141.12 [Reserved] ...

  7. Deprotonated Dicarboxylic Acid Homodimers: Hydrogen Bonds and Atmospheric Implications

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hou, Gao-Lei; Valiev, Marat; Wang, Xue-Bin

    Dicarboxylic acids represent an important class of water-soluble organic compounds found in the atmosphere. In this work we are studying properties of dicarboxylic acid homodimer complexes (HO 2(CH 2) nCO 2 -[HO 2(CH 2) nCO 2H], n = 0-12), as potentially important intermediates in aerosol formation processes. Our approach is based on experimental data from negative ion photoelectron spectra of the dimer complexes combined with updated measurements of the corresponding monomer species. These results are analyzed with quantum-mechanical calculations, which provide further information about equilibrium structures, thermochemical parameters associated with the complex formation, and evaporation rates. We find that uponmore » formation of the dimer complexes the electron binding energies increase by 1.3–1.7 eV (30.0–39.2 kcal/mol), indicating increased stability of the dimerized complexes. Calculations indicate that these dimer complexes are characterized by the presence of strong intermolecular hydrogen bonds with high binding energies and are thermodynamically favorable to form with low evaporation rates. Comparison with previously studied HSO 4 -[HO 2(CH 2) 2CO 2H] complex (J. Phys. Chem. Lett. 2013, 4, 779-785) shows that HO 2(CH 2) 2CO 2 -[HO 2(CH 2) 2CO 2H] has very similar thermochemical properties. These results imply that dicarboxylic acids not only can contribute to the heterogeneous complexes formation involving sulfuric acid and dicarboxylic acids, but also can promote the formation of homogenous complexes by involving dicarboxylic acids themselves.« less

  8. Association between a polymorphism in the IL-12p40 gene and cytomegalovirus reactivation after kidney transplantation.

    PubMed

    Hoffmann, Thomas W; Halimi, Jean-Michel; Büchler, Mathias; Velge-Roussel, Florence; Goudeau, Alain; Al Najjar, Azmi; Boulanger, Marie-Denise; Houssaini, Tarik Sqalli; Marliere, Jean-Frédéric; Lebranchu, Yvon; Baron, Christophe

    2008-05-27

    Cytomegalovirus (CMV) infection is associated with a significant rate of morbidity after organ transplantation. The genetic factors influencing its occurrence have been little investigated. IL-12 plays a crucial role in anti-infectious immune responses, especially by stimulating IFNgamma production. An A-to-C single nucleotide polymorphism (SNP) within the 3'-untranslated region of the IL-12p40 gene has been characterized and was reported to be both functionally and clinically relevant. However, the impact of this single nucleotide polymorphism on events after organ transplantation has never been reported. In this study, we investigated the impact of the 3'-untranslated region polymorphism on the occurrence of CMV infection in 469 kidney recipients transplanted at the University Hospital of Tours between 1995 and 2005. The polymorphism was genotyped using the restriction fragment length polymorphism method and CMV infection was determined by pp65 antigenemia. Multifactorial Cox regression analysis demonstrated that the presence of the C allele was an independent risk factor for CMV infection (OR=1.52, P=0.043), the risk being even higher when study was restricted to patients with positive CMV serological status before the graft and who did not receive any CMV prophylaxis (OR=1.88, P=0.028). This study identified a new genetic risk factor for CMV reactivation after kidney transplantation. The results of our study suggest that C carriers might especially benefit from CMV prophylaxis.

  9. 40 CFR 12.160 - Communications.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Communications. 12.160 Section 12.160... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE ENVIRONMENTAL PROTECTION AGENCY § 12.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants...

  10. 40 CFR 12.160 - Communications.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 1 2012-07-01 2012-07-01 false Communications. 12.160 Section 12.160... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE ENVIRONMENTAL PROTECTION AGENCY § 12.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants...

  11. 40 CFR 279.12 - Prohibitions.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 28 2013-07-01 2013-07-01 false Prohibitions. 279.12 Section 279.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR THE MANAGEMENT OF USED OIL Applicability § 279.12 Prohibitions. (a) Surface impoundment prohibition...

  12. 40 CFR 279.12 - Prohibitions.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 27 2014-07-01 2014-07-01 false Prohibitions. 279.12 Section 279.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) STANDARDS FOR THE MANAGEMENT OF USED OIL Applicability § 279.12 Prohibitions. (a) Surface impoundment prohibition...

  13. 40 CFR 12.160 - Communications.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Communications. 12.160 Section 12.160... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE ENVIRONMENTAL PROTECTION AGENCY § 12.160 Communications. (a) The agency shall take appropriate steps to ensure effective communication with applicants...

  14. 40 CFR 1502.12 - Summary.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Summary. 1502.12 Section 1502.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY ENVIRONMENTAL IMPACT STATEMENT § 1502.12 Summary. Each environmental impact statement shall contain a summary which adequately and accurately summarizes...

  15. A crystallographic study of human NONO (p54nrb): overcoming pathological problems with purification, data collection and noncrystallographic symmetry

    PubMed Central

    Knott, Gavin J.; Panjikar, Santosh; Thorn, Andrea; Fox, Archa H.; Conte, Maria R.; Lee, Mihwa; Bond, Charles S.

    2016-01-01

    Non-POU domain-containing octamer-binding protein (NONO, a.k.a. p54nrb) is a central player in nuclear gene regulation with rapidly emerging medical significance. NONO is a member of the highly conserved Drosophila behaviour/human splicing (DBHS) protein family, a dynamic family of obligatory dimeric nuclear regulatory mediators. However, work with the NONO homodimer has been limited by rapid irreversible sample aggregation. Here, it is reported that l-proline stabilizes purified NONO homodimers, enabling good-quality solution small-angle X-ray structure determination and crystallization. NONO crystallized in the apparent space group P21 with a unique axis (b) of 408.9 Å and with evidence of twinning, as indicated by the cumulative intensity distribution L statistic, suggesting the possibility of space group P1. Structure solution by molecular replacement shows a superhelical arrangement of six NONO homodimers (or 12 in P1) oriented parallel to the long axis, resulting in extensive noncrystallographic symmetry. Further analysis revealed that the crystal was not twinned, but the collected data suffered from highly overlapping reflections that obscured the L-test. Optimized data collection on a new crystal using higher energy X-rays, a smaller beam width and an increased sample-to-detector distance produced non-overlapping reflections to 2.6 Å resolution. The steps taken to analyse and overcome this series of practical difficulties and to produce a biologically informative structure are discussed. PMID:27303796

  16. Loss of Interleukin 1 Receptor Antagonist Enhances Susceptibility to Ebola Virus Infection.

    PubMed

    Hill-Batorski, Lindsay; Halfmann, Peter; Marzi, Andrea; Lopes, Tiago J S; Neumann, Gabriele; Feldmann, Heinz; Kawaoka, Yoshihiro

    2015-10-01

    The current outbreak of Ebola virus (EBOV) infection in West Africa is unprecedented, with nearly 26 000 confirmed cases and >10 000 deaths. Comprehensive data on the pathogenesis of EBOV infection are lacking; however, recent studies suggested that fatal EBOV infections are characterized by dysregulation of the innate immune response and a subsequent cytokine storm. Specifically, several studies suggested that hypersecretion of interleukin 1 receptor antagonist (IL-1Ra) correlates with lethal EBOV infections. To examine the significance of IL-1Ra in EBOV infections, we infected mice that lack the gene encoding IL-1Ra, Il1rn (IL-1RN-KO), and mice with wild-type Il1rn (IL-1RN-WT) with a mouse-adapted EBOV (MA-EBOV). Infected IL-1RN-KO mice lost more weight and had a lower survival rate than IL-1RN-WT mice infected with MA-EBOV. In addition, IL-1RN-KO mice infected with wild-type EBOV, which does not cause lethal infection in adult immunocompetent mice, such as C57BL/6 mice, experienced greater weight loss than IL-1RN-WT mice infected with wild-type EBOV. Further studies revealed that the levels of 6 cytokines in spleens-IL-1α, IL-1β, interleukin 12p40, interleukin 17, granulocyte colony-stimulating factor, and regulated on activation, normal T-cell expressed and secreted-were significantly different between IL-1RN-KO mice and IL-1RN-WT mice infected with MA-EBOV. Collectively, our data suggest that IL-1Ra may have a protective effect upon EBOV infection, likely by damping an overactive proinflammatory immune response. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Effect of 1.2% of simvastatin gel as a local drug delivery system on Gingival Crevicular Fluid interleukin-6 & interleukin-8 levels in non surgical treatment of chronic periodontitis patients.

    PubMed

    Gunjiganur Vemanaradhya, Gayathri; Emani, Shilpa; Mehta, Dhoom Singh; Bhandari, Shilpy

    2017-10-01

    The present study was carried out to evaluate the effect of 1.2% simvastatin gel as local drug delivery (LDD) system on Gingival Crevicular Fluid (GCF) Interleukin -6 (IL-6) and Interleukin-8 (IL-8) levels in chronic periodontitis patients, in addition to scaling and root planing (SRP). A total of 46 chronic periodontitis patients were equally divided into two groups. Group I patients were treated by SRP; Group II patients were treated by SRP followed by LDD of 1.2% simvastatin (SMV) gel. Plaque index (PI), Gingival index(GI), Sulcus Bleeding Index (SBI), Probing pocket depth (PPD) and Relative clinical attachment level (CAL) were recorded & GCF samples were collected at baseline (0day) and at 45th day from both the groups. The collected GCF samples were analysed for IL-6 and IL-8 levels with enzyme-linked immunosorbent assay (ELISA). Both the groups showed significant reduction in all the clinical parameters scores and IL-6 and IL-8 levels after non-surgical periodontal therapy (SRP for group I/SRP+1.2% SMV gel for group II) in contrast to baseline values. However, a greater reduction was observed in group II. A non-significant positive correlation was observed between clinical parameters and IL-6 and IL-8 levels except at baseline, a significant correlation was observed between PPD &IL 6 levels in group II. In adjunct to SRP, 1.2% Simvastatin gel acts as an effective local drug delivery agent for the management of chronic periodontitis. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. 40 CFR 12.140 - Employment.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Employment. 12.140 Section 12.140... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE ENVIRONMENTAL PROTECTION AGENCY § 12.140 Employment. No... employment under any program or activity conducted by the agency. The definitions, requirements, and...

  19. Radiation Inhibits Interleukin-12 Production via Inhibition of C-Rel through the Interleukin-6/ Signal Transducer and Activator of Transcription 3 Signaling Pathway in Dendritic Cells

    PubMed Central

    Lee, Eun-Jung; Lee, Seo Jin; Kim, Ji-Hye; Kim, Kyoung-Jin; Yang, Seung-Hyun; Jeong, Keun-Yeong; Seong, Jinsil

    2016-01-01

    Radiotherapy (RT) is a potent anti-tumor modality. However, unwanted effects including increased recurrence and metastasis that involve factors such as cytokines, which induce complex molecular mechanisms, have also been reported. In a previous study, we showed that interleukin (IL)-12 and radiotherapy combination treatment suppressed tumor growth and metastasis in a hepatoma mouse model. In this study, we investigated the mechanism underlying the IL-12 anti-tumor effect during radiotherapy. In tumor-bearing mice, irradiation decreased IL-12 expression in the tumors and spleens. However, a number of dendritic cells infiltrated into the tumors in which IL-12 expression did not decrease. To further study the underlying detailed mechanism for this decrease in IL-12, LPS-stimulated bone marrow–derived dendritic cells (BMDCs) were irradiated, and then IL-12– and IL-6–associated molecules were examined in irradiated tumors and BMDCs. Irradiation resulted in IL-12 suppression and IL-6 increase. IL-6 and signal transducer and activator of transcription 3 (STAT3) inhibitors restored the irradiation-induced IL-12 decrease via suppression of C-Rel activation. Taken together, our study suggests that irradiation-induced IL-6 can decrease IL-12 production through the inhibition of C-Rel phosphorylation by the IL-6/STAT3 signaling pathway. PMID:26745884

  20. Enhancing Interleukin-6 and Interleukin-11 receptor cleavage.

    PubMed

    Lokau, Juliane; Wandel, Marieke; Garbers, Christoph

    2017-04-01

    Proteolytic cleavage of the membrane-bound Interleukin-6 receptor (IL-6R) by the metalloprotease ADAM17 releases an agonistic soluble form of the IL-6R (sIL-6R), which is responsible for the pro-inflammatory trans-signaling branch of the cytokine's activities. This proteolytic step, which is also called ectodomain shedding, is critically regulated by the cleavage site within the IL-6R stalk, because mutations or small deletions within this region are known to render the IL-6R irresponsive towards proteolysis. In the present study, we employed cleavage site profiling data of ADAM17 to generate an IL-6R with increased cleavage susceptibility. Using site-directed mutagenesis, we showed that the non-prime sites P3 and P2 and the prime site P1' were critical for this increase in proteolysis, whereas other positions within the cleavage site were of minor importance. Insertion of this optimized cleavage site into the stalk of the Interleukin-11 receptor (IL-11R) was not sufficient to enable ADAM17-mediated proteolysis, but transfer of different parts of the IL-6R stalk enabled shedding by ADAM17. These findings shed light on the cleavage site specificities of ADAM17 using a native substrate and reveal further differences in the proteolysis of IL-6R and IL-11R. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

    PubMed

    Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

    2007-06-01

    Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

  2. Interleukin-12- and interferon-γ-mediated natural killer cell activation by Agaricus blazei Murill

    PubMed Central

    Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

    2007-01-01

    Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-γ (IFN-γ) deficient mice. NK cell activation and IFN-γ production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-γ production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-γ-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-γ production. PMID:17346284

  3. Cytokine concentration in aqueous humour of eyes with exudative age-related macular degeneration.

    PubMed

    Jonas, Jost B; Tao, Yong; Neumaier, Michael; Findeisen, Peter

    2012-08-01

    To measure the concentration of cytokines in the aqueous humour of eyes with exudative age-related macular degeneration (AMD). The clinical interventional study included a study group of 18 patients with exudative AMD and a control group of 20 patients undergoing routine cataract surgery. Age did not vary significantly (p = 0.36) between study group (80.8 ± 6.4 years) and control group (77.0 ± 9.9 years), nor did gender (p = 0.75). During the interventions, aqueous humour samples were obtained, in which the concentration of cytokines was measured using a solid-phase chemiluminescence immunoassay. Macular thickness was measured by optical coherence tomography (OCT). In the study group as compared to the control group, significantly higher concentrations were measured for epithelial growth factor (EGF) (p = 0.017), human growth factor (HGF) (p= 0.048), intercellular adhesion molecule-1 (ICAM1) (p = 0.028), interleukin 12p40 (IL12p40) (p = 0.009), interleukin 1a2 (IL1a2) (p = 0.01), interleukin 3 (IL3) (p = 0.02), interleukin 6 (IL6) (p = 0.006), interleukin 8 (IL8) (p = 0.02), monocyte chemoattractant protein-1 (MCP-1) (p = 0.048), monokine induced by interferon gamma (MIG) (p = 0.016), matrix metalloproteinase 9 (MMP9) (p = 0.004) and plasminogen activator inhibitor 1 (PAI1) (p = 0.006). Macular thickness was significantly associated with the concentrations of EGF (p = 0.001), HGF (p = 0.02), ICAM1 (p = 0.001), interleukin 12p40 (p = 0.006), IL 1a2 (p = 0.002), MIG (p = 0.001), MMP9 (p < 0.001) and PAI1 (p = 0.01). Interleukin 6 and MCP-1 showed significant associations with the height of retinal pigment epithelium detachment. Numerous cytokines are associated with the presence and the amount of exudative AMD. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.

  4. Dandy-Walker malformations in a case of partial trisomy 9p (p12.1→pter) due to maternal translocation t(9;12)(p12.1;p13.3)

    PubMed Central

    Vundinti, Babu Rao; Kerketta, Lily; Korgaonkar, Seema; Ghosh, Kanjaksha

    2007-01-01

    We describe a five-year-old proband presented with Dandy-Walker malformations, right microopthalmia, hamstring contractures, undescended testis with absence of testis in right scrotum in addition to typical trisomy 9p clinical features. Routine cytogenetic studies with GTG - banding showed 46,XY,der(12)t(9;12) (p12;q13.3),mat karyotype (trisomy 9p). Chromosomal analysis of the father was normal and phenotypically normal mother had 46,XX,t(9;12)(p12;q13) karyotype. Fluorescence in situ hybridization analysis with single copy probes bA5OIA2 (9p11.2), bA562M8 (12p12.1) and centromere probes (9) showed break point at 9p12.1 region. The gene dosage effect of Chromosome 9p along with environmental factors might be associated with Dandy- Walker malformations in the patient. PMID:21957340

  5. Interleukin‑12B is upregulated by decoy receptor 3 in rheumatoid synovial fibroblasts.

    PubMed

    Fukuda, Koji; Miura, Yasushi; Maeda, Toshihisa; Hayashi, Shinya; Kurosaka, Masahiro

    2016-04-01

    Decoy receptor 3 (DcR3) competitively binds to three ligands, Fas ligand, lymphotoxin‑related inducible ligand that competes for glycoprotein D binding to herpesvirus entry mediator on T cells and tumor necrosis factor‑like ligand 1A (TL1A), to prevent their effects. Recent studies have suggested that DcR3 directly affects cells as a ligand. Using a microarray assay, our group newly identified interleukin (IL)‑12B, which encodes the p40 subunit common to IL‑12 and IL‑23, as one of the genes for which expression in fibroblast‑like synoviocytes from patients with rheumatoid arthritis (RA‑FLS) is induced by DcR3. The present study demonstrated that IL‑12B mRNA expression was upregulated by DcR3‑Fc in RA‑FLS in a dose‑dependent manner, but not in OA‑FLS. IL‑12B p40 protein in RA‑FLS was increased when stimulated with DcR3‑Fc. Pre‑treatment with anti‑TL1A antibody suppressed the upregulation of IL‑12B mRNA in RA‑FLS stimulated with DcR3‑Fc. DcR3 mRNA expression in RA‑FLS was induced by IL‑23, but not by IL‑12. These results indicated that DcR3 may increase IL‑12 or IL‑23 by inducing IL‑12B p40 expression via membrane‑bound TL1A on RA‑FLS and that IL‑23 reciprocally induces DcR3 expression in RA‑FLS. DcR3 and IL‑23 may interact in a feedback loop that aggravates local inflammation in patients with RA.

  6. Defining a Role for Acid Sphingomyelinase in the p38/Interleukin-6 Pathway*

    PubMed Central

    Perry, David M.; Newcomb, Benjamin; Adada, Mohamad; Wu, Bill X.; Roddy, Patrick; Kitatani, Kazuyuki; Siskind, Leah; Obeid, Lina M.; Hannun, Yusuf A.

    2014-01-01

    Acid sphingomyelinase (ASM) is one of the key enzymes involved in regulating the metabolism of the bioactive sphingolipid ceramide in the sphingolipid salvage pathway, yet defining signaling pathways by which ASM exerts its effects has proven difficult. Previous literature has implicated sphingolipids in the regulation of cytokines such as interleukin-6 (IL-6), but the specific sphingolipid pathways and mechanisms involved in inflammatory signaling need to be further elucidated. In this work, we sought to define the role of ASM in IL-6 production because our previous work showed that a parallel pathway of ceramide metabolism, acid β-glucosidase 1, negatively regulates IL-6. First, silencing ASM with siRNA abrogated IL-6 production in response to the tumor promoter, 4β-phorbol 12-myristate 13-acetate (PMA), in MCF-7 cells, in distinction to acid β-glucosidase 1 and acid ceramidase, suggesting specialization of the pathways. Moreover, treating cells with siRNA to ASM or with the indirect pharmacologic inhibitor desipramine resulted in significant inhibition of TNFα- and PMA-induced IL-6 production in MDA-MB-231 and HeLa cells. Knockdown of ASM was found to significantly inhibit PMA-dependent IL-6 induction at the mRNA level, probably ruling out mechanisms of translation or secretion of IL-6. Further, ASM knockdown or desipramine blunted p38 MAPK activation in response to TNFα, revealing a key role for ASM in activating p38, a signaling pathway known to regulate IL-6 induction. Last, knockdown of ASM dramatically blunted invasion of HeLa and MDA-MB-231 cells through Matrigel. Taken together, these results demonstrate that ASM plays a critical role in p38 signaling and IL-6 synthesis with implications for tumor pathobiology. PMID:24951586

  7. Lowering Interleukin-12 Activity Improves Myocardial and Vascular Function Compared With Tumor Necrosis Factor-a Antagonism or Cyclosporine in Psoriasis.

    PubMed

    Ikonomidis, Ignatios; Papadavid, Evangelia; Makavos, George; Andreadou, Ioanna; Varoudi, Maria; Gravanis, Kostas; Theodoropoulos, Kostas; Pavlidis, George; Triantafyllidi, Helen; Moutsatsou, Paraskevi; Panagiotou, Christina; Parissis, John; Iliodromitis, Efstathios; Lekakis, John; Rigopoulos, Dimitrios

    2017-09-01

    Interleukin (IL)-12 activity is involved in the pathogenesis of psoriasis and acute coronary syndromes. We investigated the effects of IL-12 inhibition on vascular and left ventricular (LV) function in psoriasis. One hundred fifty psoriasis patients were randomized to receive an anti-IL-12/23 (ustekinumab, n=50), anti-tumor necrosis factor-a (TNF-α; etanercept, n=50), or cyclosporine treatment (n=50). At baseline and 4 months post-treatment, we measured (1) LV global longitudinal strain, twisting, and percent difference between peak twisting and untwisting at mitral valve opening (%untwMVO) using speckle-tracking echocardiography, (2) coronary flow reserve, (3) pulse wave velocity and augmentation index, (4) circulating NT-proBNP (N-terminal pro-B-type natriuretic peptide), TNF-α, IL-6, IL-12, IL-17, malondialdehyde, and fetuin-a. Compared with baseline, all patients had improved global longitudinal strain (median values: -17.7% versus -19.5%), LV twisting (12.4° versus 14°), %untwMVO (27.8% versus 35%), and coronary flow reserve (2.8 versus 3.1) and reduced circulating NT-proBNP, IL-17, TNF-α, and IL-6 post-treatment ( P <0.05). Compared with anti-TNF-α and cyclosporine, anti-IL-12/23 treatment resulted in a greater improvement of global longitudinal strain (25% versus 17% versus 6%,), LV twist (27% versus 17% versus 1%), %untwMVO (31% versus 27% versus 17%), and coronary flow reserve (14% versus 11% versus 4%), as well as a greater reduction of IL-12 (-25% versus -4% versus -2%), malondialdehyde (-27% versus +5% versus +26%), and NT-proBNP(-26% versus -13.6% versus 9.1%) and increase of fetuin-a ( P <0.01). Pulse wave velocity and augmentation index were improved only after anti-IL-12/23 treatment and correlated with changes in global longitudinal strain, LV twisting-untwisting ( P <0.05). In psoriasis, IL-12/23 inhibition results in a greater improvement of coronary, arterial, and myocardial function than TNF-α inhibition or cyclosporine treatment. URL

  8. 46 CFR 12.40-11 - Citizenship and identity.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Citizenship and identity. 12.40-11 Section 12.40-11... Passenger Vessels § 12.40-11 Citizenship and identity. (a) In lieu of the requirements of § 10.221 of this... and identity requirements of this subpart, an applicant must present an unexpired passport issued by...

  9. 46 CFR 12.40-11 - Citizenship and identity.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 1 2011-10-01 2011-10-01 false Citizenship and identity. 12.40-11 Section 12.40-11... Passenger Vessels § 12.40-11 Citizenship and identity. (a) In lieu of the requirements of § 10.221 of this... and identity requirements of this subpart, an applicant must present an unexpired passport issued by...

  10. 46 CFR 12.40-11 - Citizenship and identity.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Citizenship and identity. 12.40-11 Section 12.40-11... Passenger Vessels § 12.40-11 Citizenship and identity. (a) In lieu of the requirements of § 10.221 of this... and identity requirements of this subpart, an applicant must present an unexpired passport issued by...

  11. 46 CFR 12.40-11 - Citizenship and identity.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Citizenship and identity. 12.40-11 Section 12.40-11... Passenger Vessels § 12.40-11 Citizenship and identity. (a) In lieu of the requirements of § 10.221 of this... and identity requirements of this subpart, an applicant must present an unexpired passport issued by...

  12. In vivo induction of interferon gamma expression in grey horses with metastatic melanoma resulting from direct injection of plasmid DNA coding for equine interleukin 12.

    PubMed

    Müller, J-M V; Wissemann, J; Meli, M L; Dasen, G; Lutz, H; Heinzerling, L; Feige, K

    2011-11-01

    Whole blood pharmacokinetics of intratumourally injected naked plasmid DNA coding for equine Interleukin 12 (IL-12) was assessed as a means of in vivo gene transfer in the treatment of melanoma in grey horses. The expression of induced interferon gamma (IFN-g) was evaluated in order to determine the pharmacodynamic properties of in vivo gene transduction. Seven grey horses bearing melanoma were injected intratumourally with 250 µg naked plasmid DNA coding for IL-12. Peripheral blood and biopsies from the injection site were taken at 13 time points until day 14 post injection (p.i.). Samples were analysed using quantitative real-time PCR. Plasmid DNA was quantified in blood samples and mRNA expression for IFN-g in tissue samples. Plasmid DNA showed fast elimination kinetics with more than 99 % of the plasmid disappearing within 36 hours. IFN-g expression increased quickly after IL-12 plasmid injection, but varied between individual horses. Intratumoural injection of plasmid DNA is a feasible method for inducing transgene expression in vivo. Biological activity of the transgene IL-12 was confirmed by measuring expression of IFN-g.

  13. 40 CFR 209.12 - Time.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Time. 209.12 Section 209.12 Protection... Issued Under Section 11(d) of the Noise Control Act § 209.12 Time. (a) In computing any period of time... period of time begins to run shall not be included, except as otherwise provided. Saturdays, Sundays, and...

  14. 40 CFR 209.12 - Time.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Time. 209.12 Section 209.12 Protection... Issued Under Section 11(d) of the Noise Control Act § 209.12 Time. (a) In computing any period of time... period of time begins to run shall not be included, except as otherwise provided. Saturdays, Sundays, and...

  15. 40 CFR 209.12 - Time.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Time. 209.12 Section 209.12 Protection... Issued Under Section 11(d) of the Noise Control Act § 209.12 Time. (a) In computing any period of time... period of time begins to run shall not be included, except as otherwise provided. Saturdays, Sundays, and...

  16. 40 CFR 209.12 - Time.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Time. 209.12 Section 209.12 Protection... Issued Under Section 11(d) of the Noise Control Act § 209.12 Time. (a) In computing any period of time... period of time begins to run shall not be included, except as otherwise provided. Saturdays, Sundays, and...

  17. 40 CFR 209.12 - Time.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Time. 209.12 Section 209.12 Protection... Issued Under Section 11(d) of the Noise Control Act § 209.12 Time. (a) In computing any period of time... period of time begins to run shall not be included, except as otherwise provided. Saturdays, Sundays, and...

  18. Neutralizing anti-interleukin-1β antibodies modulate fetal blood-brain barrier function after ischemia.

    PubMed

    Chen, Xiaodi; Sadowska, Grazyna B; Zhang, Jiyong; Kim, Jeong-Eun; Cummings, Erin E; Bodge, Courtney A; Lim, Yow-Pin; Makeyev, Oleksandr; Besio, Walter G; Gaitanis, John; Threlkeld, Steven W; Banks, William A; Stonestreet, Barbara S

    2015-01-01

    We have previously shown that increases in blood-brain barrier permeability represent an important component of ischemia-reperfusion related brain injury in the fetus. Pro-inflammatory cytokines could contribute to these abnormalities in blood-brain barrier function. We have generated pharmacological quantities of mouse anti-ovine interleukin-1β monoclonal antibody and shown that this antibody has very high sensitivity and specificity for interleukin-1β protein. This antibody also neutralizes the effects of interleukin-1β protein in vitro. In the current study, we hypothesized that the neutralizing anti-interleukin-1β monoclonal antibody attenuates ischemia-reperfusion related fetal blood-brain barrier dysfunction. Instrumented ovine fetuses at 127 days of gestation were studied after 30 min of carotid occlusion and 24h of reperfusion. Groups were sham operated placebo-control- (n=5), ischemia-placebo- (n=6), ischemia-anti-IL-1β antibody- (n=7), and sham-control antibody- (n=2) treated animals. Systemic infusions of placebo (0.154M NaCl) or anti-interleukin-1β monoclonal antibody (5.1±0.6 mg/kg) were given intravenously to the same sham or ischemic group of fetuses at 15 min and 4h after ischemia. Concentrations of interleukin-1β protein and anti-interleukin-1β monoclonal antibody were measured by ELISA in fetal plasma, cerebrospinal fluid, and parietal cerebral cortex. Blood-brain barrier permeability was quantified using the blood-to-brain transfer constant (Ki) with α-aminoisobutyric acid in multiple brain regions. Interleukin-1β protein was also measured in parietal cerebral cortices and tight junction proteins in multiple brain regions by Western immunoblot. Cerebral cortical interleukin-1β protein increased (P<0.001) after ischemia-reperfusion. After anti-interleukin-1β monoclonal antibody infusions, plasma anti-interleukin-1β monoclonal antibody was elevated (P<0.001), brain anti-interleukin-1β monoclonal antibody levels were higher (P<0

  19. 40 CFR 86.884-12 - Test run.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 19 2014-07-01 2014-07-01 false Test run. 86.884-12 Section 86.884-12... Engines; Smoke Exhaust Test Procedure § 86.884-12 Test run. (a) The temperature of the air supplied to the... taken for each test: (1) Start cooling system; (2) Warm up the engine by the procedure described in 40...

  20. 40 CFR 191.12 - Definitions.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Definitions. 191.12 Section 191.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR MANAGEMENT AND DISPOSAL OF SPENT NUCLEAR FUEL, HIGH-LEVEL AND...

  1. Logical Analysis of Regulation of Interleukin-12 Expression Pathway Regulation During HCV Infection.

    PubMed

    Farooqi, Zia-Ur-Rehman; Tareen, Samar H K; Ahmed, Jamil; Zaidi, Najam-Us-Sahar S

    2016-01-01

    Hepatitis C virus (HCV) triggers coordinated innate and adaptive response in host cell. HCV genome and proteins of the replicating virus are recognized as non-self-antigens by host cell to activate Toll Like Receptors (TLRs). Activated TLRs ultimately express cytokines, which can clear virus either by activating interferon (IFN), protein kinase C (PKC) and RNA Lase system or through activation of cytotoxic T-lymphocytes. Interleukin-12 (IL-12) is a potent antiviral cytokine, capable of clearing HCV by bridging both innate and adaptive antiviral immune response. Activation of TLR-4 on macrophages surface induces expression of IL-12 via NF-κB and AP-1 transcriptional pathway. After expression, IL- 12 releases IFN-γ, which activates anti-HCV cytotoxic lymphocytes. Conversely, in chronic HCV infection downregulation of IL-12 has been reported instead of by number of studies. Keeping in view of the above mentioned facts, this study was designed to evaluate HCV-core mediated down-regulation of IL-12 transcriptional pathway by employing a logical modeling approach based on the Ren´e Thomas formalism. The logical parameters of entities were estimated by using SMBioNet. The Logical model represents all possible dynamics of protein expression involved during course of HCV pathology. Results demonstrated that at chronic stage of infection, though TLR-4 was constantly active but yet it failed to express the NF-κB, AP-1, IL-12 and IFN-γ. This mechanism was indicative of incorporation of core mediated changes in IL-12 regulatory pathway. Moreover, results also indicate that HCV adopts different trajectories to accomplish the persistence of chronic phase of infection. It also implicated that human immune system tries to clear HCV but core is capable of inducing system oscillations to evade the immunity.

  2. DNA Binding and Phosphorylation Regulate the Core Structure of the NF-κB p50 Transcription Factor

    NASA Astrophysics Data System (ADS)

    Vonderach, Matthias; Byrne, Dominic P.; Barran, Perdita E.; Eyers, Patrick A.; Eyers, Claire E.

    2018-06-01

    The NF-κB transcription factors are known to be extensively phosphorylated, with dynamic site-specific modification regulating their ability to dimerize and interact with DNA. p50, the proteolytic product of p105 (NF-κB1), forms homodimers that bind DNA but lack intrinsic transactivation function, functioning as repressors of transcription from κB promoters. Here, we examine the roles of specific phosphorylation events catalysed by either protein kinase A (PKAc) or Chk1, in regulating the functions of p50 homodimers. LC-MS/MS analysis of proteolysed p50 following in vitro phosphorylation allows us to define Ser328 and Ser337 as PKAc- and Chk1-mediated modifications, and pinpoint an additional four Chk1 phosphosites: Ser65, Thr152, Ser242 and Ser248. Native mass spectrometry (MS) reveals Chk1- and PKAc-regulated disruption of p50 homodimer formation through Ser337. Additionally, we characterise the Chk1-mediated phosphosite, Ser242, as a regulator of DNA binding, with a S242D p50 phosphomimetic exhibiting a > 10-fold reduction in DNA binding affinity. Conformational dynamics of phosphomimetic p50 variants, including S242D, are further explored using ion-mobility MS (IM-MS). Finally, comparative theoretical modelling with experimentally observed p50 conformers, in the absence and presence of DNA, reveals that the p50 homodimer undergoes conformational contraction during electrospray ionisation that is stabilised by complex formation with κB DNA.

  3. DNA Binding and Phosphorylation Regulate the Core Structure of the NF-κB p50 Transcription Factor.

    PubMed

    Vonderach, Matthias; Byrne, Dominic P; Barran, Perdita E; Eyers, Patrick A; Eyers, Claire E

    2018-06-05

    The NF-κB transcription factors are known to be extensively phosphorylated, with dynamic site-specific modification regulating their ability to dimerize and interact with DNA. p50, the proteolytic product of p105 (NF-κB1), forms homodimers that bind DNA but lack intrinsic transactivation function, functioning as repressors of transcription from κB promoters. Here, we examine the roles of specific phosphorylation events catalysed by either protein kinase A (PKA c ) or Chk1, in regulating the functions of p50 homodimers. LC-MS/MS analysis of proteolysed p50 following in vitro phosphorylation allows us to define Ser328 and Ser337 as PKA c - and Chk1-mediated modifications, and pinpoint an additional four Chk1 phosphosites: Ser65, Thr152, Ser242 and Ser248. Native mass spectrometry (MS) reveals Chk1- and PKA c -regulated disruption of p50 homodimer formation through Ser337. Additionally, we characterise the Chk1-mediated phosphosite, Ser242, as a regulator of DNA binding, with a S242D p50 phosphomimetic exhibiting a > 10-fold reduction in DNA binding affinity. Conformational dynamics of phosphomimetic p50 variants, including S242D, are further explored using ion-mobility MS (IM-MS). Finally, comparative theoretical modelling with experimentally observed p50 conformers, in the absence and presence of DNA, reveals that the p50 homodimer undergoes conformational contraction during electrospray ionisation that is stabilised by complex formation with κB DNA. Graphical Abstract ᅟ.

  4. The 3'UTR 1188A/C polymorphism of IL-12p40 is not associated with susceptibility for developing plaque psoriasis in Mestizo population from western Mexico.

    PubMed

    Sandoval-Talamantes, Ana Karen; Brito-Luna, Myrian Johanna; Fafutis-Morris, Mary; Villanueva-Quintero, Delfina Guadalupe; Graciano-Machuca, Omar; Ramírez-Dueñas, María Guadalupe; Alvarado-Navarro, Anabell

    2015-02-01

    Psoriasis is a chronic autoimmune inflammatory disease that affects the skin and the joints. Psoriasis is characterized by the keratinocyte proliferation, which is induced by cytokines Th1 and Th17. Patients with plaque psoriasis present a chronic inflammatory response with high levels of interleukin (IL)-12 and IL-23. Various single-nucleotide polymorphisms (SNP) have been identified in the IL12B gene, such as SNP 3' UTR 1188 A/C (SNP rs3212227), which has been associated with susceptibility to developing plaque psoriasis and with the production of IL-12 and IL-23 in individuals of different ethnic groups. In this study, we determined whether there is an association of SNP rs3212227 with the susceptibility of developing plaque psoriasis and with serum levels of IL-12 and IL-23 in Mestizo population in western Mexico. We included 112 patients with psoriasis and 112 clinical healthy individuals in the study. The frequencies of genotypes A/A, A/C, and C/C in patients with plaque psoriasis were 41, 53, and 6%, respectively, while in the control group, these were 37, 53, and 10%, respectively, without finding statistically significant differences between both groups (p>0.05). Although IL-12 and IL-23 serum levels were higher in patients than in controls, we found no significant differences. The group of patients with genotype CC presented the highest levels of IL-23 (p<0.05). These data suggest that the SNP rs3212227 phenotype is not associated with the risk of developing plaque psoriasis or with IL-12 and IL-23 levels in Mestizo population in western Mexico. Copyright © 2014 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  5. 12 CFR 303.40 - Scope.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Scope. 303.40 Section 303.40 Banks and Banking... branches of domestic banks are processed in accordance with subpart J (International Banking) of this part... without the acquisition of the whole bank are treated as interstate bank merger transactions under section...

  6. The Specificity of Innate Immune Responses Is Enforced by Repression of Interferon Response Elements by NF-κB p50

    PubMed Central

    Cheng, Christine S.; Feldman, Kristyn E.; Lee, James; Verma, Shilpi; Huang, De-Bin; Huynh, Kim; Chang, Mikyoung; Ponomarenko, Julia V.; Sun, Shao-Cong; Benedict, Chris A.; Ghosh, Gourisankar; Hoffmann, Alexander

    2011-01-01

    The specific binding of transcription factors to cognate sequence elements is thought to be critical for the generation of specific gene expression programs. Members of the nuclear factor κB (NF-κB) and interferon (IFN) regulatory factor (IRF) transcription factor families bind to the κB site and the IFN response element (IRE), respectively, of target genes, and they are activated in macrophages after exposure to pathogens. However, how these factors produce pathogen-specific inflammatory and immune responses remains poorly understood. Combining top-down and bottom-up systems biology approaches, we have identified the NF-κB p50 homodimer as a regulator of IRF responses. Unbiased genome-wide expression and biochemical and structural analyses revealed that the p50 homodimer repressed a subset of IFN-inducible genes through a previously uncharacterized subclass of guanine-rich IRE (G-IRE) sequences. Mathematical modeling predicted that the p50 homodimer might enforce the stimulus specificity of composite promoters. Indeed, the production of the antiviral regulator IFN-β was rendered stimulus-specific by the binding of the p50 homodimer to the G-IRE–containing IFNβ enhancer to suppress cytotoxic IFN signaling. Specifically, a deficiency in p50 resulted in the inappropriate production of IFN-β in response to bacterial DNA sensed by Toll-like receptor 9. This role for the NF-κB p50 homodimer in enforcing the specificity of the cellular response to pathogens by binding to a subset of IRE sequences alters our understanding of how the NF-κB and IRF signaling systems cooperate to regulate antimicrobial immunity. PMID:21343618

  7. 40 CFR 258.12 - Wetlands.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Wetlands. 258.12 Section 258.12... Act or applicable State wetlands laws, the presumption that practicable alternative to the proposed... Species Act of 1973, and (iv) Violate any requirement under the Marine Protection, Research, and...

  8. 40 CFR 258.12 - Wetlands.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Wetlands. 258.12 Section 258.12... Act or applicable State wetlands laws, the presumption that practicable alternative to the proposed... Species Act of 1973, and (iv) Violate any requirement under the Marine Protection, Research, and...

  9. 40 CFR 258.12 - Wetlands.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Wetlands. 258.12 Section 258.12... Act or applicable State wetlands laws, the presumption that practicable alternative to the proposed... Species Act of 1973, and (iv) Violate any requirement under the Marine Protection, Research, and...

  10. Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

    PubMed

    Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

    2017-01-01

    Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Structural Activation of Pro-inflammatory Human Cytokine IL-23 by Cognate IL-23 Receptor Enables Recruitment of the Shared Receptor IL-12Rβ1.

    PubMed

    Bloch, Yehudi; Bouchareychas, Laura; Merceron, Romain; Składanowska, Katarzyna; Van den Bossche, Lien; Detry, Sammy; Govindarajan, Srinath; Elewaut, Dirk; Haerynck, Filomeen; Dullaers, Melissa; Adamopoulos, Iannis E; Savvides, Savvas N

    2018-01-16

    Interleukin-23 (IL-23), an IL-12 family cytokine, plays pivotal roles in pro-inflammatory T helper 17 cell responses linked to autoimmune and inflammatory diseases. Despite intense therapeutic targeting, structural and mechanistic insights into receptor complexes mediated by IL-23, and by IL-12 family members in general, have remained elusive. We determined a crystal structure of human IL-23 in complex with its cognate receptor, IL-23R, and revealed that IL-23R bound to IL-23 exclusively via its N-terminal immunoglobulin domain. The structural and functional hotspot of this interaction partially restructured the helical IL-23p19 subunit of IL-23 and restrained its IL-12p40 subunit to cooperatively bind the shared receptor IL-12Rβ1 with high affinity. Together with structural insights from the interaction of IL-23 with the inhibitory antibody briakinumab and by leveraging additional IL-23:antibody complexes, we propose a mechanistic paradigm for IL-23 and IL-12 whereby cognate receptor binding to the helical cytokine subunits primes recruitment of the shared receptors via the IL-12p40 subunit. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Different Epidermal Growth Factor (EGF) Receptor Ligands Show Distinct Kinetics and Biased or Partial Agonism for Homodimer and Heterodimer Formation*

    PubMed Central

    Macdonald-Obermann, Jennifer L.; Pike, Linda J.

    2014-01-01

    The EGF receptor has seven different cognate ligands. Previous work has shown that these different ligands are capable of inducing different biological effects, even in the same cell. To begin to understand the molecular basis for this variation, we used luciferase fragment complementation to measure ligand-induced dimer formation and radioligand binding to study the effect of the ligands on subunit-subunit interactions in EGF receptor (EGFR) homodimers and EGFR/ErbB2 heterodimers. In luciferase fragment complementation imaging studies, amphiregulin (AREG) functioned as a partial agonist, inducing only about half as much total dimerization as the other three ligands. However, unlike the other ligands, AREG showed biphasic kinetics for dimer formation, suggesting that its path for EGF receptor activation involves binding to both monomers and preformed dimers. EGF, TGFα, and betacellulin (BTC) appear to mainly stimulate receptor activation through binding to and dimerization of receptor monomers. In radioligand binding assays, EGF and TGFα exhibited increased affinity for EGFR/ErbB2 heterodimers compared with EGFR homodimers. By contrast, BTC and AREG showed a similar affinity for both dimers. Thus, EGF and TGFα are biased agonists, whereas BTC and AREG are balanced agonists with respect to selectivity of dimer formation. These data suggest that the differences in biological response to different EGF receptor ligands may result from partial agonism for dimer formation, differences in the kinetic pathway utilized to generate activated receptor dimers, and biases in the formation of heterodimers versus homodimers. PMID:25086039

  13. Adenosine triphosphate induces P2Y2 activation and interleukin-8 release in human esophageal epithelial cells.

    PubMed

    Wu, Liping; Oshima, Tadayuki; Fukui, Hirokazu; Watari, Jiro; Miwa, Hiroto

    2017-07-01

    Immune-mediated mucosal inflammation characterized by the release of interleukin (IL)-8 is associated with gastroesophageal reflux disease. ATP released by human esophageal epithelial cells (HEECs) mediates the release of cytokines through P2 nucleotide receptors that are present on various cells, including HEECs. This study characterized and identified human esophageal epithelial P2 receptors that are responsible for ATP-mediated release of IL-8 by using a human esophageal stratified squamous epithelial model. Primary HEECs were cultured with the use of an air-liquid interface (ALI) system. The ATP analogue adenosine 5'-O-3-thiotriphosphate (ATP-γ-S) was added to the basolateral compartment, and IL-8 release was measured. Involvement of the P2Y2 receptor was assessed with the use of selective and non-selective receptor antagonists and a P2Y2 receptor agonist. Expression of the P2Y2 receptor was assessed using western blotting and immunohistochemistry. Adenosine triphosphate-γ-S induced IL-8 release through the P2Y2 receptor. A P2Y2 receptor antagonist but not a P2X3 receptor antagonist or a P2Y1 receptor antagonist blocked ATP-γ-S-mediated IL-8 release. Conversely, a P2Y2 receptor agonist induced IL-8 release. Western blotting and immunohistochemistry of the P2Y2 receptor showed strong expression of the P2Y2 receptor on ALI-cultured HEECs and in human esophagus. Inhibition of extracellular signal-regulated kinase but not of protein kinase C blocked the ATP-mediated release of IL-8. ATP-γ-S induced phosphorylation of extracellular signal-regulated kinase, and a P2Y2 receptor antagonist blocked this phosphorylation. Interleukin-8 release after purinergic stimulation in ALI-cultured HEECs is mediated through P2Y2 receptor activation. ATP-induced IL-8 release maybe involved in the pathogenesis of refractory gastroesophageal reflux disease. © 2016 Journal of Gastroenterology and Hepatology Foundation and John Wiley & Sons Australia, Ltd.

  14. Expression of Cytokines Interleukin-2, Interleukin-4, Interleukin-10 and Transforming Growth Factor β in Gastric Adenocarcinoma Biopsies Obtained from Mexican Patients

    PubMed Central

    Orea, Maria Alicia Diaz; Perez, Veronica Muñoz; Conde, Eduardo Gómez; Sánchez, Victor Omar Castellanos; Lopez, Rogelio Gonzalez; Alonso, J Carlos Flores; Cárdenas, M Elena; Galicia, A Luisa; Mendoza, Aurelio

    2017-01-01

    Objective: In this study, expression of Interleukin-2, Interleukin-4, Interleukin-10 and transforming growth factor beta in diffuse and intestinal type gastric cancers from Mexican patients was assessed for use as markers of malignancy. Methods: A total of 30 biopsies from gastric adenocarcinomas, 60% diffuse, 20% intestinal and 20% mixed in type, were studied by immunohistochemistry. Results: Regarding expression of cytokines, 23% were positive for IL-2, 26.7% for IL-4, 16.6% for IL-10 and none for TGF-β. There were found Significant statistically stage differences were noted. For example, for stages I-II 100% were IL-2 positive (p = 0.009), 87.5% were IL-4 positive (p = 0.005) and 100.0% IL-10 positive (p = 0.009). Young women were more likely to suffer gastric adenocarcinoma. In biopsies of male patients with gastric cancer, there was an increased expression of IL-2 and in biopsies from female patients in IL4. There was significantly greater detection of IL-4 and IL-10 expression in stages I and II than in stages III and IV. It was also found that IL-4, IL-10 had a higher positive expression in patients biopsies with low-level differentiations than patients with well differentiated gastric cancer in which cases were undetected. Conclusions: These results suggest that positive expression of IL-4 and IL-10 may be useful as a molecular marker to distinguish stage I and II diffuse gastric cancers which can be more readily controlled. PMID:28350427

  15. 40 CFR 610.12 - Program initiative.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 30 2011-07-01 2011-07-01 false Program initiative. 610.12 Section 610.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY RETROFIT DEVICES Test Procedures and Evaluation Criteria General Provisions § 610.12 Program initiative. A...

  16. 40 CFR 610.12 - Program initiative.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 31 2012-07-01 2012-07-01 false Program initiative. 610.12 Section 610.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY RETROFIT DEVICES Test Procedures and Evaluation Criteria General Provisions § 610.12 Program initiative. A...

  17. 40 CFR 610.12 - Program initiative.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 31 2013-07-01 2013-07-01 false Program initiative. 610.12 Section 610.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY RETROFIT DEVICES Test Procedures and Evaluation Criteria General Provisions § 610.12 Program initiative. A...

  18. 40 CFR 610.12 - Program initiative.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Program initiative. 610.12 Section 610.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY RETROFIT DEVICES Test Procedures and Evaluation Criteria General Provisions § 610.12 Program initiative. A...

  19. 40 CFR 72.12 - Administrative appeals.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Administrative appeals. 72.12 Section 72.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) PERMITS REGULATION Acid Rain Program General Provisions § 72.12 Administrative appeals. The procedures for...

  20. 40 CFR 72.12 - Administrative appeals.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 17 2012-07-01 2012-07-01 false Administrative appeals. 72.12 Section 72.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) PERMITS REGULATION Acid Rain Program General Provisions § 72.12 Administrative appeals. The procedures for...

  1. 40 CFR 72.12 - Administrative appeals.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 17 2014-07-01 2014-07-01 false Administrative appeals. 72.12 Section 72.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) PERMITS REGULATION Acid Rain Program General Provisions § 72.12 Administrative appeals. The procedures for...

  2. 40 CFR 72.12 - Administrative appeals.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 16 2011-07-01 2011-07-01 false Administrative appeals. 72.12 Section 72.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) PERMITS REGULATION Acid Rain Program General Provisions § 72.12 Administrative appeals. The procedures for...

  3. 40 CFR 72.12 - Administrative appeals.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 17 2013-07-01 2013-07-01 false Administrative appeals. 72.12 Section 72.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) PERMITS REGULATION Acid Rain Program General Provisions § 72.12 Administrative appeals. The procedures for...

  4. PDB-NMA of a protein homodimer reproduces distinct experimental motility asymmetry.

    PubMed

    Tirion, Monique M; Ben-Avraham, Daniel

    2018-01-16

    We have extended our analytically derived PDB-NMA formulation, Atomic Torsional Modal Analysis or ATMAN (Tirion and ben-Avraham 2015 Phys. Rev. E 91 032712), to include protein dimers using mixed internal and Cartesian coordinates. A test case on a 1.3 [Formula: see text] resolution model of a small homodimer, ActVA-ORF6, consisting of two 112-residue subunits identically folded in a compact 50 [Formula: see text] sphere, reproduces the distinct experimental Debye-Waller motility asymmetry for the two chains, demonstrating that structure sensitively selects vibrational signatures. The vibrational analysis of this PDB entry, together with biochemical and crystallographic data, demonstrates the cooperative nature of the dimeric interaction of the two subunits and suggests a mechanical model for subunit interconversion during the catalytic cycle.

  5. PDB-NMA of a protein homodimer reproduces distinct experimental motility asymmetry

    NASA Astrophysics Data System (ADS)

    Tirion, Monique M.; ben-Avraham, Daniel

    2018-03-01

    We have extended our analytically derived PDB-NMA formulation, Atomic Torsional Modal Analysis or ATMAN (Tirion and ben-Avraham 2015 Phys. Rev. E 91 032712), to include protein dimers using mixed internal and Cartesian coordinates. A test case on a 1.3 {\\mathringA} resolution model of a small homodimer, ActVA-ORF6, consisting of two 112-residue subunits identically folded in a compact 50 {\\mathringA} sphere, reproduces the distinct experimental Debye-Waller motility asymmetry for the two chains, demonstrating that structure sensitively selects vibrational signatures. The vibrational analysis of this PDB entry, together with biochemical and crystallographic data, demonstrates the cooperative nature of the dimeric interaction of the two subunits and suggests a mechanical model for subunit interconversion during the catalytic cycle.

  6. Antitumor effect of interleukin (IL)-12 in the absence of endogenous IFN-gamma: a role for intrinsic tumor immunogenicity and IL-15.

    PubMed

    Gri, Giorgia; Chiodoni, Claudia; Gallo, Elena; Stoppacciaro, Antonella; Liew, Foo Y; Colombo, Mario P

    2002-08-01

    IFN-gamma knockout mice (GKO) rejected C26 colon carcinoma cells transduced to secrete interleukin(IL)-12 but do not reject similarly transduced TSA mammary adenocarcinoma (C26/12 and TSA/12 cells, respectively). To determine whether such difference could be because of a different tumor response to IFN-gamma, we injected BALB/c mice with TSA, C26, and their IL-12-transduced counterparts rendered unresponsive to IFN-gamma by stable transduction of a dominant negative (DN), truncated IFN-gamma receptor alpha chain. TSA/DN and C26/DN showed the same in vivo growth kinetics as parental cells, whereas coexpression of IL-12 induced rejection independent of tumor-cell responsiveness to IFN-gamma. This suggests that the role of IFN-gamma is primarily in activating the host immune response, which appears to depend on the intrinsic immunogenicity of the target tumor. C26 and TSA share a common tumor-associated antigen, yet C26 cells are more immunogenic than TSA. C26/12 expressed 10-fold higher levels of class I MHC molecules and induced higher CTL activity compared with TSA/12 cells in GKO mice. Moreover, whereas in GKO mice the TSA/12 tumor was associated with a greater number of infiltrating T cells, only those infiltrating C26/12 tumor expressed the activation marker OX40. The search for cytokine(s) that might contribute in determining the different T-cell response to these IL-12-transduced tumors in GKO mice revealed a role of IL-15. In situ hybridization showed IL-15 expression in C26/12 but not in TSA/12 tumors. In addition, injection of GKO mice with soluble IL-15 receptor-alpha to block IL-15 expression prevented rejection of C26/12 cells. Together, the results suggest that in the absence of IFN-gamma, IL-12 can exert antitumor activity through alternative mechanisms, depending on the tumor cell type and the availability of cytokines that can replace IFN-gamma in sustaining T-cell functions.

  7. Mast cells counteract regulatory T-cell suppression through interleukin-6 and OX40/OX40L axis toward Th17-cell differentiation.

    PubMed

    Piconese, Silvia; Gri, Giorgia; Tripodo, Claudio; Musio, Silvia; Gorzanelli, Andrea; Frossi, Barbara; Pedotti, Rosetta; Pucillo, Carlo E; Colombo, Mario P

    2009-09-24

    The development of inflammatory diseases implies inactivation of regulatory T (Treg) cells through mechanisms that still are largely unknown. Here we showed that mast cells (MCs), an early source of inflammatory mediators, are able to counteract Treg inhibition over effector T cells. To gain insight into the molecules involved in their interplay, we set up an in vitro system in which all 3 cellular components were put in contact. Reversal of Treg suppression required T cell-derived interleukin-6 (IL-6) and the OX40/OX40L axis. In the presence of activated MCs, concomitant abundance of IL-6 and paucity of Th1/Th2 cytokines skewed Tregs and effector T cells into IL-17-producing T cells (Th17). In vivo analysis of lymph nodes hosting T-cell priming in experimental autoimmune encephalomyelitis revealed activated MCs, Tregs, and Th17 cells displaying tight spatial interactions, further supporting the occurrence of an MC-mediated inhibition of Treg suppression in the establishment of Th17-mediated inflammatory responses.

  8. 40 CFR 12.110 - Self-evaluation.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... organizations representing individuals with handicaps to, participate in the self-evaluation process by... 40 Protection of Environment 1 2014-07-01 2014-07-01 false Self-evaluation. 12.110 Section 12.110... IN PROGRAMS OR ACTIVITIES CONDUCTED BY THE ENVIRONMENTAL PROTECTION AGENCY § 12.110 Self-evaluation...

  9. 46 CFR 12.40-15 - Alternative means of compliance.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Alternative means of compliance. 12.40-15 Section 12.40.... Flag Large Passenger Vessels § 12.40-15 Alternative means of compliance. (a) The owner or managing..., which, if approved, will serve as an alternative means of complying with the requirements of this...

  10. Cloning and characterization of an adenoviral vector for highly efficient and doxycycline – suppressible expression of bioactive human single – chain interleukin 12 in colon cancer

    PubMed Central

    Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

    2007-01-01

    Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and

  11. Hydrocortisone prevents immunosuppression by interleukin-10+ natural killer cells after trauma-hemorrhage.

    PubMed

    Roquilly, Antoine; Broquet, Alexis; Jacqueline, Cédric; Masson, Damien; Segain, Jean Pierre; Braudeau, Cecile; Vourc'h, Mickael; Caillon, Jocelyne; Altare, Frédéric; Josien, Regis; Retière, Christelle; Villadangos, Jose; Asehnoune, Karim

    2014-12-01

    Trauma induces a state of immunosuppression, which is responsible for the development of nosocomial infections. Hydrocortisone reduces the rate of pneumonia in patients with trauma. Because alterations of dendritic cells and natural killer cells play a central role in trauma-induced immunosuppression, we investigated whether hydrocortisone modulates the dendritic cell/natural killer cell cross talk in the context of posttraumatic pneumonia. Experimental study. Research laboratory from an university hospital. Bagg Albino/cJ mice (weight, 20-24 g). First, in an a priori substudy of a multicenter, randomized, double-blind, placebo-controlled trial of hydrocortisone (200 mg/d for 7 d) in patients with severe trauma, we have measured the blood levels of five cytokines (tumor necrosis factor-α, interleukin-6, interleukin-10, interleukin-12, interleukin-17) at day 1 and day 8. In a second step, the effects of hydrocortisone on dendritic cell/natural killer cell cross talk were studied in a mouse model of posttraumatic pneumonia. Hydrocortisone (0.6 mg/mice i.p.) was administered immediately after hemorrhage. Twenty-four hours later, the mice were challenged with Staphylococcus aureus (7 × 10 colony-forming units). Using sera collected during a multicenter study in patients with trauma, we found that hydrocortisone decreased the blood level of interleukin-10, a cytokine centrally involved in the regulation of dendritic cell/natural killer cell cluster. In a mouse model of trauma-hemorrhage-induced immunosuppression, splenic natural killer cells induced an interleukin-10-dependent elimination of splenic dendritic cell. Hydrocortisone treatment reduced this suppressive function of natural killer cells and increased survival of mice with posthemorrhage pneumonia. The reduction of the interleukin-10 level in natural killer cells by hydrocortisone was partially dependent on the up-regulation of glucocorticoid-induced tumor necrosis factor receptor-ligand (TNFsf18) on

  12. 40 CFR 721.9285 - Reaction products of formalin (37%) with amine C12.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Reaction products of formalin (37... Specific Chemical Substances § 721.9285 Reaction products of formalin (37%) with amine C12. (a) Chemical... as reaction products of formalin (37%) with amine C12 (PMN P-95-535) is subject to reporting under...

  13. 40 CFR 721.9285 - Reaction products of formalin (37%) with amine C12.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Reaction products of formalin (37... Specific Chemical Substances § 721.9285 Reaction products of formalin (37%) with amine C12. (a) Chemical... as reaction products of formalin (37%) with amine C12 (PMN P-95-535) is subject to reporting under...

  14. 40 CFR 1506.12 - Effective date.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Effective date. 1506.12 Section 1506.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY OTHER REQUIREMENTS OF NEPA § 1506.12... local agencies to adopt their implementing procedures. (a) These regulations shall apply to the fullest...

  15. 40 CFR 1506.12 - Effective date.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 33 2011-07-01 2011-07-01 false Effective date. 1506.12 Section 1506.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY OTHER REQUIREMENTS OF NEPA § 1506.12... local agencies to adopt their implementing procedures. (a) These regulations shall apply to the fullest...

  16. Plasma interferon-gamma and interleukin-10 concentrations in systemic meningococcal disease compared with severe systemic Gram-positive septic shock.

    PubMed

    Bjerre, Anna; Brusletto, Berit; Høiby, Ernst Arne; Kierulf, Peter; Brandtzaeg, Petter

    2004-02-01

    To analyze plasma interferon-gamma and interleukin-10 concentrations in patients with systemic meningococcal disease and patients with severe Gram-positive septic shock caused by Streptococcus pneumoniae or Staphylococcus aureus. To study the in vitro cytokine (interferon-gamma and interleukin-10) responses in a whole blood model boosted with heat-killed Neisseria meningitidis, S. pneumoniae, and S. aureus before and after treatment with recombinant interleukin-10 or recombinant interferon-gamma. Experimental study. Laboratory. Plasma samples were collected from patients with systemic meningococcal disease (n = 66) and patients with severe Gram-positive septic shock caused by S. pneumoniae (n = 4) or S. aureus (n = 3). Whole blood was boosted with heat-killed N. meningitidis, S. pneumoniae, and S. aureus (1 x 106 colony forming units/mL), and plasmas were analyzed for interleukin-10 or interferon-gamma at 0, 5, 12, and 24 hrs. Furthermore, recombinant interleukin-10 or recombinant interferon-gamma was added before bacteria, and the effect on the secretion of interferon-gamma and interleukin-10, respectively, was analyzed after 24 hrs. The median concentration of interferon-gamma was 15 pg/mL and of interleukin-10 was 10,269 pg/mL in patients with meningococcal septic shock (n = 24) compared with median interferon-gamma concentration of 3400 pg/mL and interleukin-10 concentration of 465 pg/mL in patients with severe Gram-positive shock (p =.001). Increased interferon-gamma concentrations were associated with case fatality (p =.011). In a whole blood model we demonstrated that 1 x 106 colony forming units/mL of N. meningitidis induced more interleukin-10 but less interferon-gamma than S. pneumoniae. S. aureus induced minimal secretion of both cytokines. Recombinant interleukin-10 efficiently down-regulated the secretion of interferon-gamma, and vice versa, as shown in a whole blood model. We speculate whether high concentrations of interleukin-10 contribute to the

  17. 40 CFR 35.925-12 - Property.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 1 2013-07-01 2013-07-01 false Property. 35.925-12 Section 35.925-12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Grants for Construction of Treatment Works-Clean Water Act § 35.925-12 Property. That the...

  18. 40 CFR 35.925-12 - Property.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Property. 35.925-12 Section 35.925-12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Grants for Construction of Treatment Works-Clean Water Act § 35.925-12 Property. That the...

  19. The interleukin-23/interleukin-17 immune axis as a promising new target in the treatment of spondyloarthritis.

    PubMed

    Yeremenko, Nataliya; Paramarta, Jacqueline E; Baeten, Dominique

    2014-07-01

    Various novel therapies for spondyloarthritis (SpA) are currently under development. In this review, we discuss the scientific rational to target the interleukin (IL)-23/IL-17 axis in SpA and give an overview of the proof-of-concept trials with drugs directed towards this axis. Cumulative evidence from genetics (e.g. the strong genetic association with the IL-23 receptor gene), in-vitro models (e.g. the increased IL-23 production upon HLA-B27 misfolding), human expression studies (e.g. the expansion of IL-17 producing innate cells in SpA) and animal models (e.g. the increased IL-17 production in HLA-B27 transgenic rats) strongly supports the involvement of the IL-23/IL-17 axis in the pathogenesis of SpA. Ustekinumab (a monoclonal antibody directed against the common p40 subunit of IL-23 and IL-12), secukinumab, ixekizumab (both monoclonal antibodies directed against IL-17A), and brodalumab a monoclonal antibody against the IL-17RA receptor) have been recently used in proof-of-concept and randomized trials in the ankylosing spondylitis and/or psoriatic arthritis subforms of SpA, with overall very promising clinical efficacy. The first results for novel drugs blocking key cytokines in the IL-23/IL-17 axis are promising in SpA and more novel compounds are upcoming. This will teach us more on the role of the IL-23/IL-17 axis in the pathophysiology of SpA.

  20. Pott's disease in Moroccan children: clinical features and investigation of the interleukin-12/interferon-γ pathway.

    PubMed

    El Azbaoui, S; Alaoui Mrani, N; Sabri, A; Jouhadi, Z; Ailal, F; Bousfiha, A A; Najib, J; El Hafidi, N; Deswarte, C; Schurr, E; Bustamante, J; Boisson-Dupuis, S; Casanova, J-L; Abel, L; El Baghdadi, J

    2015-12-01

    Tuberculosis spondylodiscitis (TS), or Pott's disease, an extra-pulmonary form of tuberculosis (TB), is rare and difficult to diagnose in children. Some cases of severe TB in children were recently explained by inborn errors of immunity affecting the interleukin-12/interferon-gamma (IL-12/IFN-γ) axis. To analyse clinical data on Moroccan children with TS, and to perform immunological and genetic explorations of the IL-12/IFN-γ axis. We studied nine children with TS diagnosed between 2012 and 2014. We investigated the IL-12/IFN-γ circuit by both whole-blood assays and sequencing of the coding regions of 14 core genes of this pathway. A diagnosis of TS was based on a combination of clinical, biological, histological and radiological data. QuantiFERON(®)-TB Gold In-Tube results were positive in 75% of patients. Whole-blood assays showed normal IL-12 and IFN-γ production in all but one patient, who displayed impaired decreased response to IL-12. No candidate disease-causing mutations were detected in the exonic regions of the 14 genes. TS diagnosis in children remains challenging, and is based largely on imaging. Further investigations of TS in children are required to determine the role of genetic defects in pathways that may or may not be related to the IL-12/IFN-γ axis.

  1. Enhanced Control of Pathogenic Simian Immunodeficiency Virus SIVmac239 Replication in Macaques Immunized with an Interleukin-12 Plasmid and a DNA Prime-Viral Vector Boost Vaccine Regimen ▿ §

    PubMed Central

    Winstone, Nicola; Wilson, Aaron J.; Morrow, Gavin; Boggiano, Cesar; Chiuchiolo, Maria J.; Lopez, Mary; Kemelman, Marina; Ginsberg, Arielle A.; Mullen, Karl; Coleman, John W.; Wu, Chih-Da; Narpala, Sandeep; Ouellette, Ian; Dean, Hansi J.; Lin, Feng; Sardesai, Niranjan Y.; Cassamasa, Holly; McBride, Dawn; Felber, Barbara K.; Pavlakis, George N.; Schultz, Alan; Hudgens, Michael G.; King, C. Richter; Zamb, Timothy J.; Parks, Christopher L.; McDermott, Adrian B.

    2011-01-01

    DNA priming has previously been shown to elicit augmented immune responses when administered by electroporation (EP) or codelivered with a plasmid encoding interleukin-12 (pIL-12). We hypothesized that the efficacy of a DNA prime and recombinant adenovirus 5 boost vaccination regimen (DNA/rAd5) would be improved when incorporating these vaccination strategies into the DNA priming phase, as determined by pathogenic simian immunodeficiency virus SIVmac239 challenge outcome. The whole SIVmac239 proteome was delivered in 5 separate DNA plasmids (pDNA-SIV) by EP with or without pIL-12, followed by boosting 4 months later with corresponding rAd5-SIV vaccine vectors. Remarkably, after repeated low-dose SIVmac239 mucosal challenge, we demonstrate 2.6 and 4.4 log reductions of the median SIV peak and set point viral loads in rhesus macaques (RMs) that received pDNA-SIV by EP with pIL-12 compared to the median peak and set point viral loads in mock-immunized controls (P < 0.01). In 5 out of 6 infected RMs, strong suppression of viremia was observed, with intermittent “blips” in virus replication. In 2 RMs, we could not detect the presence of SIV RNA in tissue and lymph nodes, even after 13 viral challenges. RMs immunized without pIL-12 demonstrated a typical maximum of 1.5 log reduction in virus load. There was no significant difference in the overall magnitude of SIV-specific antibodies or CD8 T-cell responses between groups; however, pDNA delivery by EP with pIL-12 induced a greater magnitude of SIV-specific CD4 T cells that produced multiple cytokines. This vaccine strategy is relevant for existing vaccine candidates entering clinical evaluation, and this model may provide insights into control of retrovirus replication. PMID:21734035

  2. 40 CFR 799.12 - Test results.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 32 2014-07-01 2014-07-01 false Test results. 799.12 Section 799.12...) IDENTIFICATION OF SPECIFIC CHEMICAL SUBSTANCE AND MIXTURE TESTING REQUIREMENTS General Provisions § 799.12 Test results. Except as set forth in specific chemical test rules in subpart B of this part, a positive or...

  3. 40 CFR 799.12 - Test results.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 32 2011-07-01 2011-07-01 false Test results. 799.12 Section 799.12...) IDENTIFICATION OF SPECIFIC CHEMICAL SUBSTANCE AND MIXTURE TESTING REQUIREMENTS General Provisions § 799.12 Test results. Except as set forth in specific chemical test rules in subpart B of this part, a positive or...

  4. Phenotypic behavior of C2C12 myoblasts upon expression of the dystrophy-related caveolin-3 P104L and TFT mutants.

    PubMed

    Fanzani, Alessandro; Stoppani, Elena; Gualandi, Laura; Giuliani, Roberta; Galbiati, Ferruccio; Rossi, Stefania; Fra, Anna; Preti, Augusto; Marchesini, Sergio

    2007-10-30

    Caveolin-3 (Cav-3) is the main scaffolding protein present in myofiber caveolae. We transfected C2C12 myoblasts with dominant negative forms of Cav-3, P104L or DeltaTFT, respectively, which cause the limb-girdle muscular dystrophy 1-C. Both these forms triggered Cav-3 loss during C2C12 cell differentiation. The P104L mutation reduced myofiber formation by impaired AKT signalling, accompanied by dramatic expression of the E3 ubiquitin ligase Atrogin. On the other hand, the DeltaTFT mutation triggered hypertrophic myotubes sustained by prolonged AKT activation, but independent of increased levels of follistatin and interleukin 4 expression. These data suggest that separated mutations within the same dystrophy-related gene may cause muscle degeneration through different mechanisms.

  5. Characterisation and stability of anthocyanins in purple-fleshed sweet potato P40.

    PubMed

    Xu, Jianteng; Su, Xiaoyu; Lim, Soyoung; Griffin, Jason; Carey, Edward; Katz, Benjamin; Tomich, John; Smith, J Scott; Wang, Weiqun

    2015-11-01

    Purple-fleshed sweet potato P40 has been shown to prevent colorectal cancer in a murine model. This study is to identify anthocyanins by using HPLC/MS-MS and assess the stability during various cooking conditions. P40 possesses a high content of anthocyanins up to 14 mg/g dry matter. Total 12 acylated anthocyanins are identified. Top three anthocyanins, e.g., cyanidin 3-caffeoyl-p-hydroxybenzoyl sophoroside-5-glucoside, peonidin 3-caffeoyl sophoroside-5-glucoside, and cyanidin 3-(6"-caffeoyl-6"-feruloylsophoroside)-5-glucoside, account for half of the anthocyanin contents. Over 80% of anthocyanins measured by acid hydrolysis were cyanidin derivatives, indicating P40 is unique when compared with other purple-fleshed sweet potatoes that usually contain more peonidin than cyanidin. Steaming, pressure cooking, microwaving, and frying but not baking significantly reduced 8-16% of total anthocyanin contents. Mono-acylated anthocyanins showed a higher resistance against heat than di- and non-acylated. Among of which, cyanidin 3-p-hydroxybenzoylsophoroside-5-glucoside exhibited the best thermal stability. The stable acylated and cyanidin-predominated anthocyanins in P40 may provide extra benefits for cancer prevention. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. Physiological and molecular effects of interleukin-18 administration on the mouse kidney.

    PubMed

    Yamanishi, Kyosuke; Mukai, Keiichiro; Hashimoto, Takuya; Ikubo, Kaoru; Nakasho, Keiji; El-Darawish, Yosif; Li, Wen; Okuzaki, Daisuke; Watanabe, Yuko; Hayakawa, Tetsu; Nojima, Hiroshi; Yamanishi, Hiromichi; Okamura, Haruki; Matsunaga, Hisato

    2018-03-07

    The cytokine interleukin-18 was originally identified as an interferon-γ-inducing proinflammatory factor; however, there is increasing evidence to suggest that it has non-immunological effects on physiological functions. We previously investigated the potential pathophysiological relationship between interleukin-18 and dyslipidemia, non-alcoholic fatty liver disease, and non-alcoholic steatohepatitis, and suggested interleukin-18 as a possible novel treatment for not only these diseases but also for cancer immunotherapy. Before clinical application, the effects of interleukin-18 on the kidney need to be determined. In the current study, we examined the kidney of interleukin-18 knockout (Il18 -/- ) mice and the effects of interleukin-18 on the kidney following intravenous administration of recombinant interleukin-18. Il18 -/- male mice were generated on the C57Bl/6 background and littermate C57Bl/6 Il18 +/+ male mice were used as controls. To assess kidney damage, serum creatinine and blood urea nitrogen levels were measured and histopathological analysis was performed. For molecular analysis, microarray and quantitative reverse transcription PCR was performed using mice 6 and 12 weeks old. To evaluate the short- and long-term effects of interleukin-18 on the kidney, recombinant interleukin-18 was administered for 2 and 12 weeks, respectively. Compared with Il18 +/+ mice, Il18 -/- mice developed kidney failure in their youth-6 weeks of age, but the condition was observed to improve as the mice aged, even though dyslipidemia, arteriosclerosis, and higher insulin resistance occurred. Analyses of potential molecular mechanisms involved in the onset of early kidney failure in Il18 -/- mice identified a number of associated genes, such as Itgam, Nov, and Ppard. Intravenous administration of recombinant interleukin-18 over both the short and long term showed no effects on the kidney despite significant improvement in metabolic diseases. Short- and long

  7. 40 CFR 190.12 - Effective date.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Effective date. 190.12 Section 190.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR NUCLEAR POWER OPERATIONS Environmental Standards for the...

  8. 40 CFR 190.12 - Effective date.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Effective date. 190.12 Section 190.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR NUCLEAR POWER OPERATIONS Environmental Standards for the...

  9. 40 CFR 190.12 - Effective date.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Effective date. 190.12 Section 190.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR NUCLEAR POWER OPERATIONS Environmental Standards for the...

  10. 40 CFR 190.12 - Effective date.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Effective date. 190.12 Section 190.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR NUCLEAR POWER OPERATIONS Environmental Standards for the...

  11. P2Y12 shRNA treatment decreases SGC activation to relieve diabetic neuropathic pain in type 2 diabetes mellitus rats.

    PubMed

    Wang, Shouyu; Wang, Zilin; Li, Lin; Zou, Lifang; Gong, Yingxin; Jia, Tianyu; Zhao, Shanhong; Yuan, Huilong; Shi, Liran; Liu, Shuangmei; Wu, Bing; Yi, Zhihua; Liu, Hui; Gao, Yun; Li, Guilin; Deussing, Jan M; Li, Man; Zhang, Chunping; Liang, Shangdong

    2018-06-26

    Diabetic neuropathic pain is a common complication of type 2 diabetes mellitus (DM). Activation of satellite glial cells (SGCs) in the dorsal root ganglia (DRG) plays a crucial role in neuropathic pain through the release of proinflammatory cytokines. The P2Y12 receptor is expressed in SGCs of the DRG. In this study, our aim was to investigate the role of the P2Y12 receptor on the pathological changes in diabetic neuropathic pain. The present study showed that diabetic neuropathic pain increased mechanical and thermal hyperalgesia in type 2 DM model rats. The results showed that the expression levels of P2Y12 messenger RNA (mRNA) and protein in DRG SGCs were increased in DM model rats compared with control rats. Glial fibrillary acidic protein (GFAP) and interleukin-1β (IL-1β) expression levels in the DRG were increased in DM rats. Upregulation of GFAP is a marker of SGC activation. Targeting the P2Y12 receptor by short hairpin RNA (shRNA) decreased the upregulated expression of P2Y12 mRNA and protein, coexpression of P2Y12 and GFAP, the expression of GFAP, IL-1β, and tumor necrosis factor-receptor 1 in the DRG of DM rats, and relieved mechanical and thermal hyperalgesia in DM rats. After treatment with the P2Y12 receptor shRNA, the enhancing integrated OPTICAL density (IOD) ratios of p-P38 MAPK to P38 mitogen activated protein kinase (MAPK) in the DM rats treated with P2Y12 shRNA were significantly lower than that in the untreated DM rats. Therefore, P2Y12 shRNA treatment decreased SGC activation to relieve mechanical and thermal hyperalgesia in DM rats. © 2018 Wiley Periodicals, Inc.

  12. SCIL-STROKE (Subcutaneous Interleukin-1 Receptor Antagonist in Ischemic Stroke): A Randomized Controlled Phase 2 Trial.

    PubMed

    Smith, Craig J; Hulme, Sharon; Vail, Andy; Heal, Calvin; Parry-Jones, Adrian R; Scarth, Sylvia; Hopkins, Karen; Hoadley, Margaret; Allan, Stuart M; Rothwell, Nancy J; Hopkins, Stephen J; Tyrrell, Pippa J

    2018-05-01

    The proinflammatory cytokine IL-1 (interleukin-1) has a deleterious role in cerebral ischemia, which is attenuated by IL-1 receptor antagonist (IL-1Ra). IL-1 induces peripheral inflammatory mediators, such as interleukin-6, which are associated with worse prognosis after ischemic stroke. We investigated whether subcutaneous IL-1Ra reduces the peripheral inflammatory response in acute ischemic stroke. SCIL-STROKE (Subcutaneous Interleukin-1 Receptor Antagonist in Ischemic Stroke) was a single-center, double-blind, randomized, placebo-controlled phase 2 trial of subcutaneous IL-1Ra (100 mg administered twice daily for 3 days) in patients presenting within 5 hours of ischemic stroke onset. Randomization was stratified for baseline National Institutes of Health Stroke Scale score and thrombolysis. Measurement of plasma interleukin-6 and other peripheral inflammatory markers was undertaken at 5 time points. The primary outcome was difference in concentration of log(interleukin-6) as area under the curve to day 3. Secondary outcomes included exploratory effect of IL-1Ra on 3-month outcome with the modified Rankin Scale. We recruited 80 patients (mean age, 72 years; median National Institutes of Health Stroke Scale, 12) of whom 73% received intravenous thrombolysis with alteplase. IL-1Ra significantly reduced plasma interleukin-6 ( P <0.001) and plasma C-reactive protein ( P <0.001). IL-1Ra was well tolerated with no safety concerns. Allocation to IL-1Ra was not associated with a favorable outcome on modified Rankin Scale: odds ratio (95% confidence interval)=0.67 (0.29-1.52), P =0.34. Exploratory mediation analysis suggested that IL-1Ra improved clinical outcome by reducing inflammation, but there was a statistically significant, alternative mechanism countering this benefit. IL-1Ra reduced plasma inflammatory markers which are known to be associated with worse clinical outcome in ischemic stroke. Subcutaneous IL-1Ra is safe and well tolerated. Further experimental

  13. 40 CFR 1400.12 - Qualified researchers.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Qualified researchers. 1400.12 Section 1400.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY AND DEPARTMENT OF JUSTICE ACCIDENTAL RELEASE PREVENTION REQUIREMENTS; RISK MANAGEMENT PROGRAMS UNDER THE CLEAN AIR ACT SECTION 112(r)(7...

  14. Periodontitis aggravated pancreatic β-cell dysfunction in diabetic mice through interleukin-12 regulation on Klotho.

    PubMed

    Liu, Yihua; Zhang, Qiuli

    2016-05-01

    Recent studies have shown that periodontitis can contribute to adipose tissue inflammation and subsequent systemic insulin resistance in the obese rat model. However, the related inflammatory mechanism is not yet clear. The present study aims to investigate the effects of periodontitis on the function of pancreatic β-cells with pro-inflammatory cytokines-related immune mechanism in a mouse model. C57BL/6-db/db and inbred C57BL/6 mice were chosen here to establish a mouse model with periodontitis, which was induced by ligatures for 8 weeks. Glucose-stimulated insulin secretion was introduced to evaluate the function of pancreatic islets and β-cells. Serum levels of pro-inflammatory cytokines and Klotho were also measured, and the correlation between immunostimulation and Klotho level was deeply investigated in vitro. Pancreatic β-cell failure, with insulin resistance, was observed in db/db mice, while periodontitis could aggravate β-cell dysfunction-related features. Serum levels of interleukin (IL)-12 and Klotho showed a negatively synergistic change, whereas the expression of Klotho was also inhibited under IL-12 treatment in MIN6 β-cells or isolated islets. Furthermore, IL-12-induced immune stimulation and also decreased insulin secretion were proven to be reversed by Klotho overexpression. Periodontitis aggravated pancreatic β-cell failure in diabetic mice. Further in vitro studies showed IL-12 regulation on Klotho, while Klotho also acted as an inhibitor on IL-12, indicating the potential of Klotho for preserving pancreatic β-cell function in diabetes.

  15. 12 CFR 40.8 - Revised privacy notices.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Revised privacy notices. 40.8 Section 40.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.8 Revised privacy notices. (a) General rule. Except as otherwise...

  16. 12 CFR 40.8 - Revised privacy notices.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Revised privacy notices. 40.8 Section 40.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.8 Revised privacy notices. (a) General rule. Except as otherwise...

  17. 12 CFR 40.8 - Revised privacy notices.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Revised privacy notices. 40.8 Section 40.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.8 Revised privacy notices. (a) General rule. Except as otherwise...

  18. 12 CFR 40.8 - Revised privacy notices.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Revised privacy notices. 40.8 Section 40.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.8 Revised privacy notices. (a) General rule. Except as otherwise...

  19. 12 CFR 40.8 - Revised privacy notices.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Revised privacy notices. 40.8 Section 40.8 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.8 Revised privacy notices. (a) General rule. Except as otherwise...

  20. 40 CFR 121.12 - Supplemental information.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 23 2012-07-01 2012-07-01 false Supplemental information. 121.12 Section 121.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS STATE CERTIFICATION OF ACTIVITIES REQUIRING A FEDERAL LICENSE OR PERMIT Determination of Effect on Other States § 121...

  1. 40 CFR 121.12 - Supplemental information.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 22 2014-07-01 2013-07-01 true Supplemental information. 121.12 Section 121.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS STATE CERTIFICATION OF ACTIVITIES REQUIRING A FEDERAL LICENSE OR PERMIT Determination of Effect on Other States § 121...

  2. 40 CFR 121.12 - Supplemental information.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 22 2011-07-01 2011-07-01 false Supplemental information. 121.12 Section 121.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS STATE CERTIFICATION OF ACTIVITIES REQUIRING A FEDERAL LICENSE OR PERMIT Determination of Effect on Other States § 121...

  3. 40 CFR 121.12 - Supplemental information.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Supplemental information. 121.12 Section 121.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS STATE CERTIFICATION OF ACTIVITIES REQUIRING A FEDERAL LICENSE OR PERMIT Determination of Effect on Other States § 121...

  4. 40 CFR 121.12 - Supplemental information.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 23 2013-07-01 2013-07-01 false Supplemental information. 121.12 Section 121.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS STATE CERTIFICATION OF ACTIVITIES REQUIRING A FEDERAL LICENSE OR PERMIT Determination of Effect on Other States § 121...

  5. Luteolin, a flavonoid, inhibits CD40 ligand expression by activated human basophils.

    PubMed

    Hirano, Toru; Arimitsu, Junsuke; Higa, Shinji; Naka, Tetsuji; Ogata, Atsushi; Shima, Yoshihito; Fujimoto, Minoru; Yamadori, Tomoki; Ohkawara, Tomoharu; Kuwabara, Yusuke; Kawai, Mari; Kawase, Ichiro; Tanaka, Toshio

    2006-01-01

    We have previously shown that flavonoids such as luteolin, apigenin and fisetin inhibit interleukin 4 and interleukin 13 production. In this study, we investigated whether luteolin can suppress CD40 ligand expression by basophils. A human basophilic cell line, KU812, was stimulated with A23187 and phorbol myristate acetate (PMA) with or without various concentrations of luteolin or other flavonoids for 12 h, and CD40 ligand expression was analyzed by FACS. The effect of luteolin on CD40 ligand mRNA expression was studied by semiquantitative reverse transcription PCR analysis. In addition, CD40 ligand expression was also measured in purified basophils that had been stimulated for 12 h with A23187 plus PMA with or without various concentrations of luteolin. CD40 ligand expression by KU812 cells was enhanced noticeably in response to A23187 and even more strikingly augmented by A23187 plus PMA. The expression was significantly suppressed by 10 or 30 microM of luteolin, whereas myricetin failed to inhibit. Reverse transcription PCR analyses demonstrated that luteolin inhibited CD40 ligand mRNA expression by stimulated KU812 cells. Of the six flavonoids examined, luteolin, apigenin, fisetin and quercetin at 30 microM showed a significant inhibitory effect on CD40 ligand expression. The incubation of purified basophils with A23187 plus PMA significantly enhanced CD40 ligand expression, and the presence of luteolin again had an inhibitory effect. Luteolin inhibits CD40 ligand expression by activated basophils.

  6. Combined Allogeneic Tumor Cell Vaccination and Systemic Interleukin 12 Prevents Mammary Carcinogenesis in HER-2/neu Transgenic Mice

    PubMed Central

    Nanni, Patrizia; Nicoletti, Giordano; De Giovanni, Carla; Landuzzi, Lorena; Di Carlo, Emma; Cavallo, Federica; Pupa, Serenella M.; Rossi, Ilaria; Colombo, Mario P.; Ricci, Cinzia; Astolfi, Annalisa; Musiani, Piero; Forni, Guido; Lollini, Pier-Luigi

    2001-01-01

    Transgenic Balb/c mice expressing the transforming rat HER-2/neu oncogene develop early and multifocal mammary carcinomas. Within the first 5 months of life the tissue-specific expression of HER-2/neu causes a progression in all their 10 mammary glands from atypical hyperplasia to invasive carcinoma. It was previously observed that chronic administration of interleukin (IL)-12 increased tumor latency, but every mouse eventually succumbed to multiple carcinomas. A significant improvement in tumor prevention was sought by administering allogeneic mammary carcinoma cells expressing HER-2/neu combined with systemic IL-12. This treatment reduced tumor incidence by 90% and more than doubled mouse lifetime. For the maximum prevention p185neu antigen must be expressed by allogeneic cells. IL-12 treatment strongly increased the cell vaccine efficacy. The mammary glands of mice receiving the combined treatment displayed a markedly reduced epithelial cell proliferation, angiogenesis, and HER-2/neu expression, while the few hyperplastic foci were heavily infiltrated by granulocytes, macrophages, and CD8+ lymphocytes. Specific anti–HER-2/neu antibodies were produced and a nonpolarized activation of CD4+ and CD8+ cells secreting IL-4 and interferon (IFN)-γ were evident. A central role for IFN-γ in the preventive effect was proven by the lack of efficacy of vaccination in IFN-γ gene knockout HER-2/neu transgenic Balb/c mice. A possible requirement for IFN-γ is related to its effect on antibody production, in particular on IgG2a and IgG2b subclasses, that were not induced in IFN-γ knockout HER-2/neu mice. In conclusion, our data show that an allogeneic HER-2/neu–expressing cell vaccine combined with IL-12 systemic treatment can prevent the onset of genetically determined tumors. PMID:11696586

  7. Association between Genetic Polymorphisms in Interleukin Genes and Recurrent Pregnancy Loss - A Systematic Review and Meta-Analysis.

    PubMed

    Zhang, Meixiang; Xu, Jiawei; Bao, Xiao; Niu, Wenbin; Wang, Linlin; Du, Linqing; Zhang, Nan; Sun, Yingpu

    2017-01-01

    Interleukins are a group of immunomodulatory proteins that mediate a variety of immune reactions in the human body. To investigate the association between interleukin gene polymorphisms and recurrent pregnancy loss (RPL), we reviewed 21 studies from MEDLINE, EMBASE, OVID SP and PubMed to evaluate RPL-related interleukin gene polymorphisms. Meta-analysis was performed on 12 of the polymorphisms, and a review included the others. Our integrated results indicated that IL-1β (-511C/T) (P = 0.02, 95% CI 0.77[0.62,0.96]), IL-6 (-634C/G) (P<0.001, 95% CI 2.91[2.01,4.22]), IL-10 (-1082G/A, -819T/C) (P = 0.01, 95% CI 0.80[0.67,0.96]; P<0.01, 95% CI 0.66[0.49,0.89]), and IL-18 (-137G/C, -105G/A) (P<0.01, 95% CI 1.69[1.24,2.31]; P = <0.01, 95% CI 1.41[1.17,1.70]) consistently associated with RPL after meta-analysis. IL-17A rs2275913 and IL-17F rs763780, IL-21 rs2055979 and rs13143866, IL-1β (-31C/T), IL-6 (-2954G/C), and IL-10 (-536A/G) were reported only once as having a significant association with RPL. The potential mechanism underlying miscarriage and these polymorphisms and future research directions are also discussed.

  8. The Role of High Dose Interleukin-2 in the Era of Targeted Therapy.

    PubMed

    Gills, Jessie; Parker, William P; Pate, Scott; Niu, Sida; Van Veldhuizen, Peter; Mirza, Moben; Holzbeierlein, Jeffery M; Lee, Eugene K

    2017-09-01

    We assessed survival outcomes following high dose interleukin-2 in a contemporary cohort of patients during the era of targeted agents. We retrospectively reviewed the records of patients with metastatic renal cell carcinoma treated with high dose interleukin-2 between July 2007 and September 2014. Clinicopathological data were abstracted and patient response to therapy was based on RECIST (Response Evaluation Criteria In Solid Tumors), version 1.1 criteria. The Kaplan-Meier method was used to estimate progression-free and overall survival in the entire cohort, the response to high dose interleukin-2 in regard to previous targeted agent therapy and the response to the targeted agent in relation to the response to high dose interleukin-2. We identified 92 patients, of whom 87 had documentation of a response to high dose interleukin-2. Median overall survival was 34.4 months from the initiation of high dose interleukin-2 therapy in the entire cohort. Patients who received targeted therapy before high dose interleukin-2 had overall survival (median 34.4 and 30.0 months, p = 0.88) and progression-free survival (median 1.5 and 1.7 months, p = 0.8) similar to those in patients who received no prior therapy, respectively. Additionally, patients with a complete or partial response to high dose interleukin-2 had similar outcomes for subsequent targeted agents compared to patients whose best response was stable or progressive disease (median overall survival 30.1 vs 25.4 months, p = 0.4). Our data demonstrate that patient responses to high dose interleukin-2 and to targeted agents before and after receiving high dose interleukin-2 are independent. As such, carefully selected patients should be offered high dose interleukin-2 for the possibility of a complete and durable response without the fear of limiting the treatment benefit of targeted agents. Copyright © 2017 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

  9. 40 CFR 610.12 - Program initiative.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Program initiative. 610.12 Section 610... RETROFIT DEVICES Test Procedures and Evaluation Criteria General Provisions § 610.12 Program initiative. A... being marketed may be inadequate, (b) At the EPA Administrator's initiative, or (c) Upon the application...

  10. 40 CFR 52.12 - Source surveillance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 3 2011-07-01 2011-07-01 false Source surveillance. 52.12 Section 52...) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.12 Source surveillance. (a) Each subpart identifies the plan provisions for source surveillance which are disapproved, and sets forth the...

  11. 40 CFR 52.12 - Source surveillance.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 3 2012-07-01 2012-07-01 false Source surveillance. 52.12 Section 52...) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.12 Source surveillance. (a) Each subpart identifies the plan provisions for source surveillance which are disapproved, and sets forth the...

  12. 40 CFR 52.12 - Source surveillance.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 3 2010-07-01 2010-07-01 false Source surveillance. 52.12 Section 52...) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.12 Source surveillance. (a) Each subpart identifies the plan provisions for source surveillance which are disapproved, and sets forth the...

  13. 40 CFR 52.12 - Source surveillance.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 3 2013-07-01 2013-07-01 false Source surveillance. 52.12 Section 52...) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.12 Source surveillance. (a) Each subpart identifies the plan provisions for source surveillance which are disapproved, and sets forth the...

  14. 40 CFR 52.12 - Source surveillance.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 3 2014-07-01 2014-07-01 false Source surveillance. 52.12 Section 52...) APPROVAL AND PROMULGATION OF IMPLEMENTATION PLANS General Provisions § 52.12 Source surveillance. (a) Each subpart identifies the plan provisions for source surveillance which are disapproved, and sets forth the...

  15. The neonatal Fc receptor (FcRn) binds independently to both sites of the IgG homodimer with identical affinity.

    PubMed

    Abdiche, Yasmina Noubia; Yeung, Yik Andy; Chaparro-Riggers, Javier; Barman, Ishita; Strop, Pavel; Chin, Sherman Michael; Pham, Amber; Bolton, Gary; McDonough, Dan; Lindquist, Kevin; Pons, Jaume; Rajpal, Arvind

    2015-01-01

    The neonatal Fc receptor (FcRn) is expressed by cells of epithelial, endothelial and myeloid lineages and performs multiple roles in adaptive immunity. Characterizing the FcRn/IgG interaction is fundamental to designing therapeutic antibodies because IgGs with moderately increased binding affinities for FcRn exhibit superior serum half-lives and efficacy. It has been hypothesized that 2 FcRn molecules bind an IgG homodimer with disparate affinities, yet their affinity constants are inconsistent across the literature. Using surface plasmon resonance biosensor assays that eliminated confounding experimental artifacts, we present data supporting an alternate hypothesis: 2 FcRn molecules saturate an IgG homodimer with identical affinities at independent sites, consistent with the symmetrical arrangement of the FcRn/Fc complex observed in the crystal structure published by Burmeister et al. in 1994. We find that human FcRn binds human IgG1 with an equilibrium dissociation constant (KD) of 760 ± 60 nM (N = 14) at 25°C and pH 5.8, and shows less than 25% variation across the other human subtypes. Human IgG1 binds cynomolgus monkey FcRn with a 2-fold higher affinity than human FcRn, and binds both mouse and rat FcRn with a 10-fold higher affinity than human FcRn. FcRn/IgG interactions from multiple species show less than a 2-fold weaker affinity at 37°C than at 25°C and appear independent of an IgG's variable region. Our in vivo data in mouse and rat models demonstrate that both affinity and avidity influence an IgG's serum half-life, which should be considered when choosing animals, especially transgenic systems, as surrogates.

  16. A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer.

    PubMed

    Shen, Huaishun; Cao, Kaiming; Wang, Xiping

    2007-10-19

    Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors.

  17. 40 CFR 65.12 - Delegation of authority.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 15 2011-07-01 2011-07-01 false Delegation of authority. 65.12 Section 65.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONSOLIDATED FEDERAL AIR RULE General Provisions § 65.12 Delegation of authority. (a) In delegating...

  18. 40 CFR 65.12 - Delegation of authority.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Delegation of authority. 65.12 Section 65.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONSOLIDATED FEDERAL AIR RULE General Provisions § 65.12 Delegation of authority. (a) In delegating...

  19. 40 CFR 600.301-12 - General applicability.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... and Later Model Year Automobiles-Labeling § 600.301-12 General applicability. (a) Unless otherwise... 40 Protection of Environment 29 2010-07-01 2010-07-01 false General applicability. 600.301-12 Section 600.301-12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY...

  20. Increased Protection against Pneumococcal Disease by Mucosal Administration of Conjugate Vaccine plus Interleukin-12

    PubMed Central

    Lynch, Joyce M.; Briles, David E.; Metzger, Dennis W.

    2003-01-01

    Streptococcus pneumoniae is a common cause of respiratory tract infections, its main entry route being the nasal mucosa. The recent development of pneumococcal polysaccharide conjugate vaccines has led to a dramatic improvement in protection against invasive disease in infants and children, but these vaccines have been found to be only 50 to 60% protective against bacterial carriage. In this study, we investigated the efficacy of intranasal (i.n.) conjugate vaccine delivery using interleukin-12 (IL-12) as a mucosal adjuvant. Immunized mice treated with IL-12 demonstrated increased expression of lung and splenic gamma interferon and IL-10 mRNAs; high levels of antibody, particularly serum immunoglobulin G2a (IgG2a) and respiratory IgA; and significantly increased opsonic activity. After intraperitoneal challenge with type 3 pneumococci, there was 75% survival of i.n. vaccinated mice compared to 0% survival of unvaccinated mice. In addition, after i.n. challenge with type 14 pneumococci, vaccinated mice possessed fewer bacterial colonies in the upper respiratory tract than unvaccinated mice. However, no significant difference in type 14 carriage was observed between vaccinated and unvaccinated groups following intramuscular vaccination, the typical route of vaccination in humans. Using mice with a genetic disruption in IgA expression, it was found that pneumococcus-specific IgA played a significant role in the clearance of bacteria from the upper respiratory tract. We conclude that i.n vaccination in the presence of IL-12 is able to enhance systemic and mucosal immune responses to pneumococci and efficiently protect against both invasive infection and bacterial carriage. PMID:12874361

  1. Regulatory T-Cell Augmentation or Interleukin-17 Inhibition Prevents Calcineurin Inhibitor-Induced Hypertension in Mice.

    PubMed

    Chiasson, Valorie L; Pakanati, Abhinandan R; Hernandez, Marcos; Young, Kristina J; Bounds, Kelsey R; Mitchell, Brett M

    2017-07-01

    The immunosuppressive calcineurin inhibitors cyclosporine A and tacrolimus alter T-cell subsets and can cause hypertension, vascular dysfunction, and renal toxicity. We and others have reported that cyclosporine A and tacrolimus decrease anti-inflammatory regulatory T cells and increase proinflammatory interleukin-17-producing T cells; therefore, we hypothesized that inhibition of these effects using noncellular therapies would prevent the hypertension, endothelial dysfunction, and renal glomerular injury induced by calcineurin inhibitor therapy. Daily treatment of mice with cyclosporine A or tacrolimus for 1 week significantly decreased CD4 + /FoxP3 + regulatory T cells in the spleen and lymph nodes, as well as induced hypertension, vascular injury and dysfunction, and glomerular mesangial expansion in mice. Daily cotreatment with all-trans retinoic acid reported to increase regulatory T cells and decrease interleukin-17-producing T cells, prevented all of the detrimental effects of cyclosporine A and tacrolimus. All-trans retinoic acid also increased regulatory T cells and prevented the hypertension, endothelial dysfunction, and glomerular injury in genetically modified mice that phenocopy calcineurin inhibitor-treated mice (FKBP12-Tie2 knockout). Treatment with an interleukin-17-neutralizing antibody also increased regulatory T-cell levels and prevented the hypertension, endothelial dysfunction, and glomerular injury in cyclosporine A-treated and tacrolimus-treated mice and FKBP12-Tie2 knockout mice, whereas an isotype control had no effect. Augmenting regulatory T cells and inhibiting interleukin-17 signaling using noncellular therapies prevents the cardiovascular and renal toxicity of calcineurin inhibitors in mice. © 2017 American Heart Association, Inc.

  2. 40 CFR 429.12 - Monitoring requirements. [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Monitoring requirements. [Reserved] 429.12 Section 429.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT... Monitoring requirements. [Reserved] ...

  3. Activated Platelets Induce Endothelial Cell Activation via an Interleukin-1β Pathway in Systemic Lupus Erythematosus.

    PubMed

    Nhek, Sokha; Clancy, Robert; Lee, Kristen A; Allen, Nicole M; Barrett, Tessa J; Marcantoni, Emanuela; Nwaukoni, Janet; Rasmussen, Sara; Rubin, Maya; Newman, Jonathan D; Buyon, Jill P; Berger, Jeffrey S

    2017-04-01

    Systemic lupus erythematosus (SLE) is associated with the premature development of cardiovascular disease. The platelet-endothelium interaction is important in the pathogenesis of cardiovascular disease. In this study, we investigated the platelet phenotype from patients with SLE and matched controls, and their effect on endothelial cells. Platelet aggregability was measured in 54 SLE subjects off antiplatelet therapy (mean age 40.1±12.8 years; 82% female; 37% white) with age- and sex-matched controls. Platelets were coincubated with human umbilical vein endothelial cells (HUVECs) and changes to gene expression assessed by an RNA array and quantitative reverse transcription polymerase chain reaction. SLE disease activity index ranged from 0 to 22 (mean 5.1±3.9). Compared with controls, patients with SLE had significantly increased monocyte and leukocyte-platelet aggregation and platelet aggregation in response to submaximal agonist stimulation. An agnostic microarray of HUVECs cocultured with SLE platelets found a platelet-mediated effect on endothelial gene pathways involved in cell activation. Sera from SLE versus control subjects significantly increased (1) activation of control platelets; (2) platelet adhesion to HUVECs; (3) platelet-induced HUVEC gene expression of interleukin-8, and intercellular adhesion molecule 1; and (4) proinflammatory gene expression in HUVECs, mediated by interleukin-1β-dependent pathway. Incubation of SLE-activated platelets with an interleukin-1β-neutralizing antibody or HUVECs pretreated with interleukin-1 receptor antibodies attenuated the platelet-mediated activation of endothelial cells. Platelet activity measurements and subsequent interleukin-1β-dependent activation of the endothelium are increased in subjects with SLE. Platelet-endothelial interactions may play a role in the pathogenesis of cardiovascular disease in patients with SLE. © 2017 American Heart Association, Inc.

  4. The interleukin-1, interleukin-2, interleukin-6 and tumour necrosis factor alpha serological levels in localised and systemic sclerosis.

    PubMed

    Alecu, M; Geleriu, L; Coman, G; Gălăţescu, L

    1998-01-01

    Serological level of interleukin-1 (IL-1), Interleukin-2 (IL-2), Interleukin-6 (IL-6) and tumour necrosis factor (TNF) alpha was investigated in 26 patients with scleroderma, divided into three lots, by the extension and the progress of the disease. Determinations were performed by ELISA in attack and in remission (after treatment with prednison). Normal values: IL-1 (0-5 pg/ml), IL-2 (0-5 pg/ml), IL-6 (5-15 pg/ml), TNF (0-16 pg/ml). Lot A. Results obtained at the first determination showed that IL-1 is elevated in 4 cases (10-15 pg/ml), IL-2 in 5 cases (10-32 pg/ml), IL-6 in 5 cases (15-42 pg/ml) and TNF in 4 cases (18-34 pg/ml). In the second determination IL-1 was increased in 1 case (8 pg/ml), IL-2 in 1 case (9 pg/ml), IL-6 in 2 cases (12 pg/ml) and TNF was normal. Lot B. In the first determination IL-1 was elevated in 5 cases (8-12 pg/ml), IL-2 in 5 cases (10-15 pg/ml), IL-6 in 7 cases (16-20 pg/ml) and TNF was raised in 3 cases (18-25 pg/ml). At the second determination IL-1 showed normal values in all the cases, IL-2 was raised in 2 cases (10 pg/ml), IL-6 in 2 cases (12.15 pg/ml), TNF in 1 case (20 pg/ml). Lot C. In the first determination there were raised values in 4 cases for IL-1 (6-8 pg/ml), 3 cases for IL-2 (10-18 pg/ml), 5 cases for IL-6 (18-20 pg/ml), 2 cases for TNF (20 pg/ml). At the second determination IL-2 was elevated in 1 case (10 pg/ml), IL-6 in 1 case (15 pg/ml). We consider that in scleroderma there is a disturbance of the investigated cytokines due to the activation and involvement of the secretory cells into the pathogenesis of the disease. The increase of the serological levels of IL-1, IL-2, IL-6 and TNF depends on the extension of the lesions and the clinical and biological activity periods of the disease. The absence of the increase of the serological levels does not exclude their activity at the lesional site.

  5. Role of interleukin-6 and pentraxin 3 as an early marker in Peyronie's disease.

    PubMed

    Atar, Arda; Kural, Alev; Yenice, Gurkan; Comez, Ilker; Tugcu, Volkan

    2017-04-01

    Inflammation is mechanistically involved in the development of Peyronie's disease (PD). The aim of this study is to assess the relevance of serum pentraxin 3 (PTX3) and interleukin-6 (IL-6) concentrations in PD. The study enrolled 40 patients with PD in the acute phase and 40 healthy controls. Plasma PTX3 and IL-6 concentrations were evaluated in 40 patients in the acute phase of PD and 40 healthy controls by enzyme-linked immunosorbent assay. Serum concentrations of both PTX3 and IL-6 were significantly higher in the PD patients than in the control group (p=0.001 and p=0.001, respectively). There was a significant correlation between concentration of PTX3 and painful erections. IL-6 concentrations were significantly higher in patients with erectile dysfunction. IL-6 and PTX3 levels showed no correlation with age, serum C-reactive protein, degree of curvature, and disease duration. IL-6 trans-signaling and PTX3 amplification at the site of inflammation could have a role in pathophysiological mechanisms of PD. Biological drugs may be used for treatment during the acute phase of the disease based on this mechanism. Copyright © 2017. Published by Elsevier Taiwan.

  6. In vivo treatment with interleukin 12 protects mice from immune abnormalities observed during murine acquired immunodeficiency syndrome (MAIDS)

    PubMed Central

    1994-01-01

    Lymphoproliferation, chronic B cell activation resulting in hypergammaglobulinemia, and profound immunodeficiency are prominent features of a retrovirus-induced syndrome designated murine acquired immunodeficiency syndrome (MAIDS). In vivo treatment of infected mice with recombinant interleukin 12 (IL-12) beginning at the time of infection or up to 9 wk after virus inoculation markedly inhibited the development of splenomegaly and lymphadenopathy, as well as B cell activation and Ig secretion. Treatment with IL-12 also had major effects in preventing induction of several immune defects including impaired production of interferon gamma (IFN-gamma) and IL-2 and depressed proliferative responses to various stimuli. The therapeutic effects of IL-12 on the immune system of mice with MAIDS were also associated with reduced expression of the retrovirus that causes this disease (BM5def), with lesser effects on expression of ecotropic MuLV. IL-12 treatment was not effective in IFN-gamma knockout mice or in infected mice treated simultaneously with IL-12 and anti-IFN-gamma. These results demonstrate that induction and progression of MAIDS are antagonized by IL-12 through high-level expression of IFN-gamma and may provide an experimental basis for developing treatments of retrovirus- induced immune disorders with similar immunopathogenic mechanisms. PMID:7964495

  7. Nanoparticle-Encapsulated Curcumin Inhibits Diabetic Neuropathic Pain Involving the P2Y12 Receptor in the Dorsal Root Ganglia

    PubMed Central

    Jia, Tianyu; Rao, Jingan; Zou, Lifang; Zhao, Shanhong; Yi, Zhihua; Wu, Bing; Li, Lin; Yuan, Huilong; Shi, Liran; Zhang, Chunping; Gao, Yun; Liu, Shuangmei; Xu, Hong; Liu, Hui; Liang, Shangdong; Li, Guilin

    2018-01-01

    Diabetic peripheral neuropathy results in diabetic neuropathic pain (DNP). Satellite glial cells (SGCs) enwrap the neuronal soma in the dorsal root ganglia (DRG). The purinergic 2 (P2) Y12 receptor is expressed on SGCs in the DRG. SGC activation plays an important role in the pathogenesis of DNP. Curcumin has anti-inflammatory and antioxidant properties. Because curcumin has poor metabolic stability in vivo and low bioavailability, nanoparticle-encapsulated curcumin was used to improve its targeting and bioavailability. In the present study, our aim was to investigate the effects of nanoparticle-encapsulated curcumin on DNP mediated by the P2Y12 receptor on SGCs in the rat DRG. Diabetic peripheral neuropathy increased the expression levels of the P2Y12 receptor on SGCs in the DRG and enhanced mechanical and thermal hyperalgesia in rats with diabetes mellitus (DM). Up-regulation of the P2Y12 receptor in SGCs in the DRG increased the production of pro-inflammatory cytokines. Up-regulation of interleukin-1β (IL-1β) and connexin43 (Cx43) resulted in mechanical and thermal hyperalgesia in rats with DM. The nanoparticle-encapsulated curcumin decreased up-regulated IL-1β and Cx43 expression and reduced levels of phosphorylated-Akt (p-Akt) in the DRG of rats with DM. The up-regulation of P2Y12 on SGCs and the up-regulation of the IL-1β and Cx43 in the DRG indicated the activation of SGCs in the DRG. The nano-curcumin treatment inhibited the activation of SGCs accompanied by its anti-inflammatory effect to decrease the up-regulated CGRP expression in the DRG neurons. Therefore, the nanoparticle-encapsulated curcumin treatment decreased the up-regulation of the P2Y12 receptor on SGCs in the DRG and decreased mechanical and thermal hyperalgesia in rats with DM. PMID:29422835

  8. 40 CFR 413.12-413.13 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true [Reserved] 413.12-413.13 Section 413.12-413.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS ELECTROPLATING POINT SOURCE CATEGORY Electroplating of Common Metals Subcategory §§ 413.12-413.13...

  9. 40 CFR 135.12 - Contents of notice.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 22 2011-07-01 2011-07-01 false Contents of notice. 135.12 Section 135.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PRIOR NOTICE OF CITIZEN SUITS Prior Notice Under the Safe Drinking Water Act § 135.12 Contents of notice. (a...

  10. 40 CFR 135.12 - Contents of notice.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Contents of notice. 135.12 Section 135.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PRIOR NOTICE OF CITIZEN SUITS Prior Notice Under the Safe Drinking Water Act § 135.12 Contents of notice. (a...

  11. 40 CFR 78.12 - Standard of review.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 17 2013-07-01 2013-07-01 false Standard of review. 78.12 Section 78.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) APPEAL PROCEDURES § 78.12 Standard of review. (a) On appeal of a decision of the Administrator prior to...

  12. 40 CFR 1700.12 - Petition requirements.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Petition requirements. 1700.12 Section... VESSELS OF THE ARMED FORCES Effect on States State Petition for Review § 1700.12 Petition requirements. A petition for review of a determination or standard must include: (a) The discharge from § 1700.4 or § 1700...

  13. Association between Genetic Polymorphisms in Interleukin Genes and Recurrent Pregnancy Loss – A Systematic Review and Meta-Analysis

    PubMed Central

    Bao, Xiao; Niu, Wenbin; Wang, Linlin; Du, Linqing; Zhang, Nan; Sun, Yingpu

    2017-01-01

    Interleukins are a group of immunomodulatory proteins that mediate a variety of immune reactions in the human body. To investigate the association between interleukin gene polymorphisms and recurrent pregnancy loss (RPL), we reviewed 21 studies from MEDLINE, EMBASE, OVID SP and PubMed to evaluate RPL-related interleukin gene polymorphisms. Meta-analysis was performed on 12 of the polymorphisms, and a review included the others. Our integrated results indicated that IL-1β (-511C/T) (P = 0.02, 95% CI 0.77[0.62,0.96]), IL-6 (-634C/G) (P<0.001, 95% CI 2.91[2.01,4.22]), IL-10 (-1082G/A, –819T/C) (P = 0.01, 95% CI 0.80[0.67,0.96]; P<0.01, 95% CI 0.66[0.49,0.89]), and IL-18 (-137G/C, -105G/A) (P<0.01, 95% CI 1.69[1.24,2.31]; P = <0.01, 95% CI 1.41[1.17,1.70]) consistently associated with RPL after meta-analysis. IL-17A rs2275913 and IL-17F rs763780, IL-21 rs2055979 and rs13143866, IL-1β (-31C/T), IL-6 (-2954G/C), and IL-10 (-536A/G) were reported only once as having a significant association with RPL. The potential mechanism underlying miscarriage and these polymorphisms and future research directions are also discussed. PMID:28103273

  14. Transgenic tomato expressing interleukin-12 has a therapeutic effect in a murine model of progressive pulmonary tuberculosis

    PubMed Central

    Elías-López, A L; Marquina, B; Gutiérrez-Ortega, A; Aguilar, D; Gomez-Lim, M; Hernández-Pando, R

    2008-01-01

    Host control of mycobacterial infection, in both human and mouse models, has been shown to be associated with the production of interferon (IFN)-γ by CD4+ T cells. Interleukin (IL)-12 is known to be a crucial cytokine in the differentiation of IFN-γ-producing T helper 1 (Th1) cells. To determine whether continuous administration of IL-12 expressed in transgenic tomato (TT–IL-12) has therapeutic efficacy in a murine model of pulmonary tuberculosis, BALB/c mice were infected with either Mycobacterium tuberculosis H37Rv strain or a multi-drug-resistant clinical isolate (MDR) and treated with a daily oral dose of TT-IL12 crude fruit extracts. For the early H37Rv infection, TT–IL-12 administration was started 1 day before infection and continued for 60 days. In the H37Rv or MDR late infection, treatment was started 60 days after infection and continued for another 60 days. In both phases of infection, TT–IL-12 administration resulted in a reduction of bacterial loads and tissue damage compared with wild-type tomato (non-TT). The Th1 response was increased and the Th2 response was reduced. In the late infection, a long-term treatment with TT–IL-12 was necessary. We demonstrate that TT–IL-12 increases resistance to infection and reduces lung tissue damage during early and late drug-sensitive and drug-resistant mycobacterial infection. PMID:18727633

  15. Phase 2 study of pegylated liposomal doxorubicin in combination with interleukin-12 for AIDS-related Kaposi sarcoma

    PubMed Central

    Little, Richard F.; Aleman, Karen; Kumar, Pallavi; Wyvill, Kathleen M.; Pluda, James M.; Read-Connole, Elizabeth; Wang, Victoria; Pittaluga, Stefania; Catanzaro, Andrew T.; Steinberg, Seth M.

    2007-01-01

    Thirty-six patients with AIDS-associated Kaposi sarcoma (KS) requiring chemotherapy were treated for six 3-week cycles of pegylated liposomal doxorubicin (20 mg/m2) plus interleukin-12 (IL-12; 300 ng/kg subcutaneously twice weekly), followed by 500 ng/kg subcutaneous IL-12 twice weekly for up to 3 years. All received highly active antiretroviral therapy (HAART). Twenty-two had poor-prognosis KS (T1S1). Thirty patients had a major response, including 9 with complete response, yielding an 83.3% major response rate (95% confidence interval: 67.2%-93.6%). Median time to first response was 2 cycles. Median progression was not reached at median potential follow-up of 46.9 months. Of 27 patients with residual disease when starting maintenance IL-12, 15 had a new major response compared with this new baseline. The regimen was overall well tolerated; principal toxicities were neutropenia, anemia, transaminitis, and neuropsychiatric toxicity. Patients had increases in serum IL-12, interferon gamma, and inducible protein-10 (IP-10), and these remained increased at weeks 18 and 34. The regimen of IL-12 plus liposomal doxorubicin yielded rapid tumor responses and a high response rate in patients with AIDS-KS receiving HAART, and responses were sustained on IL-12 maintenance therapy. A randomized trial of IL-12 in this setting may be warranted. This study is registered at http://www.clinicaltrials.gov as no. NCT00020449. PMID:17846226

  16. Interleukin-12 Inhibits Tumor Growth in a Novel Angiogenesis Canine Hemangiosarcoma Xenograft Model1

    PubMed Central

    Dickerson, Erin B; Steinberg, Howard; Breen, Matthew; Auerbach, Robert; Helfand, Stuart C

    2004-01-01

    Abstract We established a canine hemangiosarcoma cell line derived from malignant endothelial cells comprising a spontaneous tumor in a dog to provide a renewable source of endothelial cells for studies of angiogenesis in malignancy. Pieces of the hemangiosarcoma biopsy were engrafted subcutaneously in a bg/nu/XID mouse allowing the tumor cells to expand in vivo. A cell line, SB-HSA, was derived from the xenograft. SB-HSA cells expressed vascular endothelial growth factor (VEGF) receptors 1 and 2, CD31, CD146, and αvβ3 integrin, and produced several growth factors and cytokines, including VEGF, basic fibroblast growth factor, and interleukin (IL)-8 that are stimulatory to endothelial cell growth. These results indicated that the cells recapitulated features of mitotically activated endothelia. In vivo, SB-HSA cells stimulated robust angiogenic responses in mice and formed tumor masses composed of aberrant vascular channels in immunocompromised mice providing novel opportunities for investigating the effectiveness of antiangiogenic agents. Using this model, we determined that IL-12, a cytokine with both immunostimulatory and antiangiogenic effects, suppressed angiogenesis induced by, and tumor growth of, SB-HSA cells. The endothelial cell model we have described offers unique opportunities to pursue further investigations with IL-12, as well as other antiangiogenic approaches in cancer therapy. PMID:15140399

  17. 40 CFR 799.12 - Test results.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 31 2010-07-01 2010-07-01 true Test results. 799.12 Section 799.12... results. Except as set forth in specific chemical test rules in subpart B of this part, a positive or negative test result in any of the tests required under subpart B is defined in the TSCA test guidelines...

  18. 40 CFR 799.12 - Test results.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 33 2013-07-01 2013-07-01 false Test results. 799.12 Section 799.12... results. Except as set forth in specific chemical test rules in subpart B of this part, a positive or negative test result in any of the tests required under subpart B is defined in the TSCA test guidelines...

  19. 40 CFR 799.12 - Test results.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 33 2012-07-01 2012-07-01 false Test results. 799.12 Section 799.12... results. Except as set forth in specific chemical test rules in subpart B of this part, a positive or negative test result in any of the tests required under subpart B is defined in the TSCA test guidelines...

  20. Nomenclature for secreted regulatory proteins of the immune system (interleukins). WHO-IUIS Nomenclature Subcommittee on Interleukin Designation.

    PubMed Central

    1991-01-01

    The recommended procedures and criteria for interleukin designations are described. The officially adopted designations are, in sequence, from interleukin-1 to interleukin-10, including interleukin-1 alpha and interleukin-1 beta. PMID:1934243

  1. Interleukin-10 -1082 gene polymorphism and susceptibility to cervical cancer among Japanese women.

    PubMed

    Matsumoto, Koji; Oki, Akinori; Satoh, Toyomi; Okada, Satoshi; Minaguchi, Takeo; Onuki, Mamiko; Ochi, Hiroyuki; Nakao, Sari; Sakurai, Manabu; Abe, Azusa; Hamada, Hiromi; Yoshikawa, Hiroyuki

    2010-11-01

    Polymorphisms in cytokine genes can influence immune responses to human papillomavirus infection, possibly modifying risks of cervical cancer. Using an amplification refractory mutation system-polymerase chain reaction method, we analyzed a single nucleotide polymorphism (A/G) at position -1082 in interleukin-10 promoter region in 440 Japanese women: 173 women with normal cytology, 163 women with cervical intraepithelial neoplasia and 104 women with invasive cervical cancer. The carrier frequency of interleukin-10 -1082 G alleles associated with higher interleukin-10 production increased with disease severity: 9.8% for normal cytology; 19.6% for cervical intraepithelial neoplasia; 29.8% for invasive cervical cancer (P for trend < 0.001). Among cytologically normal women, human papillomavirus infections were more common in those who were positive for an interleukin-10 -1082 G allele (P = 0.04). In conclusion, our data suggest that interleukin-10 -1082 gene polymorphism may serve as a marker of genetic susceptibility to cervical cancer among Japanese women.

  2. The accuracy of serum interleukin-6 and tumour necrosis factor as markers for ovarian torsion.

    PubMed

    Cohen, S B; Wattiez, A; Stockheim, D; Seidman, D S; Lidor, A L; Mashiach, S; Goldenberg, M

    2001-10-01

    The aim of this study was to investigate a possible role for interleukin-6 (IL-6) and tumour necrosis factor (TNF-alpha) as pre-operative markers for the diagnosis of ovarian torsion. Twenty consecutive patients admitted to the gynaecological emergency room with suspected clinical diagnosis of ovarian torsion were prospectively assigned to the study. Blood samples were drawn pre-operatively and examined for serum concentrations of IL-6 and TNF-alpha. Surgeons were blinded to laboratory results prior to laparoscopy. The pre-operative diagnosis of ovarian torsion was confirmed during an urgent diagnostic laparoscopy in 8 (40%) patients. The surgical diagnosis among the remaining 12 patients was a large ovarian cyst not in torsion. In six out of eight (75.0%) patients with ovarian torsion serum IL-6 concentrations were elevated. None of the 12 patients without torsion had elevated serum IL-6 concentrations. This difference was statistically significant (P < 0.001). There was no significant difference in the proportion of women with elevated serum TNF-alpha concentrations, two of eight (25.0%) patients with torsion and four of 12 (33.3%) control cases. Elevated serum IL-6 concentrations, but not serum TNF-alpha concentrations, were significantly associated with the occurrence of ovarian torsion. In patients with vague clinical signs of ovarian torsion, serum IL-6 might help to distinguish which patients should undergo diagnostic laparoscopy.

  3. Interleukin-12 Therapy Reduces the Number of Immune Cells and Pathology in Lungs of Mice Infected with Mycobacterium tuberculosis

    PubMed Central

    Nolt, Dawn; Flynn, JoAnne L.

    2004-01-01

    Alternate modalities for the treatment of Mycobacterium tuberculosis are needed due to the rise in numbers of immunosuppressed individuals at risk for serious disease and the increasing prevalence of multidrug-resistant isolates. Interleukin-12 (IL-12) has been shown to improve immune responses against M. tuberculosis infection in both humans and mice. Previous studies using high-dose IL-12 in various disease models reported a paradoxical immunosuppression. We demonstrate here that exogenous administration of IL-12 for 8 weeks after an aerosolized low dose of M. tuberculosis results in increased survival and decreased pulmonary bacterial loads for CD4-T-cell-deficient mice, most likely due to an early increase in gamma interferon. IL-12 treatment did not impair or enhance the ability of the wild-type mice to control infection, as measured by bacterial numbers. Two novel findings are reported here regarding exogenous IL-12 therapy for M. tuberculosis infections: (i) IL-12 treatment resulted in decreased numbers of immune cells and reduced frequencies of lymphocytes (CD8+, CD4+, and NK cells) in the lungs of infected mice and (ii) IL-12 therapy reduced the pathology of M. tuberculosis-infected lungs, as granulomas were smaller and less numerous. These studies support an immunoregulatory role for IL-12 in tuberculosis. PMID:15102810

  4. Interleukins 12 and 15 induce cytotoxicity and early NK-cell differentiation in type 3 innate lymphoid cells.

    PubMed

    Raykova, Ana; Carrega, Paolo; Lehmann, Frank M; Ivanek, Robert; Landtwing, Vanessa; Quast, Isaak; Lünemann, Jan D; Finke, Daniela; Ferlazzo, Guido; Chijioke, Obinna; Münz, Christian

    2017-12-26

    Type 3 innate lymphoid cells (ILC3s) fulfill protective functions at mucosal surfaces via cytokine production. Although their plasticity to become ILC1s, the innate counterparts of type 1 helper T cells, has been described previously, we report that they can differentiate into cytotoxic lymphocytes with many characteristics of early differentiated natural killer (NK) cells. This transition is promoted by the proinflammatory cytokines interleukin 12 (IL-12) and IL-15, and correlates with expression of the master transcription factor of cytotoxicity, eomesodermin (Eomes). As revealed by transcriptome analysis and flow cytometric profiling, differentiated ILC3s express CD94, NKG2A, NKG2C, CD56, and CD16 among other NK-cell receptors, and possess all components of the cytotoxic machinery. These characteristics allow them to recognize and kill leukemic cells with perforin and granzymes. Therefore, ILC3s can be harnessed for cytotoxic responses via differentiation under the influence of proinflammatory cytokines.

  5. Proton-bound dimers of nitrogen heterocyclic molecules: Substituent effects on the structures and binding energies of homodimers of diazine, triazine, and fluoropyridine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Attah, Isaac K.; Platt, Sean P.; Meot-Ner, Michael

    2014-03-21

    The bonding energies of proton-bound homodimers BH{sup +}B were measured by ion mobility equilibrium studies and calculated at the DFT B3LYP/6-311++G{sup **} level, for a series of nitrogen heterocyclic molecules (B) with electron-withdrawing in-ring N and on-ring F substituents. The binding energies (ΔH°{sub dissoc}) of the proton-bound dimers (BH{sup +}B) vary significantly, from 29.7 to 18.1 kcal/mol, decreasing linearly with decreasing the proton affinity of the monomer (B). This trend differs significantly from the constant binding energies of most homodimers of other organic nitrogen and oxygen bases. The experimentally measured ΔH°{sub dissoc} for (1,3-diazine){sub 2}H{sup +}, i.e., (pyrimidine){sub 2}H{sup +}more » and (3-F-pyridine){sub 2}H{sup +} are 22.7 and 23.0 kcal/mol, respectively. The measured ΔH°{sub dissoc} for the pyrimidine{sup ·+}(3-F-pyridine) radical cation dimer (19.2 kcal/mol) is signifcantly lower than that of the proton-bound homodimers of pyrimidine and 3-F-pyridine, reflecting the stronger interaction in the ionic H-bond of the protonated dimers. The calculated binding energies for (1,2-diazine){sub 2}H{sup +}, (pyridine){sub 2}H{sup +}, (2-F-pyridine){sub 2}H{sup +}, (3-F-pyridine){sub 2}H{sup +}, (2,6-di-F-pyridine){sub 2}H{sup +}, (4-F-pyridine){sub 2}H{sup +}, (1,3-diazine){sub 2}H{sup +}, (1,4-diazine){sub 2}H{sup +}, (1,3,5-triazine){sub 2}H{sup +}, and (pentafluoropyridine){sub 2}H{sup +} are 29.7, 24.9, 24.8, 23.3, 23.2, 23.0, 22.4, 21.9, 19.3, and 18.1 kcal/mol, respectively. The electron-withdrawing substituents form internal dipoles whose electrostatic interactions contribute to both the decreased proton affinities of (B) and the decreased binding energies of the protonated dimers BH{sup +}B. The bonding energies also vary with rotation about the hydrogen bond, and they decrease in rotamers where the internal dipoles of the components are aligned efficiently for inter-ring repulsion. For compounds substituted at the

  6. The interleukins of fish.

    PubMed

    Secombes, C J; Wang, T; Bird, S

    2011-12-01

    Interleukins are a subgroup of cytokines, molecules involved in the intercellular regulation of the immune system. The term interleukin was first coined in 1979 to refer to molecules that signal between different leucocyte types, although not exclusively restricted to leucocyte communication. Whilst it is now known that interleukins are produced by a wide variety of cell types, nevertheless many are synthesised by CD4(+) T helper cells, macrophages/monocytes and endothelial cells. The nomenclature is relatively straightforward, with interleukin 1 the first discovered and interleukin 2 the second, etc. However, whilst 35 interleukins are currently described in mammals, several are in fact terms referring to subfamilies of more molecules, as with the IL-1 family where 11 members (IL-1F1-IL-1F11) are present, and the IL-17 family where 6 members (IL-17A-IL-17F) are present. So the total is much higher and splice variants and allelic variation increase this diversity further. This review will focus on what is known about interleukins in fish, and will refer to the major subfamilies rather than try to work through 35 descriptions in a row. It is clear that many direct homologues of molecules known in mammals are present in fish, but that not all are present and some novel interleukins exist that may have arisen from fish specific gene duplication events. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santhanam, U.; Ray, A.; Sehgal, P.B.

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

  8. Agonist and antagonist effects of diadenosine tetraphosphate, a platelet dense granule constituent, on platelet P2Y1, P2Y12 and P2X1 receptors.

    PubMed

    Chang, Hung; Yanachkov, Ivan B; Michelson, Alan D; Li, YouFu; Barnard, M R; Wright, George E; Frelinger, Andrew L

    2010-02-01

    Diadenosine 5',5'''-P(1),P(4)- tetraphosphate (Ap(4)A) is stored in platelet dense granules, but its effects on platelet function are not well understood. We examined the effects of Ap(4)A on platelet purinergic receptors P2Y(1), P2Y(12) and P2X(1). Flow cytometry was used to measure the effects of Ap(4)A in the presence or absence of ADP on: a) P2Y(12)-mediated decrease in intraplatelet phosphorylated vasodilator stimulated phosphoprotein (VASP), b) P2Y(1)-mediated increase in platelet cytosolic Ca(2+), and c) P2X(1)-mediated intraplatelet entry of extracellular Ca(2+). ADP-stimulated platelet shape change (P2Y(1)-mediated) and aggregation (P2Y(1)- and P2Y(12)-mediated) were measured optically. Ap(4)A inhibited 3 microM ADP-induced: a) platelet aggregation (IC(50) 9.8+/-2.8 microM), b) P2Y(1)-mediated shape change, c) P2Y(1)-mediated increase in platelet cytosolic Ca(2+) (IC(50) 40.8+/-12.3 microM), and d) P2Y(12)-mediated decrease in VASP phosphorylation (IC(50)>250 microM). In the absence of added ADP, Ap(4)A had agonist effects on platelet P2X(1) and P2Y(12), but not P2Y(1), receptors. Ap(4)A, a constituent of platelet dense granules, is a) an antagonist of platelet P2Y(1) and P2Y(12) receptors, where it inhibits the effects of ADP, and b) an agonist of platelet P2X(1) and P2Y(12) receptors. Copyright 2009 Elsevier Ltd. All rights reserved.

  9. Agonist and Antagonist Effects of Diadenosine Tetraphosphate, a Platelet Dense Granule Constituent, on Platelet P2Y1, P2Y12 and P2X1 Receptors

    PubMed Central

    Chang, Hung; Yanachkov, Ivan B.; Michelson, Alan D.; Li, YouFu; Barnard, M.R.; Wright, George E.; Frelinger, Andrew L.

    2010-01-01

    Introduction Diadenosine 5',5"'-P1,P4-tetraphosphate (Ap4A) is stored in platelet dense granules, but its effects on platelet function are not well understood. Methods and Results We examined the effects of Ap4A on platelet purinergic receptors P2Y1, P2Y12 and P2X1. Flow cytometry was used to measure the effects of Ap4A in the presence or absence of ADP on: a) P2Y12-mediated decrease in intraplatelet phosphorylated vasodilator stimulated phosphoprotein (VASP), b) P2Y1-mediated increase in platelet cytosolic Ca2+, and c) P2X1-mediated intraplatelet entry of extracellular Ca2+. ADP-stimulated platelet shape change (P2Y1-mediated) and aggregation (P2Y1- and P2Y12-mediated) were measured optically. Ap4A inhibited 3 µM ADP-induced: a) platelet aggregation (IC50 9.8 ± 2.8 µM), b) P2Y1-mediated shape change, c) P2Y1-mediated increase in platelet cytosolic Ca2+ (IC50 40.8 ± 12.3 µM), and d) P2Y12-mediated decrease in VASP phosphorylation (IC50 >250 µM). In the absence of added ADP, Ap4A had agonist effects on platelet P2X1 and P2Y12, but not P2Y1, receptors. Conclusion Ap4A, a constituent of platelet dense granules, is a) an antagonist of platelet P2Y1 and P2Y12 receptors, where it inhibits the effects of ADP, and b) an agonist of platelet P2X1 and P2Y12 receptors. PMID:19945153

  10. 40 CFR 1601.12 - Public reading room.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 34 2013-07-01 2013-07-01 false Public reading room. 1601.12 Section 1601.12 Protection of Environment CHEMICAL SAFETY AND HAZARD INVESTIGATION BOARD PROCEDURES FOR DISCLOSURE OF RECORDS UNDER THE FREEDOM OF INFORMATION ACT Administration § 1601.12 Public reading room. (a) The CSB maintains a public reading room that...

  11. 40 CFR 1601.12 - Public reading room.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 33 2011-07-01 2011-07-01 false Public reading room. 1601.12 Section 1601.12 Protection of Environment CHEMICAL SAFETY AND HAZARD INVESTIGATION BOARD PROCEDURES FOR DISCLOSURE OF RECORDS UNDER THE FREEDOM OF INFORMATION ACT Administration § 1601.12 Public reading room. (a) The CSB maintains a public reading room that...

  12. 40 CFR 1601.12 - Public reading room.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Public reading room. 1601.12 Section 1601.12 Protection of Environment CHEMICAL SAFETY AND HAZARD INVESTIGATION BOARD PROCEDURES FOR DISCLOSURE OF RECORDS UNDER THE FREEDOM OF INFORMATION ACT Administration § 1601.12 Public reading room. (a) The CSB maintains a public reading room that...

  13. 40 CFR 1601.12 - Public reading room.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 33 2014-07-01 2014-07-01 false Public reading room. 1601.12 Section 1601.12 Protection of Environment CHEMICAL SAFETY AND HAZARD INVESTIGATION BOARD PROCEDURES FOR DISCLOSURE OF RECORDS UNDER THE FREEDOM OF INFORMATION ACT Administration § 1601.12 Public reading room. (a) The CSB maintains a public reading room that...

  14. 40 CFR 1601.12 - Public reading room.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 34 2012-07-01 2012-07-01 false Public reading room. 1601.12 Section 1601.12 Protection of Environment CHEMICAL SAFETY AND HAZARD INVESTIGATION BOARD PROCEDURES FOR DISCLOSURE OF RECORDS UNDER THE FREEDOM OF INFORMATION ACT Administration § 1601.12 Public reading room. (a) The CSB maintains a public reading room that...

  15. 40 CFR 86.884-12 - Test run.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 20 2012-07-01 2012-07-01 false Test run. 86.884-12 Section 86.884-12... Heavy-Duty Engines; Smoke Exhaust Test Procedure § 86.884-12 Test run. (a) The temperature of the air... steps shall be taken for each test: (1) Start cooling system; (2) Warm up the engine by the procedure...

  16. Increased neuronal beta-amyloid precursor protein expression in human temporal lobe epilepsy: association with interleukin-1 alpha immunoreactivity.

    PubMed

    Sheng, J G; Boop, F A; Mrak, R E; Griffin, W S

    1994-11-01

    Levels of immunoreactive beta-amyloid precursor protein and interleukin-1 alpha were found to be elevated in surgically resected human temporal lobe tissue from patients with intractable epilepsy compared with postmortem tissue from neurologically unaffected patients (controls). In tissue from epileptics, the levels of the 135-kDa beta-amyloid precursor protein isoform were elevated to fourfold (p < 0.05) those of controls and those of the 130-kDa isoform to threefold (p < 0.05), whereas those of the 120-kDa isoform (p > 0.05) were not different from control values. beta-Amyloid precursor protein-immunoreactive neurons were 16 times more numerous, and their cytoplasm and proximal processes were more intensely immunoreactive in tissue sections from epileptics than controls (133 +/- 12 vs. 8 +/- 3/mm2; p < 0.001). However, neither beta-amyloid precursor protein-immunoreactive dystrophic neurites nor beta-amyloid deposits were found in this tissue. Interleukin-1 alpha-immunoreactive cells (microglia) were three times more numerous in epileptics than in controls (80 +/- 8 vs. 25 +/- 5/mm2; p < 0.001), and these cells were often found adjacent to beta-amyloid precursor protein-immunoreactive neuronal cell bodies. Our findings, together with functions established in vitro for interleukin-1, suggest that increased expression of this protein contributes to the increased levels of beta-amyloid precursor protein in epileptics, thus indicating a potential role for both of these proteins in the neuronal dysfunctions, e.g., hyperexcitability, characteristic of epilepsy.

  17. Dimerization of nitrophorin 4 at low pH and comparison to the K1A mutant of nitrophorin 1.

    PubMed

    Berry, Robert E; Yang, Fei; Shokhireva, Tatiana K; Amoia, Angela M; Garrett, Sarah A; Goren, Allena M; Korte, Stephanie R; Zhang, Hongjun; Weichsel, Andrzej; Montfort, William R; Walker, F Ann

    2015-01-20

    Nitrophorin 4, one of the four NO-carrying heme proteins from the salivary glands of Rhodnius prolixus, forms a homodimer at pH 5.0 with a Kd of ∼8 μM. This dimer begins to dissociate at pH 5.5 and is completely dissociated to monomer at pH 7.3, even at 3.7 mM. The dimer is significantly stabilized by binding NO to the heme and at pH 7.3 would require dilution to well below 0.2 mM to completely dissociate the NP4-NO homodimer. The primary techniques used for investigating the homodimer and the monomer-dimer equilibrium were size-exclusion fast protein liquid chromatography at pH 5.0 and (1)H{(15)N} heteronuclear single-quantum coherence spectroscopy as a function of pH and concentration. Preparation of site-directed mutants of NP4 (A1K, D30A, D30N, V36A/D129A/L130A, K38A, R39A, K125A, K125E, D132A, L133V, and K38Q/R39Q/K125Q) showed that the N-terminus, D30, D129, D132, at least one heme propionate, and, by association, likely also E32 and D35 are involved in the dimerization. The "closed loop" form of the A-B and G-H flexible loops of monomeric NP4, which predominates in crystal structures of the monomeric protein reported at pH 5.6 but not at pH 7.5 and which involves all of the residues listed above except D132, is required for dimer formation. Wild-type NP1 does not form a homodimer, but NP1(K1A) and native N-terminal NP1 form dimers in the presence of NO. The homodimer of NP1, however, is considerably less stable than that of NP4 in the absence of NO. This suggests that additional aspartate or glutamate residues present in the C-terminal region of NP4, but not NP1, are also involved in stabilizing the dimer.

  18. Dimerization of Nitrophorin 4 at Low pH and Comparison to the K1A Mutant of Nitrophorin 1

    PubMed Central

    2015-01-01

    Nitrophorin 4, one of the four NO-carrying heme proteins from the salivary glands of Rhodnius prolixus, forms a homodimer at pH 5.0 with a Kd of ∼8 μM. This dimer begins to dissociate at pH 5.5 and is completely dissociated to monomer at pH 7.3, even at 3.7 mM. The dimer is significantly stabilized by binding NO to the heme and at pH 7.3 would require dilution to well below 0.2 mM to completely dissociate the NP4-NO homodimer. The primary techniques used for investigating the homodimer and the monomer–dimer equilibrium were size-exclusion fast protein liquid chromatography at pH 5.0 and 1H{15N} heteronuclear single-quantum coherence spectroscopy as a function of pH and concentration. Preparation of site-directed mutants of NP4 (A1K, D30A, D30N, V36A/D129A/L130A, K38A, R39A, K125A, K125E, D132A, L133V, and K38Q/R39Q/K125Q) showed that the N-terminus, D30, D129, D132, at least one heme propionate, and, by association, likely also E32 and D35 are involved in the dimerization. The “closed loop” form of the A–B and G–H flexible loops of monomeric NP4, which predominates in crystal structures of the monomeric protein reported at pH 5.6 but not at pH 7.5 and which involves all of the residues listed above except D132, is required for dimer formation. Wild-type NP1 does not form a homodimer, but NP1(K1A) and native N-terminal NP1 form dimers in the presence of NO. The homodimer of NP1, however, is considerably less stable than that of NP4 in the absence of NO. This suggests that additional aspartate or glutamate residues present in the C-terminal region of NP4, but not NP1, are also involved in stabilizing the dimer. PMID:25489673

  19. Dimerization of Nitrophorin 4 at Low pH and Comparison to the K1A Mutant of Nitrophorin 1

    DOE PAGES

    Berry, Robert E.; Yang, Fei; Shokhireva, Tatiana K.; ...

    2014-12-09

    Nitrophorin 4, one of the four NO-carrying heme proteins from the salivary glands of Rhodnius prolixus, forms a homodimer at pH 5.0 with a K d of ~8 μM. This dimer begins to dissociate at pH 5.5 and is completely dissociated to monomer at pH 7.3, even at 3.7 mM. The dimer is significantly stabilized by binding NO to the heme and at pH 7.3 would require dilution to well below 0.2 mM to completely dissociate the NP4-NO homodimer. The primary techniques used for investigating the homodimer and the monomer–dimer equilibrium were size-exclusion fast protein liquid chromatography at pH 5.0more » and 1H{ 15N} heteronuclear single-quantum coherence spectroscopy as a function of pH and concentration. Preparation of site-directed mutants of NP4 (A1K, D30A, D30N, V36A/D129A/L130A, K38A, R39A, K125A, K125E, D132A, L133V, and K38Q/R39Q/K125Q) showed that the N-terminus, D30, D129, D132, at least one heme propionate, and, by association, likely also E32 and D35 are involved in the dimerization. The “closed loop” form of the A–B and G–H flexible loops of monomeric NP4, which predominates in crystal structures of the monomeric protein reported at pH 5.6 but not at pH 7.5 and which involves all of the residues listed above except D132, is required for dimer formation. Wild-type NP1 does not form a homodimer, but NP1(K1A) and native N-terminal NP1 form dimers in the presence of NO. Lastly, the homodimer of NP1, however, is considerably less stable than that of NP4 in the absence of NO. This suggests that additional aspartate or glutamate residues present in the C-terminal region of NP4, but not NP1, are also involved in stabilizing the dimer.« less

  20. Bleomycin/interleukin-12 electrochemogene therapy for treating naturally occurring spontaneous neoplasms in dogs.

    PubMed

    Reed, S D; Fulmer, A; Buckholz, J; Zhang, B; Cutrera, J; Shiomitsu, K; Li, S

    2010-07-01

    On the basis of superior outcomes from electrochemogene therapy (ECGT) compared with electrochemotherapy in mice, we determined the efficacy of ECGT applied to spontaneous canine neoplasms. Intralesional bleomycin and feline interleukin-12 DNA (fIL-12 DNA) injection combined with translesional electroporation resulted in complete cure of two recurrent World Health Organization stage T(2b)N(0)M(0) oral squamous cell carcinomas (SCCs) and one T(2)N(0)M(0) acanthomatous ameloblastoma. Three remaining dogs, which had no other treatment options, had partial responses to ECGT; one had mandibular T(3b)N(2b)M(1) melanoma with pulmonary and lymph node metastases; one had cubital T(3)N(0)M(1) histiocytic sarcoma with spleen metastases; and one had soft palate T(3)N(0)M(0) fibrosarcoma. The melanoma dog had decrease in size of the primary tumor before recrudescence and euthanasia. The histiocytic sarcoma dog had resolution of the primary tumor, but was euthanized because of metastases 4 months after the only treatment. The dog with T(3)N(0)M(0) fibrosarcoma had tumor regression with recrudescence. Treatment was associated with minimal side effects and was easy to perform. It was associated with repair of bone lysis in cured dogs, it improved quality of life of dogs with partial responses and extended overall survival time. ECGT seems to be a safe and resulted in complete responses in SCC and acanthomatous ameloblastoma.

  1. 40 CFR 415.12-415.13 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true [Reserved] 415.12-415.13 Section 415.12-415.13 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS INORGANIC CHEMICALS MANUFACTURING POINT SOURCE CATEGORY Aluminum Chloride Production Subcategory...

  2. p40 (ΔNp63) expression in breast disease and its correlation with p63 immunohistochemistry

    PubMed Central

    Kim, Sang Kyum; Jung, Woo Hee; Koo, Ja Seung

    2014-01-01

    p63 protein is widely used to identify myoepithelial cells in breast disease. There have been no comparative studies of the p63 antibodies which detect different isoforms. In this study, we examine the expression profiles of p63 protein in benign proliferative diseases and malignant tumors of the breast using pan-p63 and p40 antibodies, and analyze their diagnostic utility and clinical implications. We selected 32 adenoses, 34 intraductal papillomas, 31 ductal carcinoma in situ (DCIS), 257 invasive ductal carcinoma (IDC), and 36 metaplastic carcinomas, and created tissue microarray blocks from them. Immunohistochemical assays for p63 protein were performed on these samples. We investigated the expression patterns of the pan-p63 (TP63, 4A4, Dako, 1:700), p40 antibody [5-17, CalBiochem/EMD Biosciences, 1:2000, p40 (CB)], and p40 antibody [polyclonal, Diagnostic BioSystems, 1:100, p40 (DB)] in various forms of breast disease. We determined that p63 and p40 (DB) expression in myoepithelial cells was broadly similar and showed cognate clinicopathologic features, unlike p40 (CB). p40 (CB) was more sensitive (99.0%) but less specific (85.8%), and p63 was less sensitive (93.8%) in adenosis, IP, and DCIS. In IDCs, p63 and p40 (DB) had similar expression in cancer cells; p40 (CB) expression, however, was statistically different. In metaplastic carcinomas, both p63 and p40 (DB) had distinct expression profiles, according to their histologic subtypes. We conclude that p40 antibodies as well as pan-p63 antibody are specific and sensitive myoepithelial cell markers. Interpretation of p40 positivity in cancer cells, however, should be considered carefully, due to their relatively lower specificity. PMID:24696720

  3. 12 CFR 343.40 - What you must disclose.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 5 2012-01-01 2012-01-01 false What you must disclose. 343.40 Section 343.40 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY CONSUMER PROTECTION IN SALES OF INSURANCE § 343.40 What you must disclose. (a) Insurance disclosures. In...

  4. Enteroaggregative Escherichia coli flagellin-induced interleukin-8 secretion requires Toll-like receptor 5-dependent p38 MAP kinase activation

    PubMed Central

    Khan, Mohammed A S; Kang, Jian; Steiner, Theodore S

    2004-01-01

    Enteroaggregative Escherichia coli (EAEC) is an emerging enteric pathogen that causes acute and chronic diarrhoea in a number of clinical settings. EAEC diarrhoea involves bacterial aggregation, adherence to intestinal epithelial cells and elaboration of several toxigenic bacterial mediators. Flagellin (FliC-EAEC), a major bacterial surface protein of EAEC, causes interleukin (IL)-8 release from several epithelial cell lines. The host response to flagellins from E. coli and several other bacteria is mediated by Toll-like receptor 5 (TLR5), which signals through nuclear factor kappa B (NF-κB) to induce transcription of pro-inflammatory cytokines. p38 mitogen-activating protein (MAP) kinase (MAPK) is a member of a family of stress-related kinases that influences a diverse range of cellular functions including host inflammatory responses to microbial products. We studied the role of p38 MAPK in FliC-EAEC-induced IL-8 secretion from Caco-2 human intestinal epithelial cells and THP-1 human monocytic cells. We found that IL-8 secretion from both cell types is dependent on p38 MAPK, which is phospho-activated in response to FliC-EAEC. The role of TLR5 in p38 MAPK-dependent IL-8 secretion was verified in HEp-2 cells transiently transfected with a TLR5 expression construct. Activation of interleukin-1 receptor-associated kinase (IRAK) was also observed in Caco-2 and TLR5-transfected HEp-2 cells after exposure to FliC-EAEC. Finally, we demonstrated that pharmacological inhibition of p38 MAPK reduced IL-8 transcription and mRNA levels, but did not affect NF-κB activation. Collectively, our results suggest that TLR5 mediates p38 MAPK-dependent IL-8 secretion from epithelial and monocytic cells incubated with FliC-EAEC, and that this effect requires IL-8 promoter activation independent of NF-κB nuclear migration. PMID:15270737

  5. Activated Platelets Induce Endothelial Cell Activation via an Interleukin-1β Pathway in Systemic Lupus Erythematosus

    PubMed Central

    Nhek, Sokha; Clancy, Robert; Lee, Kristen A.; Allen, Nicole M.; Barrett, Tessa J.; Marcantoni, Emanuela; Nwaukoni, Janet; Rasmussen, Sara; Rubin, Maya; Newman, Jonathan D.; Buyon, Jill P.; Berger, Jeffrey S.

    2017-01-01

    Objective Systemic lupus erythematosus (SLE) is associated with the premature development of cardiovascular disease. The platelet–endothelium interaction is important in the pathogenesis of cardiovascular disease. In this study, we investigated the platelet phenotype from patients with SLE and matched controls, and their effect on endothelial cells. Approach and Results Platelet aggregability was measured in 54 SLE subjects off antiplatelet therapy (mean age 40.1±12.8 years; 82% female; 37% white) with age- and sex-matched controls. Platelets were coincubated with human umbilical vein endothelial cells (HUVECs) and changes to gene expression assessed by an RNA array and quantitative reverse transcription polymerase chain reaction. SLE disease activity index ranged from 0 to 22 (mean 5.1±3.9). Compared with controls, patients with SLE had significantly increased monocyte and leukocyte–platelet aggregation and platelet aggregation in response to submaximal agonist stimulation. An agnostic microarray of HUVECs cocultured with SLE platelets found a platelet-mediated effect on endothelial gene pathways involved in cell activation. Sera from SLE versus control subjects significantly increased (1) activation of control platelets; (2) platelet adhesion to HUVECs; (3) platelet-induced HUVEC gene expression of interleukin-8, and intercellular adhesion molecule 1; and (4) proinflammatory gene expression in HUVECs, mediated by interleukin-1β–dependent pathway. Incubation of SLE-activated platelets with an interleukin-1β–neutralizing antibody or HUVECs pretreated with interleukin-1 receptor antibodies attenuated the platelet-mediated activation of endothelial cells. Conclusions Platelet activity measurements and subsequent interleukin-1β–dependent activation of the endothelium are increased in subjects with SLE. Platelet–endothelial interactions may play a role in the pathogenesis of cardiovascular disease in patients with SLE. PMID:28153882

  6. 40 CFR 268.10-268.12 - [Reserved

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 27 2011-07-01 2011-07-01 false [Reserved] 268.10-268.12 Section 268.10-268.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Schedule for Land Disposal Prohibition and Establishment of Treatment...

  7. 40 CFR 268.10-268.12 - [Reserved

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 26 2010-07-01 2010-07-01 false [Reserved] 268.10-268.12 Section 268.10-268.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Schedule for Land Disposal Prohibition and Establishment of Treatment...

  8. 40 CFR 268.10-268.12 - [Reserved

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 28 2013-07-01 2013-07-01 false [Reserved] 268.10-268.12 Section 268.10-268.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES (CONTINUED) LAND DISPOSAL RESTRICTIONS Schedule for Land Disposal Prohibition and Establishment of Treatment...

  9. 12 CFR 536.40 - What you must disclose.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 6 2012-01-01 2012-01-01 false What you must disclose. 536.40 Section 536.40 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY CONSUMER PROTECTION IN SALES OF INSURANCE § 536.40 What you must disclose. (a) Insurance disclosures. In connection with the...

  10. 12 CFR 536.40 - What you must disclose.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 6 2014-01-01 2012-01-01 true What you must disclose. 536.40 Section 536.40 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY CONSUMER PROTECTION IN SALES OF INSURANCE § 536.40 What you must disclose. (a) Insurance disclosures. In connection with the...

  11. Serum interleukin measurement may help identify thyroid cancer patients with active disease.

    PubMed

    Martins, Mariana Bonjiorno; Marcello, Marjory Alana; Batista, Fernando de Assis; Peres, Karina Colombera; Meneghetti, Murilo; Ward, Mirela Andrea Latham; Etchebehere, Elba Cristina Sá de Camargo; da Assumpção, Ligia Vera Montali; Ward, Laura Sterian

    2018-02-01

    Investigate the clinical utility of serum interleukin dosages of IL-2, IL-2R, IL-4, IL-6, IL-6R, IL-8, IL-10 and IL-12 in the diagnosis and characterization of patients with DTC. In particular, verify ILs utility in the identification of individuals who are evolving disease-free or with the active disease. We evaluated 200 patients with malignant nodules (100 patients disease-free and 100 patients with recurrence/active disease); 60 benign nodules and 100 healthy controls, serum levels were assessed by ELISA. All ILs, but not IL-4, differentiated these three groups. We observed that IL-2, 2R and 10 serum concentrations were associated with thyroglobulin levels. Serum IL-2 was able to differentiate patients with active disease from the disease-free with a sensitivity of 98%, specificity of 58%, positive predictive value (PPV) of 70% and negative predictive value (NPV) of 97% (p=0.0007). IL-6R levels differentiated patients with active disease from the disease-free patients with 56% sensitivity, 63% specificity, PPV of 60% and NPV of 59% (p<0.0001). IL-8 values also distinguished patients with active disease from the disease-free ones with sensitivity of 50%, specificity of 76%, PPV of 68% and NPV of 60% (p=0.0025); using IL-12, we obtained a sensitivity value of 73%, specificity of 66%, PPV of 68% and NPV of 71% (p<0.0001). Furthermore, interleukin levels showed association with some tumor characteristics of aggressiveness. We suggest that the serum concentration of ILs may assist in the diagnosis and characterization of tumor malignancy helping identify patients with active disease who deserve closer medical attention. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  12. An autoinflammatory neurological disease due to interleukin 6 hypersecretion

    PubMed Central

    2013-01-01

    Autoinflammatory diseases are rare illnesses characterized by apparently unprovoked inflammation without high-titer auto-antibodies or antigen-specific T cells. They may cause neurological manifestations, such as meningitis and hearing loss, but they are also characterized by non-neurological manifestations. In this work we studied a 30-year-old man who had a chronic disease characterized by meningitis, progressive hearing loss, persistently raised inflammatory markers and diffuse leukoencephalopathy on brain MRI. He also suffered from chronic recurrent osteomyelitis of the mandible. The hypothesis of an autoinflammatory disease prompted us to test for the presence of mutations in interleukin-1−pathway genes and to investigate the function of this pathway in the mononuclear cells obtained from the patient. Search for mutations in genes associated with interleukin-1−pathway demonstrated a novel NLRP3 (CIAS1) mutation (p.I288M) and a previously described MEFV mutation (p.R761H), but their combination was found to be non-pathogenic. On the other hand, we uncovered a selective interleukin-6 hypersecretion within the central nervous system as the likely pathogenic mechanism. This is also supported by the response to the anti-interleukin-6−receptor monoclonal antibody tocilizumab, but not to the recombinant interleukin-1−receptor antagonist anakinra. Exome sequencing failed to identify mutations in other genes known to be involved in autoinflammatory diseases. We propose that the disease described in this patient might be a prototype of a novel category of autoinflammatory diseases characterized by prominent neurological involvement. PMID:23432807

  13. 12 CFR 40.17 - Relation to State laws.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Relation to State laws. 40.17 Section 40.17... INFORMATION Relation to Other Laws; Effective Date § 40.17 Relation to State laws. (a) In general. This part.... (b) Greater protection under State law. For purposes of this section, a State statute, regulation...

  14. 12 CFR 40.17 - Relation to State laws.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Relation to State laws. 40.17 Section 40.17... INFORMATION Relation to Other Laws; Effective Date § 40.17 Relation to State laws. (a) In general. This part.... (b) Greater protection under State law. For purposes of this section, a State statute, regulation...

  15. 40 CFR 262.12 - EPA identification numbers.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 26 2014-07-01 2014-07-01 false EPA identification numbers. 262.12... (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE General § 262.12 EPA identification numbers... waste without having received an EPA identification number from the Administrator. (b) A generator who...

  16. 40 CFR 262.12 - EPA identification numbers.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false EPA identification numbers. 262.12... (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE General § 262.12 EPA identification numbers... waste without having received an EPA identification number from the Administrator. (b) A generator who...

  17. 40 CFR 262.12 - EPA identification numbers.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 27 2012-07-01 2012-07-01 false EPA identification numbers. 262.12... (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE General § 262.12 EPA identification numbers... waste without having received an EPA identification number from the Administrator. (b) A generator who...

  18. 40 CFR 262.12 - EPA identification numbers.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 27 2013-07-01 2013-07-01 false EPA identification numbers. 262.12... (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE General § 262.12 EPA identification numbers... waste without having received an EPA identification number from the Administrator. (b) A generator who...

  19. 40 CFR 262.12 - EPA identification numbers.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 26 2011-07-01 2011-07-01 false EPA identification numbers. 262.12... (CONTINUED) STANDARDS APPLICABLE TO GENERATORS OF HAZARDOUS WASTE General § 262.12 EPA identification numbers... waste without having received an EPA identification number from the Administrator. (b) A generator who...

  20. Gene gun-mediated delivery of an interleukin-12 expression plasmid protects against infections with the intracellular protozoan parasites Leishmania major and Trypanosoma cruzi in mice

    PubMed Central

    Sakai, T; Hisaeda, H; Nakano, Y; Ishikawa, H; Maekawa, Y; Ishii, K; Nitta, Y; Miyazaki, J; Himeno, K

    2000-01-01

    An interleukin-12 (IL-12) expression plasmid was transferred, using a gene gun, to mice infected with Leishmania major or Trypanosoma cruzi. Transfer of the IL-12 gene to susceptible BALB/c mice resulted in regression of lesion size and reduced the number of parasites in draining lymph nodes (LN) at the site of L. major infection. Coincident with these protective effects, the T-helper type (Th) response shifted towards Th1, as evaluated by cytokine production in vitro and L. major-specific antibody responses. Protective effects of the IL-12 gene were also observed in T. cruzi infection. Treatment of BALB/c mice infected with T. cruzi enhanced the production of interferon-γ (IFN-γ) by spleen cells, while suppressed production of interleukin-10 (IL-10) compared with control mice. Administration of anti-CD4 or anti-CD8 monoclonal antibody (mAb) abolished the protective immunity against T. cruzi infection, and treatment with the IL-12 gene could not restore the resistance in these mice. Mice depleted of natural killer (NK) cells with anti-asialo GM1 also became susceptible to infection, while the resistance was restored when these mice were treated with the IL-12 gene. Thus, target cells for the treatment appear to be CD4+ and CD8+ T cells, which are ordinarily activated by NK cells. These results suggest that the transfer of cytokine genes using a gene gun is an effective method for investigating the roles of cytokines and gene therapy in infectious diseases. PMID:10792510

  1. 40 CFR 104.12 - Certification of record.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 22 2011-07-01 2011-07-01 false Certification of record. 104.12 Section 104.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PUBLIC... transcript his certificate stating that, to the best of his knowledge and belief, the transcript is a true...

  2. 40 CFR 104.12 - Certification of record.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 23 2013-07-01 2013-07-01 false Certification of record. 104.12 Section 104.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PUBLIC... transcript his certificate stating that, to the best of his knowledge and belief, the transcript is a true...

  3. 40 CFR 104.12 - Certification of record.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 23 2012-07-01 2012-07-01 false Certification of record. 104.12 Section 104.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PUBLIC... transcript his certificate stating that, to the best of his knowledge and belief, the transcript is a true...

  4. 40 CFR 104.12 - Certification of record.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Certification of record. 104.12 Section 104.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS PUBLIC... transcript his certificate stating that, to the best of his knowledge and belief, the transcript is a true...

  5. 40 CFR 233.12 - Attorney General's statement.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Attorney General's statement. 233.12... STATE PROGRAM REGULATIONS Program Approval § 233.12 Attorney General's statement. (a) Any State that seeks to administer a program under this part shall submit a statement from the State Attorney General...

  6. Per a 10 protease activity modulates CD40 expression on dendritic cell surface by nuclear factor-kappaB pathway.

    PubMed

    Goel, C; Kalra, N; Dwarakanath, B S; Gaur, S N; Arora, N

    2015-05-01

    Serine protease activity of Per a 10 from Periplaneta americana modulates dendritic cell (DC) functions by a mechanism(s) that remains unclear. In the present study, Per a 10 protease activity on CD40 expression and downstream signalling was evaluated in DCs. Monocyte-derived DCs from cockroach-allergic patients were treated with proteolytically active/heat-inactivated Per a 10. Stimulation with active Per a 10 demonstrated low CD40 expression on DCs surface (P < 0·05), while enhanced soluble CD40 level in the culture supernatant (P < 0·05) compared to the heat-inactivated Per a 10, suggesting cleavage of CD40. Per a 10 activity reduced the interleukin (IL)-12 and interferon (IFN)-γ secretion by DCs (P < 0·05) compared to heat-inactivated Per a 10, indicating that low CD40 expression is associated with low levels of IL-12 secretion. Active Per a 10 stimulation caused low nuclear factor-kappa B (NF-κB) activation in DCs compared to heat-inactivated Per a 10. Inhibition of the NF-κB pathway suppressed the CD40 expression and IL-12 secretion by DCs, further indicating that NF-κB is required for CD40 up-regulation. CD40 expression activated the tumour necrosis factor (TNF) receptor-associated factor 6 (TRAF6), thereby suggesting its involvement in NF-κB activation. Protease activity of Per a 10 induced p38 mitogen-activated protein kinase (MAPK) activation that showed no significant effect on CD40 expression by DCs. However, inhibiting p38 MAPK or NF-κB suppressed the secretion of IL-12, IFN-γ, IL-6 and TNF-α by DCs. Such DCs further reduced the secretion of IL-4, IL-6, IL-12 and TNF-α by CD4(+) T cells. In conclusion, protease activity of Per a 10 reduces CD40 expression on DCs. CD40 down-regulation leads to low NF-κB levels, thereby modulating DC-mediated immune responses. © 2014 British Society for Immunology.

  7. Per a 10 protease activity modulates CD40 expression on dendritic cell surface by nuclear factor-kappaB pathway

    PubMed Central

    Goel, C; Kalra, N; Dwarakanath, B S; Gaur, S N; Arora, N

    2015-01-01

    Serine protease activity of Per a 10 from Periplaneta americana modulates dendritic cell (DC) functions by a mechanism(s) that remains unclear. In the present study, Per a 10 protease activity on CD40 expression and downstream signalling was evaluated in DCs. Monocyte-derived DCs from cockroach-allergic patients were treated with proteolytically active/heat-inactivated Per a 10. Stimulation with active Per a 10 demonstrated low CD40 expression on DCs surface (P < 0·05), while enhanced soluble CD40 level in the culture supernatant (P < 0·05) compared to the heat-inactivated Per a 10, suggesting cleavage of CD40. Per a 10 activity reduced the interleukin (IL)-12 and interferon (IFN)-γ secretion by DCs (P < 0·05) compared to heat-inactivated Per a 10, indicating that low CD40 expression is associated with low levels of IL-12 secretion. Active Per a 10 stimulation caused low nuclear factor-kappa B (NF-κB) activation in DCs compared to heat-inactivated Per a 10. Inhibition of the NF-κB pathway suppressed the CD40 expression and IL-12 secretion by DCs, further indicating that NF-κB is required for CD40 up-regulation. CD40 expression activated the tumour necrosis factor (TNF) receptor-associated factor 6 (TRAF6), thereby suggesting its involvement in NF-κB activation. Protease activity of Per a 10 induced p38 mitogen-activated protein kinase (MAPK) activation that showed no significant effect on CD40 expression by DCs. However, inhibiting p38 MAPK or NF-κB suppressed the secretion of IL-12, IFN-γ, IL-6 and TNF-α by DCs. Such DCs further reduced the secretion of IL-4, IL-6, IL-12 and TNF-α by CD4+ T cells. In conclusion, protease activity of Per a 10 reduces CD40 expression on DCs. CD40 down-regulation leads to low NF-κB levels, thereby modulating DC-mediated immune responses. PMID:25492061

  8. Thermodynamics reveal that helix four in the NLS of NF-kappaB p65 anchors IkappaBalpha, forming a very stable complex.

    PubMed

    Bergqvist, Simon; Croy, Carrie H; Kjaergaard, Magnus; Huxford, Tom; Ghosh, Gourisankar; Komives, Elizabeth A

    2006-07-07

    IkappaBalpha is an ankyrin repeat protein that inhibits NF-kappaB transcriptional activity by sequestering NF-kappaB outside of the nucleus in resting cells. We have characterized the binding thermodynamics and kinetics of the IkappaBalpha ankyrin repeat domain to NF-kappaB(p50/p65) using surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC). SPR data showed that the IkappaBalpha and NF-kappaB associate rapidly but dissociate very slowly, leading to an extremely stable complex with a K(D,obs) of approximately 40 pM at 37 degrees C. As reported previously, the amino-terminal DNA-binding domain of p65 contributes little to the overall binding affinity. Conversely, helix four of p65, which forms part of the nuclear localization sequence, was essential for high-affinity binding. This was surprising, given the small size of the binding interface formed by this part of p65. The NF-kappaB(p50/p65) heterodimer and p65 homodimer bound IkappaBalpha with almost indistinguishable thermodynamics, except that the NF-kappaB p65 homodimer was characterized by a more favorable DeltaH(obs) relative to the NF-kappaB(p50/p65) heterodimer. Both interactions were characterized by a large negative heat capacity change (DeltaC(P,obs)), approximately half of which was contributed by the p65 helix four that was necessary for tight binding. This could not be accounted for readily by the small loss of buried non-polar surface area and we hypothesize that the observed effect is due to additional folding of some regions of the complex.

  9. 40 CFR 1515.12 - Fees in general.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 34 2013-07-01 2013-07-01 false Fees in general. 1515.12 Section 1515.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY FREEDOM OF INFORMATION ACT PROCEDURES... comply with a time limit under the Freedom of Information Act for responding to the request for records...

  10. 40 CFR 1515.12 - Fees in general.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 33 2014-07-01 2014-07-01 false Fees in general. 1515.12 Section 1515.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY FREEDOM OF INFORMATION ACT PROCEDURES... comply with a time limit under the Freedom of Information Act for responding to the request for records...

  11. 40 CFR 1515.12 - Fees in general.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 34 2012-07-01 2012-07-01 false Fees in general. 1515.12 Section 1515.12 Protection of Environment COUNCIL ON ENVIRONMENTAL QUALITY FREEDOM OF INFORMATION ACT PROCEDURES... comply with a time limit under the Freedom of Information Act for responding to the request for records...

  12. In Vitro Interleukin-1 and 2 Production and Interleukin 2 Receptor Expression in the Rhesus Monkey

    NASA Technical Reports Server (NTRS)

    Schmitt, Didier A.; Sonnenfeld, Gerald; Husson, David; Tkaczuk, Jean; Andre, Eric; Schaffar, Laurance

    1996-01-01

    Anti-human monoclonal antibodies were used to detect and quantify interleukins-1 and 2 and interleukin-2 receptor expression in peripheral blood mononuclear cells from a rhesus monkey. Interleukin-1 production could be induced by phorbol esters (PMA) and was potentiated by phytohemagglutinin (PHA). Interleukin-2 secretion could also be induced by the combination of PHA and PMA, but only weakly with PHA alone. Interleukin-2 receptor expression was present in a subpopulation of unstimulated lymphocytes and could be enhanced by PHA or PMA. These data show once again that the rhesus monkey immune system is cross-reactive with the human one and that rhesus macaque could be a good model to study interleukin therapy.

  13. Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

    PubMed

    Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

    2003-12-01

    p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

  14. Expanding Diversity in Molecular Structures and Functions of the IL-6/IL-12 Heterodimeric Cytokine Family

    PubMed Central

    Hasegawa, Hideaki; Mizoguchi, Izuru; Chiba, Yukino; Ohashi, Mio; Xu, Mingli; Yoshimoto, Takayuki

    2016-01-01

    The interleukin (IL)-6/IL-12 family cytokines have pleiotropic functions and play critical roles in multiple immune responses. This cytokine family has very unique characteristics in that they comprise two distinct subunits forming a heterodimer and each cytokine and receptor subunit shares with each other. The members of this cytokine family are increasing; currently, there are more than six cytokines, including the tentatively named cytokines IL-Y (p28/p40), IL-12 (p35/p40), IL-23 (p19/p40), IL-27 [p28/Epstein–Barr virus-induced protein 3 (EBI3)], IL-35 (p35/EBI3), and IL-39 (p19/EBI3). This family of cytokines covers a very broad range of immune responses, including pro-inflammatory responses, such as helper T (Th)1, Th2, and Th17, to anti-inflammatory responses, such as regulatory T (Treg) cells and IL-10-producing Treg cells. IL-12 is the first member of this family, and IL-12, IL-23, and IL-27 are mainly produced by activated antigen-presenting cells, such as dendritic cells and macrophages. IL-12 plays a critical role in the promotion of Th1 immune responses by inducing interferon-γ production to combat pathogens and malignant tumors. IL-23 induces IL-17 production and is necessary to maintain pathogenic Th17 cells that cause inflammatory and autoimmune diseases. IL-27 was initially reported to play a critical role in promotion of Th1 differentiation; however, subsequent studies revealed that IL-27 has broader stimulatory and inhibitory roles by inducing IL-10-producing Treg cells. IL-35 is produced by forkhead box P3+ Treg cells and activated B cells and has immunosuppressive functions to maintain immune tolerance. The most recently identified cytokine, IL-39, is produced by activated B cells and has pro-inflammatory functions. The cytokine tentatively named IL-Y seems to have anti-inflammatory functions by inhibiting Th1 and Th17 differentiation. In addition, individual cytokine subunits were also shown to have self-standing activities. Thus

  15. Serum amyloid protein A concentration in cryopyrin-associated periodic syndromes patients treated with interleukin-1 beta antagonist.

    PubMed

    Pastore, Serena; Paloni, Giulia; Caorsi, Roberta; Ronfani, Luca; Taddio, Andrea; Lepore, Loredana

    2014-01-01

    Cryopyrin-associated periodic syndromes (CAPS) are a group of chronic, relapsing autoinflammatory disorders which may be complicated by systemic AA amyloidosis. The aim of our study was to evaluate serum amyloid protein A (SAA) level in CAPS patients treated with Interleukin-1beta (IL-1β) antagonist and to correlate its level with treatment response. All patients of CAPS Italian Register treated with IL-1β inhibitor were enrolled. SAA levels before starting therapy, and at last visit were evaluated. Patients were then divided in complete responders and partial responders. Twenty-five patients were enrolled. SAA level before starting therapy was increased (median 118.5 mg/L, IQR 96.4-252.8; normal value <6.4 mg/L), while at last visit SAA was significantly reduced (median 4.3 mg/L, IQR 2.3-12.7) (p<0.001). However 12 patients still presented SAA levels beyond normal range, 10/25 patients (40%) showed a complete response to treatment. Conversely, 15 patients presented only a partial response, of which 12 for increased SAA value and 3 for increased CRP value. Patients with partial response had SAA values significantly higher than patients with complete response (median 12.6 mg/L; IQR 8.3-20.0 vs. 2.7 mg/L; IQR 1.6-4.1, p<0.001). Our results confirm the long term efficacy of anti IL-1β treatment in CAPS and the decrease of SAA levels; however 48% of patients still presented SAA elevation despite treatment. The real risk of these patients in developing amyloidosis is not clear but the persistent increase of SAA needs a close follow-up.

  16. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility.

    PubMed

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-03-28

    Inflammatory bowel disease (IBD), which includes Crohn's disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms.

  17. 40 CFR 86.1805-12 - Useful life.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 19 2010-07-01 2010-07-01 false Useful life. 86.1805-12 Section 86... Complete Otto-Cycle Heavy-Duty Vehicles § 86.1805-12 Useful life. (a) Except as permitted under paragraph (b) of this section or required under paragraphs (c) and (d) of this section, the full useful life...

  18. 40 CFR 86.1805-12 - Useful life.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 19 2011-07-01 2011-07-01 false Useful life. 86.1805-12 Section 86... Complete Otto-Cycle Heavy-Duty Vehicles § 86.1805-12 Useful life. (a) Except as permitted under paragraph (b) of this section or required under paragraphs (c) and (d) of this section, the full useful life...

  19. 40 CFR 86.1805-12 - Useful life.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 20 2013-07-01 2013-07-01 false Useful life. 86.1805-12 Section 86... Complete Otto-Cycle Heavy-Duty Vehicles § 86.1805-12 Useful life. (a) Except as permitted under paragraph (b) of this section or required under paragraphs (c) and (d) of this section, the full useful life...

  20. 40 CFR 86.1805-12 - Useful life.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 20 2012-07-01 2012-07-01 false Useful life. 86.1805-12 Section 86... Complete Otto-Cycle Heavy-Duty Vehicles § 86.1805-12 Useful life. (a) Except as permitted under paragraph (b) of this section or required under paragraphs (c) and (d) of this section, the full useful life...

  1. Whole Genomic Analysis of Human G12P[6] and G12P[8] Rotavirus Strains that Have Emerged in Myanmar

    PubMed Central

    Ide, Tomihiko; Komoto, Satoshi; Higo-Moriguchi, Kyoko; Htun, Khaing Win; Myint, Yi Yi; Myat, Theingi Win; Thant, Kyaw Zin; Thu, Hlaing Myat; Win, Mo Mo; Oo, Htun Naing; Htut, Than; Wakuda, Mitsutaka; Dennis, Francis Ekow; Haga, Kei; Fujii, Yoshiki; Katayama, Kazuhiko; Rahman, Shofiqur; Nguyen, Sa Van; Umeda, Kouji; Oguma, Keiji; Tsuji, Takao; Taniguchi, Koki

    2015-01-01

    G12 rotaviruses are emerging rotavirus strains causing severe diarrhea in infants and young children worldwide. However, the whole genomes of only a few G12 strains have been fully sequenced and analyzed. In this study, we sequenced and characterized the complete genomes of six G12 strains (RVA/Human-tc/MMR/A14/2011/G12P[8], RVA/Human-tc/MMR/A23/2011/G12P[6], RVA/Human-tc/MMR/A25/2011/G12P[8], RVA/Human-tc/MMR/P02/2011/G12P[8], RVA/Human-tc/MMR/P39/2011/G12P[8], and RVA/Human-tc/MMR/P43/2011/G12P[8]) detected in six stool samples from children with acute gastroenteritis in Myanmar. On whole genomic analysis, all six Myanmarese G12 strains were found to have a Wa-like genetic backbone: G12-P[8]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strains A14, A25, P02, P39, and P43, and G12-P[6]-I1-R1-C1-M1-A1-N1-T1-E1-H1 for strain A23. Phylogenetic analysis showed that most genes of the six strains examined in this study were genetically related to globally circulating human G1, G3, G9, and G12 strains. Of note is that the NSP4 gene of strain A23 exhibited the closest relationship with the cognate genes of human-like bovine strains as well as human strains, suggesting the occurrence of reassortment between human and bovine strains. Furthermore, strains A14, A25, P02, P39, and P43 were very closely related to one another in all the 11 gene segments, indicating derivation of the five strains from a common origin. On the other hand, strain A23 consistently formed distinct clusters as to all the 11 gene segments, indicating a distinct origin of strain A23 from that of strains A14, A25, P02, P39, and P43. To our knowledge, this is the first report on whole genome-based characterization of G12 strains that have emerged in Myanmar. Our observations will provide important insights into the evolutionary dynamics of spreading G12 rotaviruses in Asia. PMID:25938434

  2. P2Y12 regulates platelet adhesion/activation, thrombus growth, and thrombus stability in injured arteries

    PubMed Central

    André, Patrick; Delaney, Suzanne M.; LaRocca, Thomas; Vincent, Diana; DeGuzman, Francis; Jurek, Marzena; Koller, Beverley; Phillips, David R.; Conley, Pamela B.

    2003-01-01

    The critical role for ADP in arterial thrombogenesis was established by the clinical success of P2Y12 antagonists, currently used at doses that block 40–50% of the P2Y12 on platelets. This study was designed to determine the role of P2Y12 in platelet thrombosis and how its complete absence affects the thrombotic process. P2Y12-null mice were generated by a gene-targeting strategy. Using an in vivo mesenteric artery injury model and real-time continuous analysis of the thrombotic process, we observed that the time for appearance of first thrombus was delayed and that only small, unstable thrombi formed in P2Y12–/– mice without reaching occlusive size, in the absence of aspirin. Platelet adhesion to vWF was impaired in P2Y12–/– platelets. While adhesion to fibrinogen and collagen appeared normal, the platelets in thrombi from P2Y12–/– mice on collagen were less dense and less activated than their WT counterparts. P2Y12–/– platelet activation was also reduced in response to ADP or a PAR-4–activating peptide. Thus, P2Y12 is involved in several key steps of thrombosis: platelet adhesion/activation, thrombus growth, and stability. The data suggest that more aggressive strategies of P2Y12 antagonism will be antithrombotic without the requirement of aspirin cotherapy and may provide benefits even to the aspirin-nonresponder population. PMID:12897207

  3. Effects of Baicalin on Diabetic Cardiac Autonomic Neuropathy Mediated by the P2Y12 Receptor in Rat Stellate Ganglia.

    PubMed

    Sheng, Xuan; Wang, Jiayue; Guo, Jingjing; Xu, Yurong; Jiang, Huaide; Zheng, Chaoran; Xu, Zixi; Zhang, Yuanruohan; Che, Hongyu; Liang, Shangdong; Zhu, Gaochun; Li, Guilin

    2018-01-01

    Chronic diabetic hyperglycemia can damage various of organ systems and cause serious complications. Although diabetic cardiac autonomic neuropathy (DCAN) is the primary cause of death in diabetic patients, its pathogenesis remains to be fully elucidated. Baicalin is a flavonoid extracted from Scutellaria baicalensis root and has antibacterial, diuretic, anti-inflammatory, anti- metamorphotic, and antispasmodic effects. Our study explored the effects of baicalin on enhancing sympathoexcitatory response induced by DCAN via the P2Y12 receptor. A type 2 diabetes mellitus rat model was induced by a combination of diet and streptozotocin. Serum epinephrine was measured by enzyme-linked immunosorbent assay. Blood pressure and heart rate were measured using the indirect tail-cuff method. Heart rate variability was analyzed using the frequency-domain of electrocardiogram recordings. The expression levels of P2Y12, interleukin-1beta (IL-1β), tumor necrosis factor alpha (TNF-α), and connexin 43 (Cx43) were determined by quantitative real-time reverse transcription-polymerase chain reaction and western blotting. The interaction between baicalin and P2Y12 determined using by molecular docking. Baicalin alleviated elevated blood pressure and heart rate, improved heart rate variability, and decreased the elevated expression levels of P2Y12, IL-1β, TNF-α, and Cx43 in the stellate ganglia of diabetic rats. Baicalin also reduced the elevated concentration of serum epinephrine and the phosphorylation of p38 mitogen-activated protein kinase in diabetic rats. Baicalin decreases sympathetic activity by inhibiting the P2Y12 receptor in stellate ganglia satellite glial cells to maintain the balance between sympathetic and parasympathetic nerves and relieves DCAN in the rat. © 2018 The Author(s). Published by S. Karger AG, Basel.

  4. 40 CFR 86.1805-12 - Useful life.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 19 2014-07-01 2014-07-01 false Useful life. 86.1805-12 Section 86...-Cycle Heavy-Duty Vehicles § 86.1805-12 Useful life. (a) Except as permitted under paragraph (b) of this section or required under paragraphs (c) and (d) of this section, the full useful life for all LDVs and...

  5. Autoantibodies to BP180 associated with bullous pemphigoid release interleukin-6 and interleukin-8 from cultured human keratinocytes.

    PubMed

    Schmidt, E; Reimer, S; Kruse, N; Jainta, S; Bröcker, E B; Marinkovich, M P; Giudice, G J; Zillikens, D

    2000-11-01

    Bullous pemphigoid is an inflammatory subepidermal blistering disease that is associated with auto- antibodies to the keratinocyte surface protein, BP180. In addition to the binding of autoantibodies, the infiltration of inflammatory cells is necessary for blister formation. Cytokines, including interleukin-6 and interleukin-8, have been implicated in the disease process of both human and experimental murine bullous pemphigoid. This study was aimed at testing the hypothesis that the binding of anti-BP180 antibodies to their target antigen triggers a signal transduction event that results in the secretion of these pro-inflammatory cytokines. Consistent with this hypothesis, treatment of cultured normal human epidermal keratinocytes with bullous pemphigoid IgG, but not control IgG, led to increased levels of interleukin-6 and interleukin-8, but not interleukin-1alpha, interleukin-1beta, tumor necrosis factor-alpha, interleukin-10, or monocyte chemoattractant protein-1, in the culture medium. This effect was concentration- and time-dependent and was abolished by depleting the bullous pemphigoid IgG of reactivity to two distinct epitopes on the BP180 NC16A domain. Upregulation of interleukin-6 and interleukin-8 was found at both protein and mRNA levels. In addition, bullous pemphigoid IgG did not induce the release of interleukin-6 and interleukin-8 from BP180-deficient keratinocytes obtained from a patient with generalized atrophic benign epidermolysis bullosa. These data indicate that bullous pemphigoid-associated autoantibodies to the human BP180 ectodomain trigger a signal transducing event that leads to expression and secretion of interleukin-6 and interleukin-8 from human keratinocytes.

  6. Interleukins and interleukin receptors in rheumatoid arthritis: Research, diagnostics and clinical implications

    PubMed Central

    Magyari, Lili; Varszegi, Dalma; Kovesdi, Erzsebet; Sarlos, Patricia; Farago, Bernadett; Javorhazy, Andras; Sumegi, Katalin; Banfai, Zsolt; Melegh, Bela

    2014-01-01

    Rheumatoid arthritis (RA) is an autoimmune disease, resulting in a chronic, systemic inflammatory disorder. It may affect many tissues and organs, but it primarily affects the flexible joints. In clinical practice patient care generates many questions about diagnosis, prognosis, and treatment. It is challenging for health care specialists to keep up to date with the medical literature. This review summarizes the pathogenesis, the polymorphisms of interleukin and interleukin genes and the standard available and possible future immunologic targets for RA treatment. The identification of disease-associated interleukin and interleukin receptor genes can provide precious insight into the genetic variations prior to disease onset in order to identify the pathways important for RA pathogenesis. The knowledge of the complex genetic background may prove useful for developing novel therapies and making personalized medicine based on the individual’s genetics. PMID:25232528

  7. Administration of interleukin-12 enhances the therapeutic efficacy of dendritic cell-based tumor vaccines in mouse hepatocellular carcinoma.

    PubMed

    Tatsumi, T; Takehara, T; Kanto, T; Miyagi, T; Kuzushita, N; Sugimoto, Y; Jinushi, M; Kasahara, A; Sasaki, Y; Hori, M; Hayashi, N

    2001-10-15

    Dendritic cells (DCs) are potent antigen-presenting cells that are capable of priming systemic antitumor immune response. Here, we evaluated the combined effectiveness of tumor lysate-pulsed DC immunization and interleukin (IL)-12 administration on the induction of antitumor immunity in a mouse hepatocellular carcinoma (HCC) model. Mouse DCs were pulsed with lysate of BNL 1ME A.7R.1 (BNL), a BALB/c-derived HCC cell line, and then injected into syngeneic mice in combination with systemic administration of IL-12. Lymphocytes from mice treated with BNL lysate-pulsed DCs and IL-12 showed stronger cytolytic activity and produced higher amounts of IFN-gamma than those from mice treated with BNL lysate-pulsed DCs alone. Although immunization with BNL lysate-pulsed DCs alone did not lead to complete regression of established tumors, it significantly inhibited tumor growth compared with vehicle injection. Importantly, the combined therapy of BNL lysate-pulsed DCs and IL-12 resulted in tumor rejection or significant inhibition of tumor growth compared with mice treated with BNL lysate-pulsed DCs alone. In vivo lymphocyte depletion experiments demonstrated that this combination was dependent on both CD8+ and CD4+ T cells, but not natural killer cells. These results demonstrated that IL-12 administration enhanced the therapeutic effect of immunization of tumor lysate-pulsed DCs against HCC in mice. This combination of IL-12 and DCs may be useful for suppressing the growth of residual tumor after primary therapy of human HCC.

  8. Enhanced Delivery of Plasmid Encoding Interleukin-12 Gene by Diethylene Triamine Penta-Acetic Acid (DTPA)-Conjugated PEI Nanoparticles.

    PubMed

    Dehshahri, Ali; Sadeghpour, Hossein; Keykhaee, Maryam; Khalvati, Bahman; Sheikhsaran, Fatemeh

    2016-05-01

    Recombinant therapeutic proteins have been considered as an efficient category of medications used for the treatment of various diseases. Despite their effectiveness, there are some reports on the systemic adverse effects of recombinant therapeutic proteins limiting their wide clinical applications. Among different cytokines used for cancer immunotherapy, interleukin-12 (IL-12) has shown great ability as a powerful antitumor and antiangiogenic agent. However, significant toxic reactions following the systemic administration of IL-12 have led researchers to seek for alternative approaches such as the delivery and local expression of the IL-12 gene inside the tumor tissues. In order to transfer the plasmid encoding IL-12 gene, the most extensively investigated polycationic polymer, polyethylenimine (PEI), was modified by diethylene triamine penta-acetic acid (DTPA) to modulate the hydrophobic-hydrophilic balance of the polymer as well as its toxicity. DTPA-conjugated PEI derivatives were able to form complexes in the size range around 100-180 nm with great condensation ability and protection of the plasmid against enzymatic degradation. The highest gene transfer ability was achieved by the DTPA-conjugated PEI at the conjugation degree of 0.1 % where the level of IL-12 production increased up to twofold compared with that of the unmodified PEI. Results of the present study demonstrated that modulation of the surface positive charge of PEI along with the improvement of the polymer hydrophobic balance could be considered as a successful strategy to develop safe and powerful nanocarriers.

  9. Del(12)(p11.21p12.2) associated with an asphyxiating thoracic dystrophy or chondroectodermal dysplasia-like syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nagai, T.; Kato, R.; Hasegawa, T.

    1995-01-02

    We describe a 5-year-old Japanese boy who has some radiographic findings characteristic of asphyxiating thoracic dystrophy (ATD)-chondroectodermal dysplasia with a de novo chromosome abnormality. He also has mild mental retardation, short stature, hypoplastic hair and skin, oligodontia, small thoracic cage, hypoplastic pelvis and cone-shaped epiphyses of hands. On cytogenetic studies he was found to have a de novo del(12)(p11.21p12.2). These results suggest that the locus of the gene associated with ATD-chondroectodermal dysplasia may be situated at 12p11.21p12.2. 11 refs., 2 figs.

  10. 40 CFR 74.12 - Opt-in permit contents.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 17 2013-07-01 2013-07-01 false Opt-in permit contents. 74.12 Section 74.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) SULFUR DIOXIDE OPT-INS Permitting Procedures § 74.12 Opt-in permit contents. (a) The opt-in permit shall be included in the Acid Rain permit. (b)...

  11. Interleukin-Encoding Adenoviral Vectors as Genetic Adjuvant for Vaccination against Retroviral Infection

    PubMed Central

    Ohs, Inga; Windmann, Sonja; Wildner, Oliver; Dittmer, Ulf; Bayer, Wibke

    2013-01-01

    Interleukins (IL) are cytokines with stimulatory and modulatory functions in the immune system. In this study, we have chosen interleukins which are involved in the enhancement of TH2 responses and B cell functions to analyze their potential to improve a prophylactic adenovirus-based anti-retroviral vaccine with regard to antibody and virus-specific CD4+ T cell responses. Mice were vaccinated with an adenoviral vector which encodes and displays the Friend Virus (FV) surface envelope protein gp70 (Ad.pIXgp70) in combination with adenoviral vectors encoding the interleukins IL4, IL5, IL6, IL7 or IL23. Co-application of Ad.pIXgp70 with Ad.IL5, Ad.IL6 or Ad.IL23 resulted in improved protection with high control over FV-induced splenomegaly and reduced viral loads. Mice co-immunized with adenoviral vectors encoding IL5 or IL23 showed increased neutralizing antibody responses while mice co-immunized with Ad.IL6 or Ad.IL23 showed improved FV-specific CD4+ T cell responses compared to mice immunized with Ad.pIXgp70 alone. We show that the co-application of adenoviral vectors encoding specific interleukins is suitable to improve the vaccination efficacy of an anti-retroviral vaccine. Improved protection correlated with improved CD4+ T cell responses and especially with higher neutralizing antibody titers. The co-application of selected interleukin-encoding adenoviral vectors is a valuable tool for vaccination with regard to enhancement of antibody mediated immunity. PMID:24349306

  12. 12 CFR 40.12 - Limits on sharing account number information for marketing purposes.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Limits on sharing account number information... OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Limits on Disclosures § 40.12 Limits on sharing account number information for marketing purposes. (a) General prohibition on disclosure of...

  13. Association of Gene Polymorphisms in Interleukin 6 in Infantile Bronchial Asthma.

    PubMed

    Babusikova, Eva; Jurecekova, Jana; Jesenak, Milos; Evinova, Andrea

    2017-07-01

    The genetic background of bronchial asthma is complex, and it is likely that multiple genes contribute to its development both directly and through gene-gene interactions. Cytokines contribute to different aspects of asthma, as they determine the type, severity and outcomes of asthma pathogenesis. Allergic asthmatics undergoing an asthmatic attack exhibit significantly higher levels of pro-inflammatory cytokines, such as interleukins and chemokines. In recent years, cytokines and their receptors have been shown to be highly polymorphic, and this prompted us to investigate interleukin 6 promoter polymorphisms at position -174G/C (rs1800795) and at -572G/C (rs1800796) in relation to asthma in children. Interleukin 6 promoter polymorphisms were analyzed in bronchial asthma patients and healthy children using polymerase chain reaction-restriction fragment length polymorphism analysis. We observed a significant association between polymorphism at -174G/C and bronchial asthma (OR=3.4, 95% CI: 2.045-5.638, P<.001). Higher associations between polymorphism at IL-6 -174G/C and bronchial asthma were observed in atopic patients (OR=4.1, 95% CI: 2.308-7.280, P<8.10 -7 ). Interleukin 6 polymorphism is associated with bronchial asthma, particularly its atopic phenotype. Expression and secretion of interleukins in asthmatic patients may be affected by genetic polymorphisms, and could have a disease-modifying effect in the asthmatic airway and modify the therapeutic response. Copyright © 2016 SEPAR. Publicado por Elsevier España, S.L.U. All rights reserved.

  14. Interleukin and interleukin receptor gene polymorphisms in inflammatory bowel diseases susceptibility

    PubMed Central

    Magyari, Lili; Kovesdi, Erzsebet; Sarlos, Patricia; Javorhazy, Andras; Sumegi, Katalin; Melegh, Bela

    2014-01-01

    Inflammatory bowel disease (IBD), which includes Crohn’s disease (CD) and ulcerative colitis (UC), represents a group of chronic inflammatory disorders caused by dysregulated immune responses in genetically predisposed individuals. Genetic markers are associated with disease phenotype and long-term evolution, but their value in everyday clinical practice is limited at the moment. IBD has a clear immunological background and interleukins play key role in the process. Almost 130 original papers were revised including meta-analysis. It is clear these data are very important for understanding the base of the disease, especially in terms of clinical utility and validity, but text often do not available for the doctors use these in the clinical practice nowadays. We conducted a systematic review of the current literature on interleukin and interleukin receptor gene polymorphisms associated with IBD, performing an electronic search of PubMed Database from publications of the last 10 years, and used the following medical subject heading terms and/or text words: IBD, CD, UC, interleukins and polymorphisms. PMID:24695754

  15. An in vitro and in vivo investigation of bivalent ligands that display preferential binding and functional activity for different melanocortin receptor homodimers

    PubMed Central

    Lensing, Cody J.; Freeman, Katie T.; Schnell, Sathya M.; Adank, Danielle N.; Speth, Robert C.; Haskell-Luevano, Carrie

    2017-01-01

    Pharmacological probes for the melanocortin receptors have been utilized for studying various disease states including cancer, sexual function disorders, Alzheimer's disease, social disorders, cachexia, and obesity. This study focused on the design and synthesis of bivalent ligands to target melanocortin receptor homodimers. Lead ligands increased binding affinity by 14- to 25-fold and increased cAMP signaling potency by 3- to 5-fold compared to their monovalent counterparts. Unexpectedly, different bivalent ligands showed preferences for particular melanocortin receptor subtypes depending on the linker that connected the binding scaffolds suggesting structural differences between the various dimer subtypes. Homobivalent compound 12 (CJL-1-140) possessed a functional profile that was unique from its monovalent counterparts providing evidence of the discrete effects of bivalent ligands. Lead compound 7 (CJL-1-87) significantly decreased feeding in mice after intracerebroventricular administration. To the best of our knowledge, this is the first report of a melanocortin bivalent ligand's in vivo physiological effects. PMID:26959173

  16. Clinical Significance of Serum Interleukin-31 and Interleukin-33 Levels in Patients of Endometrial Cancer: A Case Control Study

    PubMed Central

    Zeng, Xi; Zhang, Zhu; Gao, Qian-Qian; Wang, Yan-Yun; Yu, Xiu-Zhang; Zhou, Bin; Xi, Ming-Rong

    2016-01-01

    Aims. Previous evidence has proved that interleukin-31 (IL-31) and interleukin-33 (IL-33) can be potential markers in some cancers' formulation. We aimed to determine the potential role of IL-31 and IL-33 in prognosis of endometrial cancer patients. Methods. Serum samples were collected from 160 patients with endometrial cancer and 160 healthy controls. The ELISA kits (Raybio® Systems) specific for human IL-31 and human IL-33 were used. Serum levels of tumor markers (CEA, CA-125, and CA19-9) were measured by chemiluminescence immunoassay. A two-side P value < 0.05 was indicated to be significant. Results. Serum levels of IL-31 and IL-33 in patients were significantly elevated compared to those of healthy controls. The interleukin levels were also related to clinical characteristics, including tumor stages, depth of invasion, and existence of node metastases and distant metastases. The sensitivity and specificity of IL-31 and IL-33 were higher than the counterparts of tumor markers, both separately and in combination of IL-31, IL-33, and the clinical markers. Conclusions. This report is the first one mentioning the possible association between serum IL-31 and IL-33 and endometrial cancer. With their sensitivity and specificity, the interleukins may be useful biomarkers for endometrial cancer's prognosis. PMID:27340318

  17. Cumulative meta-analysis of interleukins 6 and 1β, tumour necrosis factor α and C-reactive protein in patients with major depressive disorder.

    PubMed

    Haapakoski, Rita; Mathieu, Julia; Ebmeier, Klaus P; Alenius, Harri; Kivimäki, Mika

    2015-10-01

    Cumulative meta-analyses are used to evaluate the extent to which further studies are needed to confirm or refute a hypothesis. We used this approach to assess observational evidence on systemic inflammation in individuals with major depressive disorder. We identified 58 studies of four common inflammatory markers in a literature search of PubMed, Embase and PsychInfo databases in May 2014. Pooled data from the earliest eight studies already showed an association between interleukin-6 concentrations and major depression; 23 more recent studies confirmed this finding (d=0.54, p<0.0001). A significant association between C-reactive protein levels and major depression was noted after 14 studies and this did not change after addition of six more studies (d=0.47, p<0.0001). For these two inflammatory markers, there was moderate heterogeneity in study-specific estimates, subgroup differences were small, and publication bias appeared to be an unlikely explanation for the findings. Sensitivity analyses including only high-quality studies and subjects free of antidepressant medication further verified the associations. While there was a link between tumour necrosis factor-α levels and major depression (d=0.40, p=0.002), the cumulative effect remained uncertain due to the extensive heterogeneity in study-specific estimates and inconsistencies between subgroups. No evidence was found for the association between interleukin-1β levels and major depression (d=-0.05, p=0.86). In conclusion, this cumulative meta-analysis confirmed higher mean levels of interleukin-6 and C-reactive protein in patients with major depression compared to non-depressed controls. No consistent association between tumour necrosis factor-α, interleukin-1β and major depression was observed. Future studies should clarify the specific immune mechanisms involved as well as continue testing anti-inflammatory therapies in patients suffering from major depression. Copyright © 2015 The Authors. Published by

  18. Alagille syndrome with deletion 20p12.2-p12.3 and hypoplastic left heart.

    PubMed

    Robert, Marie Leema P; Lopez, Tony; Crolla, John; Huang, Shuwen; Owen, Carol; Burvill-Holmes, Lisa; Stumper, Oliver; Turnpenny, Peter D

    2007-10-01

    We report a male patient born at 37-weeks gestation, weighing 1.885 kg (<0.4th centile). Shortly after birth, he was diagnosed with hypoplastic left heart syndrome for which he underwent a Norwood procedure. Subsequently, he developed problems with failure to thrive and developmental delay. At the age of 4 years his delay in growth and development led to further investigations, which revealed a small de-novo interstitial deletion of chromosome 20p12.2. JAGGED1 haploinsufficiency was confirmed by fluorescence in situ hybridization. Array-comparative genomic hybridization analysis confirmed and quantified an approximate 5.4 Mb interstitial deletion involving the chromosomal region 20p12.2-p12.3. This precise interstitial deletion has not been previously reported. Further clinical evaluation revealed posterior embryotoxon and butterfly vertebrae. He has normal liver function tests, facial features consistent with Alagille syndrome, and mild learning difficulties. To our knowledge this is the first report of Alagille syndrome associated with hypoplastic left heart syndrome.

  19. 12 CFR 40.2 - Model privacy form and examples.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Model privacy form and examples. 40.2 Section 40.2 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION § 40.2 Model privacy form and examples. (a) Model privacy form. Use of the model...

  20. 12 CFR 40.2 - Model privacy form and examples.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 1 2014-01-01 2014-01-01 false Model privacy form and examples. 40.2 Section 40.2 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION § 40.2 Model privacy form and examples. (a) Model privacy form. Use of the model...

  1. 12 CFR 40.2 - Model privacy form and examples.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Model privacy form and examples. 40.2 Section 40.2 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION § 40.2 Model privacy form and examples. (a) Model privacy form. Use of the model...

  2. 12 CFR 40.2 - Model privacy form and examples.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 1 2012-01-01 2012-01-01 false Model privacy form and examples. 40.2 Section 40.2 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION § 40.2 Model privacy form and examples. (a) Model privacy form. Use of the model...

  3. 12 CFR 40.2 - Model privacy form and examples.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Model privacy form and examples. 40.2 Section 40.2 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION § 40.2 Model privacy form and examples. (a) Model privacy form. Use of the model...

  4. Structural complementarity of Toll/interleukin-1 receptor domains in Toll-like receptors and the adaptors Mal and MyD88.

    PubMed

    Dunne, Aisling; Ejdeback, Mikael; Ludidi, Phumzile L; O'Neill, Luke A J; Gay, Nicholas J

    2003-10-17

    The Toll/interleukin 1 receptor (TIR) domain is a region found in the cytoplasmic tails of members of the Toll-like receptor/interleukin-1 receptor superfamily. The domain is essential for signaling and is also found in the adaptor proteins Mal (MyD88 adaptor-like) and MyD88, which function to couple activation of the receptor to downstream signaling components. Experimental structures of two Toll/interleukin 1 receptor domains reveal a alpha-beta-fold similar to that of the bacterial chemotaxis protein CheY, and other evidence suggests that the adaptors can make heterotypic interactions with both the receptors and themselves. Here we show that the purified TIR domains of Mal and MyD88 can form stable heterodimers and also that Mal homodimers and oligomers are dissociated in the presence of ATP. To identify structural features that may contribute to the formation of signaling complexes, we produced models of the TIR domains from human Toll-like receptor 4 (TLR4), Mal, and MyD88. We found that although the overall fold is conserved the electrostatic surface potentials are quite distinct. Docking studies of the models suggest that Mal and MyD88 bind to different regions in TLRs 2 and 4, a finding consistent with a cooperative role of the two adaptors in signaling. Mal and MyD88 are predicted to interact at a third non-overlapping site, suggesting that the receptor and adaptors may form heterotetrameric complexes. The theoretical model of the interactions is supported by experimental data from glutathione S-transferase pull-downs and co-immunoprecipitations. Neither theoretical nor experimental data suggest a direct role for the conserved proline in the BB-loop in the association of TLR4, Mal, and MyD88. Finally we show a sequence relationship between the Drosophila protein Tube and Mal that may indicate a functional equivalence of these two adaptors in the Drosophila and vertebrate Toll pathways.

  5. A synergistic interferon-γ production is induced by mouse hepatitis virus in interleukin-12 (IL-12)/IL-18-activated natural killer cells and modulated by carcinoembryonic antigen-related cell adhesion molecules (CEACAM) 1a receptor

    PubMed Central

    Jacques, Alexandre; Bleau, Christian; Turbide, Claire; Beauchemin, Nicole; Lamontagne, Lucie

    2009-01-01

    The production of interferon-γ (IFN-γ) by infiltrating natural killer (NK) cells in liver is involved in the control of mouse hepatitis virus (MHV) infection. The objectives of this study were to identify the mechanisms used by MHV type 3 to modulate the production of IFN-γ by NK cells during the acute hepatitis in susceptible C57BL/6 mice. Ex vivo and in vitro experiments revealed that NK cells, expressing carcinoembryonic antigen-related cell adhesion molecules (CEACAM) 1a (the MHV receptor), can produce a higher level of IFN-γ in the presence of both L2-MHV3 and interleukin-12 (IL-12)/IL-18. The synergistic production of IFN-γ by NK cells depends on viral replication rather than viral fixation only, because it is inhibited or not induced in cells infected with ultraviolet-inactivated viruses and in cells from Ceacam1a−/− mice infected with virulent viruses. The synergistic IFN-γ production involves the p38 mitogen-activated protein kinase (MAPK) rather than the extracellular signal-regulated kinase-1/2 MAPK signalling pathway. However, the signal triggered through the engagement of CEACAM1a decreases the production of IFN-γ, when these molecules are cross-linked using specific monoclonal antibodies. These results suggest that control of acute hepatitis by IFN-γ-producing NK cells may depend on both production of IL-12 and IL-18 in the liver environment and viral infection of NK cells. PMID:19740316

  6. Intratumoural interleukin 12 gene therapy stimulates the immune system and decreases angiogenesis in dogs with spontaneous cancer.

    PubMed

    Cicchelero, L; Denies, S; Haers, H; Vanderperren, K; Stock, E; Van Brantegem, L; de Rooster, H; Sanders, N N

    2017-12-01

    Interleukin 12 (IL-12) is a powerful immunostimulatory cytokine with a strong antitumoural activity. In this work, the immunological, anti-angiogenic and clinical effects of three consecutive intratumoural IL-12 electrogene therapy (EGT) treatments were evaluated in nine dogs with spontaneous cancer. In all the dogs, tumour biopsies and blood samples were taken prior, during and after the intratumoural IL-12 EGT (on days 1, 8, 35 and 1, 3, 8, 15, 35, respectively). An initial decrease in immune cells was followed by an increase above baseline 1-3 weeks after treatment initiation. Interestingly, the decrease in peripheral leukocytes 2 days after the first intratumoural IL-12 EGT coincided with erythema and tumour swelling. Transient increases of IL-12 and interferon γ were measured in the serum and the tumour tissue, whereas IL-10 transiently increased only in the serum. The effect of intratumoural IL-12 EGT on the levels of IL-24 and vascular endothelial growth factor in the sera and tumour biopsies differed per dog. Via contrast-enhanced ultrasound (US) (on days 1, 8 and 35), we demonstrated that intratumoural IL-12 EGT resulted in a significant decrease of the relative blood volume and blood flow speed in the tumour compared with baseline. Metastases were present in two dogs. In one of these dogs, IL-12 EGT of the primary tumour caused a transient partial regression of the metastases, but not of the primary tumour. The second dog with metastases did not survive long enough to complete the entire treatment cycle. Despite encouraging immunostimulatory and anti-angiogenic effects after intratumoural IL-12 EGT, no clinically relevant outcomes were observed in this study, as persistent tumour regression could not be obtained. On the other hand, the laboratory and US results hold great promise for combinatorial strategies of intratumoural IL-12 EGT with conventional antitumour (immuno)therapies. © 2016 John Wiley & Sons Ltd.

  7. CD40 in Retinal Müller Cells Induces P2X7-Dependent Cytokine Expression in Macrophages/Microglia in Diabetic Mice and Development of Early Experimental Diabetic Retinopathy.

    PubMed

    Portillo, Jose-Andres C; Lopez Corcino, Yalitza; Miao, Yanling; Tang, Jie; Sheibani, Nader; Kern, Timothy S; Dubyak, George R; Subauste, Carlos S

    2017-02-01

    Müller cells and macrophages/microglia are likely important for the development of diabetic retinopathy; however, the interplay between these cells in this disease is not well understood. An inflammatory process is linked to the onset of experimental diabetic retinopathy. CD40 deficiency impairs this process and prevents diabetic retinopathy. Using mice with CD40 expression restricted to Müller cells, we identified a mechanism by which Müller cells trigger proinflammatory cytokine expression in myeloid cells. During diabetes, mice with CD40 expressed in Müller cells upregulated retinal tumor necrosis factor-α (TNF-α), interleukin 1β (IL-1β), intracellular adhesion molecule 1 (ICAM-1), and nitric oxide synthase (NOS2), developed leukostasis and capillary degeneration. However, CD40 did not cause TNF-α or IL-1β secretion in Müller cells. TNF-α was not detected in Müller cells from diabetic mice with CD40 + Müller cells. Rather, TNF-α was upregulated in macrophages/microglia. CD40 ligation in Müller cells triggered phospholipase C-dependent ATP release that caused P2X 7 -dependent production of TNF-α and IL-1β by macrophages. P2X 7 -/- mice and mice treated with a P2X 7 inhibitor were protected from diabetes-induced TNF-α, IL-1β, ICAM-1, and NOS2 upregulation. Our studies indicate that CD40 in Müller cells is sufficient to upregulate retinal inflammatory markers and appears to promote experimental diabetic retinopathy and that Müller cells orchestrate inflammatory responses in myeloid cells through a CD40-ATP-P2X 7 pathway. © 2017 by the American Diabetes Association.

  8. 40 CFR 239.12 - Modifications of state programs.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Modifications of state programs. 239.12 Section 239.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...'s initial application, but may have a significant impact on the adequacy of the state's permit...

  9. 40 CFR 239.12 - Modifications of state programs.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false Modifications of state programs. 239.12 Section 239.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...'s initial application, but may have a significant impact on the adequacy of the state's permit...

  10. 40 CFR 239.12 - Modifications of state programs.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false Modifications of state programs. 239.12 Section 239.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...'s initial application, but may have a significant impact on the adequacy of the state's permit...

  11. 40 CFR 239.12 - Modifications of state programs.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false Modifications of state programs. 239.12 Section 239.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...'s initial application, but may have a significant impact on the adequacy of the state's permit...

  12. 40 CFR 239.12 - Modifications of state programs.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true Modifications of state programs. 239.12 Section 239.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES...'s initial application, but may have a significant impact on the adequacy of the state's permit...

  13. [Diagnostic value of procalcitonin, interleukin 8, interleukin 6, and C-reactive protein for detecting bacteremia and fungemia in cancer patients].

    PubMed

    Aznar-Oroval, Eduardo; Sánchez-Yepes, Marina; Lorente-Alegre, Pablo; San Juan-Gadea, Mari Carmen; Ortiz-Muñoz, Blanca; Pérez-Ballestero, Pilar; Picón-Roig, Isabel; Maíquez-Richart, Joaquín

    2010-05-01

    Bacteremia is one of the most important causes of morbidity and mortality in cancer patients. The aim of this study was to evaluate the diagnostic usefulness of procalcitonin (PCT), interleukin 8 (IL-8), interleukin 6 (IL-6), and C-reactive protein (CRP) in the detection of bacteremia in cancer patients. PCT, IL-8, IL-6, and CPR levels were measured in 2 groups of cancer patients who had fever: one group with true bacteremia and another without bacteremia. Seventy-nine febrile episodes were analyzed in 79 patients, 43 men and 36 women. Forty-four patients were in the true bacteremia group. Significant differences in PCT (P<0.001), IL-8 (P<0.001), and IL-6 (P=0.002) values were found between patients with and without true bacteremia. CPR results were not significantly different between the groups (P=0.23). The cut-off point for PCT was 0.5 ng/mL and this parameter yielded the best specificity at 91.4%, with a sensitivity of 59.1%. Among the infection markers studied, PCT provided the most information for diagnosing bacteremia in cancer patients. (c) 2009 Elsevier España, S.L. All rights reserved.

  14. Protein arginine methyltransferase 7 has a novel homodimer-like structure formed by tandem repeats.

    PubMed

    Hasegawa, Morio; Toma-Fukai, Sachiko; Kim, Jun-Dal; Fukamizu, Akiyoshi; Shimizu, Toshiyuki

    2014-05-21

    Protein arginine methyltransferase 7 (PRMT7) is a member of a family of enzymes that catalyze the transfer of methyl groups from S-adenosyl-l-methionine to nitrogen atoms on arginine residues. Here, we describe the crystal structure of Caenorhabditis elegans PRMT7 in complex with its reaction product S-adenosyl-L-homocysteine. The structural data indicated that PRMT7 harbors two tandem repeated PRMT core domains that form a novel homodimer-like structure. S-adenosyl-L-homocysteine bound to the N-terminal catalytic site only; the C-terminal catalytic site is occupied by a loop that inhibits cofactor binding. Mutagenesis demonstrated that only the N-terminal catalytic site of PRMT7 is responsible for cofactor binding. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  15. Local delivery of interleukin-12 using T cells targeting VEGF receptor-2 eradicates multiple vascularized tumors in mice.

    PubMed

    Chinnasamy, Dhanalakshmi; Yu, Zhiya; Kerkar, Sid P; Zhang, Ling; Morgan, Richard A; Restifo, Nicholas P; Rosenberg, Steven A

    2012-03-15

    We investigated the feasibility of delivering the proinflammatory cytokine interleukin (IL)-12 into tumor using T cells genetically engineered to express a chimeric antigen receptor (CAR) against the VEGF receptor-2 (VEGFR-2). Two different strains of mice bearing five different established subcutaneous tumors were treated with syngeneic T cells cotransduced with an anti-VEGFR-2 CAR and a constitutively expressed single-chain murine IL-12 or an inducible IL-12 gene after host lymphodepletion. Tumor regression, survival of mice, and persistence of the transferred cells were evaluated. Adoptive transfer of syngeneic T cells cotransduced with an anti-VEGFR-2 CAR and a constitutively expressing single-chain IL-12 resulted in the regression of five different established tumors of different histologies without the need for IL-2 administration. T cells transduced with either anti-VEGFR-2 CAR or single-chain IL-12 alone did not alter the tumor growth indicating that both of them had to be expressed in the same cell to mediate tumor regression. Anti-VEGFR-2 CAR and IL-12-cotransduced T cells infiltrated the tumors, expanded, and persisted for prolonged periods. The antitumor effect did not require the presence of host T and B cells but was dependent on host IL-12R-expressing cells. The anti-VEGFR-2 CAR changed the immunosuppressive tumor environment by altering/reducing both the systemic and the intratumoral CD11b(+)Gr1(+) myeloid suppressor cell subsets that expressed VEGFR-2. These results suggest that targeted delivery of IL-12 into the tumor environment with T cells redirected against VEGFR-2 is a promising approach for treating patients with a variety of solid tumor types.

  16. Expression analysis of Toll like receptors and interleukins in Tharparkar cattle during acclimation to heat stress exposure.

    PubMed

    Bharati, Jaya; Dangi, S S; Mishra, S R; Chouhan, V S; Verma, V; Shankar, O; Bharti, M K; Paul, A; Mahato, Dilip K; Rajesh, G; Singh, G; Maurya, V P; Bag, S; Kumar, Puneet; Sarkar, M

    2017-04-01

    Six male Tharparkar cattle of 2-3 years old were selected for the study. After 15 days acclimation at thermo neutral zone (TNZ) in psychrometric chamber, animals were exposed at 42°C for 6h up to 23 days followed by 12 days of recovery period. Blood samples were collected during control period at TNZ (day 1, 5 and 12), after heat stress exposure (day 1-10, Short Term Heat Stress Acclimation - STHSA; day 15-23, Long Term Heat Stress Acclimation - LTHSA) and recovery period (day 7 and 12) and peripheral blood mononuclear cells (PBMCs) were isolated for RNA and protein extraction. Serum cortisol concentration was assessed by RIA. The mRNA and protein expression in PBMCs were determined by qPCR and western blot respectively. Samples at TNZ were taken as control. Serum cortisol concentration was increased (P<0.05) during STHSA and gradually declined during LTHSA. Toll like receptor 2 (TLR 2) expression was up regulated (P<0.05) during STHSA and declined to basal level during LTHSA and recovery phase. However, toll like receptor 4 (TLR 4) expression was up regulated (P<0.05) during STHSA and LTHSA while declined in recovery phase. Interleukin 2 (IL2) and interleukin 6 (IL 6) were up regulated (P<0.05) during STHSA and reduced to basal level during LTHSA. PBMCs culture study was conducted to study transcriptional abundance of TLR2/4 and IL2/6 at different temperature-time combinations. The present findings indicate that TLR 2/4 and IL 2/6 could possibly play a vital role in thermo tolerance in Tharparkar cattle during short term and long term heat stress exposure. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Homodimerization of the p51 Subunit of HIV-1 Reverse Transcriptase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zheng, X.; Mueller, G; Cuneo, M

    2010-01-01

    The dimerization of HIV reverse transcriptase (RT), required to obtain the active form of the enzyme, is influenced by mutations, non-nucleoside reverse transcriptase inhibitors (NNRTIs), nucleotide substrates, Mg ions, temperature, and specifically designed dimerization inhibitors. In this study, we have utilized nuclear magnetic resonance (NMR) spectroscopy of the [methyl-{sup 13}C]methionine-labeled enzyme and small-angle X-ray scattering (SAXS) to investigate how several of these factors influence the dimerization behavior of the p51 subunit. The {sup 1}H-{sup 13}C HSQC spectrum of p51 obtained at micromolar concentrations indicates that a significant fraction of the p51 adopts a 'p66-like' conformation. SAXS data obtained for p51more » samples were used to determine the fractions of monomer and dimer in the sample and to evaluate the conformation of the fingers/thumb subdomain. All of the p51 monomer observed was found to adopt the compact, 'p51C' conformation observed for the p51 subunit in the RT heterodimer. The NMR and SAXS data indicate that the p51 homodimer adopts a structure that is similar to the p66/p51 heterodimer, with one p51C subunit and a second p51 subunit in an extended, 'p51E' conformation that resembles the p66 subunit of the heterodimer. The fractional dimer concentration and the fingers/thumb orientation are found to depend strongly on the experimental conditions and exhibit a qualitative dependence on nevirapine and ionic strength (KCl) that is similar to the behavior reported for the heterodimer and the p66 homodimer. The L289K mutation interferes with p51 homodimer formation as it does with formation of the heterodimer, despite its location far from the dimer interface. This effect is readily interpreted in terms of a conformational selection model, in which p51{sub L289K} has a much greater preference for the compact, p51C conformation. A reduced level of dimer formation then results from the reduced ratio of the p51E{sub L289K} to p

  18. Exogenous Thyropin from p41 Invariant Chain Diminishes Cysteine Protease Activity and Affects IL-12 Secretion during Maturation of Human Dendritic Cells

    PubMed Central

    Zavašnik-Bergant, Tina; Bergant Marušič, Martina

    2016-01-01

    Dendritic cells (DC) play a pivotal role as antigen presenting cells (APC) and their maturation is crucial for effectively eliciting an antigen-specific immune response. The p41 splice variant of MHC class II-associated chaperone, called invariant chain p41 Ii, contains an amino acid sequence, the p41 fragment, which is a thyropin-type inhibitor of proteolytic enzymes. The effects of exogenous p41 fragment and related thyropin inhibitors acting on human immune cells have not been reported yet. In this study we demonstrate that exogenous p41 fragment can enter the endocytic pathway of targeted human immature DC. Internalized p41 fragment has contributed to the total amount of the immunogold labelled p41 Ii-specific epitope, as quantified by transmission electron microscopy, in particular in late endocytic compartments with multivesicular morphology where antigen processing and binding to MHC II take place. In cell lysates of treated immature DC, diminished enzymatic activity of cysteine proteases has been confirmed. Internalized exogenous p41 fragment did not affect the perinuclear clustering of acidic cathepsin S-positive vesicles typical of mature DC. p41 fragment is shown to interfere with the nuclear translocation of NF-κB p65 subunit in LPS-stimulated DC. p41 fragment is also shown to reduce the secretion of interleukin-12 (IL-12/p70) during the subsequent maturation of treated DC. The inhibition of proteolytic activity of lysosomal cysteine proteases in immature DC and the diminished capability of DC to produce IL-12 upon their subsequent maturation support the immunomodulatory potential of the examined thyropin from p41 Ii. PMID:26960148

  19. Bleomycin/interleukin-12 electrochemogenetherapy for treating naturally occurring spontaneous neoplasms in dogs.

    PubMed

    Reed, S D; Fulmer, A; Buckholz, J; Zhang, B; Cutrera, J; Shiomitsu, K; Li, S

    2010-08-01

    On the basis of superior outcomes from electrochemogenetherapy (ECGT) compared with electrochemotherapy in mice, we determined the efficacy of ECGT applied to spontaneous canine neoplasms. Intralesional bleomycin (BLM) and feline interleukin-12 DNA injection combined with translesional electroporation resulted in complete cure of two recurrent World Health Organization stage T(2b)N(0)M(0) oral squamous cell carcinomas (SCCs) and one T(2)N(0)M(0) acanthomatous ameloblastoma. Three remaining dogs, which had no other treatment options, had partial responses to ECGT; one had mandibular T(3b)N(2b)M(1) melanoma with pulmonary and lymph node metastases; one had cubital T(3)N(0)M(1) histiocytic sarcoma with spleen metastases; and one had soft palate T(3)N(0)M(0) fibrosarcoma. The melanoma dog had decrease in the size of the primary tumor before recrudescence and euthanasia. The histiocytic sarcoma dog had resolution of the primary tumor, but was euthanized because of metastases 4 months after the only treatment. The dog with T(3)N(0)M(0) fibrosarcoma had tumor regression with recrudescence. Treatment was associated with minimal side effects and was easy to perform, was associated with repair of bone lysis in cured dogs, improved quality of life for dogs with partial responses and extended overall survival time. ECGT seems to be a safe and resulted in complete responses in SCC and acanthomatous ameloblastoma.

  20. 40 CFR 53.12 - Request for hearing on cancellation.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 5 2010-07-01 2010-07-01 false Request for hearing on cancellation. 53.12 Section 53.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) AMBIENT AIR MONITORING REFERENCE AND EQUIVALENT METHODS General Provisions § 53.12 Request for...

  1. Identification of interleukin genes in Pogona vitticeps using a de novo transcriptome assembly from RNA-seq data.

    PubMed

    Livernois, Alexandra; Hardy, Kristine; Domaschenz, Renae; Papanicolaou, Alexie; Georges, Arthur; Sarre, Stephen D; Rao, Sudha; Ezaz, Tariq; Deakin, Janine E

    2016-10-01

    Interleukins are a group of cytokines with complex immunomodulatory functions that are important for regulating immunity in vertebrate species. Reptiles and mammals last shared a common ancestor more than 350 million years ago, so it is not surprising that low sequence identity has prevented divergent interleukin genes from being identified in the central bearded dragon lizard, Pogona vitticeps, in its genome assembly. To determine the complete nucleotide sequences of key interleukin genes, we constructed full-length transcripts, using the Trinity platform, from short paired-end read RNA sequences from stimulated spleen cells. De novo transcript reconstruction and analysis allowed us to identify interleukin genes that are missing from the published P. vitticeps assembly. Identification of key cytokines in P. vitticeps will provide insight into the essential molecular mechanisms and evolution of interleukin gene families and allow for characterization of the immune response in a lizard for comparison with mammals.

  2. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  3. Interleukins for the paediatric pulmonologist.

    PubMed

    Rozycki, Henry J; Zhao, Wei

    2014-03-01

    Interleukins are critical immune modulators and since their first description in 1977, there has been a steady increase in the recognition of their roles in many paediatric respiratory diseases. This basic and clinical knowledge is now maturing into both approved and investigational therapies aimed at blocking or modifying the interleukin response. The purpose of this review is to bring up to date what is known about interleukin function in paediatric pulmonology, focusing on nine important lung conditions. This is followed by summaries about 18 interleukins which have been associated with these paediatric pulmonary conditions. Throughout, emphasis is placed on where interventions have been tested. Over the next several years, it is likely that many more treatments based on interleukin biology and function will become available and understanding the basis for these therapies will allow the practicing paediatric pulmonologist to take appropriate advantage of them. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Haptoglobin gene polymorphisms and interleukin-6 and -8 levels in patients with sickle cell anemia

    PubMed Central

    Pierrot-Gallo, Bruna Spinella; Vicari, Perla; Matsuda, Sandra Satiko; Adegoke, Samuel Ademola; Mecabo, Grazielle; Figueiredo, Maria Stella

    2015-01-01

    Background Haptoglobin genotypes, and interleukin-6 and -8 participate in the pathophysiology of sickle cell anemia. The expression of cytokines is regulated by genetic mechanisms however the effect of haptoglobin polymorphisms on these cytokines is not fully understood. This study aimed to compare the frequency of haptoglobin genotypes and the interleukin-6 and -8 concentrations in sickle cell anemia patients and controls to investigate the association between haptoglobin genotypes and cytokine levels. Methods Sixty sickle cell anemia patients and 74 healthy individuals were analyzed. Haptoglobin genotypes were determined by multiplex polymerase chain reaction, and the interleukin-6 and -8 levels by enzyme linked immunosorbent assay. The association between haptoglobin genotypes and cytokines was investigated by statistical tests. Results Hp2-1 was the most common genotype in both the cases and controls while Hp1-1 was less frequent among sickle cell anemia patients. Interleukin-6 and -8 levels were higher in patients than controls (p-value <0.0001). There was no significant difference in interleukin-6 and -8 concentrations between the genotypes (p-value >0.05). A similar trend was observed among the controls. Conclusion Although, levels of interleukin-6 and -8 were higher in the sickle cell anemia patients, they appeared not to be related to the haptoglobin genotypes. Further investigations are necessary to identify factors responsible for increased secretion of the interleukin-6 and -8 pro-inflammatory cytokines in patients with sickle cell anemia. PMID:26408368

  5. Crystal structure and functional characterization of yeast YLR011wp, an enzyme with NAD(P)H-FMN and ferric iron reductase activities.

    PubMed

    Liger, Dominique; Graille, Marc; Zhou, Cong-Zhao; Leulliot, Nicolas; Quevillon-Cheruel, Sophie; Blondeau, Karine; Janin, Joël; van Tilbeurgh, Herman

    2004-08-13

    Flavodoxins are involved in a variety of electron transfer reactions that are essential for life. Although FMN-binding proteins are well characterized in prokaryotic organisms, information is scarce for eukaryotic flavodoxins. We describe the 2.0-A resolution crystal structure of the Saccharomyces cerevisiae YLR011w gene product, a predicted flavoprotein. YLR011wp indeed adopts a flavodoxin fold, binds the FMN cofactor, and self-associates as a homodimer. Despite the absence of the flavodoxin key fingerprint motif involved in FMN binding, YLR011wp binds this cofactor in a manner very analogous to classical flavodoxins. YLR011wp closest structural homologue is the homodimeric Bacillus subtilis Yhda protein (25% sequence identity) whose homodimer perfectly superimposes onto the YLR011wp one. Yhda, whose function is not documented, has 53% sequence identity with the Bacillus sp. OY1-2 azoreductase. We show that YLR011wp has an NAD(P)H-dependent FMN reductase and a strong ferricyanide reductase activity. We further demonstrate a weak but specific reductive activity on azo dyes and nitrocompounds.

  6. New Role for Interleukin-13 Receptor α1 in Myocardial Homeostasis and Heart Failure.

    PubMed

    Amit, Uri; Kain, David; Wagner, Allon; Sahu, Avinash; Nevo-Caspi, Yael; Gonen, Nir; Molotski, Natali; Konfino, Tal; Landa, Natalie; Naftali-Shani, Nili; Blum, Galia; Merquiol, Emmanuelle; Karo-Atar, Danielle; Kanfi, Yariv; Paret, Gidi; Munitz, Ariel; Cohen, Haim Y; Ruppin, Eytan; Hannenhalli, Sridhar; Leor, Jonathan

    2017-05-20

    The immune system plays a pivotal role in myocardial homeostasis and response to injury. Interleukins-4 and -13 are anti-inflammatory type-2 cytokines, signaling via the common interleukin-13 receptor α1 chain and the type-2 interleukin-4 receptor. The role of interleukin-13 receptor α1 in the heart is unknown. We analyzed myocardial samples from human donors (n=136) and patients with end-stage heart failure (n=177). We found that the interleukin-13 receptor α1 is present in the myocardium and, together with the complementary type-2 interleukin-4 receptor chain Il4ra , is significantly downregulated in the hearts of patients with heart failure. Next, we showed that Il13ra1 -deficient mice develop severe myocardial dysfunction and dyssynchrony compared to wild-type mice (left ventricular ejection fraction 29.7±9.9 versus 45.0±8.0; P =0.004, left ventricular end-diastolic diameter 4.2±0.2 versus 3.92±0.3; P =0.03). A bioinformatic analysis of mouse hearts indicated that interleukin-13 receptor α1 regulates critical pathways in the heart other than the immune system, such as extracellular matrix (normalized enrichment score=1.90; false discovery rate q=0.005) and glucose metabolism (normalized enrichment score=-2.36; false discovery rate q=0). Deficiency of Il13ra1 was associated with reduced collagen deposition under normal and pressure-overload conditions. The results of our studies in humans and mice indicate, for the first time, a role of interleukin-13 receptor α1 in myocardial homeostasis and heart failure and suggests a new therapeutic target to treat heart disease. © 2017 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  7. Polymorphisms in interleukins 17A and 17F genes and periodontitis: results from a meta-analysis.

    PubMed

    da Silva, Felipe Rodolfo Pereira; Pessoa, Larissa Dos Santos; Vasconcelos, Any Carolina Cardoso Guimarães; de Aquino Lima, Weberson; Alves, Even Herlany Pereira; Vasconcelos, Daniel Fernando Pereira

    2017-12-01

    Polymorphisms in inflammatory genes such as interleukins 17A and 17F are associated with the risk of development of periodontitis, although the results remain contradictory. Hence, the aim of this study was perform a meta-analysis focusing on two polymorphisms (rs2275913 and rs763780) in interleukins 17A and 17F genes, respectively, in both chronic (CP) and aggressive periodontitis (AgP). A review in literature was performed in several databases for studies published before 25, September 2016. The meta-analysis was obtained through the review manager statistical software (version 5.2) with odds ratio (OR) calculation and funnel plot (P < 0.05) for heterogeneity, as well as the comprehensive meta-analysis software (version 3.3.070) for the assessment of publication bias. Seven articles with 1540 participants composed the results in which the mutant allele in the rs2275913 polymorphism did not present significant association with the risk of CP or AgP (OR 1.56, 95% CI 0.77, 3.15, P = 0.21; OR 1.12, 95% CI 0.05, 23.44, P = 0.94, respectively) nor was the mutant allele in rs763780 associated with the risk of CP (OR 1.19, 95% CI 0.80, 1.76, P = 0.39) or AgP (OR 1.07, 95% CI 0.63, 1.84, P = 0.79). No bias of publication was observed by Egger's and Begg's tests in any allelic evaluation. This meta-analysis showed a non-significant association between the polymorphisms rs2275913 and rs763780 in interleukins 17A and 17F genes and chronic and aggressive periodontitis in the allelic evaluation.

  8. Interleukin-6, interleukin-8, and soluble tumor necrosis factor receptor-I in the cord blood as predictors of chronic lung disease in premature infants.

    PubMed

    An, Hiromi; Nishimaki, Shigeru; Ohyama, Makiko; Haruki, Atsushi; Naruto, Takuya; Kobayashi, Naoki; Sugai, Toshiyuki; Kobayashi, Yoshinori; Mori, Masaaki; Seki, Kazuo; Yokota, Shumpei

    2004-11-01

    In order to predict the late-development of chronic lung disease of prematurity (CLD), cytokines in the cord blood were assessed in this study. Eighteen premature infants with CLD were enrolled. Cord blood plasma levels of cytokines of these infants and 12 control infants without CLD were measured including interleukin (IL)-1beta, IL-2, IL-4, IL-6, IL-8, IL-10, interferon (IFN)-gamma, tumor necrosis factor (TNF)-alpha, soluble TNF receptor-I, and soluble IL-6 receptor using a cytometric bead array and an enzyme-linked immunosorbent assay. The cord blood IL-6, IL-8, and sTNFR-I levels were significantly elevated in CLD infants compared with those in control (P < .05). IL-1beta, IL-2, IL-4, IL-10, and IFN-gamma were undetectable in both groups. CLD infants with maternal chorioamnionitis had higher IL-6 than those without chorioamnionitis (P < .01). In CLD infants, IL-6 was higher in the infants who required prolonged oxygen therapy (P < .05). Elevated inflammatory cytokines in the cord blood are associated with the progression to CLD.

  9. Evaluation of Interleukin-17 and Interleukin-23 in Pterygium: Immunohistochemistry Study.

    PubMed

    Tiong, Kiew Ing; Mohd Zahidin, Aida Zairani; Sumugam, S Kala A/P; Uchang, Joseph; Mohd Isa, Hazlita Dato'

    2017-01-01

    To compare the interleukin-17 (IL-17) and interleukin-23 (IL-23) positive cell counts between pterygium and normal conjunctiva. A case-control study. This study received ethical approval (NMRR Research ID 23957) and informed consent was obtained from all participants. It involved 20 participants with 20 samples of pterygium and 20 samples of normal conjunctiva that were obtained from the same eye of each participant. All the participants underwent history taking, slit lamp examination, and pterygium excision surgery. Both samples underwent immunohistochemistry procedure. Pretreatment procedure was conducted using heat-induced epitope retrieval with PT link, subsequently followed by EnVision FLEX staining procedure and incubation with anti‒IL-17 antibody and anti‒IL-23 antibody. Slides were examined in high-power fields (400x) for both samples in 3 different fields. Total positive stained cell counts in all 3 fields with IL-17 and IL-23 between pterygium and normal conjunctiva were analyzed by using Wilcoxon signed rank test. IL-17 positive cell counts for normal conjunctiva showed mean 196.10 ± 80.487 but for pterygium was 331.10 ± 108.416. As for IL-23, the mean for positive cell counts for normal conjunctiva was 62.10 ± 33.462 and IL-23 positive cell counts for pterygium showed mean 102.95 ± 41.378. Both IL-17 and IL-23 were significantly increased in pterygium compared with normal conjunctiva (P < 0.001). Both IL-17 and IL-23 were found to be significantly higher in the pterygium group than in the normal conjunctiva group with P < 0.001 by Wilcoxon signed rank test. Copyright 2017 Asia-Pacific Academy of Ophthalmology.

  10. Neuropsychiatric systemic lupus erythematosus is associated with imbalance in interleukin 10 promoter haplotypes

    PubMed Central

    Rood, M; Keijsers, V; van der Linden, M W; Tong, T; Borggreve, S; Verweij, C; Breedveld, F; Huizinga, T

    1999-01-01

    OBJECTIVE—To investigate the association of interleukin 10 (IL10) promoter polymorphisms and neuropsychiatric manifestations of systemic lupus erythematosus (SLE).
METHODS—IL10 haplotypes of 11 healthy volunteers were cloned to confirm that in the Dutch population, only the three common haplotypes (-1082/-819/-592) GCC, ACC and ATA exist. The IL10 promoter polymorphisms of 92 SLE patients and 162 healthy controls were determined. The medical records of the SLE patients were screened for the presence of neuropsychiatric involvement.
RESULTS—All cloned haplotypes were either GCC, ACC or ATA. Forty two SLE patients had suffered from neuropsychiatric manifestations (NP-SLE). In NP-SLE patients, the frequency of the ATA haplotype is 30% versus 18% in the controls and 17% in the non-NP-SLE group (odds ratios 1.9, p=0.02, and 2.1, p=0.04, respectively), whereas the GCC haplotype frequency is lower in the NP-SLE group compared with controls and non-NP-SLE patients (40% versus 55% and 61%, odds ratios 0.6, p=0.02 and 0.4 p=0.006). The odds ratio for the presence of NP-SLE is inversely proportional to the number of GCC haplotypes per genotype when the NP-SLE group is compared with non-NP-SLE patients.
CONCLUSIONS—The IL10 locus is associated with neuropsychiatric manifestations in SLE. This suggests that IL10 is implicated in the immunopathogenesis of neuropsychiatric manifestations in SLE.

 Keywords: systemic lupus erythematosus; neuropsychiatric manifestations; genetics; interleukin 10 promoter haplotypes PMID:10343522

  11. Natural Killer Cell Activity and Interleukin-12 in Metabolically Healthy versus Metabolically Unhealthy Overweight Individuals

    PubMed Central

    Kim, Minjoo; Kim, Minkyung; Yoo, Hye Jin; Lee, Jong Ho

    2017-01-01

    The purpose of this study was to determine whether the immune system is involved in the different metabolic circumstances in healthy and unhealthy overweight individuals. We examined the metabolic and immune characteristics of 117 overweight individuals. Subjects were classified as metabolically healthy overweight (MHO, n = 72) or metabolically unhealthy overweight (MUO, n = 45). The immune response was measured by circulating levels of natural killer (NK) cell activity and cytokines. Both groups were comparable with regards to age, sex distribution, smoking and drinking status, and body mass index. When compared to the MHO group, the MUO group showed higher systolic and diastolic blood pressure, serum levels of triglyceride, glucose, glucose-related markers, and lower levels of HDL cholesterol. Compared to the MHO group, the MUO group showed 39% lower interferon-γ levels (not significant) and 41% lower interleukin (IL)-12 levels (significant). The MUO group also showed lower NK cell activity at E:T ratios of 10:1, 5:1, 2.5:1, and 1.25:1 (all Ps < 0.05) than the MHO group. This study indicates that individuals displaying the MUO phenotype present an unfavorable immune system with lower NK cell activities under all assay conditions and lower serum levels of IL-12 than the activities and levels in similarly overweight MHO individuals. This result suggests that the immune system may be altered in overweight individuals who are at risk for overweight/obesity-related comorbidities. PMID:29238351

  12. Functional Analysis of the p40 and p75 Proteins from Lactobacillus casei BL23

    PubMed Central

    Bäuerl, Christine; Pérez-Martínez, Gaspar; Yan, Fang; Polk, D. Brent; Monedero, Vicente

    2011-01-01

    The genomes of Lactobacillus casei/paracasei and Lactobacillus rhamnosus strains carry two genes encoding homologues of p40 and p75 from L. rhamnosus GG, two secreted proteins which display anti-apoptotic and cell protective effects on human intestinal epithelial cells. p40 and p75 carry cysteine, histidine-dependent aminohydrolase/peptidase (CHAP) and NLPC/P60 domains, respectively, which are characteristic of proteins with cell-wall hydrolase activity. In L. casei BL23 both proteins were secreted to the growth medium and were also located at the bacterial cell surface. The genes coding for both proteins were inactivated in this strain. Inactivation of LCABL_00230 (encoding p40) did not result in a significant difference in phenotype, whereas a mutation in LCABL_02770 (encoding p75) produced cells that formed very long chains. Purified glutathione-S-transferase (GST)-p40 and -p75 fusion proteins were able to hydrolyze the muropeptides from L. casei cell walls. Both fusions bound to mucin, collagen and to intestinal epithelial cells and, similar to L. rhamnosus GG p40, stimulated epidermal growth factor receptor phosphorylation in mouse intestine ex vivo. These results indicate that extracellular proteins belonging to the machinery of cell-wall metabolism in the closely related L. casei/paracasei-L. rhamnosus group are most likely involved in the probiotic effects described for these bacteria PMID:21178363

  13. Differential regulation of interleukin-12 (IL-12), tumor necrosis factor alpha, and IL-1 beta production in human myeloid leukemia cell lines and peripheral blood mononuclear cells.

    PubMed

    Kubin, M; Chow, J M; Trinchieri, G

    1994-04-01

    Natural killer cell-stimulatory factor or interleukin-12 (NKSF/IL-12) was originally identified and purified from the conditioned medium of Epstein-Barr virus (EBV)-transformed B-cell lines. Phorbol diesters were observed to be potent stimulators of NKSF/IL-12 production from the B-cell lines. Although monocytes were found to be the major producers of NKSF/IL-12 in peripheral blood (PB) in response to lipopolysaccharide (LPS) or to Staphylococcus aureus, several myeloid leukemia cell lines tested did not produce detectable NKSF/IL-12 either constitutively or upon stimulation with phorbol diesters. However, three lines, ML-3, HL-60, and THP-1, responded to LPS with significant levels of NKSF/IL-12 production, whereas S aureus was effective only on THP-1 cells. When the cell lines were preincubated with compounds known to induce them to differentiate, production of tumor necrosis factor alpha (TNF alpha) and IL-1 beta was in most cases maximal in cells with differentiated characteristics, whereas NKSF/IL-12 production in response to LPS in all three producing cell lines was significantly enhanced only by pretreatment with dimethylsulfoxide (DMSO) for 24 hours, or by costimulation with interferon gamma (IFN gamma). The efficiency of DMSO enhancement of NKSF/IL-12 production decreased after 2 to 5 days of incubation, when the cells acquired differentiated characteristics. Unlike DMSO, IFN gamma enhanced NKSF/IL-12 production, and IL-10 and dexamethasone inhibited it in cell lines and PB mononuclear cells stimulated by either LPS or S aureus. The ability of the cell lines to respond to these mediators of possibly physiologically relevant function provides a tissue-culture model for studying their mechanism of action.

  14. The administration of IL-12/GM-CSF and Ig-4-1BB ligand markedly decreases murine floor of mouth squamous cell cancer.

    PubMed

    Adappa, Nithin D; Sung, Chi-Kwang; Choi, Bryan; Huang, Tian-Gui; Genden, Eric M; Shin, Edward J

    2008-09-01

    To assess immune-based gene therapy in a murine floor of mouth (FOM) squamous cell carcinoma (SCC) model. In vitro and in vivo testing of immune therapy for SCC. Multiple SCC lines were infected by using advRSV-interleukin-12 (IL-12) and advCMV-interleukin-12/granulocyte macrophage colony-stimulating factor (IL-12/GM-CSF) and monitored for production of IL-12 and GM-CSF. Intratumoral injections of viral vectors were administered with systemic Ig-4-1BB ligand in an orthotopic murine FOM SCC model and followed for tumor size and survival. In vitro, all cell lines produced substantial levels of IL-12 and GM-CSF. In vivo, tumors treated with advCMV-IL-12/GM-CSF and Ig-4-1BBL showed a striking reduction in tumor volume (vs control P<0.0001) and improved median survival (38 days vs 19 days for control, P<0.0001). Combination immune-based therapies effectively improve survival in mice bearing FOM SCC over single-modality therapy.

  15. Production and characterization of active recombinant interleukin-12/eGFP fusion protein in stably-transfected DF1 chicken cells.

    PubMed

    Wu, Hsing Chieh; Chen, Yu San; Shen, Pin Chun; Shien, Jui Hung; Lee, Long Huw; Chiu, Hua Hsien

    2015-01-01

    The adjuvant activity of chicken interleukin-12 (chIL-12) protein has been described as similar to that of mammalian IL-12. Recombinant chIL-12 can be produced using several methods, but chIL-12 production in eukaryotic cells is lower than that in prokaryotic cells. Stimulating compounds, such as dimethyl sulfoxide (DMSO), can be added to animal cell cultures to overcome this drawback. In this study, we constructed a cell line, DF1/chIL-12 which stably expressed a fusion protein, chIL-12 and enhanced green fluorescent protein (eGFP) connected by a (G4 S)3 linker sequence. Fusion protein production was increased when cells were cultured in the presence of DMSO. When 1 × 10(6) DF1/chIL-12 cells were inoculated in a T-175 flask containing 30 mL of media, incubated for 15 h, and further cultivated in the presence of 4% DMSO for 48 h, the production of total fusion protein was mostly enhanced compared with the production of total fusion protein by using cell lysates induced with DMSO at other concentrations. The concentrations of the unpurified and purified total fusion proteins in cell lysates were 2,781 ± 2.72 ng mL(-1) and 2,207 ± 3.28 ng mL(-1) , respectively. The recovery rate was 79%. The fusion protein stimulated chicken splenocytes to produce IFN-γ, which was measured using an enzyme-linked immunosorbent assay, in the culture supernatant, indicating that treating DF1/chIL-12 cells with DMSO or producing chIL-12 in a fusion protein form does not have adverse effects on the bioactivity of chIL-12. © 2015 American Institute of Chemical Engineers.

  16. Conformational dynamics of cancer-associated MyD88-TIR domain mutant L252P (L265P) allosterically tilts the landscape toward homo-dimerization

    PubMed Central

    Zhan, Chendi; Qi, Ruxi; Wei, Guanghong; Guven-Maiorov, Emine; Nussinov, Ruth; Ma, Buyong

    2016-01-01

    MyD88 is an essential adaptor protein, which mediates the signaling of the toll-like and interleukin-1 receptors’ superfamily. The MyD88 L252P (L265P) mutation has been identified in diffuse large B-cell lymphoma. The identification of this mutation has been a major advance in the diagnosis of patients with aldenstrom macroglobulinemia and related lymphoid neoplasms. Here we used computational methods to characterize the conformational effects of the mutation. Our molecular dynamics simulations revealed that the mutation allosterically quenched the global conformational dynamics of the toll/IL-1R (TIR) domain, and readjusted its salt bridges and dynamic community network. Specifically, the mutation changed the orientation and reduced the fluctuation of α-helix 3, possibly through eliminating/weakening ~8 salt bridges and enhancing the salt bridge D225-K258. Using the energy landscape of the TIR domains of MyD88, we identified two dynamic conformational basins, which correspond to the binding sites used in homo- and hetero-oligomerization, respectively. Our results indicate that the mutation stabilizes the core of the homo-dimer interface of the MyD88-TIR domain, and increases the population of homo-dimer-compatible conformational states in MyD88 family proteins. However, the dampened motion restricts its ability to heterodimerize with other TIR domains, thereby curtailing physiological signaling. In conclusion, the L252P both shifts the landscape toward homo-dimerization and restrains the dynamics of the MyD88-TIR domain, which disfavors its hetero-dimerization with other TIR domains. We further put these observations within the framework of MyD88-mediated cell signaling. PMID:27503954

  17. 12 CFR 40.4 - Initial privacy notice to consumers required.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Initial privacy notice to consumers required. 40.4 Section 40.4 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.4 Initial privacy notice to...

  18. 12 CFR 40.4 - Initial privacy notice to consumers required.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Initial privacy notice to consumers required. 40.4 Section 40.4 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.4 Initial privacy notice to...

  19. Preliminary evaluation of safety and activity of recombinant human interleukin 11 in patients with active Crohn's disease.

    PubMed

    Sands, B E; Bank, S; Sninsky, C A; Robinson, M; Katz, S; Singleton, J W; Miner, P B; Safdi, M A; Galandiuk, S; Hanauer, S B; Varilek, G W; Buchman, A L; Rodgers, V D; Salzberg, B; Cai, B; Loewy, J; DeBruin, M F; Rogge, H; Shapiro, M; Schwertschlag, U S

    1999-07-01

    Recombinant human interleukin 11 (rhIL-11) is a cytokine with thrombocytopoietic activity and anti-inflammatory and mucosal protective effects. The objectives of this study were to investigate the safety and tolerability of rhIL-11 in patients with Crohn's disease and to explore the effects of dose and schedule on platelet count and Crohn's disease activity. A multicenter, double-masked, placebo-controlled, dose-escalation study of 76 patients with active Crohn's disease was performed. Patients were randomized to receive subcutaneous placebo or rhIL-11 at doses of 5, 16, or 40 microgram. kg-1. wk-1 given 2 or 5 times weekly for 3 weeks. Clinical and laboratory safety data were recorded, and disease activity was measured at each visit. Subcutaneous injection of rhIL-11 generally was well tolerated. Significantly greater increases in platelet counts were found among patients receiving rhIL-11 40 microgram. kg-1. wk-1 as 2 or 5 weekly doses and 16 microgram. kg-1. week-1 as 5 weekly doses compared with patients receiving placebo (P < 0.05). Patients receiving 16 microgram. kg-1. wk-1 had the highest clinical response rates, with a response seen in 42% of patients (5/12) receiving 5 weekly doses and 33% of patients (4/12) receiving 2 weekly doses, compared with 7% of patients (1/15) receiving placebo. Short-term treatment with rhIL-11 is well tolerated in patients with active Crohn's disease. The thrombocytopoietic effect of rhIL-11 seems to be both dose and schedule dependent and may be minimized with retained clinical benefit in Crohn's disease at 16 microgram. kg-1. wk-1 given in 2 equal doses.

  20. Attempts on producing lymphoid cell line from Penaeus monodon by induction with SV40-T and 12S EIA oncogenes.

    PubMed

    Puthumana, Jayesh; Prabhakaran, Priyaja; Philip, Rosamma; Singh, I S Bright

    2015-12-01

    In an attempt of in vitro transformation, transfection mediated expression of Simian virus-40 (T) antigen (SV40-T) and transduction mediated expression of Adenovirus type 12 early region 1A (12S E1A) oncogene were performed in Penaeus monodon lymphoid cells. pSV3-neo vector encoding SV40-T oncogene and a recombinant baculovirus BacP2-12S E1A-GFP encoding 12S E1A oncogene under the control of hybrid promoters were used. Electroporation and lipofection mediated transformation of SV40-T in lymphoid cells confirmed the transgene expression by phenotypic variation and the expression of GFP in co-transfection experiment. The cells transfected by lipofection (≥ 5%) survived for 14 days with lower toxicity (30%), whilst on electroporation, most of the cells succumbed to death (60%) and survived cells lived up to 7 days. Transduction efficiency in primary lymphoid cells was more than 80% within 14 days of post-transduction, however, an incubation period of 7 days post-transduction was observed without detectable expression of 12S E1A. High level of oncogenic 12S E1A expression were observed after 14 day post-transduction and the proliferating cells survived for more than 90 days with GFP expression, however, without in vitro transformation and immortalization. The study put forth the requirement of transduction mediated 'specific' oncogene expression along with telomerase activation and epigenetic induction for the immortalization and establishment of shrimp cell line. Copyright © 2015. Published by Elsevier Ltd.

  1. Interleukin-1 antagonism in type 1 diabetes of recent onset: two multicentre, randomised, double-blind, placebo-controlled trials

    PubMed Central

    Moran, Antoinette; Bundy, Brian; Becker, Dorothy J; DiMeglio, Linda A; Gitelman, Stephen E; Goland, Robin; Greenbaum, Carla J; Herold, Kevan C; Marks, Jennifer B; Raskin, Philip; Sanda, Srinath; Schatz, Desmond; Wherrett, Diane K; Wilson, Darrell M; Krischer, Jeffrey P; Skyler, Jay S; Pickersgill, Linda; de Koning, Eelco; Ziegler, Anette-G; Böehm, Bernhard; Badenhoop, Klaus; Schloot, Nanette; Bak, Jens Friis; Pozzilli, Paolo; Mauricio, Didac; Donath, Marc Y; Castaño, Luis; Wägner, Ana; Lervang, Hans Henrik; Perrild, Hans; Poulsen, Thomas Mandrup

    2013-01-01

    and 25 anakinra-treated and 26 placebo-treated patients in the anakinra trial were included in the primary analyses. The difference in C peptide area under curve between the canakinumab and placebo groups at 12 months was 0·01 nmol/L (95% CI −0·11 to 0·14; p=0·86), and between the anakinra and the placebo groups at 9 months was 0·02 nmol/L (−0·09 to 0·15; p=0·71). The number and severity of adverse events did not differ between groups in the canakinumab trial. In the anakinra trial, patients in the anakinra group had significantly higher grades of adverse events than the placebo group (p=0·018), which was mainly because of a higher number of injection site reactions in the anakinra group. Interpretation Canakinumab and anakinra were safe but were not effective as single immunomodulatory drugs in recent-onset type 1 diabetes. Interleukin-1 blockade might be more effective in combination with treatments that target adaptive immunity in organ-specific autoimmune disorders. Funding National Institutes of Health and Juvenile Diabetes Research Foundation. PMID:23562090

  2. Interleukin-1 antagonism in type 1 diabetes of recent onset: two multicentre, randomised, double-blind, placebo-controlled trials.

    PubMed

    Moran, Antoinette; Bundy, Brian; Becker, Dorothy J; DiMeglio, Linda A; Gitelman, Stephen E; Goland, Robin; Greenbaum, Carla J; Herold, Kevan C; Marks, Jennifer B; Raskin, Philip; Sanda, Srinath; Schatz, Desmond; Wherrett, Diane K; Wilson, Darrell M; Krischer, Jeffrey P; Skyler, Jay S; Pickersgill, Linda; de Koning, Eelco; Ziegler, Anette-G; Böehm, Bernhard; Badenhoop, Klaus; Schloot, Nanette; Bak, Jens Friis; Pozzilli, Paolo; Mauricio, Didac; Donath, Marc Y; Castaño, Luis; Wägner, Ana; Lervang, Hans Henrik; Perrild, Hans; Mandrup-Poulsen, Thomas

    2013-06-01

    -treated patients in the anakinra trial were included in the primary analyses. The difference in C peptide area under curve between the canakinumab and placebo groups at 12 months was 0·01 nmol/L (95% CI -0·11 to 0·14; p=0·86), and between the anakinra and the placebo groups at 9 months was 0·02 nmol/L (-0·09 to 0·15; p=0·71). The number and severity of adverse events did not differ between groups in the canakinumab trial. In the anakinra trial, patients in the anakinra group had significantly higher grades of adverse events than the placebo group (p=0·018), which was mainly because of a higher number of injection site reactions in the anakinra group. Canakinumab and anakinra were safe but were not effective as single immunomodulatory drugs in recent-onset type 1 diabetes. Interleukin-1 blockade might be more effective in combination with treatments that target adaptive immunity in organ-specific autoimmune disorders. National Institutes of Health and Juvenile Diabetes Research Foundation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  3. Lactobacillus plantarum 299V in the treatment and prevention of spontaneous colitis in interleukin-10-deficient mice.

    PubMed

    Schultz, Michael; Veltkamp, Claudia; Dieleman, Levinus A; Grenther, Wetonia B; Wyrick, Pricilla B; Tonkonogy, Susan L; Sartor, R Balfour

    2002-03-01

    Interleukin (IL)-10-deficient (IL-10-/-) mice develop colitis under specific pathogen-free (SPF) conditions and remain disease free if kept sterile (germ free [GF]). We used four different protocols that varied the time-points of oral administration of Lactobacillus plantarum 299v (L. plantarum) relative to colonization with SPF bacteria to determine whether L. plantarum could prevent and treat colitis induced by SPF bacteria in IL-10-/- mice and evaluated the effect of this probiotic organism on mucosal immune activation. Assessment of colitis included blinded histologic scores, measurements of secreted colonic immunoglobulin isotypes, IL-12 (p40 subunit), and interferon (IFN)-gamma production by anti-CD3-stimulated mesenteric lymph node cells. Treating SPF IL-10-/- mice with L. plantarum attenuated previously established colonic inflammation as manifested by decreased mucosal IL-12, IFN-gamma, and immunoglobulin G2a levels. Colonizing GF animals with L. plantarum and SPF flora simultaneously had no protective effects. Gnotobiotic IL-10-/- mice monoassociated with L. plantarum exhibited mild immune system activation but no colitis. Pretreatment of GF mice by colonization with L. plantarum, then exposure to SPF flora and continued probiotic therapy significantly decreased histologic colitis scores. These results demonstrate that L. plantarum can attenuate immune-mediated colitis and suggest a potential therapeutic role for this agent in clinical inflammatory bowel diseases.

  4. Effects of modified Sanhuang decoction () enema on serum tumor necrosis factor-α and colonic mucosa interleukin-1β, interleukin-6 levels in ulcerative colitis rats.

    PubMed

    Wang, Shuai; Zhou, Tao; Zhai, Jun-Peng; Wang, Li-Hua; Chen, Jing

    2014-11-01

    To investigate the effects of Modified Sanhuang Decoction (, MSD) enema on the serum tumor necrosis factor alpha (TNF-α) and colonic mucosa interleukin-1β (IL-1β), interleukin-6 (IL-6) levels in experimental ulcerative colitis (UC) rats. Forty-five male Wistar rats were randomly divided into 4 groups: normal group (n=12), model group (n=11), salazosulfapyridine (SASP) group (n=11) and MSD group (n=11). The UC model was induced by 2,4,6-trinitrobenzene sulfonic acid (TNBS)/ethanol solution. Rats in the normal group and model group were clystered with 0.9% normal saline, while in the SASP group and MSD group were clystered with SASP and MSD enema, respectively. After drug administration (10 mL/kg body weight, for 7 days), colonic gross changes and colonic mucosa histology were observed, serum TNF-α and colonic mucosa IL-1β, IL-6 levels were tested by enzyme linked immunosorbent assay and radioimmunoassay, respectively. As compared with the normal group, the experimental UC rats, the colonic mucosal damage index scores (CMDIs), histopathological scores (HS) and the serum TNF-α and colonic mucosa IL-1β, IL-6 levels significantly increased (P<0.05 or P<0.01). In the MSD and SASP groups, the ulcer area significantly reduced, and edema disappeared. The CMDIs, HS, the serum TNF-α and colonic mucosa IL-1β, IL-6 levels in the MSD and SASP groups significantly decreased (P<0.05 or P<0.01) compared with the model group. The CMDIs in the MSD group were lower than that in the SASP group (P<0.05), but there were no significant differences in HS, serum TNF-α or colonic mucosa IL-1β, IL-6 levels between the MSD and SASP groups. MSD enema can improve colonic mucosa impairment and decrease serum TNF-α and colonic mucosa IL-1β, IL-6 levels in experimental UC.

  5. 12 CFR 40.5 - Annual privacy notice to customers required.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Annual privacy notice to customers required. 40.5 Section 40.5 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.5 Annual privacy notice to customers...

  6. 12 CFR 40.5 - Annual privacy notice to customers required.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Annual privacy notice to customers required. 40.5 Section 40.5 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.5 Annual privacy notice to customers...

  7. 12 CFR 550.40 - When do I have investment discretion?

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 5 2010-01-01 2010-01-01 false When do I have investment discretion? 550.40 Section 550.40 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY FIDUCIARY POWERS OF SAVINGS ASSOCIATIONS § 550.40 When do I have investment discretion? (a) General. You have...

  8. 12 CFR 550.40 - When do I have investment discretion?

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 5 2011-01-01 2011-01-01 false When do I have investment discretion? 550.40 Section 550.40 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY FIDUCIARY POWERS OF SAVINGS ASSOCIATIONS § 550.40 When do I have investment discretion? (a) General. You have...

  9. 12 CFR 652.40 - Stress tests for mortgage securities.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Stress tests for mortgage securities. 652.40... MORTGAGE CORPORATION FUNDING AND FISCAL AFFAIRS Investment Management § 652.40 Stress tests for mortgage securities. (a) You must perform stress tests to determine how interest rate changes will affect the cashflow...

  10. 12 CFR 652.40 - Stress tests for mortgage securities.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... MORTGAGE CORPORATION FUNDING AND FISCAL AFFAIRS Investment Management § 652.40 Stress tests for mortgage securities. (a) You must perform stress tests to determine how interest rate changes will affect the cashflow... 12 Banks and Banking 7 2012-01-01 2012-01-01 false Stress tests for mortgage securities. 652.40...

  11. 12 CFR 652.40 - Stress tests for mortgage securities.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... MORTGAGE CORPORATION FUNDING AND FISCAL AFFAIRS Investment Management § 652.40 Stress tests for mortgage securities. (a) You must perform stress tests to determine how interest rate changes will affect the cashflow... 12 Banks and Banking 6 2011-01-01 2011-01-01 false Stress tests for mortgage securities. 652.40...

  12. 12 CFR 652.40 - Stress tests for mortgage securities.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... MORTGAGE CORPORATION FUNDING AND FISCAL AFFAIRS Investment Management § 652.40 Stress tests for mortgage securities. (a) You must perform stress tests to determine how interest rate changes will affect the cashflow... 12 Banks and Banking 7 2013-01-01 2013-01-01 false Stress tests for mortgage securities. 652.40...

  13. Dissection of Structural and Functional Requirements That Underlie the Interaction of ERdj3 Protein with Substrates in the Endoplasmic Reticulum*

    PubMed Central

    Otero, Joel H.; Lizák, Beata; Feige, Matthias J.; Hendershot, Linda M.

    2014-01-01

    ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. PMID:25143379

  14. Upregulation of Interleukin 21 and Interleukin 21 Receptor in Patients with Dermatomyositis and Polymyositis.

    PubMed

    Liu, Tao; Hou, Ying; Dai, Ting-Jun; Yan, Chuan-Zhu

    2017-09-05

    The immunopathologic mechanism underlying dermatomyositis (DM) and polymyositis (PM) remains poorly understood. Many cytokines play a pathogenic role in DM and PM. Interleukin 21 (IL-21) has a pleiotropic effect on inflammation regulation. This study aimed to detect the serum IL-21 level and investigate the expression of IL-21 and IL-21 receptor (IL-21R) in muscle tissues of patients with DM and PM. Biopsied muscle samples were obtained from 11 patients with DM, 12 with PM, and six controls; mRNA levels of IL-21 and IL-21R were analyzed by real-time quantitative reverse transcription-polymerase chain reaction; and immunohistochemical staining was used to evaluate the protein expression of IL-21 and IL-21R. Serum samples were obtained from 36 patients with DM, 19 with PM, and 20 healthy controls. The serum IL-21 level was detected by enzyme-linked immunosorbent assay. The expression of IL-21 was upregulated in patients with DM and PM. The IL-21 mRNA level was significantly increased in muscle tissues of patients with DM and PM (DM vs. control, P= 0.001; PM vs. control, P= 0.001), whereas IL-21R mRNA level in patients with DM/PM was not statistically different from that of healthy controls. Immunohistochemical staining showed both IL-21 and IL-21R were significantly expressed in the inflammatory cells in muscle tissues of patients with DM and PM. The serum IL-21 level was also significantly higher in patients with DM/PM than in controls (DM vs. control, 49.12 [45.28, 60.07] pg/ml vs. 42.54 [38.69, 48.85] pg/ml, P= 0.001; PM vs. control, 50.77 [44.19, 60.62] pg/ml vs. 42.54 [38.69, 48.85] pg/ml, P= 0.005). IL-21 expression is upregulated in patients with DM and PM in both muscle tissue and serum. In addition, IL-21R protein is highly expressed in affected muscle tissues of patients with DM and PM. IL-21 may play a pathogenic role through IL-21R in patients with DM and PM.

  15. 40 CFR 148.12 - Waste specific prohibitions-California list wastes.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 22 2010-07-01 2010-07-01 false Waste specific prohibitions-California list wastes. 148.12 Section 148.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS (CONTINUED) HAZARDOUS WASTE INJECTION RESTRICTIONS Prohibitions on Injection § 148.12...

  16. Interleukin 12B (IL12B) Genetic Variation and Pulmonary Tuberculosis: A Study of Cohorts from The Gambia, Guinea-Bissau, United States and Argentina

    PubMed Central

    Hill, Philip C.; Wejse, Christian; Bisseye, Cyrille; Olesen, Rikke; Edwards, Todd L.; Gilbert, John R.; Myers, Jamie L.; Stryjewski, Martin E.; Abbate, Eduardo; Estevan, Rosa; Hamilton, Carol D.; Tacconelli, Alessandra; Novelli, Giuseppe; Brunetti, Ercole; Aaby, Peter; Sodemann, Morten; Østergaard, Lars; Adegbola, Richard; Williams, Scott M.; Scott, William K.; Sirugo, Giorgio

    2011-01-01

    We examined whether polymorphisms in interleukin-12B (IL12B) associate with susceptibility to pulmonary tuberculosis (PTB) in two West African populations (from The Gambia and Guinea-Bissau) and in two independent populations from North and South America. Nine polymorphisms (seven SNPs, one insertion/deletion, one microsatellite) were analyzed in 321 PTB cases and 346 controls from Guinea-Bissau and 280 PTB cases and 286 controls from The Gambia. For replication we studied 281 case and 179 control African-American samples and 221 cases and 144 controls of European ancestry from the US and Argentina. First-stage single locus analyses revealed signals of association at IL12B 3′ UTR SNP rs3212227 (unadjusted allelic p = 0.04; additive genotypic p = 0.05, OR = 0.78, 95% CI [0.61–0.99]) in Guinea-Bissau and rs11574790 (unadjusted allelic p = 0.05; additive genotypic p = 0.05, OR = 0.76, 95% CI [0.58–1.00]) in The Gambia. Association of rs3212227 was then replicated in African-Americans (rs3212227 allelic p = 0.002; additive genotypic p = 0.05, OR = 0.78, 95% CI [0.61–1.00]); most importantly, in the African-American cohort, multiple significant signals of association (seven of the nine polymorphisms tested) were detected throughout the gene. These data suggest that genetic variation in IL12B, a highly relevant candidate gene, is a risk factor for PTB in populations of African ancestry, although further studies will be required to confirm this association and identify the precise mechanism underlying it. PMID:21339808

  17. 18 CFR 12.40 - Quality control programs.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... PROJECT WORKS Other Responsibilities of Applicant or Licensee § 12.40 Quality control programs. (a) General rule. During any construction, repair, or modification of project works, including any corrective... 18 Conservation of Power and Water Resources 1 2014-04-01 2014-04-01 false Quality control...

  18. 18 CFR 12.40 - Quality control programs.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... PROJECT WORKS Other Responsibilities of Applicant or Licensee § 12.40 Quality control programs. (a) General rule. During any construction, repair, or modification of project works, including any corrective... 18 Conservation of Power and Water Resources 1 2013-04-01 2013-04-01 false Quality control...

  19. 18 CFR 12.40 - Quality control programs.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... PROJECT WORKS Other Responsibilities of Applicant or Licensee § 12.40 Quality control programs. (a) General rule. During any construction, repair, or modification of project works, including any corrective... 18 Conservation of Power and Water Resources 1 2012-04-01 2012-04-01 false Quality control...

  20. 40 CFR 721.10420 - Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569). 721.10420 Section 721.10420 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10420 Fluoropolymers (generic) (P-11-567, P-11-568...

  1. 40 CFR 721.10420 - Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569).

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569). 721.10420 Section 721.10420 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10420 Fluoropolymers (generic) (P-11-567, P-11-568...

  2. 40 CFR 721.10420 - Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Fluoropolymers (generic) (P-11-567, P-11-568, and P-11-569). 721.10420 Section 721.10420 Protection of Environment ENVIRONMENTAL PROTECTION... New Uses for Specific Chemical Substances § 721.10420 Fluoropolymers (generic) (P-11-567, P-11-568...

  3. 12 CFR 40.9 - Delivering privacy and opt out notices.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Delivering privacy and opt out notices. 40.9 Section 40.9 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.9 Delivering privacy and opt out notices. (a) How to...

  4. 12 CFR 40.9 - Delivering privacy and opt out notices.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Delivering privacy and opt out notices. 40.9 Section 40.9 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.9 Delivering privacy and opt out notices. (a) How to...

  5. 40 CFR 24.12 - Summary of hearing; Presiding Officer's recommendation.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... Orders Requiring Investigations or Studies § 24.12 Summary of hearing; Presiding Officer's recommendation... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Summary of hearing; Presiding Officer's recommendation. 24.12 Section 24.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL RULES...

  6. 40 CFR 24.12 - Summary of hearing; Presiding Officer's recommendation.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Orders Requiring Investigations or Studies § 24.12 Summary of hearing; Presiding Officer's recommendation... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Summary of hearing; Presiding Officer's recommendation. 24.12 Section 24.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL RULES...

  7. 40 CFR 792.12 - Statement of compliance or non-compliance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 32 2011-07-01 2011-07-01 false Statement of compliance or non-compliance. 792.12 Section 792.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT (CONTINUED) GOOD LABORATORY PRACTICE STANDARDS General Provisions § 792.12 Statement...

  8. 40 CFR 160.12 - Statement of compliance or non-compliance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 24 2011-07-01 2011-07-01 false Statement of compliance or non-compliance. 160.12 Section 160.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS GOOD LABORATORY PRACTICE STANDARDS General Provisions § 160.12 Statement of compliance or...

  9. Trisomy 4p and deletion 4p- in a family having translocation, t(4p-; 12p+).

    PubMed

    Mortimer, J G; Chewings, W; Miethke, P; Smith, G F

    1978-01-01

    Chromosome studies on a newborn infant with the clinical features of 4p-syndrome revealed a 46,XY,4p-karyotype with deletion of bands distal to 4p14. Investigation of the family revealed normal chromosomes in the mother and a balanced translocation rcp(4;12) (p14;p13) in the father, the paternal grandfather and an uncle. A severely retarded and malformed aunt is a partial trismoy for the short arms of chromosome 4, with the unbalanced karyotype 45,XX,12p+. It appears that monosomy of bands 4p15 and 4p16 leads to the full clinical features of 4p-syndrome, while trisomy of this region causes disabilities consistent with the rather more variable 4p trisomy syndrome. From currently reported cases, a summary is presented of the results of pregnancies of both male and female translocation carriers.

  10. Inhibitory Effect of Anti-rheumatic Drug Iguratimod for Hepatocellular Carcinogenesis by Inhibition of Serum Interleukin-8 Production.

    PubMed

    Sakamoto, Taro; Ishii, Yuji; Shiba, Hiroaki; Furukawa, Kenei; Fujiwara, Yuki; Haruki, Koichiro; Iwase, Ryota; Shirai, Yoshihiro; Yanaga, Katsuhiko

    2016-07-01

    Angiogenesis is a known factor for the development of hepatocellular carcinoma (HCC). The aim of this study was to assess the property of iguratimod, that is an anti-inflammatory drug for rheumatoid arthritis, on anti-angiogenesis and anti-carcinogensis for HCC. In vitro, human umbilical vein endothelial cells were cultured under interleukin-8 (IL-8) with or without iguratimod. In vivo, a rat model with HCC received iguratimod or distilled water for 6 weeks. Diameter of the largest tumor, number of tumors and serum interleukin-8 concentration were compared between iguratimod and control groups. By an in vitro angiogenesis assay, it was found angiogenesis in iguratimod group was significantly lower than that in control group (p=0.013). In vivo, largest tumor diameter (p=0.036), number of the tumor (p=0.011) and serum interleukin-8 concentration (p=0.036) in the iguratimod group were significantly smaller and lower than those in the control group. Iguratimod may inhibit hepatocellular carcinogensis by inhibition of interleukin-8 production in a rat model. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  11. Triggered Urine Interleukin-6 Correlates to Severity of Symptoms in Nonfebrile Lower Urinary Tract Infections.

    PubMed

    Sundén, Fredrik; Butler, Daniel; Wullt, Björn

    2017-07-01

    Objective diagnosis of symptomatic urinary tract infections in patients prone to asymptomatic bacteriuria is compromised by local host responses that are already present and the positive urine culture. We investigated interleukin-6 as a biomarker for nonfebrile urinary tract infection severity and diagnostic thresholds for interleukin-6 and 8, and neutrophils to differentiate between asymptomatic bacteriuria and urinary tract infection. Patients with residual urine and neurogenic bladders due to spinal lesions included in a long-term Escherichia coli 83972 asymptomatic bacteriuria inoculation trial were monitored for 2 years. Symptom scoring and urine sampling to estimate interleukin-6 and 8, and neutrophils were performed regularly monthly and at urinary tract infection episodes. Patients were followed in the complete study for a mean of 19 months (range 10 to 27) and those with asymptomatic bacteriuria with E. coli 83972 were followed a mean of 11 months (range 4 to 19). A total of 37 nonfebrile urinary tract infection episodes with complete data on interleukin-6 and 8, neutrophils and symptom scoring were documented. Interleukin-6 was the only marker that persistently increased during urinary tract infection compared to asymptomatic bacteriuria in pooled and paired intra-individual comparisons (p <0.05). Interleukin-6 above the threshold (greater than 25 ng/l) correlated to more severe urinary tract infection symptoms (p <0.05). The sensitivity and specificity of all biomarkers were poor/moderate when differentiating asymptomatic bacteriuria vs all urinary tract infection episodes. However, in urinary tract infections with worse symptoms interleukin-6 and neutrophils demonstrated equal good/excellent outcomes. Triggered interleukin-6 correlated to urinary tract infection symptom severity and demonstrated a promising differential diagnostic capacity to discriminate urinary tract infection from asymptomatic bacteriuria. Future studies should explore interleukin-6

  12. 18 CFR 12.40 - Quality control programs.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 18 Conservation of Power and Water Resources 1 2011-04-01 2011-04-01 false Quality control... PROJECT WORKS Other Responsibilities of Applicant or Licensee § 12.40 Quality control programs. (a... meeting any requirements or standards set by the Regional Engineer. If a quality control program is...

  13. 18 CFR 12.40 - Quality control programs.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Quality control... PROJECT WORKS Other Responsibilities of Applicant or Licensee § 12.40 Quality control programs. (a... meeting any requirements or standards set by the Regional Engineer. If a quality control program is...

  14. Cumulative meta-analysis of interleukins 6 and 1β, tumour necrosis factor α and C-reactive protein in patients with major depressive disorder

    PubMed Central

    Haapakoski, Rita; Mathieu, Julia; Ebmeier, Klaus P.; Alenius, Harri; Kivimäki, Mika

    2015-01-01

    Cumulative meta-analyses are used to evaluate the extent to which further studies are needed to confirm or refute a hypothesis. We used this approach to assess observational evidence on systemic inflammation in individuals with major depressive disorder. We identified 58 studies of four common inflammatory markers in a literature search of PubMed, Embase and PsychInfo databases in May 2014. Pooled data from the earliest eight studies already showed an association between interleukin-6 concentrations and major depression; 23 more recent studies confirmed this finding (d = 0.54, p < 0.0001). A significant association between C-reactive protein levels and major depression was noted after 14 studies and this did not change after addition of six more studies (d = 0.47, p < 0.0001). For these two inflammatory markers, there was moderate heterogeneity in study-specific estimates, subgroup differences were small, and publication bias appeared to be an unlikely explanation for the findings. Sensitivity analyses including only high-quality studies and subjects free of antidepressant medication further verified the associations. While there was a link between tumour necrosis factor-α levels and major depression (d = 0.40, p = 0.002), the cumulative effect remained uncertain due to the extensive heterogeneity in study-specific estimates and inconsistencies between subgroups. No evidence was found for the association between interleukin-1β levels and major depression (d = −0.05, p = 0.86). In conclusion, this cumulative meta-analysis confirmed higher mean levels of interleukin-6 and C-reactive protein in patients with major depression compared to non-depressed controls. No consistent association between tumour necrosis factor-α, interleukin-1β and major depression was observed. Future studies should clarify the specific immune mechanisms involved as well as continue testing anti-inflammatory therapies in patients suffering from major depression. PMID

  15. 40 CFR 8.12 - Coordination of reviews from other Parties.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Coordination of reviews from other Parties. 8.12 Section 8.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL ENVIRONMENTAL IMPACT ASSESSMENT OF NONGOVERNMENTAL ACTIVITIES IN ANTARCTICA § 8.12 Coordination of reviews from other...

  16. Midazolam suppresses interleukin-1β-induced interleukin-6 release from rat glial cells

    PubMed Central

    2011-01-01

    Background Peripheral-type benzodiazepine receptor (PBR) expression levels are low in normal human brain, but their levels increase in inflammation, brain injury, neurodegenerative states and gliomas. It has been reported that PBR functions as an immunomodulator. The mechanisms of action of midazolam, a benzodiazepine, in the immune system in the CNS remain to be fully elucidated. We previously reported that interleukin (IL)-1β stimulates IL-6 synthesis from rat C6 glioma cells and that IL-1β induces phosphorylation of inhibitory kappa B (IκB), p38 mitogen-activated protein (MAP) kinase, stress-activated protein kinase (SAPK)/c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase 1/2, and signal transducer and activator of transcription (STAT)3. It has been shown that p38 MAP kinase is involved in IL-1β-induced IL-6 release from these cells. In the present study, we investigated the effect of midazolam on IL-1β-induced IL-6 release from C6 cells, and the mechanisms of this effect. Methods Cultured C6 cells were stimulated by IL-1β. IL-6 release from C6 cells was measured using an enzyme-linked immunosorbent assay, and phosphorylation of IκB, the MAP kinase superfamily, and STAT3 was analyzed by Western blotting. Results Midazolam, but not propofol, inhibited IL-1β-stimulated IL-6 release from C6 cells. The IL-1β-stimulated levels of IL-6 were suppressed by wedelolactone (an inhibitor of IκB kinase), SP600125 (an inhibitor of SAPK/JNK), and JAK inhibitor I (an inhibitor of JAK 1, 2 and 3). However, IL-6 levels were not affected by PD98059 (an inhibitor of MEK1/2). Midazolam markedly suppressed IL-1β-stimulated STAT3 phosphorylation without affecting the phosphorylation of p38 MAP kinase, SAPK/JNK or IκB. Conclusion These results strongly suggest that midazolam inhibits IL-1β-induced IL-6 release in rat C6 glioma cells via suppression of STAT3 activation. Midazolam may affect immune system function in the CNS. PMID:21682888

  17. 40 CFR 721.5293 - Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.5293 Poly(oxy-1,2-ethanediyl), alpha...), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt (PMN P-99-920; CAS No. 58857-49-1...

  18. 40 CFR 721.5293 - Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.5293 Poly(oxy-1,2-ethanediyl), alpha...), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt (PMN P-99-920; CAS No. 58857-49-1...

  19. 40 CFR 721.5293 - Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.5293 Poly(oxy-1,2-ethanediyl), alpha...), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt (PMN P-99-920; CAS No. 58857-49-1...

  20. 40 CFR 721.5293 - Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 32 2012-07-01 2012-07-01 false Poly(oxy-1,2-ethanediyl), alpha-(9Z)-9... SUBSTANCES Significant New Uses for Specific Chemical Substances § 721.5293 Poly(oxy-1,2-ethanediyl), alpha...), alpha-(9Z)-9-octadecenyl-.omega.-hydroxy-, phosphate, ammonium salt (PMN P-99-920; CAS No. 58857-49-1...

  1. The role of charge and multiple faces of the CD8 alpha/alpha homodimer in binding to major histocompatibility complex class I molecules: support for a bivalent model.

    PubMed

    Giblin, P A; Leahy, D J; Mennone, J; Kavathas, P B

    1994-03-01

    The CD8 dimer interacts with the alpha 3 domain of major histocompatibility complex class I molecules through two immunoglobulin variable-like domains. In this study a crystal structure-informed mutational analysis has been performed to identify amino acids in the CD8 alpha/alpha homodimer that are likely to be involved in binding to class I. Several key residues are situated on the top face of the dimer within loops analogous to the complementarity-determining regions (CDRs) of immunoglobulin. In addition, other important amino acids are located in the A and B beta-strands on the sides of the dimer. The potential involvement of amino acids on both the top and the side faces of the molecule is consistent with a bivalent model for the interaction between a single CD8 alpha/alpha homodimer and two class I molecules and may have important implications for signal transduction in class I-expressing cells. This study also demonstrates a role for the positive surface potential of CD8 in class I binding and complements previous work demonstrating the importance of a negatively charged loop on the alpha 3 domain of class I for CD8 alpha/alpha-class I interaction. We propose a model whereby residues located on the CDR-like loops of the CD8 homodimer interact with the alpha 3 domain of MHC class I while amino acids on the side of the molecule containing the A and B beta-strands contact the alpha 2 domain of class I.

  2. Structure of states in 12Be via the 11Be( d,p) reaction

    NASA Astrophysics Data System (ADS)

    Kanungo, R.; Gallant, A. T.; Uchida, M.; Andreoiu, C.; Austin, R. A. E.; Bandyopadhyay, D.; Ball, G. C.; Becker, J. A.; Boston, A. J.; Boston, H. C.; Brown, B. A.; Buchmann, L.; Colosimo, S. J.; Clark, R. M.; Cline, D.; Cross, D. S.; Dare, H.; Davids, B.; Drake, T. E.; Djongolov, M.; Finlay, P.; Galinski, N.; Garrett, P. E.; Garnsworthy, A. B.; Green, K. L.; Grist, S.; Hackman, G.; Harkness, L. J.; Hayes, A. B.; Howell, D.; Hurst, A. M.; Jeppesen, H. B.; Leach, K. G.; Macchiavelli, A. O.; Oxley, D.; Pearson, C. J.; Pietras, B.; Phillips, A. A.; Rigby, S. V.; Ruiz, C.; Ruprecht, G.; Sarazin, F.; Schumaker, M. A.; Shotter, A. C.; Sumitharachchi, C. S.; Svensson, C. E.; Tanihata, I.; Triambak, S.; Unsworth, C.; Williams, S. J.; Walden, P.; Wong, J.; Wu, C. Y.

    2010-01-01

    The s-wave neutron fraction of the 0 levels in 12Be has been investigated for the first time through the 11Be(d,p) transfer reaction using a 5 A MeV11Be beam at TRIUMF, Canada. The reaction populated all the known bound states of 12Be. The ground state s-wave spectroscopic factor was determined to be 0.28-0.07+0.03 while that for the long-lived 02+ excited state was 0.73-0.40+0.27. This observation, together with the smaller effective separation energy indicates enhanced probability for an extended density tail beyond the 10Be core for the 02+ excited state compared to the ground state.

  3. 40 CFR 310.12 - What costs are NOT allowable?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false What costs are NOT allowable? 310.12... PLANNING, AND COMMUNITY RIGHT-TO-KNOW PROGRAMS REIMBURSEMENT TO LOCAL GOVERNMENTS FOR EMERGENCY RESPONSE TO HAZARDOUS SUBSTANCE RELEASES Provisions What Can Be Reimbursed? § 310.12 What costs are NOT allowable? (a...

  4. In enterovirus 71 encephalitis with cardio-respiratory compromise, elevated interleukin 1β, interleukin 1 receptor antagonist, and granulocyte colony-stimulating factor levels are markers of poor prognosis.

    PubMed

    Griffiths, Michael J; Ooi, Mong H; Wong, See C; Mohan, Anand; Podin, Yuwana; Perera, David; Chieng, Chae H; Tio, Phaik H; Cardosa, Mary J; Solomon, Tom

    2012-09-15

    Enterovirus 71 (EV71) causes large outbreaks of hand, foot, and mouth disease (HFMD), with severe neurological complications and cardio-respiratory compromise, but the pathogenesis is poorly understood. We measured levels of 30 chemokines and cytokines in serum and cerebrospinal fluid (CSF) samples from Malaysian children hospitalized with EV71 infection (n = 88), comprising uncomplicated HFMD (n = 47), meningitis (n = 8), acute flaccid paralysis (n = 1), encephalitis (n = 21), and encephalitis with cardiorespiratory compromise (n = 11). Four of the latter patients died. Both pro-inflammatory and anti-inflammatory mediator levels were elevated, with different patterns of mediator abundance in the CSF and vascular compartments. Serum concentrations of interleukin 1β (IL-1β), interleukin 1 receptor antagonist (IL-1Ra), and granulocyte colony-stimulating factor (G-CSF) were raised significantly in patients who developed cardio-respiratory compromise (P = .013, P = .004, and P < .001, respectively). Serum IL-1Ra and G-CSF levels were also significantly elevated in patients who died, with a serum G-CSF to interleukin 5 ratio of >100 at admission being the most accurate prognostic marker for death (P < .001; accuracy, 85.5%; sensitivity, 100%; specificity, 84.7%). Given that IL-1β has a negative inotropic action on the heart, and that both its natural antagonist, IL-1Ra, and G-CSF are being assessed as treatments for acute cardiac impairment, the findings suggest we have identified functional markers of EV71-related cardiac dysfunction and potential treatment options.

  5. 40 CFR 721.10135 - Phosphinic acid, P,P-diethyl-, zinc salt (2:1).

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Phosphinic acid, P,P-diethyl-, zinc... Specific Chemical Substances § 721.10135 Phosphinic acid, P,P-diethyl-, zinc salt (2:1). (a) Chemical... acid, P,P-diethyl-, zinc salt (2:1) (PMN P-05-11; CAS No. 284685-45-6) is subject to reporting under...

  6. 40 CFR 721.10135 - Phosphinic acid, P,P-diethyl-, zinc salt (2:1).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Phosphinic acid, P,P-diethyl-, zinc... Specific Chemical Substances § 721.10135 Phosphinic acid, P,P-diethyl-, zinc salt (2:1). (a) Chemical... acid, P,P-diethyl-, zinc salt (2:1) (PMN P-05-11; CAS No. 284685-45-6) is subject to reporting under...

  7. Exercise-Induced Change in Plasma IL-12p70 Is Linked to Migraine Prevention and Anxiolytic Effects in Treatment-Naïve Women: A Randomized Controlled Trial.

    PubMed

    Oliveira, Arão Belitardo; Bachi, Andre Luis Lacerda; Ribeiro, Reinaldo Teixeira; Mello, Marco Túlio; Vaisberg, Mauro; Peres, Mario Fernando Prieto

    2018-03-29

    To conduct a randomized controlled trial to evaluate the effect of a 12-week aerobic exercise program for migraine prevention, plasma cytokines concentrations (TNF-α, interleukin [IL]-1β, IL-6, IL-8, IL-10, and IL-12p70), and anxiety in women with migraine. Women with episodic migraine (ICHD-II), aged between 20 and 50 years, who had never taken any prophylactic medication, and were physically inactive in the past 12 months were recruited from the university's hospital and a tertiary headache clinic between March 2012 and March 2015. Migraine attacks were recorded in headache diaries, cytokines were quantified by flow cytometry, and anxiety was assessed by the 7-item General Anxiety Disorder (GAD-7) scale. Blood sampling and psychometric interviews were undertaken on headache-free days. Twenty participants ([mean ± SD] age 33.8 ± 10.5; BMI 26 ± 5.2) were randomly assigned and received intervention ("trained": n = 10) or entered on a waitlist ("inactive": n = 10). There were no differences between groups regarding patients' characteristics and baseline data. Days with migraine (p = 0.001), IL-12p70 levels (p = 0.036), and GAD-7 score (p = 0.034) were significantly reduced in the trained group after the intervention period, but there were no significant changes in these variables in the inactive group. There was no change in the levels of the other cytokines in either group. There were positive correlations between a reduction in IL-12p70 level and a reduction in the number of days with migraine (R2 = 0.19, p = 0.045), and GAD-7 score (R2 = 0.53, p < 0.001). The clinical and psychological therapeutic effects of aerobic exercise in treatment-naïve women with migraine may involve the downregulation of IL-12p70. © 2018 S. Karger AG, Basel.

  8. Identification and Characterization of Small-Molecule Inhibitors of the R132H/R132H Mutant Isocitrate Dehydrogenase 1 Homodimer and R132H/Wild-Type Heterodimer.

    PubMed

    Brooks, Eric; Wu, Xiang; Hanel, Art; Nguyen, Shaun; Wang, Jing; Zhang, Jeffrey H; Harrison, Amanda; Zhang, Wentao

    2014-09-01

    Recurrent genetic mutations in isocitrate dehydrogenase 1 and 2 (IDH1 and IDH2) have been identified in multiple tumor types. The most frequent mutation, IDH1 R132H, is a gain-of-function mutation resulting in an enzyme-catalyzing conversion of α-ketoglutarate (α-KG) to 2-hydroxyglutarate (2-HG). A high-throughput assay quantifying consumption of NADPH by IDH1 R132H has been optimized and implemented to screen 3 million compounds in 1536-well formats. The primary high-throughput screening hits were further characterized by RapidFire-mass spectrometry measuring 2-HG directly. Multiple distinct chemotypes were identified with nanomolar potencies (6-300 nM). All inhibitors were found to be inactive against the wild-type IDH1 homodimers. An IDH1 heterodimer between wild-type and R132H mutant is capable of catalyzing conversion of α-KG to 2-HG and isocitrate to α-KG. Interestingly, one of the inhibitors, EXEL-9324, was found to inhibit both conversions by the IDH1 heterodimer. This indicates the R132H/WT heterodimer may adopt conformations distinct from that of the R132H/R132H homodimer. Further enzymatic studies support this conclusion as the heterodimer exhibited a significantly lower apparent Michaelis-Menten constant for α-KG (K(m)=110 µM) compared with the R132H homodimer (K(m)= 1200 µM). The enhanced apparent affinity for α-KG suggests R132H/WT heterodimeric IDH1 can produce 2-HG more efficiently at normal intracellular levels of α-KG (approximately 100 µM). © 2014 Society for Laboratory Automation and Screening.

  9. Structure effects in polarization and cross sections for A(p, p’)X inelastic reactions on {sup 40}Ca and {sup 12}C nuclei at 1 GeV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miklukho, O. V., E-mail: miklukho-ov@pnpi.rncki.ru; Kisselev, A. Yu., E-mail: kisselev@mail.desy.de; Amalsky, G. M.

    2017-03-15

    The polarization of secondary protons in the (p, p’) inelastic reactions on {sup 40}Ca and {sup 12}C nuclei at the initial proton energy of 1 GeV was measured over a wide range of scattered-proton momenta at a laboratory angle of Θ = 21°. The reaction cross sections were also measured. Scattered protons were detected by means of magnetic spectrometer equipped with a polarimeter based on multiwire-proportional chambers. A structure in the polarization and cross-section data, which is probably related to scattering off nucleon correlations in the nuclei involved, was observed.

  10. Associations between interleukin and interleukin receptor gene polymorphisms and risk of gout.

    PubMed

    Liu, Shiguo; Zhou, Zheng; Wang, Can; Guo, Mingzhen; Chu, Nan; Li, Changgui

    2015-09-24

    Gout is a self-limiting, auto-inflammatory arthritis induced by the deposition of monosodium urate crystals in the synovial fluid and periarticular tissues. The aim of this study was to investigate the associations between genetic variants in the interleukin (IL) and interleukin receptor (ILR) genes IL-33, IL-1RL1, IL-23R, and signal transducer and activator of transcription 4 (STAT4) and susceptibility to gout in Chinese Han male individuals. The genetic distributions of rs3939286 in IL-33, rs13015714 in IL-1RL1, rs10889677 in IL-23R, and rs7574865 in STAT4 were detected in 1100 men with gout and 1227 ethnically matched controls, using Taqman allelic discrimination real-time polymerase chain reaction (PCR). Differences in these polymorphisms between the groups were investigated using χ(2) tests. The genotype-phenotype relationship among gout patients was tested by analysis of variance. There was a significant difference in genotypic frequencies of IL-23R rs10889677 between gout patients and controls (χ(2) = 81.386, P < 0.001). However, there were no significant differences in distributions of the other polymorphisms between the groups. Our results revealed that the rs10889677 variant in IL-23R may be involved in the development of gout in Chinese Han male individuals. However, further studies in other ethnic groups are needed to confirm these results.

  11. 12 CFR 239.40 - Indemnification of directors, officers and employees.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 4 2013-01-01 2013-01-01 false Indemnification of directors, officers and employees. 239.40 Section 239.40 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM (CONTINUED) MUTUAL HOLDING COMPANIES (REGULATION MM) Indemnification...

  12. 12 CFR 239.40 - Indemnification of directors, officers and employees.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 4 2012-01-01 2012-01-01 false Indemnification of directors, officers and employees. 239.40 Section 239.40 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM (CONTINUED) MUTUAL HOLDING COMPANIES (REGULATION MM) Indemnification...

  13. 12 CFR 239.40 - Indemnification of directors, officers and employees.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 4 2014-01-01 2014-01-01 false Indemnification of directors, officers and employees. 239.40 Section 239.40 Banks and Banking FEDERAL RESERVE SYSTEM (CONTINUED) BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM (CONTINUED) MUTUAL HOLDING COMPANIES (REGULATION MM) Indemnification...

  14. Molecular characterization of the pL40 protein in Leptospira interrogans.

    PubMed

    Zhao, Wei; Chen, Chun-Yan; Zhang, Xiang-Yan; Lai, Wei-Qiang; Hu, Bao-Yu; Zhao, Guo-Ping; Qin, Jin-Hong; Guo, Xiao-Kui

    2009-06-01

    Leptospirosis is a widespread zoonotic disease caused by pathogenic leptospires. The identification of outer membrane proteins (OMPs) conserved among pathogenic leptospires, which are exposed on the leptospiral surface and expressed during mammalian infection, has become a major focus of leptospirosis research. pL40, a 40 kDa protein coded by the LA3744 gene in Leptospira interrogans, was found to be unique to Leptospira. Triton X-114 fractionation and flow cytometry analyses indicate that pL40 is a component of the leptospiral outer membrane. The conservation of pL40 among Leptospira strains prevalent in China was confirmed by both Western blotting and PCR screening. Furthermore, the pL40 antigen could be recognized by sera from guinea pigs and mice infected with low-passage L. interrogans. These findings indicate that pL40 may serve as a useful serodiagnostic antigen and vaccine candidate for L. interrogans.

  15. Interleukin-induced increase in Ia expression by normal mouse B cells.

    PubMed

    Roehm, N W; Leibson, H J; Zlotnik, A; Kappler, J; Marrack, P; Cambier, J C

    1984-09-01

    The constitutive culture supernatant (SN) of the macrophage tumor line P388D1 (P388 SN) and the concanavalin A (Con A)-induced culture supernatant of the T cell hybridoma FS6-14.13 (FS6 Con A SN) were shown to contain nonspecific factors capable of inducing increased Ia expression by normal resting B cells in a dose-dependent manner. In six consecutive experiments the relative increase in Ia expression induced by P388 SN was 4.9 +/- 0.9, with FS6 Con A SN 10.7 +/- 1.5, and with a combination of both preparations 13.0 +/- 1.7. This increase in Ia expression was observed to occur in virtually all the B cells, reaching maximum levels within 24 h of culture. The interleukin-induced increase in B cell Ia expression occurred in the absence of ancillary signals provided by ligand-receptor Ig cross-linking and despite the fact that virtually all the control B cells, cultured in the absence of factors, remained in G0. These results suggest that functional receptors for at least some interleukins are expressed on normal resting B cells and their effects can be manifest in the absence of additional activating signals. The increased Ia expression induced by the nonspecific factor preparations was shown to be correlated with enhanced antigen-presenting capacity by the B cells to T cell hybridomas. The nature of the interleukins responsible for these effects remains to be definitively determined, however, the activity of FS6 Con A SN was shown to correlate with B cell growth factor activity and increased B cell Ia expression was not observed using interleukin 2 (IL-2) or interferon-gamma, prepared by recombinant DNA technology.

  16. Interleukin-34 inhibits hepatitis B virus replication in vitro and in vivo.

    PubMed

    Cheng, Sheng-Tao; Tang, Hua; Ren, Ji-Hua; Chen, Xiang; Huang, Ai-Long; Chen, Juan

    2017-01-01

    The hepatitis B virus (HBV) infection could activate the immune system and induce extensive inflammatory response. As the most important inflammatory factor, interleukins are critical for anti-viral immunity. Here we investigated whether interleukin-34 (IL-34) play a role in HBV infection. In this study, we first found that both serum IL-34 and IL-34 mRNA in PBMCs in chronic HBV patients was significantly decreased compared to the healthy controls. Furthermore, both IL-34 protein and mRNA levels were declined hepatoma cells expressing HBV. In addition, the clinical parameters analysis found that serum IL-34 was significantly associated with HBV DNA (P = 0.0066), ALT (P = 0.0327), AST (P = 0.0435), TB (P = 0.0406), DB (P = 0.0368) and AFP (P = 0.0225). Correlation analysis also found that serum IL-34 negatively correlated with HBV DNA copies, ALT and AST. In vitro studies found that IL-34 treatment in HepAD38 and HepG2.2.15 cells markedly inhibited HBV DNA, total RNA, 3.5kb mRNA and HBc protein. In vivo studies further demonstrated IL-34 treatment in HBV transgenic mice exhibited greater inhibition on HBV DNA, total RNA, 3.5kb mRNA and HBc protein, suggesting the effect to IL-34 on HBV is likely due to host innate or adaptive immune response. Our study identified a novel interleukin, IL-34, which has anti-viral activity in HBV replication in hepatocytes in vitro and in vivo. These data suggest a rationale for the use of IL-34 in the HBV treatment.

  17. 40 CFR 307.12 - Use of number and gender.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 28 2014-07-01 2014-07-01 false Use of number and gender. 307.12... LIABILITY ACT (CERCLA) CLAIMS PROCEDURES General § 307.12 Use of number and gender. As used in this part, words in the singular also include the plural and vice versa, and words in the masculine gender also...

  18. 40 CFR 307.12 - Use of number and gender.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 29 2013-07-01 2013-07-01 false Use of number and gender. 307.12... LIABILITY ACT (CERCLA) CLAIMS PROCEDURES General § 307.12 Use of number and gender. As used in this part, words in the singular also include the plural and vice versa, and words in the masculine gender also...

  19. 40 CFR 307.12 - Use of number and gender.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false Use of number and gender. 307.12... LIABILITY ACT (CERCLA) CLAIMS PROCEDURES General § 307.12 Use of number and gender. As used in this part, words in the singular also include the plural and vice versa, and words in the masculine gender also...

  20. 40 CFR 307.12 - Use of number and gender.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 29 2012-07-01 2012-07-01 false Use of number and gender. 307.12... LIABILITY ACT (CERCLA) CLAIMS PROCEDURES General § 307.12 Use of number and gender. As used in this part, words in the singular also include the plural and vice versa, and words in the masculine gender also...

  1. 40 CFR 307.12 - Use of number and gender.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 28 2011-07-01 2011-07-01 false Use of number and gender. 307.12... LIABILITY ACT (CERCLA) CLAIMS PROCEDURES General § 307.12 Use of number and gender. As used in this part, words in the singular also include the plural and vice versa, and words in the masculine gender also...

  2. Interleukin-1β transfer across the blood-brain barrier in the ovine fetus.

    PubMed

    Sadowska, Grazyna B; Chen, Xiaodi; Zhang, Jiyong; Lim, Yow-Pin; Cummings, Erin E; Makeyev, Oleksandr; Besio, Walter G; Gaitanis, John; Padbury, James F; Banks, William A; Stonestreet, Barbara S

    2015-09-01

    Pro-inflammatory cytokines contribute to hypoxic-ischemic brain injury. Blood-brain barrier (BBB) dysfunction represents an important component of hypoxic-ischemic brain injury in the fetus. Hypoxic-ischemic injury could accentuate systemic cytokine transfer across the fetal BBB. There has been considerable conjecture suggesting that systemic cytokines could cross the BBB during the perinatal period. Nonetheless, evidence to support this contention is sparse. We hypothesized that ischemia-reperfusion increases the transfer of systemic interleukin-1β (IL-1β) across the BBB in the fetus. Ovine fetuses at 127 days of gestation were studied 4 hours after 30 minutes of bilateral carotid artery occlusion and compared with a nonischemic group. Recombinant ovine IL-1β protein was expressed from an IL-1β pGEX-2 T vector in E. coli BL-21 cells and purified. The BBB function was quantified in 12 brain regions using a blood-to-brain transfer constant with intravenous (125)I-radiolabeled IL-1β ((125)I-IL-1β). Interleukin-1β crossed the intact BBB in nonischemic fetuses. Blood-to-brain transport of (125)I-IL-1β was higher (P<0.05) across brain regions in fetuses exposed to ischemia-reperfusion than nonischemic fetuses. We conclude that systemic IL-1β crosses the intact fetal BBB, and that ischemia-reperfusion increases transfer of this cytokine across the fetal BBB. Therefore, altered BBB function after hypoxia-ischemia facilitates entry of systemic cytokines into the brain of the fetus.

  3. 12 CFR 40.6 - Information to be included in privacy notices.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 1 2013-01-01 2013-01-01 false Information to be included in privacy notices. 40.6 Section 40.6 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.6 Information to be included in...

  4. 12 CFR 40.6 - Information to be included in privacy notices.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 1 2011-01-01 2011-01-01 false Information to be included in privacy notices. 40.6 Section 40.6 Banks and Banking COMPTROLLER OF THE CURRENCY, DEPARTMENT OF THE TREASURY PRIVACY OF CONSUMER FINANCIAL INFORMATION Privacy and Opt Out Notices § 40.6 Information to be included in...

  5. Association of the Interleukin-27 Gene Expression and Hepatitis B Virus Infection in Liver Transplanted Patients.

    PubMed

    Zare, Abdolhossein; Karimi, Mohammad Hossein; Rashki, Ahmad; Geramizadeh, Bita; Afshari, Afsoon; Miri, Hamid Reza; Yaghobi, Ramin

    2017-10-01

    Hepatitis B viral infection is among the most common causes of cirrhosis and hepatocellular carcinoma and a frequent viral indication for liver transplant. Cytokine-mediated immunity plays a critical role in introducing and promoting hepatitis B virus outcomes and in graft microenvironment. Interleukin 27 is a heterodimeric cytokine and a member of interleukin-6/interleukin-12 family. Interleukin-27 shows a broad range of pro- and antiinflammatory properties and plays a determining role during immune responses in combating hepatitis B virus. Therefore, in this study, the possible association between expressions of interleukin-27 gene with hepatitis B virus infection was evaluated in liver transplant patients. In a cross-sectional study from liver transplant patients with the risk of hepatitis B virus infection who admitted to Namazi Hospital affiliated to Shiraz University of Medical Sciences, 50 patients were selected and subgrouped to 25 hepatitis B virus-infected and 25 noninfected ones between years 2011 and 2013. The 25 healthy controls also were enrolled in this study. The presence of hepatitis B virus infection was assessed using polymerase chain reaction and enzyme-linked immunosorbent assay protocols in liver transplant patients. In addition, the interleukin-27 gene expression level was analyzed using an in-house-SYBER Green real time polymerase chain reaction method. The rate of interleukin-27 gene expression level was statistically analyzed in studied patient groups and controls using the Livak (2-▵▵CT) method. The expression level of interleukin-27 gene was increased 10.27- and 2.36-fold in hepatitis B virus-infected and uninfected liver transplanted patients compared with healthy controls. Hepatitis B virus infection can lead to overexpression of interleukin-27 gene in liver transplant patients compared with uninfected ones and controls. However, further studies are needed to characterize the effective antihepatitis B virus effects of interleukin

  6. Interleukin 1B variant -1473G/C (rs1143623) influences triglyceride and interleukin 6 metabolism

    USDA-ARS?s Scientific Manuscript database

    Interleukin 1b (IL1B or IL-1ß), is a key modulator of the immune response which exerts its functions mainly via interleukin 6 (IL6) regulation. Fatty meals cause transient hypertriglyceridemia and are considered to be proinflammatory, but the extent of these responses shows high interindividual susc...

  7. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

    PubMed

    Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-09-20

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

  8. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

    PubMed Central

    Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-01-01

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

  9. Dissection of structural and functional requirements that underlie the interaction of ERdj3 protein with substrates in the endoplasmic reticulum.

    PubMed

    Otero, Joel H; Lizák, Beata; Feige, Matthias J; Hendershot, Linda M

    2014-10-03

    ERdj3, a mammalian endoplasmic reticulum (ER) Hsp40/DnaJ family member, binds unfolded proteins, transfers them to BiP, and concomitantly stimulates BiP ATPase activity. However, the requirements for ERdj3 binding to and release from substrates in cells are not well understood. We found that ERdj3 homodimers that cannot stimulate the ATPase activity of BiP (QPD mutants) bound to unfolded ER proteins under steady state conditions in much greater amounts than wild-type ERdj3. This was due to reduced release from these substrates as opposed to enhanced binding, although in both cases dimerization was strictly required for substrate binding. Conversely, heterodimers consisting of one wild-type and one mutant ERdj3 subunit bound substrates at levels comparable with wild-type ERdj3 homodimers, demonstrating that release requires only one protomer to be functional in stimulating BiP ATPase activity. Co-expressing wild-type ERdj3 and a QPD mutant, which each exclusively formed homodimers, revealed that the release rate of wild-type ERdj3 varied according to the relative half-lives of substrates, suggesting that ERdj3 release is an important step in degradation of unfolded client proteins in the ER. Furthermore, pulse-chase experiments revealed that the binding of QPD mutant homodimers remained constant as opposed to increasing, suggesting that ERdj3 does not normally undergo reiterative binding cycles with substrates. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Interleukin-6 and Interleukin-8 Levels Correlate With the Severity of Aplastic Anemia in Children.

    PubMed

    Gupta, Vineeta; Kumar, Sushil; Sonowal, Rimjhim; Singh, Surya K

    2017-04-01

    The aim of this study was to evaluate the levels of interleukin (IL)-6 and IL-8 in patients with aplastic anemia and its correlation with severity of the disease. IL-6 and IL-8 levels were measured in 40 patients with aplastic anemia in the age group of 4 to 14 years. A total of 40 healthy children served as controls. Quantitative estimation of IL-6 and IL-8 was performed using a solid-phase sandwich ELISA kit. Results were presented as IL-6 and IL-8 concentrations in pg/mL. Patients received immunosuppressive therapy per the British Committee for Standards in Haematology Guidelines 2009. Mean age of the patients was 9.78±2.74 years. IL-6 level of patients was elevated compared with controls (193.48±352.3 vs. 4.58±3.39; P<0.001). IL-8 levels were also significantly elevated in patients compared with controls (15.58±18.0 vs. 1.85±0.95; P<0.001). IL levels were also assessed in relation to severity of the disease. Levels were the highest in patients with very severe aplastic anemia (724.33±519.42), followed by severe aplastic anemia (80.51±66.28 pg/mL), and non-severe aplastic anemia (6.01±1.89). Differences were statistically significant. A similar trend was also observed for IL-8 levels, where the levels were 41.02±24.23, 11.34±8.0, and 1.67±0.71 for very severe aplastic anemia, severe aplastic anemia, and non-severe aplastic anemia, respectively. The differences were again statistically significant. IL levels were also correlated with the treatment outcome. Responders had lower levels compared with nonresponders, but the difference was not statistically significant (186.36±322.45 vs. 198.74±368.10). Levels of ILs decreased in responders, but were not comparable with that of controls 6 months after therapy. High levels of IL-6 and IL-8 were observed in children with aplastic anemia. Increased levels showed correlation with disease severity and therefore appear to play an important role in aplastic anemia. However, levels had no significant correlation

  11. Gene-by-environment effect of house dust mite on purinergic receptor P2Y12 (P2RY12) and lung function in children with asthma.

    PubMed

    Bunyavanich, S; Boyce, J A; Raby, B A; Weiss, S T

    2012-02-01

    Distinct receptors likely exist for leukotriene (LT)E(4), a potent mediator of airway inflammation. Purinergic receptor P2Y12 is needed for LTE(4)-induced airways inflammation, and P2Y12 antagonism attenuates house dust mite-induced pulmonary eosinophilia in mice. Although experimental data support a role for P2Y12 in airway inflammation, its role in human asthma has never been studied. To test for association between variants in the P2Y12 gene (P2RY12) and lung function in human subjects with asthma, and to examine for gene-by-environment interaction with house dust mite exposure. Nineteen single nucleotide polymorphisms (SNPs) in P2RY12 were genotyped in 422 children with asthma and their parents (n = 1266). Using family based methods, we tested for associations between these SNPs and five lung function measures. We performed haplotype association analyses and tested for gene-by-environment interactions using house dust mite exposure. We used the false discovery rate to account for multiple comparisons. Five SNPs in P2RY12 were associated with multiple lung function measures (P-values 0.006–0.025). Haplotypes in P2RY12 were also associated with lung function (P-values 0.0055–0.046). House dust mite exposure modulated associations between P2RY12 and lung function, with minor allele homozygotes exposed to house dust mite demonstrating worse lung function than those unexposed (significant interaction P-values 0.0028–0.040). The P2RY12 variants were associated with lung function in a large family-based asthma cohort. House dust mite exposure caused significant gene-by-environment effects. Our findings add the first human evidence to experimental data supporting a role for P2Y12 in lung function. P2Y12 could represent a novel target for asthma treatment.

  12. 40 CFR 197.12 - What definitions apply in subpart B?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false What definitions apply in subpart B? 197.12 Section 197.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS PUBLIC HEALTH AND ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR YUCCA MOUNTAIN, NEVADA...

  13. 40 CFR 600.509-12 - Voluntary submission of additional data.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 30 2014-07-01 2014-07-01 false Voluntary submission of additional data. 600.509-12 Section 600.509-12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL ECONOMY AND GREENHOUSE GAS EXHAUST EMISSIONS OF MOTOR VEHICLES Procedures for...

  14. 40 CFR 197.12 - What definitions apply in subpart B?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 25 2014-07-01 2014-07-01 false What definitions apply in subpart B? 197.12 Section 197.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS PUBLIC HEALTH AND ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR YUCCA MOUNTAIN, NEVADA...

  15. 40 CFR 197.12 - What definitions apply in subpart B?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 26 2013-07-01 2013-07-01 false What definitions apply in subpart B? 197.12 Section 197.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS PUBLIC HEALTH AND ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR YUCCA MOUNTAIN, NEVADA...

  16. 40 CFR 197.12 - What definitions apply in subpart B?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 40 Protection of Environment 26 2012-07-01 2011-07-01 true What definitions apply in subpart B? 197.12 Section 197.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS PUBLIC HEALTH AND ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR YUCCA MOUNTAIN, NEVADA...

  17. 40 CFR 197.12 - What definitions apply in subpart B?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 25 2011-07-01 2011-07-01 false What definitions apply in subpart B? 197.12 Section 197.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) RADIATION PROTECTION PROGRAMS PUBLIC HEALTH AND ENVIRONMENTAL RADIATION PROTECTION STANDARDS FOR YUCCA MOUNTAIN, NEVADA...

  18. Stimulation of IFN-γ production by garlic lectin in mouse spleen cells: involvement of IL-12 via activation of p38 MAPK and ERK in macrophages.

    PubMed

    Dong, Qing; Sugiura, Tsutomu; Toyohira, Yumiko; Yoshida, Yasuhiro; Yanagihara, Nobuyuki; Karasaki, Yuji

    2011-02-15

    Several lectins, present in beans and edible plant products, have immuno-potentiating and anti-tumor activities. We here report the effects of garlic lectin purified from garlic bulbs on the production of cytokines such as interleukin-12 (IL-12) and interferon-γ (IFN-γ) in the mouse. Garlic lectin induced IFN-γ production in spleen cells in a bell-shaped time (24-60 h)- and concentration (0.25-2.0 mg/ml)-dependent manner. The maximal enhancement was observed at 36 h with 0.5 mg/ml of garlic lectin. The stimulatory effect of garlic lectin on IFN-γ production was completely inhibited by both actinomycin D and cycloheximide, an inhibitor of ribosomal protein synthesis and DNA-dependent RNA polymerase, respectively, and was associated with an increase in IFN-γ mRNA level. Garlic lectin also induced IL-12 production in mouse peritoneal macrophages in a concentration (0.25-1.0 mg/ml)- and bell-shaped time (3-24 h)-dependent manner. The lectin increased the phosphorylation of extracellular signal-regulated kinases (ERK) and p38 mitogen-activated protein kinase (p38 MAPK) in macrophages. Furthermore, specific pharmacological inhibitors of ERK kinase (U0126) and p38 MAPK (SB203580) also suppressed the production of IL-12 induced by garlic lectin. The present findings suggest that garlic lectin induces IL-12 production via activation of p38 MAPK and ERK in mouse macrophages, which, in turn, stimulates IFN-γ production through an increase in IFN-γ mRNA in the spleen cells. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. TIMo/sub 2/ /SUP IV/ P/sub 3/O/sub 12/: a molybdenophosphate with a tunnel structure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leclaire, A.; Monier, J.C.; Raveau, B.

    1985-10-01

    A molybdenophosphate, TIMo/sub 2/ /SUP IV/ P/sub 3/O/sub 12/, with an original tunnel structure, has been isolated. Its structure has been determined by X-ray diffraction on a single crystal. It crystallizes in the orthorhombic system with a = 8.836(1), b = 9.255(1), c = 12.288(1) A, possible space groups Pbcm and Pbc2/sub 1/ with /ZETA/ = 4. The structure was solved and refined in the centrosymmetric space group Pbcm. The host lattice ''Mo/sub 3/P/sub 3/O/sub 12/'' is built up from corner-sharing octahedra and tetrahedra and forms tunnels running along the b axis and cages where the TI+ ions are located.more » The relationships of this framework wit that of the phosphate tungsten bronze CsP/sub 8/W/sub 8/O/sub 40/ and that of the hexagonal tungsten bronze are discussed.« less

  20. Early interleukin-6 enhances hepatic ketogenesis in APPSWE/PSEN1dE9 mice via 3-hydroxy-3-methylglutary-CoA synthase 2 signaling activation by p38/nuclear factor κB p65.

    PubMed

    Shi, Le; Zhao, Daina; Hou, Chen; Peng, Yunhua; Liu, Jing; Zhang, Shuangxi; Liu, Jiankang; Long, Jiangang

    2017-08-01

    Alzheimer's disease (AD) is considered a multifactorial disease that affects the central nervous system and periphery. A decline in brain glucose metabolism is an early feature of AD and is accompanied by a phenotypic shift from aerobic glycolysis to ketogenesis. The liver is responsible for the generation of the ketone body. However, the mechanism that underlies hepatic ketogenesis in AD remains unclear. Here, we investigated hepatic ketogenesis during the early stage of AD pathogenesis in amyloid precursor protein (APP SWE ) and presenilin (PSEN1dE9) (APP/PS1) mice. We observed that β-hydroxybutyric acid was increased in the brain of the postmortem mild cognitive impairment and AD subjects and in 3-month-old APP/PS1 AD mice. A rise in 3-hydroxy-3-methylglutary-CoA synthase 2 (HMGCS2), a key enzyme for catalyzing β-hydroxybutyric acid production, was observed in early AD mice. We further showed that proinflammatory cytokines were activated in the liver prior to their activation in the brain of 3-month-old APP/PS1 mice. Among the cytokines, interleukin-6 significantly activated HMGCS2 through the binding of nuclear factor κB (NF-κB) p65 to the HMGCS2 promoter. Additionally, interleukin-6 stimulated phosphorylation of p38 mitogen activated protein kinases, an upstream molecule for NF-κB p65 signaling. We have demonstrated that a hepatic inflammatory factor enhances ketogenesis through HMGCS2 signaling activation by p38/NF-κB p65. These results provide a novel peripheral metabolic mechanism for enhanced ketone production and suggest a plausible early AD phenotype to diagnose AD. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. 40 CFR 717.12 - Significant adverse reactions that must be recorded.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... SIGNIFICANT ADVERSE REACTIONS TO HEALTH OR THE ENVIRONMENT General Provisions § 717.12 Significant adverse... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Significant adverse reactions that must be recorded. 717.12 Section 717.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY...

  2. Interleukin-34 inhibits hepatitis B virus replication in vitro and in vivo

    PubMed Central

    Cheng, Sheng-Tao; Tang, Hua; Ren, Ji-Hua; Chen, Xiang; Huang, Ai-Long

    2017-01-01

    Background The hepatitis B virus (HBV) infection could activate the immune system and induce extensive inflammatory response. As the most important inflammatory factor, interleukins are critical for anti-viral immunity. Here we investigated whether interleukin-34 (IL-34) play a role in HBV infection. Methodology/Principal findings In this study, we first found that both serum IL-34 and IL-34 mRNA in PBMCs in chronic HBV patients was significantly decreased compared to the healthy controls. Furthermore, both IL-34 protein and mRNA levels were declined hepatoma cells expressing HBV. In addition, the clinical parameters analysis found that serum IL-34 was significantly associated with HBV DNA (P = 0.0066), ALT (P = 0.0327), AST (P = 0.0435), TB (P = 0.0406), DB (P = 0.0368) and AFP (P = 0.0225). Correlation analysis also found that serum IL-34 negatively correlated with HBV DNA copies, ALT and AST. In vitro studies found that IL-34 treatment in HepAD38 and HepG2.2.15 cells markedly inhibited HBV DNA, total RNA, 3.5kb mRNA and HBc protein. In vivo studies further demonstrated IL-34 treatment in HBV transgenic mice exhibited greater inhibition on HBV DNA, total RNA, 3.5kb mRNA and HBc protein, suggesting the effect to IL-34 on HBV is likely due to host innate or adaptive immune response. Conclusions/Significance Our study identified a novel interleukin, IL-34, which has anti-viral activity in HBV replication in hepatocytes in vitro and in vivo. These data suggest a rationale for the use of IL-34 in the HBV treatment. PMID:28614380

  3. 40 CFR 721.3025 - Fatty acids C12-18, C18 unsaturated, C12-18 alkyl esters (generic).

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 40 Protection of Environment 31 2011-07-01 2011-07-01 false Fatty acids C12-18, C18 unsaturated... Significant New Uses for Specific Chemical Substances § 721.3025 Fatty acids C12-18, C18 unsaturated, C12-18... chemical substance identified generically as fatty acids C12-18, C18 unsaturated, C12-18 alkyl esters (PMNs...

  4. Inhibition of interleukin-2-mediated lymphocyte activation in patients with Cushing's syndrome: a comparison with hypocortisolemic patients.

    PubMed

    Sauer, J; Stalla, G K; Müller, O A; Arzt, E

    1994-02-01

    We investigated the lymphocyte interleukin-2 (IL-2) system, which is critically involved in lymphocyte activation, in patients with disorders or the hypothalamic-pituitary-adrenal (HPA) axis. Patients with Cushing's syndrome (n = 9) showed a significant (p < 0.05) inhibition of phytohemagglutinin (PHA)-stimulated IL-2 secretion by peripheral lymphocytes and a decrease of sensitivity to cortisol inhibition in vitro compared to normal subjects (n = 9). Circulating soluble interleukin-2 receptor (sIL-2R) levels were significantly decreased (p < 0.05), whereas no significant difference was observed in PHA-induced sIL-2R release in vitro. In patients with hypocortisolism (n = 12), in vitro IL-2 synthesis was increased compared to normal subjects and to patients with Cushing's syndrome (p < 0.01). In vitro sIL-2R release was significantly higher (p < 0.01) compared to patients with Cushing's syndrome. In contrast to patients with secondary adrenal insufficiency (n = 7), patients with an adrenal origin of hypocortisolism (Addison's disease, bilateral adrenalectomy; n = 5) showed significantly elevated circulating sIL-2R levels compared to normal subjects and patients with Cushing's syndrome (p < 0.005). There was no significant difference between the study groups in mitogen-induced DNA synthesis. This is the first description of alterations of cytokine secretion in patients with HPA axis disorders. The contrary effects of long-term hypercortisolism and insufficient or absent adrenal glucocorticoid secretion on IL-2-mediated lymphocyte activation could account for the immune states previously observed in these patients.

  5. Repression of the Chromatin-Tethering Domain of Murine Leukemia Virus p12.

    PubMed

    Brzezinski, Jonathon D; Modi, Apexa; Liu, Mengdan; Roth, Monica J

    2016-12-15

    Murine leukemia virus (MLV) p12, encoded within Gag, binds the viral preintegration complex (PIC) to the mitotic chromatin. This acts to anchor the viral PIC in the nucleus as the nuclear envelope re-forms postmitosis. Mutations within the p12 C terminus (p12 PM13 to PM15) block early stages in viral replication. Within the p12 PM13 region (p12 60 PSPMA 65 ), our studies indicated that chromatin tethering was not detected when the wild-type (WT) p12 protein (M63) was expressed as a green fluorescent protein (GFP) fusion; however, constructs bearing p12-I63 were tethered. N-terminal truncations of the activated p12-I63-GFP indicated that tethering increased further upon deletion of p12 25 DLLTEDPPPY 34 , which includes the late domain required for viral assembly. The p12 PM15 sequence (p12 70 RREPP 74 ) is critical for wild-type viral viability; however, virions bearing the PM15 mutation (p12 70 AAAAA 74 ) with a second M63I mutant were viable, with a titer 18-fold lower than that of the WT. The p12 M63I mutation amplified chromatin tethering and compensated for the loss of chromatin binding of p12 PM15. Rescue of the p12-M63-PM15 nonviable mutant with prototype foamy virus (PFV) and Kaposi's sarcoma herpesvirus (KSHV) tethering sequences confirmed the function of p12 70-74 in chromatin binding. Minimally, full-strength tethering was seen with only p12 61 SPIASRLRGRR 71 fused to GFP. These results indicate that the p12 C terminus alone is sufficient for chromatin binding and that the presence of the p12 25 DLLTEDPPPY 34 motif in the N terminus suppresses the ability to tether. This study defines a regulatory mechanism controlling the differential roles of the MLV p12 protein in early and late replication. During viral assembly and egress, the late domain within the p12 N terminus functions to bind host vesicle release factors. During viral entry, the C terminus of p12 is required for tethering to host mitotic chromosomes. Our studies indicate that the p12 domain

  6. Interaction of Macrophage Antigen 1 and CD40 Ligand Leads to IL-12 Production and Resistance in CD40-Deficient Mice Infected with Leishmania major.

    PubMed

    Okwor, Ifeoma; Jia, Ping; Uzonna, Jude E

    2015-10-01

    Although some studies indicate that the interaction of CD40 and CD40L is critical for IL-12 production and resistance to cutaneous leishmaniasis, others suggest that this pathway may be dispensable. In this article, we compared the outcome of Leishmania major infection in both CD40- and CD40L-deficient mice after treatment with rIL-12. We show that although CD40 and CD40L knockout (KO) mice are highly susceptible to L. major, treatment with rIL-12 during the first 2 wk of infection causes resolution of cutaneous lesions and control of parasite replication. Interestingly, although treated CD40 KO mice remained healed, developed long-term immunity, and were resistant to secondary L. major challenge, treated CD40L KO reactivated their lesion after cessation of rIL-12 treatment. Disease reactivation in CD40L KO mice was associated with impaired IL-12 and IFN-γ production and a concomitant increase in IL-4 production by cells from lymph nodes draining the infection site. We show that IL-12 production by dendritic cells and macrophages via CD40L-macrophage Ag 1 (Mac-1) interaction is responsible for the sustained resistance in CD40 KO mice after cessation of rIL-12 treatment. Blockade of CD40L-Mac-1 interaction with anti-Mac-1 mAb led to spontaneous disease reactivation in healed CD40 KO mice, which was associated with impaired IFN-γ response and loss of infection-induced immunity after secondary L. major challenge. Collectively, our data reveal a novel role of CD40L-Mac-1 interaction in IL-12 production, development, and maintenance of optimal Th1 immunity in mice infected with L. major. Copyright © 2015 by The American Association of Immunologists, Inc.

  7. 12 CFR 40.16 - Protection of Fair Credit Reporting Act.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... CONSUMER FINANCIAL INFORMATION Relation to Other Laws; Effective Date § 40.16 Protection of Fair Credit... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Protection of Fair Credit Reporting Act. 40.16... Fair Credit Reporting Act (15 U.S.C. 1681 et seq.), and no inference shall be drawn on the basis of the...

  8. 40 CFR 30.12 - Forms for applying for Federal assistance.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... particular State can be obtained from EPA or the Catalog of Federal Domestic Assistance. The SPOC shall... 40 Protection of Environment 1 2012-07-01 2012-07-01 false Forms for applying for Federal assistance. 30.12 Section 30.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER...

  9. 40 CFR 30.12 - Forms for applying for Federal assistance.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... particular State can be obtained from EPA or the Catalog of Federal Domestic Assistance. The SPOC shall... 40 Protection of Environment 1 2014-07-01 2014-07-01 false Forms for applying for Federal assistance. 30.12 Section 30.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER...

  10. 40 CFR 30.12 - Forms for applying for Federal assistance.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... particular State can be obtained from EPA or the Catalog of Federal Domestic Assistance. The SPOC shall... 40 Protection of Environment 1 2011-07-01 2011-07-01 false Forms for applying for Federal assistance. 30.12 Section 30.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER...

  11. 40 CFR 30.12 - Forms for applying for Federal assistance.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... particular State can be obtained from EPA or the Catalog of Federal Domestic Assistance. The SPOC shall... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Forms for applying for Federal assistance. 30.12 Section 30.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER...

  12. 40 CFR 30.12 - Forms for applying for Federal assistance.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... particular State can be obtained from EPA or the Catalog of Federal Domestic Assistance. The SPOC shall... 40 Protection of Environment 1 2013-07-01 2013-07-01 false Forms for applying for Federal assistance. 30.12 Section 30.12 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER...

  13. Increased p50/p50 NF-κB Activation in Human Papillomavirus Type 6- or Type 11-Induced Laryngeal Papilloma Tissue

    PubMed Central

    Vancurova, Ivana; Wu, Rong; Miskolci, Veronika; Sun, Shishinn

    2002-01-01

    We have observed elevated NF-κB DNA-binding activity in nuclear extracts from human papillomavirus type 6- and 11-infected laryngeal papilloma tissues. The predominant DNA-binding species is the p50/p50 homodimer. The elevated NF-κB activity could be correlated with a reduced level of cytoplasmic IκBβ and could be associated with the overexpression of p21CIP1/WAF1 in papilloma cells. Increased NF-κB activity and cytoplasmic accumulation of p21CIP1/WAF1 might counteract death-promoting effects elicited by overexpressed PTEN and reduced activation of Akt and STAT3 previously noted in these tissues. PMID:11773428

  14. Plasma Level of Interleukin-35 as an Independent Prognostic Indicator in Hepatocellular Carcinoma.

    PubMed

    Qiu, Xiangting; Wang, Xinhua; Song, Yucui; Chen, Lingling

    2016-12-01

    Hepatocellular carcinoma is a major type of liver cancer with poor prognosis. The aim of the study was to determine the prognostic significance of plasma interleukin-35 level in hepatocellular carcinoma. A total of 153 hepatocellular carcinoma patients and 153 healthy controls were enrolled. Blood samples were obtained at admission. Plasma interleukin-35 level was analyzed by enzyme-linked immunosorbent assay. Distribution of T cell subset and expression of Fas/FasL protein were detected by flow cytometry. The patients were followed up for 2 years. Poor prognosis was defined as death of hepatocellular carcinoma. The plasma levels of interleukin-35 were significantly higher in the patients than the controls (25.1 ± 13.1, 9.3 ± 6.3 pg/mL, P < 0.001). After adjusted for multiple confounding factors, the multivariate logistic regression analyses reported that high level of interleukin-35 (≥25.0 pg/mL) was associated with the poor prognosis in the patients (OR 6.63, 95 % CI 3.27-13.47). Compared with the patients with low level of interleukin-35 (<25.0 pg/mL), the patients with high level of interleukin-35 showed higher frequencies of CD4+CD25+FoxP3+ and CD3+Foxp3+ regulatory T cells (P < 0.001 and P < 0.001) and also showed higher apoptosis levels of CD8+ T cells (P < 0.001). Circulating interleukin-35 concentration might be an independent prognostic indicator in hepatocellular carcinoma. Such prognostic significance could be partly involved in the activation of regulatory T cell and the apoptosis of CD8+ T cell.

  15. The contribution of interleukin-2 to effective wound healing.

    PubMed

    Doersch, Karen M; DelloStritto, Daniel J; Newell-Rogers, M Karen

    2017-02-01

    Ineffective skin wound healing is a significant source of morbidity and mortality. Roughly 6.5 million Americans experience chronically open wounds and the cost of treating these wounds numbers in the billions of dollars annually. In contrast, robust wound healing can lead to the development of either hypertrophic scarring or keloidosis, both of which can cause discomfort and can be cosmetically undesirable. Appropriate wound healing requires the interplay of a variety of factors, including the skin, the local microenvironment, the immune system, and the external environment. When these interactions are perturbed, wounds can be a nidus for infection, which can cause them to remain open an extended period of time, or can scar excessively. Interleukin-2, a cytokine that directs T-cell expansion and phenotypic development, appears to play an important role in wound healing. The best-studied role for Interleukin-2 is in influencing T-cell development. However, other cell types, including fibroblasts, the skin cells responsible for closing wounds, express the Interleukin-2 receptor, and therefore may respond to Interleukin-2. Studies have shown that treatment with Interleukin-2 can improve the strength of healed skin, which implicates Interleukin-2 in the wound healing process. Furthermore, diseases that involve impaired wound healing, such as diabetes and systemic lupus erythematosus, have been linked to deficiencies in Interleukin-2 or defects Interleukin-2-receptor signaling. The focus of this review is to summarize the current understanding of the role of Interleukin-2 in wound healing, to highlight diseases in which Interleukin-2 and its receptor may contribute to impaired wound healing, and to assess Interleukin-2-modulating approaches as potential therapies to improve wound healing.

  16. The contribution of interleukin-2 to effective wound healing

    PubMed Central

    DelloStritto, Daniel J; Newell-Rogers, M Karen

    2016-01-01

    Ineffective skin wound healing is a significant source of morbidity and mortality. Roughly 6.5 million Americans experience chronically open wounds and the cost of treating these wounds numbers in the billions of dollars annually. In contrast, robust wound healing can lead to the development of either hypertrophic scarring or keloidosis, both of which can cause discomfort and can be cosmetically undesirable. Appropriate wound healing requires the interplay of a variety of factors, including the skin, the local microenvironment, the immune system, and the external environment. When these interactions are perturbed, wounds can be a nidus for infection, which can cause them to remain open an extended period of time, or can scar excessively. Interleukin-2, a cytokine that directs T-cell expansion and phenotypic development, appears to play an important role in wound healing. The best-studied role for Interleukin-2 is in influencing T-cell development. However, other cell types, including fibroblasts, the skin cells responsible for closing wounds, express the Interleukin-2 receptor, and therefore may respond to Interleukin-2. Studies have shown that treatment with Interleukin-2 can improve the strength of healed skin, which implicates Interleukin-2 in the wound healing process. Furthermore, diseases that involve impaired wound healing, such as diabetes and systemic lupus erythematosus, have been linked to deficiencies in Interleukin-2 or defects Interleukin-2-receptor signaling. The focus of this review is to summarize the current understanding of the role of Interleukin-2 in wound healing, to highlight diseases in which Interleukin-2 and its receptor may contribute to impaired wound healing, and to assess Interleukin-2-modulating approaches as potential therapies to improve wound healing. PMID:27798123

  17. Anti-Inflammatory Components of the Starfish Astropecten polyacanthus

    PubMed Central

    Thao, Nguyen Phuong; Cuong, Nguyen Xuan; Luyen, Bui Thi Thuy; Quang, Tran Hong; Hanh, Tran Thi Hong; Kim, Sohyun; Koh, Young-Sang; Nam, Nguyen Hoai; Kiem, Phan Van; Minh, Chau Van; Kim, Young Ho

    2013-01-01

    Inflammation is important in biomedical research, because it plays a key role in inflammatory diseases including rheumatoid arthritis and other forms of arthritis, diabetes, heart disease, irritable bowel syndrome, Alzheimer’s disease, Parkinson’s disease, allergies, asthma, and even cancer. In the present study, we describe the inhibitory effect of crude extracts and steroids isolated from the starfish Astropecten polyacanthus on pro-inflammatory cytokine (Interleukin-12 (IL-12) p40, interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α)) production in lipopolysaccharide (LPS)-stimulated bone marrow-derived dendritic cells (BMDCs). Among those tested, compounds 5 and 7 showed potent inhibitory effects on the production of all three pro-inflammatory cytokines with IC50 values ranging from 1.82 ± 0.11 to 7.00 ± 0.16 μM. Potent inhibitory activities were also observed for compound 1 on the production of IL-12 p40 and IL-6 with values of 3.96 ± 0.12 and 4.07 ± 0.13 μM, respectively, and for compounds 3 and 4 on the production of IL-12 p40 with values of 6.55 ± 0.18 and 5.06 ± 0.16 μM, respectively. Moreover, compounds 2 (IC50 = 34.86 ± 0.31 μM) and 6 (IC50 = 79.05 ± 2.05 μM) exhibited moderate inhibitory effects on the production of IL-12 p40, whereas compounds 3 (IC50 = 22.80 ± 0.21 μM) and 4 (IC50 = 16.73 ± 0.25 μM) moderately inhibited the production of TNF-α and IL-6, respectively. PMID:23945602

  18. Decreased production of interleukin-12 and type 2 immune responses are marked in cachectic patients with colorectal and gastric cancer.

    PubMed

    Shibata, Masahiko; Nezu, Takeshi; Kanou, Hisao; Abe, Hideo; Takekawa, Motoo; Fukuzawa, Masahiro

    2002-04-01

    Balance of the two types of T helper cells is one of the most important factors for regulation of the immune system. This study examines the production of interleukin (IL)-4, -6, -10, -12, and interferon-gamma by peripheral blood mononuclear cells stimulated with phytohemagglutinin or Staphylococcus aureus. Sixty-one patients, including 25 with gastric and 39 with colorectal cancer, and 39 normal volunteers were entered. The production of IL-12 decreased significantly with advancing disease and was lowest in the patients with distant metastases and cachexia. Compared with normal donors, the production of interferon-gamma decreased in all categories of patients, with no difference among patient groups. Levels of Th2 cytokines, such as IL-4, IL-6, and IL-10, also showed no difference among patient groups. However, production of all these cytokines had increased by 2.5 months after sequential testing in the same cachectic patients. The authors' findings indicate that the induction of Th1 cells seems to be suppressed at a relatively early stage of disease, whereas that of Th2 cells seems to increase in the terminal stage.

  19. The Influence of Interleukin-4 on Ligament Healing

    PubMed Central

    Chamberlain, Connie S; Leiferman, Ellen M; Frisch, Kayt E; Wang, Sijian; Yang, Xipei; Brickson, Stacey L; Vanderby, Ray

    2011-01-01

    Despite a complex cascade of cellular events to reconstruct the damaged extracellular matrix, ligament healing results in a mechanically inferior scarred ligament. During normal healing, granulation tissue expands into any residual normal ligamentous tissue (creeping substitution), resulting in a larger region of healing, greater mechanical compromise, and an inefficient repair process. To control creeping substitution and possibly enhance the repair process, the anti-inflammatory cytokine, interleukin-4 (IL-4) was administered to rats prior to and after rupture of their medial collateral ligaments. In vitro experiments demonstrated a time-dependent effect on fibroblast proliferation after interleukin-4 treatment. In vivo treatments with interleukin-4 (100 ng/ml i.v.) for 5 days resulted in decreased wound size and type III collagen and increased type I procollagen, indicating a more regenerative early healing in response to the interleukin-4 treatment. However, continued treatment of interleukin-4 to day 11 antagonized this early benefit and slowed healing. Together, these results suggest that interleukin-4 influences the macrophages and T-lymphocytes but also stimulates fibroblasts associated with the proliferative phase of healing in a dose-, cell-, and time-dependent manner. Although treatment significantly influenced healing in the first week after injury, interleukin-4 alone was unable to maintain this early regenerative response. PMID:21518087

  20. Interleukin-1β transfer across the blood–brain barrier in the ovine fetus

    PubMed Central

    Sadowska, Grazyna B; Chen, Xiaodi; Zhang, Jiyong; Lim, Yow-Pin; Cummings, Erin E; Makeyev, Oleksandr; Besio, Walter G; Gaitanis, John; Padbury, James F; Banks, William A; Stonestreet, Barbara S

    2015-01-01

    Pro-inflammatory cytokines contribute to hypoxic–ischemic brain injury. Blood–brain barrier (BBB) dysfunction represents an important component of hypoxic–ischemic brain injury in the fetus. Hypoxic–ischemic injury could accentuate systemic cytokine transfer across the fetal BBB. There has been considerable conjecture suggesting that systemic cytokines could cross the BBB during the perinatal period. Nonetheless, evidence to support this contention is sparse. We hypothesized that ischemia–reperfusion increases the transfer of systemic interleukin-1β (IL-1β) across the BBB in the fetus. Ovine fetuses at 127 days of gestation were studied 4 hours after 30 minutes of bilateral carotid artery occlusion and compared with a nonischemic group. Recombinant ovine IL-1β protein was expressed from an IL-1β pGEX-2 T vector in E. coli BL-21 cells and purified. The BBB function was quantified in 12 brain regions using a blood-to-brain transfer constant with intravenous 125I-radiolabeled IL-1β (125I-IL-1β). Interleukin-1β crossed the intact BBB in nonischemic fetuses. Blood-to-brain transport of 125I-IL-1β was higher (P<0.05) across brain regions in fetuses exposed to ischemia–reperfusion than nonischemic fetuses. We conclude that systemic IL-1β crosses the intact fetal BBB, and that ischemia–reperfusion increases transfer of this cytokine across the fetal BBB. Therefore, altered BBB function after hypoxia–ischemia facilitates entry of systemic cytokines into the brain of the fetus. PMID:26082012