Science.gov

Sample records for interleukin-12 p40 homodimer

  1. Diagnostic value of interleukin-12 p40 in tuberculous pleural effusions.

    PubMed

    Valdés, L; San José, E; Alvarez Dobaño, J M; Golpe, A; Valle, J M; Penela, P; González Barcala, F J

    2009-04-01

    The diagnosis of tuberculous pleural effusion (TBPE) is frequently problematic. Several markers of TBPE in pleural fluid have been evaluated, with different results. Pleural effusions from 96 patients were classified on the basis of definitive diagnosis as tuberculous (n = 39), neoplastic (n = 42) or parapneumonic (n = 15). Adenosine deaminase (ADA), ADA isoform ADA-2, interferon (IFN)-gamma, CD3(+)/DR(+) T-lymphocytes and interleukin (IL)-12 p40 were determined in all 96 effusions. The efficiency of IL-12 p40 for diagnosis of TBPEs was evaluated, in comparison with those of the other parameters, by comparing the areas under their receiver operating characteristics. With the threshold value of 550 pg.mL(-1), IL-12 p40 had a sensitivity of 92.3% (36 out of 39) and specificity of 70.2% (17 false positives). The misclassification rate of IL-12 p40 was significantly greater than those of ADA-2 and ADA. Among TBPEs, ADA correlated significantly with ADA-2, and IFN-gamma with ADA and IL-12 p40. Although tuberculous pleural effusions show values of interleukin-12 p40 that are significantly higher than neoplastic and parapneumonic fluids, this parameter is less efficient than adenosine deaminase, adenosine deaminase isoform 2 and interferon-gamma. Its routine determination is, accordingly, not justified.

  2. Chronic Disseminated Salmonellosis in a Patient with Interleukin- 12p40 Deficiency.

    PubMed

    Alaki, Emadia Mohammad; Aljobair, Fahad; Alaklobi, Faisal; Al Shamrani, Mobarak; Al-Zahim, Fahad; Dongues, Aziza; Casanova, Jean-Laurent

    2017-07-18

    Interleukin (IL)-12 is composed of p35 and p40 subunit, in this case IL-12p40 deficiency is a rare genetic etiology of Mendelian susceptibility to mycobacterial disease (MSMD). Salmonellosis has been reported in almost half of these patients and mostly present in recurrent extra intestinal form. In this report, we described an 18 month old boy with absence of IL12p40 production suffering from chronic disseminated non-typhoidal salmonellosis. To the best of our knowledge this is the first reported case.

  3. Inflammation and Elevation of Interleukin-12p40 in Patients with Schizophrenia.

    PubMed

    Bedrossian, Nora; Haidar, Mariam; Fares, Jawad; Kobeissy, Firas H; Fares, Youssef

    2016-01-01

    Schizophrenia is a serious mental illness with chronic symptoms and significant impairment in psychosocial functioning, which suggests that it likely has neurodegenerative characteristics. Inflammatory markers such as pro-inflammatory cytokines are well-known etiological contributors for psychiatric disorders, including schizophrenia. Although, the role of inflammation in schizophrenia is becoming evident, the number of studies in this area is relatively scarce, especially in Lebanon, and increased procedural thoroughness is needed. Cytokines play a key role in the activation of the immune system and strongly influence neurotransmission. Previous investigation of plasma levels showed dysregulation of interleukin (IL)-12. However, genotypical variations of this interleukin have not been investigated for patients with schizophrenia yet. Thus, in this paper, we aimed to compute and assess IL-12p40 levels in the sera of individuals with schizophrenia from different provinces in Lebanon and compare it to controls. Healthy subjects comprised 60 individuals with a male/female (M/F) ratio of 31/29, whereas patients with schizophrenia consisted of 63 subjects with an M/F ratio of 30/33. The mean age for healthy controls was 30 years, whereas that for patients with schizophrenia was 35 years. A standardized enzyme-linked immunosorbent assay (ELISA) technique was used to measure the concentration of IL-12p40 in all collected sera (n = 123). The mean IL-12p40 levels in patients with schizophrenia were significantly higher than in healthy controls (p = 0.002). Healthy females had a significantly higher concentration of IL-12p40 than healthy males (p = 0.009). Female patients with schizophrenia had significantly higher concentrations of IL-12p40 than their male counterparts (p < 0.001), healthy females (p = 0.018), and healthy males (p < 0.001), respectively. Male patients with schizophrenia had significantly higher concentrations of IL-12p40 than healthy males (p = 0.023). The

  4. Inflammation and Elevation of Interleukin-12p40 in Patients with Schizophrenia

    PubMed Central

    Bedrossian, Nora; Haidar, Mariam; Fares, Jawad; Kobeissy, Firas H.; Fares, Youssef

    2016-01-01

    Schizophrenia is a serious mental illness with chronic symptoms and significant impairment in psychosocial functioning, which suggests that it likely has neurodegenerative characteristics. Inflammatory markers such as pro-inflammatory cytokines are well-known etiological contributors for psychiatric disorders, including schizophrenia. Although, the role of inflammation in schizophrenia is becoming evident, the number of studies in this area is relatively scarce, especially in Lebanon, and increased procedural thoroughness is needed. Cytokines play a key role in the activation of the immune system and strongly influence neurotransmission. Previous investigation of plasma levels showed dysregulation of interleukin (IL)-12. However, genotypical variations of this interleukin have not been investigated for patients with schizophrenia yet. Thus, in this paper, we aimed to compute and assess IL-12p40 levels in the sera of individuals with schizophrenia from different provinces in Lebanon and compare it to controls. Healthy subjects comprised 60 individuals with a male/female (M/F) ratio of 31/29, whereas patients with schizophrenia consisted of 63 subjects with an M/F ratio of 30/33. The mean age for healthy controls was 30 years, whereas that for patients with schizophrenia was 35 years. A standardized enzyme-linked immunosorbent assay (ELISA) technique was used to measure the concentration of IL-12p40 in all collected sera (n = 123). The mean IL-12p40 levels in patients with schizophrenia were significantly higher than in healthy controls (p = 0.002). Healthy females had a significantly higher concentration of IL-12p40 than healthy males (p = 0.009). Female patients with schizophrenia had significantly higher concentrations of IL-12p40 than their male counterparts (p < 0.001), healthy females (p = 0.018), and healthy males (p < 0.001), respectively. Male patients with schizophrenia had significantly higher concentrations of IL-12p40 than healthy males (p = 0.023). The

  5. Reduced cerebrospinal fluid concentration of interleukin-12/23 subunit p40 in patients with cognitive impairment.

    PubMed

    Johansson, Per; Almqvist, Erik G; Wallin, Anders; Johansson, Jan-Ove; Andreasson, Ulf; Blennow, Kaj; Zetterberg, Henrik; Svensson, Johan

    2017-01-01

    The role of inflammation in Alzheimer's disease (AD) and other cognitive disorders is unclear. In a well-defined mono-center population, we measured cytokines and chemokines in paired serum and cerebrospinal fluid (CSF) samples. Consecutive patients with AD (n = 30), stable mild cognitive impairment (SMCI, n = 11), other dementias (n = 11), and healthy controls (n = 18) were included. None of the subjects was treated with glucocorticoids, cholinesterase inhibitors, or non-steroidal anti-inflammatory drugs. Serum and CSF concentrations of interleukin-6 (IL-6), IL-8, IL-12/23 p40, IL-15, IL-16, vascular endothelial growth factor-A (VEGF-A), and three chemokines were measured using a multiplex panel. After correction for multiple comparisons, only CSF IL-12/23 p40 concentration differed significantly between the total patient group (n = 52) and controls (n = 18; p = 0.002). Further analyses showed that CSF IL-12/23 p40 concentration was decreased in all patient subgroups (AD, other dementias, and SMCI) compared to healthy controls (p < 0.01, p < 0.05, and p < 0.05, respectively). In the total study population (n = 70), CSF IL-12/23 p40 concentrations correlated positively with CSF concentrations of β-amyloid1-42 (Aβ1-42) and phosphorylated tau protein (P-tau) whereas in AD patients (n = 30), CSF IL-12/23 p40 only correlated positively with CSF P-Tau (r = 0.46, p = 0.01). Most cytokines and chemokines were similar in patients and controls, but CSF IL-12/23 subunit p40 concentration was decreased in patients with cognitive impairment, and correlated with markers of AD disease status. Further studies are needed to evaluate the role of CSF IL-12/23 p40 in other dementias and SMCI.

  6. The Structure of Interleukin-23 Reveals in the Molecular Basis of P40 Subunit Sharing With Interleukin-12

    SciTech Connect

    Lupardus, P.J.; Garcia, K.C.

    2009-05-19

    Interleukin-23 is a recently identified member of the IL-12 family of heterodimeric cytokines that modulate subpopulations of T helper cells, and both IL-12 and IL-23 are attractive targets for therapy of autoimmune diseases. IL-23 is a binary complex of a four-helix bundle cytokine (p19) and a soluble class I cytokine receptor p40. IL-12 and IL-23 share p40 as an {alpha}-receptor subunit, yet show only 15% sequence homology between their four-helix cytokines p19 and p35, respectively, and signal through different combinations of shared receptors. In order to elucidate the structural basis of p40 sharing, we have determined a 2.3{angstrom} crystal structure of IL-23 for comparison to the previously determined structure of IL-12. The docking mode of p19 to p40 is altered compared to p35, deviating by a 'tilt' and 'roll' that results in an altered footprint of p40 on the A and D helices of the respective cytokines. Binding of p19 to p40 is mediated primarily by an Arginine residue on helix D of p19 that forms an extensive charge and hydrogen-bonding network with residues at the base of the pocket on p40. This 'Arginine pocket' is lined with an inner shell of hydrophobic interactions that are ringed by an outer shell of polar interactions. Comparative analysis indicates that the IL-23 and IL-12 complexes 'mimic' the network of interactions constituting the central Arginine pocket despite p19 and p35 having limited sequence homology. The majority of the structural epitopes in the two complexes are composed of unique p19 and p35 pair-wise contacts with common residues on p40. Thus, while the critical hotspot is maintained in the two complexes, the majority of the interfaces are structurally distinct and, therefore, provide a basis for the therapeutic targeting of IL-12 versus IL-23 heterodimer formation despite their use of a common receptor subunit.

  7. Cloning, promoter analysis and expression in response to bacterial exposure of sea bass (Dicentrarchus labrax L.) interleukin-12 p40 and p35 subunits.

    PubMed

    Nascimento, Diana S; do Vale, Ana; Tomás, Ana M; Zou, Jun; Secombes, Christopher J; dos Santos, Nuno M S

    2007-03-01

    Interleukin-12 (IL-12) is a heterodimeric cytokine pivotal in resistance to microbial and viral infections. In the search for immunoregulatory genes in sea bass the genes for the two IL-12 subunits p40 and p35 were cloned and sequenced. Molecular characterization of these two genes was performed at both the cDNA and genomic levels. Sea bass IL-12 p40 and p35 conserve most cysteines involved in the intra-chain disulfide bonds of human IL-12 subunits as well as the important structural residues for human IL-12 heterodimerization. The gene organization of sea bass IL-12 p40 is similar to the human orthologue, whilst the sea bass IL-12 p35 gene structure, as reported for pufferfish, differs from the human one in containing an additional exon and lacking a second copy of a duplicated exon present in the mammalian genes. The promoter analysis of both sea bass and pufferfish IL-12 genes showed the presence of the main cis-acting elements involved in the transcriptional regulation of human and mouse orthologues. The involvement of IL-12 in sea bass anti-bacterial immune responses was demonstrated by investigating the expression profiles of IL-1beta, IL-12 p40 and p35 in the head-kidney and spleen following intraperitoneal injection of UV-killed and live Photobacterium damselae ssp. piscicida (Phdp). Finally, the importance of nuclear factor (NF)-kappaB on UV-killed Phdp-induced IL-12 p40 and p35 gene transcription was shown by the use of pyrrolidine dithiocarbamate (PDTC).

  8. Tumor Necrosis Factor-α, Interleukins-12(p40), 6, and 10 levels in cerebrospinal fluid and outcome prediction in Ossimi sheep with encephalitic listeriosis.

    PubMed

    Abdlla, Ossama A; Elboshy, Mohamed E; Reisha, Engy F; Gadlla, Hossam A; El-Khodery, Sabry A

    2015-06-01

    Encephalitic listeriosis in sheep is a life-threatening disease. However, little is known about the cytokine response and their predictive value in this disease. The aim of present study was to assess the prognostic significance of Tumor Necrosis Factor-α (TNF-α), Interleukin-12(p40) (IL-12 p40), Interleukin-6 (IL-6), and Interleukin 10 (IL-10) levels in cerebrospinal fluid (CSF) in sheep with encephalitic listeriosis. Fifty-nine ewes in 14 flocks were diagnosed clinically as having listeriosis. CSF was collected and subjected to bacteriological examination and estimation of selected cytokines. Twenty-eight ewes were confirmed to be infected with Listeria monocytogenes. Based on antimicrobial sensitivity test, sheep were treated and the outcome was recorded as survivors (n=10) and non-survivors (n=18). Cutoff points for CSF cytokines were determined by Receiver operating characteristic analysis (ROC). Association between levels of CSF cytokines and outcome of listeriosis was assessed by logistic regression. TNF-α, IL-6 and IL-12(p40) levels as well as TNF-α/IL-10 ratio were significantly higher in non-survivors than survivors (p=0.002, 0.0021, 0.0033, and 0.001, respectively). However, IL-10 level was significantly lower in non-survivors than survivors (p=0.0058). ROC analysis revealed that IL-6 and TNF-α/IL-10 ratio had the highest AUC values (0.98, 0.984, respectively). Final multivariate logistic regression model showed that TNF-α/IL-10 ratio was the only variable that has predictive value for mortality in diseased sheep (p: 0.001; OR: 7.2; 95% CI: 5.7-9.8). TNF-α showed a positive correlation with IL-12β (r=0.917) and IL-6 (r=0.965). IL-12 (p40) showed also a positive correlation with IL-6 (r=0.906). However, IL-10 showed a negative correlation with TNF-α (r=-0.915), IL-12(p40) (r=-0.790), and IL-6 (r=-0.902). In conclusion, TNF-α/IL-10 ratio may provide predictive information about outcome of encephalitic listeriosis in sheep. Copyright © 2015

  9. Synergistic regulation of the human interleukin-12 p40 promoter by NFkappaB and Ets transcription factors in Epstein-Barr virus-transformed B cells and macrophages.

    PubMed

    Gri, G; Savio, D; Trinchieri, G; Ma, X

    1998-03-13

    Monocytes/macrophages produce interleukin-12 (IL-12) in response to pathogenic stimulation, whereas most Epstein-Barr virus-transformed (EBV+) B cells constitutively secrete IL-12. The molecular mechanism regulating the constitutive IL-12 gene expression in EBV+ B cells has not been addressed. In this study, using the EBV+ B cell line RPMI-8866, we localized to the human IL-12 p40 promoter two essential cis elements, the NFkappaB site and the Ets site. The NFkappaB site was shown to interact with members of the NFkappaB family: p50 and c-Rel. The Ets site constitutively bound a multi-component Ets-2-containing complex. While the NFkappaB and Ets sites appear equally critical for inducible p40 promoter activity in macrophage cell lines, NFkappaB plays a more dominant role in the constitutive p40 promoter activity in EBV+ B cells. Transient expression of Ets-2 and c-Rel in B, T, and monocytic cell lines synergistically activated the IL-12 p40 promoter, apparently overcoming the requirement for cell type- or stimulant-specific transcription factors. These data provide new evidence that full activation of the human IL-12 p40 promoter may result primarily from the interplay between NFkappaB and Ets family members.

  10. Ciclosporin A inhibits production of interleukin-12/23p40 and interleukin-23 by the human monocyte cell line, THP-1.

    PubMed

    Kamata, M; Tada, Y; Tatsuta, A; Kawashima, T; Shibata, S; Mitsui, H; Asano, Y; Sugaya, M; Kadono, T; Kanda, N; Watanabe, S; Sato, S

    2013-07-01

    Ciclosporin (Cs)A is an effective treatment for psoriasis. However, to date, the effect of CsA on the production of interleukins (ILs) is unknown. We investigated how CsA affects production of IL-12/23p40 and IL-23 production by the human monocyte cell line, THP-1, which is able to differentiate into macrophage-like cells or normal human keratinocytes (NHKs). THP-1 cells were preincubated with CsA, then stimulated with lipopolysaccharide (LPS), polyinosinic:polycytidylic acid or adenosine triphosphate. The levels of IL-12/23p40 and IL-23 released into the supernatant were assayed by ELISA. CsA significantly reduced both IL-12/23p40 and IL-23 production by LPS-stimulated THP-1 cells, but not in LPS-stimulated macrophage-like differentiated THP-1 cells. None of the stimuli used significantly induced either IL-12/23p40 or IL-23 production in NHKs. CsA inhibits not only IL-12/23p40 and IL-12p70, but also heterodimeric IL-23 production by human monocytes, which may be one possible mechanism for the therapeutic efficacy of CsA in psoriasis.

  11. The 3'UTR 1188 A/C polymorphism in the interleukin-12p40 gene (IL-12B) is associated with lepromatous leprosy in the west of Mexico.

    PubMed

    Alvarado-Navarro, Anabell; Montoya-Buelna, Margarita; Muñoz-Valle, José Francisco; López-Roa, Rocio Ivette; Guillén-Vargas, Cecilia; Fafutis-Morris, Mary

    2008-06-30

    Leprosy is a chronic infectious disease caused by Mycobacterium leprae. IL-12 participates in the immune response against M. leprae by regulating T cell differentiation into the Th1-type response. Several single nucleotide polymorphisms have been identified in the IL-12 gene such as 3'UTR 1188 A/C polymorphism, which is associated with different diseases. However, the relationship of this polymorphism with the immune response in leprosy has not been explored. In this case-control study, we evaluated 44 patients with lepromatous leprosy (LL) and 51 healthy subjects (HS). We aimed to determine the relationship between 3'UTR 1188 A/C polymorphism of IL-12 p40, mRNA expression, and soluble IL-12 concentration in LL patients and HS. Genotype frequencies were 41% A/A, 36% A/C, and 23% C/C in LL patients, and 47% A/A, 49% A/C, and 4% C/C in HS (p<0.05). LL patients had a lower mRNA expression of IL-12 p40 gene, whereas HS had a higher expression level. Soluble IL-12 p40 concentration was higher in LL patients than in HS (p<0.05). IL-12 p70 concentration did not differ between groups, and IL-12 p40 concentration was not significantly correlated with mRNA expression in either group. These data suggest that IL-12 p40 3'UTR 1188 A/C polymorphism is associated with greater susceptibility to lepromatous leprosy in patients from western Mexico, independently of IL-12 p40 and p70 expression levels.

  12. Scavenger receptor for lipoteichoic acid is involved in the potent ability of Lactobacillus plantarum strain L-137 to stimulate production of interleukin-12p40.

    PubMed

    Hatano, Shinya; Hirose, Yoshitaka; Yamamoto, Yoshihiro; Murosaki, Shinji; Yoshikai, Yasunobu

    2015-04-01

    Heat-killed Lactobacillus plantarum strain L-137 (HK L-137) is a more potent inducer of interleukin (IL)-12 than other heat-killed Lactobacillus strains. To elucidate the mechanism involved in this IL-12p40 induction, we compared HK L-137 with heat-killed L. plantarum strain JCM1149 (HK JCM1149) by nuclear magnetic resonance and mass spectrometry. Results showed that HK L-137 contained lipoteichoic acid (LTA) with a chemical structure similar to that of JCM1149, except for a lower degree of glucosyl substitution in the poly(glycerol phosphate) backbone. Lysozyme sensitivity and electrophoretic moiety analysis revealed that HK L-137 exposed more LTA on its cell surface than HK JCM1149. Phagocytosis of HK L-137 by splenic adherent cells was significantly greater than that of HK JCM1149. Anti-LTA antibody and anti-scavenger receptor-A (SR-A) antibody selectively inhibited phagocytosis of HK L-137, as well as IL-12p40 production, by splenic adherent cells. Thus, a higher efficiency of phagocytosis of HK L-137 via SR-A for LTA is responsible for the potent IL-12p40 induction.

  13. Non-canonical interleukin 23 receptor complex assembly: p40 protein recruits interleukin 12 receptor β1 via site II and induces p19/interleukin 23 receptor interaction via site III.

    PubMed

    Schröder, Jutta; Moll, Jens M; Baran, Paul; Grötzinger, Joachim; Scheller, Jürgen; Floss, Doreen M

    2015-01-02

    IL-23, composed of the cytokine subunit p19 and the soluble α receptor subunit p40, binds to a receptor complex consisting of the IL-23 receptor (IL-23R) and the IL-12 receptor β1 (IL-12Rβ1). Complex formation was hypothesized to follow the "site I-II-III" architectural paradigm, with site I of p19 being required for binding to p40, whereas sites II and III of p19 mediate binding to IL-12Rβ1 and IL-23R, respectively. Here we show that the binding mode of p19 to p40 and of p19 to IL-23R follow the canonical site I and III paradigm but that interaction of IL-23 to IL-12Rβ1 is independent of site II in p19. Instead, binding of IL-23 to the cytokine binding module of IL-12Rβ1 is mediated by domains 1 and 2 of p40 via corresponding site II amino acids of IL-12Rβ1. Moreover, domains 2 and 3 of p40 were sufficient for complex formation with p19 and to induce binding of p19 to IL-23R. The Fc-tagged fusion protein of p40_D2D3/p19 did, however, not act as a competitive IL-23 antagonist but, at higher concentrations, induced proliferation via IL-23R but independent of IL-12Rβ1. On the basis of our experimental validation, we propose a non-canonical topology of the IL-23·IL-23R·IL-12Rβ1 complex. Furthermore, our data help to explain why p40 is an antagonist of IL-23 and IL-12 signaling and show that site II of p19 is dispensable for IL-23 signaling. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Whole blood stimulation with Toll-like receptor (TLR)-7/8 and TLR-9 agonists induces interleukin-12p40 expression in plasmacytoid dendritic cells in rhesus macaques but not in humans.

    PubMed

    Koopman, G; Beenhakker, N; Burm, S; Bouwhuis, O; Bajramovic, J; Sommandas, V; Mudde, G; Mooij, P; 't Hart, B A; Bogers, W M J M

    2013-10-01

    Macaques provide important animal models in biomedical research into infectious and chronic inflammatory disease. Therefore, a proper understanding of the similarities and differences in immune function between macaques and humans is needed for adequate interpretation of the data and translation to the human situation. Dendritic cells are important as key regulators of innate and adaptive immune responses. Using a new whole blood assay we investigated functional characteristics of blood plasmacytoid dendritic cells (pDC), myeloid dendritic cells (mDC) and monocytes in rhesus macaques by studying induction of activation markers and cytokine expression upon Toll-like receptor (TLR) stimulation. In a head-to-head comparison we observed that rhesus macaque venous blood contained relatively lower numbers of pDC than human venous blood, while mDC and monocytes were present at similar percentages. In contrast to humans, pDC in rhesus macaques expressed the interleukin (IL)-12p40 subunit in response to TLR-7/8 as well as TLR-9 stimulation. Expression of IL-12p40 was confirmed by using different monoclonal antibodies and by reverse transcription-polymerase chain reaction (RT-PCR). Both in humans and rhesus macaques, TLR-4 stimulation induced IL-12p40 expression in mDC and monocytes, but not in pDC. The data show that, in contrast to humans, pDC in macaques are able to express IL-12p40, which could have consequences for evaluation of human vaccine candidates and viral infection.

  15. A protease-activated receptor 2 agonist (AC-264613) suppresses interferon regulatory factor 5 and decreases interleukin-12p40 production by lipopolysaccharide-stimulated macrophages: Role of p53.

    PubMed

    Yamaguchi, Rui; Yamamoto, Takatoshi; Sakamoto, Arisa; Ishimaru, Yasuji; Narahara, Shinji; Sugiuchi, Hiroyuki; Yamaguchi, Yasuo

    2016-06-01

    The transcription factor interferon regulatory factor 5 (IRF5) has a key role in the production of interleukin (IL)-12 by macrophages. IRF5 is also a central mediator of toll-like receptor signaling and is a direct target of p53. Activation of protease-activated receptor 2 (PAR-2) upregulates p53 and suppresses apoptosis. This study investigated the influence of human neutrophil elastase (HNE) and PAR-2 agonists on expression of IRF5 and IL-12p40 by macrophages stimulated with lipopolysaccharide. Granulocyte-macrophage colony-stimulating factor (GM-CSF)-dependent macrophages showed upregulation of IRF5 expression, while HNE reduced expression of p53 and IRF5 in a concentration-dependent manner. HNE also caused a concentration-dependent decrease of IRF5 in macrophages transfected with small interfering RNA to silence p53, while silencing of β-arrestin 2 blunted the reduction of p53 or IRF5 by HNE. Incubation of macrophages with a PAR-2 agonist, AC-264613, caused a decrease of IRF5 expression and also significantly reduced p53 protein expression. HNE upregulated the expression of tumor necrosis factor receptor-associated factor 6 (TRAF6) and caused transactivation of TLR4, while AC-264613 did not promote TLR4 transactivation. In conclusion, the PAR-2 agonist AC-264613 attenuated IRF5-associated IL-12p40 production by macrophages.

  16. Increased interferon-gamma, interleukin-12p40 and IL-8 production in Propionibacterium acnes-treated peripheral blood mononuclear cells from patient with acne vulgaris: host response but not bacterial species is the determinant factor of the disease.

    PubMed

    Sugisaki, Hitomi; Yamanaka, Keiichi; Kakeda, Masato; Kitagawa, Hiroshi; Tanaka, Kaori; Watanabe, Kunitomo; Gabazza, Esteban C; Kurokawa, Ichiro; Mizutani, Hitoshi

    2009-07-01

    Acne vulgaris is a multifactorial inflammatory disease of the sebaceous follicles of the face and torso that frequently occurs in adolescence. Initially, acne starts as a non-inflammatory comedo. Subsequently, inflammatory reactions evolve to pustules, granulomas and cystic lesions. Many pathogenic mechanisms have been proposed including sebum excretion, obstruction of hair follicles, impaired keratinization of hair epithelium, bacterial overgrowth and immunological mechanisms; the role of Propionibacterium acnes (P. acnes) is particularly important. Facultative anaerobic gram-positive rods have been implicated in acne pathogenesis. However, the host immune response to P. acnes has not been as yet elucidated. The aim of the present study is to evaluate the importance of the immune response to P. acnes and the bacteriological factor in the pathogenesis of acne. P. acnes isolated from acne lesions and healthy volunteers skin were cultured. The peripheral blood mononuclear cells (PBMC) from acne patients or healthy volunteers were stimulated with viable P. acnes, and cytokine production was evaluated using RT-PCR and ELISA. IFN-gamma, IL-12p40, and IL-8 mRNA and protein production were significantly increased in PBMC from acne patients compared to that from normal donors. However, different P. acnes species isolated from acne lesions or normal subjects showed no difference in cytokines production from acne patients and normal subjects PBMC. The inflammatory response of acne appears to be attributable to P. acnes-induced host immune response rather than P. acnes strains from normal skin or acne lesions.

  17. Association of interferon γ T+874A and interleukin 12 p40 promoter CTCTAA/GC polymorphism with the need for respiratory support and perinatal complications in low birthweight neonates

    PubMed Central

    Bokodi, G; Derzbach, L; Bányász, I; Tulassay, T; Vásárhelyi, B

    2007-01-01

    Background Data support the role of interferon (IFN)γ and interleukin (IL)12 in perinatal complications. IFNγ T+874A and IL12 p40 promoter CTCTAA/GC polymorphisms may have an effect on cytokine production. Methods DNA was extracted from dried blood samples of 153 low birthweight (LBW) infants and 172 healthy term infants. IFNγ and IL12 genetic polymorphisms were determined to investigate the association between polymorphisms and ventilation characteristics, bronchopulmonary dysplasia (BPD) and other perinatal disorders. Results The IFNγ+874A allele was over‐represented in LBW infants. Carriers of the IFNγ+874T allele required mechanical ventilation and oxygen supplementation for time periods 41% and 35%, respectively, shorter than those required by those not carrying the IFNγ+874T allele. Stepwise logistic regression analysis showed that carriers of the IFNγ+874T allele were protected against BPD (odds ratio (OR) 0.35 (95% confidence interval (CI) (0.12 to 0.99))) and patent ductus arteriosus (OR 0.43 (95% CI 0.19 to 0.97)), whereas carriers of the IFNγ+874A allele were at higher risk of severe hypotension (OR 3.40 (95% CI 1.01 to 11.52)) and respiratory distress syndrome (OR 4.03 (95% CI 1.30 to 12.50)). Carriers of the IL12 GC allele were protected against pneumonia (OR 0.32 (95% CI 0.14 to 0.75)). Carriers of the IL12 CTCTAA allele were at higher risk of developing necrotising enterocolitis (NEC; OR 2.37 (95% CI 1.01 to 5.53)). Conclusions Carrier state of the IFNγ+874A allele presents an increased risk for premature birth and lung damage, as well as other perinatal complications. The risks of pneumonia and NEC are higher in heterozygotic carriers of the IL12 CTCTAA/GC polymorphism. Further studies are needed to determine whether these associations are the result of altered cytokine‐producing capacity in infants carrying the tested alleles. PMID:16754651

  18. Interleukin-12 in infectious diseases.

    PubMed Central

    Romani, L; Puccetti, P; Bistoni, F

    1997-01-01

    Interleukin-12 (IL-12) is a potent immunoregulatory cytokine that is crucially involved in a wide range of infectious diseases. In several experimental models of bacterial, parasitic, viral, and fungal infection, endogenous IL-12 is required for early control of infection and for generation and perhaps maintenance of acquired protective immunity, directed by T helper type 1 (Th1) cells and mediated by phagocytes. Although the relative roles of IL-12 and gamma interferon in Th1-cell priming may be to a significant extent pathogen dependent, common to most infections is that IL-12 regulates the magnitude of the gamma interferon response at the initiation of infection, thus potentiating natural resistance, favoring Th1-cell development; and inhibiting Th2 responses. Treatment of animals with IL-12, either alone or as a vaccine adjuvant, has been shown to prevent disease by many of the same infectious agents, by stimulating innate resistance or promoting specific reactivity. Although IL-12 may enhance protective memory responses in vaccination or in combination with antimicrobial chemotherapy, it is yet unclear whether exogenous IL-12 can alter established responses in humans. Continued investigation into the possible application of IL-12 therapy to human infections is warranted by the role of the cytokine in inflammation, immunopathology, and autoimmunity. PMID:9336665

  19. Cancer electrogene therapy with interleukin-12.

    PubMed

    Cemazar, Maja; Jarm, Tomaz; Sersa, Gregor

    2010-08-01

    Electrogene therapy combines administration of plasmid DNA into tissue followed by local application of electric pulses. In electrogene therapy with interleukin-12 (IL-12), different routes of administration, different doses of plasmid DNA and different protocols for delivery of electric pulses were evaluated in numerous preclinical studies. Antitumor effectiveness was tested in different types of primary tumors, distantly growing tumors and induced metastases. Intratumoral IL-12 electrogene therapy has been proved to be very effective in local tumor control, having also a systemic effect. Intramuscular and peritumoral IL-12 electrogene therapy had also a pronounced systemic effect and when combined with other treatment strategies resulted in tumor cures. Antitumor effectiveness of IL-12 electrogene therapy is due to the induction of adaptive immunity and innate resistance and anti-angiogenic action. Translation of preclinical studies into clinical trials in human and veterinary oncology has started with encouraging results that would hopefully lead to further investigation of this therapy, also in combination with other cancer treatment modalities.

  20. Interleukin-12 (IL-12), but not IL-23, deficiency ameliorates viral encephalitis without affecting viral control.

    PubMed

    Kapil, Parul; Atkinson, Roscoe; Ramakrishna, Chandran; Cua, Daniel J; Bergmann, Cornelia C; Stohlman, Stephen A

    2009-06-01

    The relative contributions of interleukin-12 (IL-12) and IL-23 to viral pathogenesis have not been extensively studied. IL-12p40 mRNA rapidly increases after neurotropic coronavirus infection. Infection of mice defective in both IL-12 and IL-23 (p40(-/-)), in IL-12 alone (p35(-/-)), and in IL-23 alone (p19(-/-)) revealed that the symptoms of coronavirus-induced encephalitis are regulated by IL-12. IL-17-producing cells never exceeded background levels, supporting a redundant role of IL-23 in pathogenesis. Viral control, tropism, and demyelination were all similar in p35(-/-), p19(-/-), and wild-type mice. Reduced morbidity in infected IL-12 deficient mice was also not associated with altered recruitment or composition of inflammatory cells. However, gamma interferon (IFN-gamma) levels and virus-specific IFN-gamma-secreting CD4 and CD8 T cells were all reduced in the central nervous systems (CNS) of infected p35(-/-) mice. Transcription of the proinflammatory cytokines IL-1beta and IL-6, but not tumor necrosis factor, were initially reduced in infected p35(-/-) mice but increased to wild-type levels during peak inflammation. Furthermore, although transforming growth factor beta mRNA was not affected, IL-10 was increased in the CNS in the absence of IL-12. These data suggest that IL-12 does not contribute to antiviral function within the CNS but enhances morbidity associated with viral encephalitis by increasing the ratio of IFN-gamma to protective IL-10.

  1. Inherited IL-12p40 Deficiency

    PubMed Central

    Prando, Carolina; Samarina, Arina; Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Cobat, Aurelie; Picard, Capucine; AlSum, Zobaida; Al-Jumaah, Suliman; Al-Hajjar, Sami; Frayha, Husn; Al-Mousa, Hamoud; Ben-Mustapha, Imen; Adimi, Parisa; Feinberg, Jacqueline; de Suremain, Maylis; Jannière, Lucile; Filipe-Santos, Orchidée; Mansouri, Nahal; Stephan, Jean-Louis; Nallusamy, Revathy; Kumararatne, Dinakantha S.; Bloorsaz, Mohamad Reza; Ben-Ali, Meriem; Elloumi-Zghal, Houda; Chemli, Jalel; Bouguila, Jihene; Bejaoui, Mohamed; Alaki, Emadia; AlFawaz, Tariq S.; Al Idrissi, Eman; ElGhazali, Gehad; Pollard, Andrew J.; Murugasu, Belinda; Wah Lee, Bee; Halwani, Rabih; Al-Zahrani, Mohammed; Al Shehri, Mohammed A.; Al-Zahrani, Mofareh; Bin-Hussain, Ibrahim; Mahdaviani, Seyed Alireza; Parvaneh, Nima; Abel, Laurent; Mansouri, Davood; Barbouche, Ridha; Al-Muhsen, Saleh

    2013-01-01

    Abstract Autosomal recessive interleukin (IL)-12 p40 (IL-12p40) deficiency is a rare genetic etiology of Mendelian susceptibility to mycobacterial disease (MSMD). We report the genetic, immunologic, and clinical features of 49 patients from 30 kindreds originating from 5 countries (India, Iran, Pakistan, Saudi Arabia, and Tunisia). There are only 9 different mutant alleles of the IL12B gene: 2 small insertions, 3 small deletions, 2 splice site mutations, and 1 large deletion, each causing a frameshift and leading to a premature stop codon, and 1 nonsense mutation. Four of these 9 variants are recurrent, affecting 25 of the 30 reported kindreds, due to founder effects in specific countries. All patients are homozygous and display complete IL-12p40 deficiency. As a result, the patients lack detectable IL-12p70 and IL-12p40 and have low levels of interferon gamma (IFN-γ). The clinical features are characterized by childhood onset of bacille Calmette-Guérin (attenuated Mycobacterium bovis strain) (BCG) and Salmonella infections, with recurrences of salmonellosis (36.4%) more common than recurrences of mycobacterial disease (25%). BCG vaccination led to BCG disease in 40 of the 41 patients vaccinated (97.5%). Multiple mycobacterial infections were rare, observed in only 3 patients, whereas the association of salmonellosis and mycobacteriosis was observed in 9 patients. A few other infections were diagnosed, including chronic mucocutaneous candidiasis (n = 3), nocardiosis (n = 2), and klebsiellosis (n = 1). IL-12p40 deficiency has a high but incomplete clinical penetrance, with 33.3% of genetically affected relatives of index cases showing no symptoms. However, the prognosis is poor, with mortality rates of up to 28.6%. Overall, the clinical phenotype of IL-12p40 deficiency closely resembles that of interleukin 12 receptor β1 (IL-12Rβ1) deficiency. In conclusion, IL-12p40 deficiency is more common than initially thought and should be considered worldwide in patients

  2. An engineered antibody-interleukin-12 fusion protein with enhanced tumor vascular targeting properties.

    PubMed

    Gafner, Verena; Trachsel, Eveline; Neri, Dario

    2006-11-01

    The antibody-mediated targeted delivery of interleukin-12 (IL12) to the EDB domain of fibronectin, a marker of angiogenesis, is a promising avenue for enhancing the therapeutic index of this anti-cancer cytokine. Previous experiments, based on sequential fusion of a single-chain IL12 derivative to the anti-EDB antibody fragment scFv(L19) had yielded a therapeutic fusion protein [IL12-scFv(L19)-FLAG], which displayed an impressive therapeutic activity in murine models of cancer, in spite of a tumor uptake, which was less efficient compared to the parental unmodified scFv(L19). In this article, we describe the comparative analysis of 3 recombinant fusion proteins comprising the scFv(L19) and IL12 moieties. One of them, in which the p40 and p35 form a covalent heterodimer and in which each subunit is fused to a molecule of scFv(L19), displays an excellent tumor targeting performance in vivo, as assessed by quantitative biodistribution analysis, and a potent anti-tumor effect, superior to the one of IL12-scFv(L19)-FLAG. These results may have a clinical impact, considering the fact that the tumor targeting ability of scFv(L19) in patients with cancer has been demonstrated using scintigraphic methods, and that 2 scFv(L19)-based antibody-cytokine fusion are currently entering clinical trials.

  3. Electrogene therapy with interleukin-12 in canine mast cell tumors

    PubMed Central

    Pavlin, Darja; Cemazar, Maja; Cör, Andrej; Sersa, Gregor; Pogacnik, Azra; Tozon, Natasa

    2011-01-01

    Background Mast cell tumors (MCT) are the most common malignant cutaneous tumors in dogs with extremely variable biological behaviour. Different treatment approaches can be used in canine cutaneous MCT, with surgical excision being the treatment of choice. In this study, electrogene therapy (EGT) as a new therapeutic approach to canine MCTs, was established. Materials and methods. Eight dogs with a total of eleven cutaneous MCTs were treated with intratumoral EGT using DNA plasmid encoding human interleukin-12 (IL-12). The local response to the therapy was evaluated by repeated measurements of tumor size and histological examination of treated tumors. A possible systemic response was assessed by determination of IL-12 and interferon- γ (IFN-γ) in patients’ sera. The occurence of side effects was monitored with weekly clinical examinations of treated animals and by performing basic bloodwork, consisting of the complete bloodcount and determination of selected biochemistry parameters. Results Intratumoral EGT with IL-12 elicits significant reduction of treated tumors’ size, ranging from 13% to 83% (median 50%) of the initial tumor volume. Additionally, a change in the histological structure of treated nodules was seen. There was a reduction in number of malignant mast cells and inflammatory cell infiltration of treated tumors. Systemic release of IL-12 in four patients was detected, without any noticeable local or systemic side effects. Conclusions These data suggest that intratumoral EGT with plasmid encoding IL-12 may be useful in the treatment of canine MCTs, exerting a local antitumor effect. PMID:22933932

  4. Selective suppression of interleukin-12 induction after macrophage receptor ligation.

    PubMed

    Sutterwala, F S; Noel, G J; Clynes, R; Mosser, D M

    1997-06-02

    Interleukin (IL)-12 is a monocyte- and macrophage-derived cytokine that plays a crucial role in both the innate and the acquired immune response. In this study, we examined the effects that ligating specific macrophage receptors had on the induction of IL-12 by lipopolysaccharide (LPS). We report that ligation of the macrophage Fcgamma, complement, or scavenger receptors inhibited the induction of IL-12 by LPS. Both mRNA synthesis and protein secretion were diminished to near-undetectable levels following receptor ligation. Suppression was specific to IL-12 since IL-10 and tumor necrosis factor-alpha (TNF-alpha) production were not inhibited by ligating macrophage receptors. The results of several different experimental approaches suggest that IL-12 downregulation was due to extracellular calcium influxes that resulted from receptor ligation. First, preventing extracellular calcium influxes, by performing the assays in EGTA, abrogated FcgammaR-mediated IL-12(p40) mRNA suppression. Second, exposure of macrophages to the calcium ionophores, ionomycin or A23187, mimicked receptor ligation and inhibited IL-12(p40) mRNA induction by LPS. Finally, bone marrow-derived macrophages from FcR gamma chain-deficient mice, which fail to flux calcium after receptor ligation, failed to inhibit IL-12(p40) mRNA induction. These results indicate that the calcium influxes that occur as a result of receptor ligation are responsible for inhibiting the induction of IL-12 by LPS. Hence, the ligation of phagocytic receptors on macrophages can lead to a dramatic decrease in IL-12 induction. This downregulation may be a way of limiting proinflammatory responses of macrophages to extracellular pathogens, or suppressing the development of cell-mediated immunity to intracellular pathogens.

  5. Nrf2-dependent repression of interleukin-12 expression in human dendritic cells exposed to inorganic arsenic.

    PubMed

    Macoch, Mélinda; Morzadec, Claudie; Génard, Romain; Pallardy, Marc; Kerdine-Römer, Saadia; Fardel, Olivier; Vernhet, Laurent

    2015-11-01

    Inorganic arsenic, a well-known Nrf2 inducer, exerts immunosuppressive properties. In this context, we recently reported that the differentiation of human blood monocytes into immature dendritic cells (DCs), in the presence of low and noncytotoxic concentrations of arsenic, represses the ability of DCs to release key cytokines in response to different stimulating agents. Particularly, arsenic inhibits the expression of human interleukin-12 (IL-12, also named IL-12p70), a major proinflammatory cytokine that controls the differentiation of Th1 lymphocytes. In the present study, we determined if Nrf2 could contribute to these arsenic immunotoxic effects. To this goal, human monocyte-derived DCs were first differentiated in the absence of metalloid and then pretreated with arsenic just before DC stimulation with lipopolysaccharide (LPS). Under these experimental conditions, arsenic rapidly and stably activates Nrf2 and increases the expression of Nrf2 target genes. It also significantly inhibits IL-12 expression in activated DCs, at both mRNA and protein levels. Particularly, arsenic reduces mRNA levels of IL12A and IL12B genes which encodes the p35 and p40 subunits of IL-12p70, respectively. tert-Butylhydroquinone (tBHQ), a reference Nrf2 inducer, mimics arsenic effects and potently inhibits IL-12 expression. Genetic inhibition of Nrf2 expression markedly prevents the repression of both IL12 mRNA and IL-12 protein levels triggered by arsenic and tBHQ in human LPS-stimulated DCs. In addition, arsenic significantly reduces IL-12 mRNA levels in LPS-activated bone marrow-derived DCs from Nrf2+/+ mice but not in DCs from Nrf2-/- mice. Finally, we show that, besides IL-12, arsenic significantly reduces the expression of IL-23, another heterodimer containing the p40 subunit. In conclusion, our study demonstrated that arsenic represses IL-12 expression in human-activated DCs by specifically stimulating Nrf2 activity. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Inhibiting cytokines of the interleukin-12 family: recent advances and novel challenges.

    PubMed

    Vandenbroeck, Koen; Alloza, Iraide; Gadina, Massimo; Matthys, Patrick

    2004-02-01

    Interleukin-12 (IL-12) and the more recently discovered IL-23 and IL-27 constitute a unique family of structurally related, heterodimeric cytokines that regulate cell-mediated immune responses and T helper 1 (Th1)-type inflammatory reactions. Not surprisingly, the potentiality of treating conditions such as multiple sclerosis (MS) and rheumatoid arthritis (RA) through pharmacological interference with IL-12 pathways has received widespread attention. In this review we have examined over 50 substances with reported IL-12 inhibitory effects. We demonstrate that a majority of these belong to a limited number of major functional classes, each of which targets discrete events in the IL-12 biological pathway. Thus, most IL-12 inhibitory substances appear to work either through inhibition of transcription factor NF-kappa B activation, up-regulation of intracellular cAMP, blockage of posttranslational processing or interference with signal transduction pathways. In addition, cyclophilin-binding drugs, and generic inhibitors of nuclear histone deacetylases, and of ion channels, pumps and antiporters are emerging as potential leads to novel targets for interference with IL-12 production. Many inhibitors of NF-kappa B and of IL-12 signal transduction have been proven effective in limiting or preventing disease in experimental autoimmune encephalomyelitis (EAE) models of MS. The sharing of the p40 subunit, the IL-12R beta 1 and components of the signal transduction pathways between IL-12 and IL-23 raises the question as to whether the beneficial effects of various drugs previously ascribed to inhibition of IL-12 may, in fact, have been due to concurrent blockage of both cytokines, or of IL-23, rather than IL-12. Moreover, the homodimeric beta(2)-form of IL-12, though originally considered to display only antagonistic effects, is now emerging as a pronounced agonist in a variety of inflammatory processes. Reassessment of IL-12 inhibitory compounds is therefore needed to

  7. Inhibition of interleukin-12 production in lipopolysaccharide-activated mouse macrophages by parthenolide, a predominant sesquiterpene lactone in Tanacetum parthenium: involvement of nuclear factor-kappaB.

    PubMed

    Kang, B Y; Chung, S W; Kim, T S

    2001-07-02

    Pharmacological control of interleukin-12 (IL-12) production may be a key therapeutic strategy for modulating immunological diseases dominated by type-1 cytokine responses. In this study, we investigated the effects of parthenolide, an anti-inflammatory sesquiterpene, on the production of IL-12 from mouse macrophages stimulated with lipopolysaccharide (LPS). Parthenolide potently inhibited the LPS-induced IL-12 production in a dose-dependent manner. The effect of parthenolide on IL-12 p40 promoter activation was analyzed by transfecting RAW264.7 monocytic cells with p40 promoter/luciferase constructs. The repressive effect mapped to a region in the p40 promoter containing a binding site for nuclear factor-kappaB (p40-kappaB). Furthermore, activation of macrophages by LPS resulted in markedly enhanced binding activity to the kappaB site, which significantly decreased upon addition of parthenolide. These results suggest that parthenolide-induced inhibition of IL-12 production in macrophages may explain some of the biological effects of parthenolide including its anti-inflammatory activity.

  8. Interleukin-12 synthesis is a required step in trehalose dimycolate-induced activation of mouse peritoneal macrophages.

    PubMed Central

    Oswald, I P; Dozois, C M; Petit, J F; Lemaire, G

    1997-01-01

    Trehalose dimycolate (TDM), a glycolipid present in the cell wall of Mycobacterium spp., is a powerful immunostimulant. TDM primes murine macrophages (Mphi) to produce nitric oxide (NO) and to develop antitumoral activity upon activation with low doses of lipopolysaccharide (LPS). In this study, we investigated the ability of TDM to induce interleukin 12 (IL-12) and the role of this cytokine in TDM-induced activation of murine Mphi. RNA isolated from peritoneal exudate cells (PEC) collected at different times after TDM injection was used to determine IL-12 (p35 and p40 subunits) and gamma interferon (IFN-gamma) mRNA levels by semiquantitative reverse transcriptase-PCR. Constitutive expression of IL-12p35 was observed in PEC from untreated as well as from TDM-injected mice. In contrast, expression of the IL-12p40 subunit was almost undetectable in control PEC but was dramatically upregulated in PEC from TDM-injected mice. IL-12p40 expression peaked at 8 h and subsided to baseline levels at 39 h postinjection. TDM was also able to induce IFN-gamma expression; however, kinetics of induction of IFN-gamma was different from that of IL-12p40. Maximal levels of IFN-gamma mRNA were reached by 24 h and did not return to baseline by 4 days. In addition, pretreatment of mice with neutralizing monoclonal antibodies directed against IL-12 (C15.6.7 and C15.1.2) blocked IFN-gamma mRNA induction in PEC from TDM-treated mice. We further determined if the induction of IL-12 and/or IFN-gamma contributes to the in vivo priming effect of TDM on peritoneal Mphi. TDM-injected mice were treated in vivo with anti-IL-12 or anti-IFN-gamma (XMG.1.6) monoclonal antibodies. TDM-primed Mphi were then activated in vitro with LPS and tested for their ability to produce NO and to develop cytostatic activity toward cocultivated L1210 tumor cells. Priming of Mphi by TDM was completely blocked by in vivo neutralization of either IL-12 or IFN-gamma as demonstrated by an absence of tumoricidal activity

  9. Mice overexpressing p40 in lungs have reduced leucocyte influx and slightly impaired resistance during tuberculosis

    PubMed Central

    Leemans, Jaklien C; Wieland, Catharina W; Florquin, Sandrine; van der Poll, Tom; Vervoordeldonk, Margriet J B M

    2006-01-01

    Interleukin (IL)-12 (p70) is a heterodimeric cytokine composed of p40 and p35, that plays a major role in the protective immune response to Mycobacterium tuberculosis. To define the role of p40 in lungs during pulmonary M. tuberculosis infection we generated transgenic (Tg) mice overexpressing p40 under control of the surfactant protein C promoter. Tg mice expressed the transgene in their lungs, yet demonstrated elevated pulmonary p40 protein levels. After infection, Tg mice displayed higher pulmonary p40 and p70 levels than wild type mice. Interferon-γ concentrations were similar in uninfected and infected Tg and wild type mice, arguing against agonistic effects of p40. Tg mice demonstrated reduced recruitment of macrophages, lymphocytes and neutrophils to the lungs early after infection. This was accompanied by reduced pulmonary tumour necrosis factor-α, macrophage inflammatory protein (MIP)-2 and MIP-1 α levels. This suggests that elevated p40 concentrations inhibited the chemotactic effects of p70 on leucocytes. Furthermore, Tg mice displayed slightly higher pulmonary mycobacterial outgrowth late in the infection than wild type mice. Taken together, we demonstrate that constitutive overexpression of p40 in lungs negatively influences IL-12-mediated leucocyte migration and protection against lung tuberculosis. This suggests a novel antagonistic role for p40 homodimers in regulating the chemotactic bioactivity of IL-12 after pulmonary mycobacterial infection. PMID:16476061

  10. A case of interleukin-12 receptor beta-1 deficiency with recurrent leishmaniasis.

    PubMed

    Sanal, Ozden; Turkkani, Gulten; Gumruk, Fatma; Yel, Leman; Secmeer, Gulten; Tezcan, Ilhan; Kara, Ates; Ersoy, Fugen

    2007-04-01

    Interleukin-12 receptor beta-1 (IL-12Rbeta1) defect is generally associated with selective susceptibility to weakly pathogenic mycobacteria and Salmonella species. Patients rarely experience infections caused by other organisms. We report a 5-year-old patient with IL-12Rbeta1 deficiency who developed recurrent visceral leishmaniasis 6 months apart. The patient responded to lyposomal amphotericin B treatment reasonably well.

  11. Vaccines with interleukin-12-transduced acute myeloid leukemia cells elicit very potent therapeutic and long-lasting protective immunity.

    PubMed

    Dunussi-Joannopoulos, K; Runyon, K; Erickson, J; Schaub, R G; Hawley, R G; Leonard, J P

    1999-12-15

    Interleukin-12 (IL-12) is a heterodimeric cytokine mediating a dynamic interplay between T cells and antigen-presenting cells (APCs). Preclinical studies have demonstrated that recombinant murine IL-12 (rmIL-12) promotes specific antitumor immunity mediated by T cells in several types of tumors. However, the in vivo antitumor properties of IL-12 in acute myeloid leukemia (AML) have not been previously reported. We show here in a murine AML model that systemic administration of rmIL-12 significantly delays tumor growth but is incapable of rescuing mice from lethal leukemia. In contrast, AML cells genetically modified to express IL-12 (IL12-AML) using murine stem cell virus (MSCV) p40 + p35 elicit very potent antileukemic activity. Vaccines with lethally irradiated IL12-AML cells protect naive mice against challenge with wild-type AML cells and, more importantly, can cure mice bearing a considerable leukemic burden. Immunized mice show no signs of systemic IL-12 toxicity and their spleen histology is comparable with naive mice spleen. In vivo depletion of IL-12, interferon-gamma (IFN-gamma), or CD8(+) T cells after injections with live IL12-AML cells abrogates completely the antileukemia immune responses. Studies on the in vitro effects of IFN-gamma on AML cells demonstrate enhanced expression of major histocompatibility complex (MHC) and accessory molecules and induction of the costimulatory molecules B7.1 and B7.2, but no significant direct antiproliferative effect. (51)Cr release assays show that rejection of live IL12-AML cells supports the development of long-lasting leukemia-specific cytotoxic T lymphocyte (CTL) activity. In conclusion, our results demonstrate that IL12-AML vaccination is a safe and potent immunotherapeutic approach that has a great potential to eliminate minimal residual disease in patients with AML.

  12. Interleukins-12 and -23 do not alter expression or activity of multiple cytochrome P450 enzymes in cryopreserved human hepatocytes.

    PubMed

    Dallas, Shannon; Chattopadhyay, Souvik; Sensenhauser, Carlo; Batheja, Ameesha; Singer, Monica; Silva, Jose

    2013-04-01

    Psoriasis is a T-cell-mediated autoimmune disease involving the skin. Two cytokines, interleukin-12 (IL-12) and IL-23 have been shown to play a pivotal role in the pathogenesis of the disease. Ustekinumab (Stelara) is a therapeutic monoclonal antibody (mAb) targeted against the p40 shared subunit of IL-12 and IL-23. Recently the ability of therapeutic proteins (TP) including mAbs that target either cytokines directly (e.g., Pegasys; peginterferon α-2a) or their respective cell surface receptors [e.g., tocilizumab (Actemra); anti IL-6R] to desuppress cytochrome P450 (P450) enzymes in vitro and in the clinic, has been demonstrated. In the present study the ability of IL-12 and IL-23 to suppress multiple P450 enzymes was investigated in vitro using six separate lots of cultured human hepatocytes. Following exposure of 10 ng/ml IL-12 and IL-23 for 48 hours, either alone or in combination, no change in CYP2B6, 2C9, 2C19, or 3A4 gene expression or functional activity was observed. None of the untreated hepatocyte donors showed appreciable expression of the IL-12 or IL-23 receptors. Similar results were seen with whole human liver samples. Exposure of hepatocytes to IL-12 and/or IL-23, known P450 suppressors (IL-6 and tumor necrosis factor-α) or known P450 inducers (β-naphthoflavone, phenobarbital, and rifampicin) did not appreciably alter the expression of the IL-12 and IL-23 receptors either. Finally, in contrast to the positive control IL-6, expression of the acute phase C-reactive protein was unaltered following IL-12 and/or IL-23 treatment. Together, these data suggest a negligible propensity for IL-12 or IL-23 to directly alter P450 enzymes in human hepatocytes.

  13. Successful therapy of chronic, nonhealing murine cutaneous leishmaniasis with sodium stibogluconate and gamma interferon depends on continued interleukin-12 production.

    PubMed Central

    Li, J; Sutterwala, S; Farrell, J P

    1997-01-01

    Treatment of nonhealing forms of human leishmaniasis with antimonial drugs in combination with gamma interferon (IFN-gamma) may promote healing more effectively than conventional drug therapy. Although the natures of immune responses in patients prior to treatment are often unclear, it is generally assumed that such therapy also promotes a switch from a Th2-type response to a dominant Th1-type response. We have examined the efficacy of IFN-gamma therapy, in combination with drug therapy, to promote healing and a Th2-to-Th1 switch in highly susceptible BALB/c mice infected with Leishmania major. Short-term treatment with the antileishmanial drug sodium stibogluconate failed to significantly alter the course of disease or the immune response when it was given during the third and fourth weeks of infection. IFN-gamma therapy, administered over the same time period, also failed to induce cure or a Th1 dominant response. In contrast, mice treated with a combination of drug and IFN-gamma therapy resolved their infections and developed Th1-type responses. However, administration of an antibody to interleukin 12 (IL-12) reversed the therapeutic effects of therapy with drug plus IFN-gamma, suggesting that IFN-gamma promotes cure through an IL-12-dependent mechanism. Analysis of mRNA levels within parasitized lesions suggests that drug treatment plus IFN-gamma treatment, in addition to reducing parasite numbers, results in reduced levels of IL-4, IL-10, and transforming growth factor beta transcripts but increased levels of transcripts of the p40 chain of IL-12 and inducible nitric oxide synthase, which catalyzes the production of nitric oxide. Together, these results suggest that such immunotherapy may promote the development of a protective Th1-type response in susceptible mice by a mechanism which involves both suppression of regulatory cytokines and enhancement of IL-12 and nitric oxide production. PMID:9234779

  14. Recombinant Guinea Pig Tumor Necrosis Factor Alpha Stimulates the Expression of Interleukin-12 and the Inhibition of Mycobacterium tuberculosis Growth in Macrophages

    PubMed Central

    Cho, Hyosun; Lasco, Todd M.; Allen, Shannon Sedberry; Yoshimura, Teizo; McMurray, David N.

    2005-01-01

    Tumor necrosis factor alpha (TNF-α) plays an important role in the host immune response to infection with the intracellular pathogen Mycobacterium tuberculosis. It is essential for the formation of protective tuberculous granulomas and regulates the expression of other cytokines which contribute to a protective immune response. Interleukin-12 (IL-12) is known to promote a Th1 response, which is essential for antimycobacterial resistance. Recombinant guinea pig TNF-α (rgpTNF-α) protein (17 kDa) was purified, and its bioactivity was confirmed by its cytotoxicity for L929 fibroblasts. High titers of polyclonal anti-gpTNF-α antibody were obtained by immunization of rabbits. Resident alveolar and peritoneal macrophages were isolated from guinea pigs and infected with either the H37Ra or H37Rv strain of M. tuberculosis. The mRNA levels for TNF-α and IL-12 p40 were measured using real-time PCR. IL-12 p40 mRNA was up-regulated in a dose-dependent manner by rgpTNF-α alone. In infected macrophages, a lower dose of rgpTNF-α intensified the mRNA levels of TNF-α and IL-12 p40. However, higher doses of rgpTNF-α suppressed TNF-α and IL-12 p40 mRNA. The antimycobacterial activity of macrophages was assessed by metabolic labeling of M. tuberculosis with [3H]uracil. Resident alveolar and peritoneal macrophages treated with anti-gpTNF-α antibody to block endogenous TNF-α exhibited increased intracellular mycobacterial growth. These data suggest that the dose of TNF-α is crucial to the stimulation of optimal expression of protective cytokines and that TNF-α contributes to the control of mycobacterial replication to promote host resistance against M. tuberculosis. PMID:15731034

  15. Immunological mechanisms of intravesical chitosan/interleukin-12 immunotherapy against murine bladder cancer.

    PubMed

    Smith, Sean G; Baltz, John L; Koppolu, Bhanu Prasanth; Ravindranathan, Sruthi; Nguyen, Khue; Zaharoff, David A

    2017-01-01

    There is a critical unmet clinical need for bladder cancer immunotherapies capable of inducing durable antitumor immunity. We have shown that four intravesical treatments with a simple co-formulation of interleukin-12 and the biopolymer chitosan not only destroy orthotopic bladder tumors, but also promote a potent long-lasting systemic immune response as evidenced through tumor-specific in vitro killing assays, complete protection from rechallenge, and abscopal antitumor responses at distant non-treated tumors. This study investigates the immunological kinetics underlying these results. We show through depletion studies that CD8(+) T cells are required for initial tumor rejection, but CD4(+) T cells protect against rechallenge. We also show that even a single intravesical treatment can eliminate tumors in 50% of mice with 6/9 and 7/8 mice eliminating tumors after three or four treatments respectively. We then performed immunophenotyping studies to analyze shifts in immune cell populations after each treatment within the tumor itself as well as in secondary lymphoid organs. These studies demonstrated an initial infiltration of macrophages and granulocytes followed by increased CD4(+) and CD8(+) effector-memory cells. This was coupled with a decreased level of regulatory T cells in peripheral lymph nodes as well as decreased myeloid-derived suppressor cell infiltration in the bladder. Taken together, these data demonstrate the ability of properly delivered interleukin-12-based therapies to engage adaptive immunity within the tumor itself as well as throughout the body and strengthen the case for clinical translation of chitosan/interleukin-12 as an intravesical treatment for bladder cancer.

  16. Immunological mechanisms of intravesical chitosan/interleukin-12 immunotherapy against murine bladder cancer

    PubMed Central

    2017-01-01

    ABSTRACT There is a critical unmet clinical need for bladder cancer immunotherapies capable of inducing durable antitumor immunity. We have shown that four intravesical treatments with a simple co-formulation of interleukin-12 and the biopolymer chitosan not only destroy orthotopic bladder tumors, but also promote a potent long-lasting systemic immune response as evidenced through tumor-specific in vitro killing assays, complete protection from rechallenge, and abscopal antitumor responses at distant non-treated tumors. This study investigates the immunological kinetics underlying these results. We show through depletion studies that CD8+ T cells are required for initial tumor rejection, but CD4+ T cells protect against rechallenge. We also show that even a single intravesical treatment can eliminate tumors in 50% of mice with 6/9 and 7/8 mice eliminating tumors after three or four treatments respectively. We then performed immunophenotyping studies to analyze shifts in immune cell populations after each treatment within the tumor itself as well as in secondary lymphoid organs. These studies demonstrated an initial infiltration of macrophages and granulocytes followed by increased CD4+ and CD8+ effector-memory cells. This was coupled with a decreased level of regulatory T cells in peripheral lymph nodes as well as decreased myeloid-derived suppressor cell infiltration in the bladder. Taken together, these data demonstrate the ability of properly delivered interleukin-12-based therapies to engage adaptive immunity within the tumor itself as well as throughout the body and strengthen the case for clinical translation of chitosan/interleukin-12 as an intravesical treatment for bladder cancer. PMID:28197381

  17. Regulation of IL-12p40 by HIF controls Th1/Th17 responses to prevent mucosal inflammation.

    PubMed

    Marks, E; Naudin, C; Nolan, G; Goggins, B J; Burns, G; Mateer, S W; Latimore, J K; Minahan, K; Plank, M; Foster, P S; Callister, R; Veysey, M; Walker, M M; Talley, N J; Radford-Smith, G; Keely, S

    2017-01-25

    Intestinal inflammatory lesions are inherently hypoxic, due to increased metabolic demands created by cellular infiltration and proliferation, and reduced oxygen supply due to vascular damage. Hypoxia stabilizes the transcription factor hypoxia-inducible factor-1α (HIF) leading to a coordinated induction of endogenously protective pathways. We identified IL12B as a HIF-regulated gene and aimed to define how the HIF-IL-12p40 axis influenced intestinal inflammation. Intestinal lamina propria lymphocytes (LPL) were characterized in wild-type and IL-12p40(-/-) murine colitis treated with vehicle or HIF-stabilizing prolyl-hydroxylase inhibitors (PHDi). IL12B promoter analysis was performed to examine hypoxia-responsive elements. Immunoblot analysis of murine and human LPL supernatants was performed to characterize the HIF/IL-12p40 signaling axis. We observed selective induction of IL-12p40 following PHDi-treatment, concurrent with suppression of Th1 and Th17 responses in murine colitis models. In the absence of IL-12p40, PHDi-treatment was ineffective. Analysis of the IL12B promoter identified canonical HIF-binding sites. HIF stabilization in LPLs resulted in production of IL-12p40 homodimer which was protective against colitis. The selective induction of IL-12p40 by HIF-1α leads to a suppression of mucosal Th1 and Th17 responses. This HIF-IL12p40 axis may represent an endogenously protective mechanism to limit the progression of chronic inflammation, shifting from pro-inflammatory IL-12p70 to an antagonistic IL-12p40 homodimer.Mucosal Immunology advance online publication, 25 January 2017; doi:10.1038/mi.2016.135.

  18. Efficient production and purification of recombinant human interleukin-12 (IL-12) overexpressed in mammalian cells without affinity tag

    PubMed Central

    Jayanthi, Srinivas; Koppolu, Bhanu prasanth; Smith, Sean G.; Jalah, Rashmi; Bear, Jenifer; Rosati, Margherita; Pavlakis, George N.; Felber, Barbara K.; Zaharoff, David A.; Kumar, Thallapuranam Krishnaswamy Suresh

    2014-01-01

    Interleukin-12 is a heterodimeric, pro-inflammatory cytokine that is a key driver of cell-mediated immunity. Clinical interest in IL-12 is significant due to its potent anti-tumor activity and efficacy in controlling certain infectious diseases such as Leishmaniasis and Listeria infection. For clinical applications, the ease of production and purification of IL-12 and the associated cost continues to be a consideration. In this context, we report a simple and effective heparin-affinity based purification of recombinant human IL-12 (hIL-12) from the serum-free supernatants of stable IL-12-transduced HEK293 cells. Fractionation of culture supernatants on heparin Sepharose columns revealed that hIL-12 elutes as a single peak in 500 mM NaCl. Coomassie staining and Western blot analysis showed that hIL-12 eluted in 500 mM NaCl is homogeneous.Purity of hIL-12 was ascertained by RP-HPLC and ESI-MS analysis, and found to be ~98%. Western blot analysis, using monoclonal antibodies, demonstrated that the crucial inter-subunit disulfide bond linking the p35 and p40 subunits is intact in the purified hIL-12. Results of far UV circular dichrosim, steady-state tryptophan fluorescence, and differential scanning calorimetry experiments suggest that purified hIL-12 is in its stable native conformation. Enzyme linked immunosorbent assays (ELISAs) and bioactivity studies demonstrate that hIL-12 is obtained in high yields (0.31 ± 0.05 mg/ mL of the culture medium) and is also fully bioactive. Isothermal titration calorimetry data show that IL-12 exhibits a moderate binding affinity (Kd(app) = 69 ± 1 μM) to heparin. The purification method described in this study is expected to provide greater impetus for research on the role of heparin in the regulation of the function of IL-12. In addition, the results of this study provide an avenue to obtain high amounts of IL-12 required for structural studies which are aimed at the development of novel IL-12-based therapeutics. PMID:25123642

  19. Myxoma virus expressing human interleukin-12 does not induce myxomatosis in European rabbits.

    PubMed

    Stanford, Marianne M; Barrett, John W; Gilbert, Philippe-Alexandre; Bankert, Richard; McFadden, Grant

    2007-11-01

    Myxoma virus (MV) is a candidate for oncolytic virotherapy due to its ability to selectively infect and kill tumor cells, yet MV is a species-specific pathogen that causes disease only in European rabbits. To assess the ability of MV to deliver cytokines to tumors, we created an MV (vMyxIL-12) that expresses human interleukin-12 (IL-12). vMyxIL-12 replicates similarly to wild-type MV, and virus-infected cells secrete bioactive IL-12. Yet, vMyxIL-12 does not cause myxomatosis, despite expressing the complete repertoire of MV proteins. Thus, vMyxIL-12 exhibits promise as an oncolytic candidate and is safe in all known vertebrate hosts, including lagomorphs.

  20. Myxoma Virus Expressing Human Interleukin-12 Does Not Induce Myxomatosis in European Rabbits▿

    PubMed Central

    Stanford, Marianne M.; Barrett, John W.; Gilbert, Philippe-Alexandre; Bankert, Richard; McFadden, Grant

    2007-01-01

    Myxoma virus (MV) is a candidate for oncolytic virotherapy due to its ability to selectively infect and kill tumor cells, yet MV is a species-specific pathogen that causes disease only in European rabbits. To assess the ability of MV to deliver cytokines to tumors, we created an MV (vMyxIL-12) that expresses human interleukin-12 (IL-12). vMyxIL-12 replicates similarly to wild-type MV, and virus-infected cells secrete bioactive IL-12. Yet, vMyxIL-12 does not cause myxomatosis, despite expressing the complete repertoire of MV proteins. Thus, vMyxIL-12 exhibits promise as an oncolytic candidate and is safe in all known vertebrate hosts, including lagomorphs. PMID:17728229

  1. Expression and secretion of the heterodimeric protein interleukin-12 in plant cell suspension culture.

    PubMed

    Kwon, T H; Seo, J E; Kim, J; Lee, J H; Jang, Y S; Yang, M S

    2003-03-30

    It has been suggested that plant cell culture is the most suitable system for producing small-to-medium quantities of specialized, expensive, and high-purity proteins. Here, we report that a heterodimeric protein, human interleukin-12 (hIL-12), was expressed and secreted into culture medium in a biologically active form. A transgenic plant expressing hIL-12 was constructed by sexual crossing of plants that expressed each subunit of the protein. From a piece of transgenic plant, callus was induced and cell suspension culture was established. The biological activity and amount of hIL-12 secreted into culture medium were analyzed using bioassays and ELISA. Analysis of cellular localization demonstrated that the protein was secreted into the culture medium together with its intrinsic signal peptide. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 870-875, 2003.

  2. Genetic variations in interleukin-12 related genes in immune-mediated diseases.

    PubMed

    van Wanrooij, R L J; Zwiers, A; Kraal, G; Bouma, G

    2012-12-01

    The interleukin-12 (IL-12) family comprises a group of heterodimeric cytokines and their respective receptors that play key roles in immune responses. A growing number of autoimmune diseases has been found to be associated with genetic variation in these genes. Based on their respective associations with the IL-12 genes, autoimmune diseases appear to cluster in two groups that either show strong associations with the Th1/Th17 pathway (as indicated by genetic association with IL12B and IL23R) or the Th1/IL-35 pathway as the consequence of their association with polymorphisms in the IL12A gene region. The genetic associations are described in relation to what is known of the functionality of these genes in the various diseases. Comparing association data for gene families in different diseases may lead to better insight in the function of the genes in the onset and course of the disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

  3. Interleukin 12 (IL-12) Family Cytokines: Role in Immune Pathogenesis and Treatment of CNS Autoimmune Disease

    PubMed Central

    Sun, Lin; He, Chang; Nair, Lekha; Yeung, Justine; Egwuagu, Charles E.

    2015-01-01

    Cytokines play crucial roles in coordinating the activities of innate and adaptive immune systems. In response to pathogen recognition, innate immune cells secrete cytokines that inform the adaptive immune system about the nature of the pathogen and instruct naïve T cells to differentiate into the appropriate T cell subtypes required to clear the infection. These include Interleukins, Interferons and other immune-regulatory cytokines that exhibit remarkable functional redundancy and pleiotropic effects. The focus of this review, however, is on the enigmatic Interleukin 12 (IL-12) family of cytokines. This family of cytokines plays crucial roles in shaping immune responses during antigen presentation and influence cell-fate decisions of differentiating naïve T cells. They also play essential roles in regulating functions of a variety of effector cells, making IL-12 family cytokines important therapeutic targets or agents in a number of inflammatory diseases, such as the CNS autoimmune diseases, uveitis and multiple sclerosis. PMID:25796985

  4. The SNARE VAMP7 Regulates Exocytic Trafficking of Interleukin-12 in Dendritic Cells

    PubMed Central

    Chiaruttini, Giulia; Piperno, Giulia M.; Jouve, Mabel; De Nardi, Francesca; Larghi, Paola; Peden, Andrew A.; Baj, Gabriele; Müller, Sabina; Valitutti, Salvatore; Galli, Thierry; Benvenuti, Federica

    2016-01-01

    Summary Interleukin-12 (IL-12), produced by dendritic cells in response to activation, is central to pathogen eradication and tumor rejection. The trafficking pathways controlling spatial distribution and intracellular transport of IL-12 vesicles to the cell surface are still unknown. Here, we show that intracellular IL-12 localizes in late endocytic vesicles marked by the SNARE VAMP7. Dendritic cells (DCs) from VAMP7-deficient mice are partially impaired in the multidirectional release of IL-12. Upon encounter with antigen-specific T cells, IL-12-containing vesicles rapidly redistribute at the immune synapse and release IL-12 in a process entirely dependent on VAMP7 expression. Consistently, acquisition of effector functions is reduced in T cells stimulated by VAMP7-null DCs. These results provide insights into IL-12 intracellular trafficking pathways and show that VAMP7-mediated release of IL-12 at the immune synapse is a mechanism to transmit innate signals to T cells. PMID:26972013

  5. Clinical Features of Candidiasis in Patients With Inherited Interleukin 12 Receptor β1 Deficiency

    PubMed Central

    Ouederni, Monia; Sanal, Ozden; Ikincioğullari, Aydan; Tezcan, Ilhan; Dogu, Figen; Sologuren, Ithaisa; Pedraza-Sánchez, Sigifredo; Keser, Melike; Tanir, Gonul; Nieuwhof, Chris; Colino, Elena; Kumararatne, Dinakantha; Levy, Jacov; Kutukculer, Necil; Aytekin, Caner; Herrera-Ramos, Estefanía; Bhatti, Micah; Karaca, Neslihan; Barbouche, Ridha; Broides, Arnon; Goudouris, Ekaterini; Franco, José Luis; Parvaneh, Nima; Reisli, Ismail; Strickler, Alexis; Shcherbina, Anna; Somer, Ayper; Segal, Anthony; Angel-Moreno, Alfonso; Lezana-Fernandez, José Luis; Bejaoui, Mohamed; Bobadilla-Del Valle, Miriam; Kachboura, Salem; Sentongo, Timothy; Ben-Mustapha, Imen; Bustamante, Jacinta; Picard, Capucine; Puel, Anne; Boisson-Dupuis, Stéphanie; Abel, Laurent; Casanova, Jean-Laurent; Rodríguez-Gallego, Carlos

    2014-01-01

    Background. Interleukin 12Rβ1 (IL-12Rβ1)–deficient patients are prone to clinical disease caused by mycobacteria, Salmonella, and other intramacrophagic pathogens, probably because of impaired interleukin 12–dependent interferon γ production. About 25% of patients also display mucocutaneous candidiasis, probably owing to impaired interleukin 23–dependent interleukin 17 immunity. The clinical features and outcome of candidiasis in these patients have not been described before, to our knowledge. We report here the clinical signs of candidiasis in 35 patients with IL-12Rβ1 deficiency. Results. Most (n = 71) of the 76 episodes of candidiasis were mucocutaneous. Isolated oropharyngeal candidiasis (OPC) was the most common presentation (59 episodes, 34 patients) and was recurrent or persistent in 26 patients. Esophageal candidiasis (n = 7) was associated with proven OPC in 2 episodes, and cutaneous candidiasis (n = 2) with OPC in 1 patient, whereas isolated vulvovaginal candidiasis (VVC; n = 3) was not. Five episodes of proven invasive candidiasis were documented in 4 patients; 1 of these episodes was community acquired in the absence of any other comorbid condition. The first episode of candidiasis occurred earlier in life (median age±standard deviation, 1.5 ± 7.87 years) than infections with environmental mycobacteria (4.29 ± 11.9 years), Mycobacterium tuberculosis (4 ± 3.12 years), or Salmonella species (4.58 ± 4.17 years) or other rare infections (3 ± 11.67 years). Candidiasis was the first documented infection in 19 of the 35 patients, despite the vaccination of 10 of these 19 patients with live bacille Calmette-Guérin. Conclusions. Patients who are deficient in IL-12Rβ1 may have candidiasis, usually mucocutaneous, which is frequently recurrent or persistent. Candidiasis may be the first clinical manifestation in these patients. PMID:24186907

  6. Definition of polymorphisms and haplotypes in the interleukin-12B gene: association with IL-12 production but not with Crohn's disease.

    PubMed

    Zwiers, A; Seegers, D; Heijmans, R; Koch, A; Hampe, J; Nikolaus, S; Peña, A S; Schreiber, S; Bouma, G

    2004-12-01

    Interleukin-12 (IL-12) is a key cytokine for the induction of Th1 immune responses. Recently, functional polymorphisms in IL-12p40 (IL12B) were found to be associated with susceptibility to several autoimmune diseases. Similarly, variation in IL12B might be involved in susceptibility to Crohn's disease (CD), a chronic inflammatory bowel disorder associated with high IL-12 expression. We searched for additional polymorphism in IL12B and genotyped a large cohort of CD patients. Differential in vitro secretors of IL-12 were tested for polymorphism. Polymorphisms were analyzed using the intrafamilial transmission disequilibrium test (TDT) and by case-control analysis. A novel polymorphism was strongly associated with differential expression of IL-12. However, no association with susceptibility to CD was seen for this and other polymorphisms. The high level of conservation is consistent with the key regulatory role of IL-12. The lack of association with IL12B makes it unlikely that this gene is directly involved in the susceptibility to CD.

  7. Combination electro-gene therapy using herpes virus thymidine kinase and interleukin-12 expression plasmids is highly efficient against murine carcinomas in vivo.

    PubMed

    Goto, Tomoaki; Nishi, Toru; Kobayashi, Osamu; Tamura, Takahiko; Dev, Sukhendu B; Takeshima, Hideo; Kochi, Masato; Kuratsu, Jun-ichi; Sakata, Tsuneaki; Ushio, Yukitaka

    2004-11-01

    We report the use of plasmid DNA-mediated combination gene therapy for tumor-bearing mice using in vivo electroporation, also called electro-gene therapy (EGT), that resulted in uncomplicated and complete cures in more than 90% of the mice. Subcutaneously inoculated CT26 tumors in syngeneic BALB/c mice were subjected to repeated EGT treatments consisting of intratumoral co-injection of naked plasmids encoding the cytokine interleukin-12 (IL-12) (p35 and p40 subunits) and the suicide gene herpes simplex virus thymidine kinase (HSV-tk), followed by in vivo electroporation. The early anti-tumor effect was always stronger, and the rate of cure, as seen in the long-term follow-up, was always greater in the groups treated with combination EGT than in those treated with IL-12 or HSV-tk EGT alone. Systemic levels of IL-12 and IFN-gamma increased in both combination and IL-12-alone EGT-treated groups. Moreover, combination EGT for established subcutaneous tumors strongly reduced hematogenous lung metastases and increased survival time when live CT26 tumor cells were injected through the tail vein. Limited experiments on C57/B16 mice with murine melanoma also showed very similar trends. These results suggest that this simple and safe method of plasmid-mediated combination EGT may provide a potentially effective gene therapy for cancer.

  8. Interleukin-12 Induces a Th1-Like Response to Burkholderia mallei and Limited Protection in BALB/c Mice

    DTIC Science & Technology

    2006-01-01

    dependent on the concentration of IL-12. Mahon et al. [21] demonstrated that IL-12 increased the efficacy of a Bordetella pertussis acellular vaccine...Interleukin-12 is pro- duced by macrophages in response to live or killed Bordetella per- tussis and enhances the efficacy of an acellular pertussis

  9. Interleukin-12 Induces a Th1-like Response to Burkholderia mallei and Limited Protection in BALB/c Mice

    DTIC Science & Technology

    2005-09-02

    which was dependent on the concentration of IL-12. Mahon et al. [21] demonstrated that IL-12 increased the efficacy of a Bordetella pertussis...Mills KHG. Interleukin-12 is pro- duced by macrophages in response to live or killed Bordetella per- tussis and enhances the efficacy of an acellular

  10. Cancer Therapeutic Based on T Cell Receptors Designed to Regiospecifically Release Interleukin-12 | NCI Technology Transfer Center | TTC

    Cancer.gov

    The National Cancer Institute's Surgery Branch is seeking statements of capability or interest from parties interested in collaborative research to further develop, evaluate, or commercialize a potential cancer therapeutic based on T cells genetically engineered to express the human interleukin 12 (IL-12) cytokine only in the tumor environment.

  11. Interleukin-12 preserves the cutaneous physical and immunological barrier after radiation exposure.

    PubMed

    Gerber, Scott A; Cummings, Ryan J; Judge, Jennifer L; Barlow, Margaret L; Nanduri, Julee; Johnson, Doug E Milano; Palis, James; Pentland, Alice P; Lord, Edith M; Ryan, Julie L

    2015-01-01

    The United States continues to be a prime target for attack by terrorist organizations in which nuclear detonation and dispersal of radiological material are legitimate threats. Such attacks could have devastating consequences to large populations, in the form of radiation injury to various human organ systems. One of these at risk organs is the cutaneous system, which forms both a physical and immunological barrier to the surrounding environment and is particularly sensitive to ionizing radiation. Therefore, increased efforts to develop medical countermeasures for treatment of the deleterious effects of cutaneous radiation exposure are essential. Interleukin-12 (IL-12) was shown to elicit protective effects against radiation injury on radiosensitive systems such as the bone marrow and gastrointestinal tract. In this article, we examined if IL-12 could protect the cutaneous system from a combined radiation injury in the form of sublethal total body irradiation and beta-radiation burn (β-burn) directly to the skin. Combined radiation injury resulted in a breakdown in skin integrity as measured by transepidermal water loss, size of β-burn lesion and an exacerbated loss of surveillant cutaneous dendritic cells. Interestingly, intradermal administration of IL-12 48 h postirradiation reduced transepidermal water loss and burn size, as well as retention of cutaneous dendritic cells. Our data identify IL-12 as a potential mitigator of radiation-induced skin injury and argue for the further development of this cytokine as a radiation countermeasure.

  12. Interleukin-12 Preserves the Cutaneous Physical and Immunological Barrier after Radiation Exposure

    PubMed Central

    Gerber, Scott A.; Cummings, Ryan J.; Judge, Jennifer L.; Barlow, Margaret L.; Nanduri, Julee; Milano Johnson, Doug E.; Palis, James; Pentland, Alice P.; Lord, Edith M.; Ryan, Julie L.

    2015-01-01

    The United States continues to be a prime target for attack by terrorist organizations in which nuclear detonation and dispersal of radiological material are legitimate threats. Such attacks could have devastating consequences to large populations, in the form of radiation injury to various human organ systems. One of these at risk organs is the cutaneous system, which forms both a physical and immunological barrier to the surrounding environment and is particularly sensitive to ionizing radiation. Therefore, increased efforts to develop medical countermeasures for treatment of the deleterious effects of cutaneous radiation exposure are essential. Interleukin-12 (IL-12) was shown to elicit protective effects against radiation injury on radiosensitive systems such as the bone marrow and gastrointestinal tract. In this article, we examined if IL-12 could protect the cutaneous system from a combined radiation injury in the form of sublethal total body irradiation and beta-radiation burn (β-burn) directly to the skin. Combined radiation injury resulted in a breakdown in skin integrity as measured by transepidermal water loss, size of β-burn lesion and an exacerbated loss of surveillant cutaneous dendritic cells. Interestingly, intradermal administration of IL-12 48 h postirradiation reduced transepidermal water loss and burn size, as well as retention of cutaneous dendritic cells. Our data identify IL-12 as a potential mitigator of radiation-induced skin injury and argue for the further development of this cytokine as a radiation countermeasure. PMID:25564716

  13. Interleukin-12- and interferon-gamma-mediated natural killer cell activation by Agaricus blazei Murill.

    PubMed

    Yuminamochi, Eri; Koike, Taisuke; Takeda, Kazuyoshi; Horiuchi, Isao; Okumura, Ko

    2007-06-01

    Dried fruiting bodies of Agaricus blazei Murill (A. blazei) and its extracts have generally used as complementary and alternative medicines (CAMs). Here, we report that the oral administration of A. blazei augmented cytotoxicity of natural killer (NK) cells in wild-type (WT) C57BL/6, C3H/HeJ, and BALB/c mice. Augmented cytotoxicity was demonstrated by purified NK cells from treated wild-type (WT) and RAG-2-deficient mice, but not from interferon-gamma (IFN-gamma) deficient mice. NK cell activation and IFN-gamma production was also observed in vitro when dendritic cell (DC)-rich splenocytes of WT mice were coincubation with an extract of A. blazei. Both parameters were largely inhibited by neutralizing anti-interleukin-12 (IL-12) monoclonal antibody (mAb) and completely inhibited when anti-IL-12 mAb and anti-IL-18 mAb were used in combination. An aqueous extract of the hemicellulase-digested compound of A. blazei particle; (ABPC) induced IFN-gamma production more effectively, and this was completely inhibited by anti-IL-12 mAb alone. NK cell cytotoxicty was augmented with the same extracts, again in an IL-12 and IFN-gamma-dependent manner. These results clearly demonstrated that A. blazei and ABPC augmented NK cell activation through IL-12-mediated IFN-gamma production.

  14. Emerging ideas: Interleukin-12 nanocoatings prevent open fracture-associated infections.

    PubMed

    Li, Bingyun; McKeague, Anne L

    2011-11-01

    Infection is a major clinical complication of orthopaedic implants and prosthetic devices, and patients with traumatic open fractures have a high risk of infection that may exceed 30%. Surgical trauma, burns, and major injuries such as traumatic open fractures induce immunosuppression, decrease resistance to infection, and decrease production of T helper type 1 (Th1) cytokines. Exogenous interleukin-12 p70 (IL-12p70 or IL-12), a natural cytokine that plays a central role in Th1 response and bridges innate and adaptive immunities, will reduce open fracture-associated infection. We propose using exogenous IL-12 nanocoating to restore or enhance the body's natural defense system to combat pathogens. Rats will have a femur fractured, inoculated with Staphylococcus aureus or injected with phosphate buffered saline, left open for 1 hour, and then fixed with an intramedullary Kirschner wire with or without IL-12 nanocoating. Animals will be euthanized at postoperative Day 21; samples of blood, soft tissue, bone, and draining lymph nodes will be collected. Infection, bone healing, and local and systemic responses will be determined. IL-12 nanocoating is a promising prophylactic means to modulate the host immune response to help prevent open fracture-associated infections and to avoid the problem of antibiotic resistance.

  15. Bleomycin/interleukin-12 electrochemogene therapy for treating naturally occurring spontaneous neoplasms in dogs.

    PubMed

    Reed, S D; Fulmer, A; Buckholz, J; Zhang, B; Cutrera, J; Shiomitsu, K; Li, S

    2010-07-01

    On the basis of superior outcomes from electrochemogene therapy (ECGT) compared with electrochemotherapy in mice, we determined the efficacy of ECGT applied to spontaneous canine neoplasms. Intralesional bleomycin and feline interleukin-12 DNA (fIL-12 DNA) injection combined with translesional electroporation resulted in complete cure of two recurrent World Health Organization stage T(2b)N(0)M(0) oral squamous cell carcinomas (SCCs) and one T(2)N(0)M(0) acanthomatous ameloblastoma. Three remaining dogs, which had no other treatment options, had partial responses to ECGT; one had mandibular T(3b)N(2b)M(1) melanoma with pulmonary and lymph node metastases; one had cubital T(3)N(0)M(1) histiocytic sarcoma with spleen metastases; and one had soft palate T(3)N(0)M(0) fibrosarcoma. The melanoma dog had decrease in size of the primary tumor before recrudescence and euthanasia. The histiocytic sarcoma dog had resolution of the primary tumor, but was euthanized because of metastases 4 months after the only treatment. The dog with T(3)N(0)M(0) fibrosarcoma had tumor regression with recrudescence. Treatment was associated with minimal side effects and was easy to perform. It was associated with repair of bone lysis in cured dogs, it improved quality of life of dogs with partial responses and extended overall survival time. ECGT seems to be a safe and resulted in complete responses in SCC and acanthomatous ameloblastoma.

  16. Bleomycin/interleukin-12 electrochemogenetherapy for treating naturally occurring spontaneous neoplasms in dogs.

    PubMed

    Reed, S D; Fulmer, A; Buckholz, J; Zhang, B; Cutrera, J; Shiomitsu, K; Li, S

    2010-08-01

    On the basis of superior outcomes from electrochemogenetherapy (ECGT) compared with electrochemotherapy in mice, we determined the efficacy of ECGT applied to spontaneous canine neoplasms. Intralesional bleomycin (BLM) and feline interleukin-12 DNA injection combined with translesional electroporation resulted in complete cure of two recurrent World Health Organization stage T(2b)N(0)M(0) oral squamous cell carcinomas (SCCs) and one T(2)N(0)M(0) acanthomatous ameloblastoma. Three remaining dogs, which had no other treatment options, had partial responses to ECGT; one had mandibular T(3b)N(2b)M(1) melanoma with pulmonary and lymph node metastases; one had cubital T(3)N(0)M(1) histiocytic sarcoma with spleen metastases; and one had soft palate T(3)N(0)M(0) fibrosarcoma. The melanoma dog had decrease in the size of the primary tumor before recrudescence and euthanasia. The histiocytic sarcoma dog had resolution of the primary tumor, but was euthanized because of metastases 4 months after the only treatment. The dog with T(3)N(0)M(0) fibrosarcoma had tumor regression with recrudescence. Treatment was associated with minimal side effects and was easy to perform, was associated with repair of bone lysis in cured dogs, improved quality of life for dogs with partial responses and extended overall survival time. ECGT seems to be a safe and resulted in complete responses in SCC and acanthomatous ameloblastoma.

  17. Systemic interleukin 12 displays anti-tumour activity in the mouse central nervous system.

    PubMed Central

    Kishima, H.; Shimizu, K.; Miyao, Y.; Mabuchi, E.; Tamura, K.; Tamura, M.; Sasaki, M.; Hakakawa, T.

    1998-01-01

    In various systemic cancers, interleukin 12 (IL-12) induces anti-tumour immunity mediated by T lymphocytes and natural killer cells. To determine whether IL-12 has anti-tumour activity against malignant gliomas in the central nervous system (CNS), which is considered to be an immunologically privileged site, we treated mice with meningeal gliomatosis by intraperitoneal (i.p.) or intrathecal (i.t.) administration of recombinant murine IL-12. Although untreated mice revealed symptoms, such as body weight loss or paraplegia as a result of the meningeal gliomatosis within 8 days after tumour inoculation, 80% of the mice treated with IL-12 at 0.5 microg i.p. were cured. Many lymphocytes, mostly CD4+ and CD8+ cells, infiltrated to the tumours of IL-12-treated mice. The numbers of these cells increased in the cervical lymph nodes, into which the cerebrospinal fluid drains, and there they secreted a considerable amount of interferon-gamma. Mice cured by IL-12 rejected subcutaneous or i.t. rechallenge with their original glioma cells, but the same mice were not able to reject other syngeneic tumour cells. These results indicate that the immune system recognizes malignant glioma cells in the subarachnoid space of the CNS and that systemic IL-12 may produce effective anti-tumour activity and long-lasting tumour-specific immunity. Images Figure 1 Figure 4 PMID:9716025

  18. Optimization of canine interleukin-12 production using a baculovirus insect cell expression system.

    PubMed

    de Pinheiro, Cristiane Garboggini Melo; Pedrosa, Mayara de Oliveira; Teixeira, Naiara Carvalho; Ano Bom, Ana Paula Dinis; van Oers, Monique M; Oliveira, Geraldo Gileno de Sá

    2016-01-22

    Interleukin-12 is an important cytokine in mediating cellular immune responses. Recombinant single-chain canine IL-12 was produced in a baculovirus-insect cell system with the aim of conducting further studies on modulation of immune responses in dogs. To optimize the production of recombinant canine IL-12, a classical baculovirus and a modified vector (chitinase A and v-cathepsin knockout) were used containing a native or an optimized insert of canine IL-12. The optimized IL-12 construct contained the GP64 signal peptide and was synthesized with optimized codons for expression in Trichoplusia ni cells. Dot-blot and Western blot analysis showed the highest production levels of recombinant IL-12 protein by the use of the modified baculovirus vector containing the optimized insert, at a multiplicity of infection of five and at 48 h after infection. The recombinant cytokine was successfully purified and showed a good degree of purity, integrity, folding, and yield, with very little endotoxin contamination. Recombinant canine IL-12 induced IFN-γ in canine lymphocytes, indicating that it was biologically active. Therefore, this study describes an efficient method to produce adequate amounts of biologically active canine IL-12, useful for immunomodulation studies in dogs.

  19. Toxoplasma gondii Upregulates Interleukin-12 To Prevent Plasmodium berghei-Induced Experimental Cerebral Malaria

    PubMed Central

    Settles, Erik W.; Moser, Lindsey A.; Harris, Tajie H.

    2014-01-01

    A chronic infection with the parasite Toxoplasma gondii has previously been shown to protect mice against subsequent viral, bacterial, or protozoal infections. Here we have shown that a chronic T. gondii infection can prevent Plasmodium berghei ANKA-induced experimental cerebral malaria (ECM) in C57BL/6 mice. Treatment with soluble T. gondii antigens (STAg) reduced parasite sequestration and T cell infiltration in the brains of P. berghei-infected mice. Administration of STAg also preserved blood-brain barrier function, reduced ECM symptoms, and significantly decreased mortality. STAg treatment 24 h post-P. berghei infection led to a rapid increase in serum levels of interleukin 12 (IL-12) and gamma interferon (IFN-γ). By 5 days after P. berghei infection, STAg-treated mice had reduced IFN-γ levels compared to those of mock-treated mice, suggesting that reductions in IFN-γ at the time of ECM onset protected against lethality. Using IL-10- and IL-12βR-deficient mice, we found that STAg-induced protection from ECM is IL-10 independent but IL-12 dependent. Treatment of P. berghei-infected mice with recombinant IL-12 significantly decreased parasitemia and mortality. These data suggest that IL-12, either induced by STAg or injected as a recombinant protein, mediates protection from ECM-associated pathology potentially through early induction of IFN-γ and reduction in parasitemia. These results highlight the importance of early IL-12 induction in protection against ECM. PMID:24396042

  20. Interleukin 12 (IL-12) family cytokines: Role in immune pathogenesis and treatment of CNS autoimmune disease.

    PubMed

    Sun, Lin; He, Chang; Nair, Lekha; Yeung, Justine; Egwuagu, Charles E

    2015-10-01

    Cytokines play crucial roles in coordinating the activities of innate and adaptive immune systems. In response to pathogen recognition, innate immune cells secrete cytokines that inform the adaptive immune system about the nature of the pathogen and instruct naïve T cells to differentiate into the appropriate T cell subtypes required to clear the infection. These include Interleukins, Interferons and other immune-regulatory cytokines that exhibit remarkable functional redundancy and pleiotropic effects. The focus of this review, however, is on the enigmatic Interleukin 12 (IL-12) family of cytokines. This family of cytokines plays crucial roles in shaping immune responses during antigen presentation and influence cell-fate decisions of differentiating naïve T cells. They also play essential roles in regulating functions of a variety of effector cells, making IL-12 family cytokines important therapeutic targets or agents in a number of inflammatory diseases, such as the CNS autoimmune diseases, uveitis and multiple sclerosis. Published by Elsevier Ltd.

  1. Interleukin-12 reverses the inhibitory impact of photodynamic therapy (PDT) on the murine contact hypersensitivity response

    NASA Astrophysics Data System (ADS)

    Simkin, Guillermo O.; Levy, Julia G.; Hunt, David W. C.

    1998-05-01

    Treatment of mice with certain photosensitizers combined with exposure to visible light limits the development of the immunologically-mediated contact hypersensitivity (CHS) response against topically-applied chemical haptens. Understanding of the inhibitory action of photosensitizers upon the CHS response is incomplete. Benzoporphyrin derivative monoacid ring A (BPD-MA, verteporfin), a photosensitizer with immunomodulatory activity, strongly depressed CHS responses to the hapten dinitrofluorobenzene (DNFB). However, if mice were administered 1 (mu) g of a recombinant preparation of the pro- inflammatory cytokine interleukin-12 (rIL-12), full-fledged CHS responses to DNFB ensued in animals treated with BPD-MA and light. In contrast, when rIL-12 was given in combination with an anti-IL-12 antibody the restorative effect of rIL-12 on the CHS response of PDT-treated mice was blocked. Evaluation of the cytokine status of spleen and draining lymph node cells showed for DNFB painted animals, that the release of the immunosuppressive cytokine IL-10 was increased by PDT and rIL-12 counter-acted the increase in IL-10 liberation associated with PDT. These studies indicate that IL-10 formation is upregulated and the availability of IL-12 may be limited in mice treated with PDT. These features may contribute to deficient CHS responses observed with PDT.

  2. Type II Toxoplasma gondii induction of CD40 on infected macrophages enhances interleukin-12 responses.

    PubMed

    Morgado, Pedro; Sudarshana, Dattanand M; Gov, Lanny; Harker, Katherine S; Lam, Tonika; Casali, Paolo; Boyle, Jon P; Lodoen, Melissa B

    2014-10-01

    Toxoplasma gondii is an obligate intracellular parasite that can cause severe neurological disease in infected humans. CD40 is a receptor on macrophages that plays a critical role in controlling T. gondii infection. We examined the regulation of CD40 on the surface of T. gondii-infected bone marrow-derived macrophages (BMdMs). T. gondii induced CD40 expression both at the transcript level and on the cell surface, and interestingly, the effect was parasite strain specific: CD40 levels were dramatically increased in type II T. gondii-infected BMdMs compared to type I- or type III-infected cells. Type II induction of CD40 was specific to cells harboring intracellular parasites and detectable as early as 6 h postinfection (hpi) at the transcript level. CD40 protein expression peaked at 18 hpi. Using forward genetics with progeny from a type II × type III cross, we found that CD40 induction mapped to a region of chromosome X that included the gene encoding the dense granule protein 15 (GRA15). Using type I parasites stably expressing the type II allele of GRA15 (GRA15II), we found that type I GRA15II parasites induced the expression of CD40 on infected cells in an NF-κB-dependent manner. In addition, stable expression of hemagglutinin-tagged GRA15II in THP-1 cells resulted in CD40 upregulation in the absence of infection. Since CD40 signaling contributes to interleukin-12 (IL-12) production, we examined IL-12 from infected macrophages and found that CD40L engagement of CD40 amplified the IL-12 response in type II-infected cells. These data indicate that GRA15II induction of CD40 promotes parasite immunity through the production of IL-12. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  3. Mechanisms by Which Interleukin-12 Corrects Defective NK Cell Anticryptococcal Activity in HIV-Infected Patients

    PubMed Central

    Kyei, Stephen K.; Ogbomo, Henry; Li, ShuShun; Timm-McCann, Martina; Xiang, Richard F.; Huston, Shaunna M.; Ganguly, Anutosh; Colarusso, Pina; Gill, M. John

    2016-01-01

    ABSTRACT Cryptococcus neoformans is a pathogenic yeast and a leading cause of life-threatening meningitis in AIDS patients. Natural killer (NK) cells are important immune effector cells that directly recognize and kill C. neoformans via a perforin-dependent cytotoxic mechanism. We previously showed that NK cells from HIV-infected patients have aberrant anticryptococcal killing and that interleukin-12 (IL-12) restores the activity at least partially through restoration of NKp30. However, the mechanisms causing this defect or how IL-12 restores the function was unknown. By examining the sequential steps in NK cell killing of Cryptococcus, we found that NK cells from HIV-infected patients had defective binding of NK cells to C. neoformans. Moreover, those NK cells that bound to C. neoformans failed to polarize perforin-containing granules to the microbial synapse compared to healthy controls, suggesting that binding was insufficient to restore a defect in perforin polarization. We also identified lower expression of intracellular perforin and defective perforin release from NK cells of HIV-infected patients in response to C. neoformans. Importantly, treatment of NK cells from HIV-infected patients with IL-12 reversed the multiple defects in binding, granule polarization, perforin content, and perforin release and restored anticryptococcal activity. Thus, there are multiple defects in the cytolytic machinery of NK cells from HIV-infected patients, which cumulatively result in defective NK cell anticryptococcal activity, and each of these defects can be reversed with IL-12. PMID:27555306

  4. Role of interferon-gamma in interleukin 12-induced pathology in mice.

    PubMed Central

    Car, B. D.; Eng, V. M.; Schnyder, B.; LeHir, M.; Shakhov, A. N.; Woerly, G.; Huang, S.; Aguet, M.; Anderson, T. D.; Ryffel, B.

    1995-01-01

    Interleukin 12 (IL-12) activates natural killer (NK) and T cells with the secondary synthesis and release of interferon-gamma (IFN-gamma) and other cytokines. IL-12-induced organ alterations are reported for mice and the pathogenetic role of IFN-gamma is investigated by the use of mice deficient in the IFN-gamma receptor (IFN-gamma R-/-). IL-12 caused a rapid infiltration of liver and splenic red pulp with activated macrophages; this and increased NK cells resulted in a fivefold increase of splenic weight in wild-type mice. Splenomegaly was associated with myelosuppression and decreasing peripheral leukocyte counts. IL-12-induced changes in wild-type mice were associated with markedly increased IFN-gamma serum levels and up-regulation of major histocompatibility complex (MHC) class I and II expression in various epithelia. IL-12 induced a qualitatively similar macrophage infiltration in IFN-gamma R-/- mice, less marked splenomegaly (to 2 x normal), and no MHC upregulation. Strikingly increased vascular endothelial intercellular adhesion molecule-1 expression was apparent in both IFN-gamma R-/- and IFN-gamma R+/+ mice. Restricted to mutant mice was a severe, invariably lethal, interstitial, and perivascular pulmonary macrophage infiltration with diffuse pulmonary edema. Extensive quantitative reverse transcriptase polymerase chain reaction analysis revealed an increase of only IL-6 and IL-10 pulmonary gene transcripts in IFN-gamma R-/- mice compared with wild-type mice. IL-12-induced myelosuppression is due to IFN-gamma-release from NK cells and T cells, and is associated with macrophage activation and distinct MHC class I and II antigen upregulation. The pulmonary pathology in IFN-gamma R-/- mice, however, reveals a toxic potential for IL-12 and suggests that endogenous IFN-gamma plays a protective role in preventing fatal pulmonary disease in these mice. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 7 Figure 8 Figure 9 PMID:7495294

  5. Logical Analysis of Regulation of Interleukin-12 Expression Pathway Regulation During HCV Infection.

    PubMed

    Farooqi, Zia-Ur-Rehman; Tareen, Samar H K; Ahmed, Jamil; Zaidi, Najam-Us-Sahar S

    2016-01-01

    Hepatitis C virus (HCV) triggers coordinated innate and adaptive response in host cell. HCV genome and proteins of the replicating virus are recognized as non-self-antigens by host cell to activate Toll Like Receptors (TLRs). Activated TLRs ultimately express cytokines, which can clear virus either by activating interferon (IFN), protein kinase C (PKC) and RNA Lase system or through activation of cytotoxic T-lymphocytes. Interleukin-12 (IL-12) is a potent antiviral cytokine, capable of clearing HCV by bridging both innate and adaptive antiviral immune response. Activation of TLR-4 on macrophages surface induces expression of IL-12 via NF-κB and AP-1 transcriptional pathway. After expression, IL- 12 releases IFN-γ, which activates anti-HCV cytotoxic lymphocytes. Conversely, in chronic HCV infection downregulation of IL-12 has been reported instead of by number of studies. Keeping in view of the above mentioned facts, this study was designed to evaluate HCV-core mediated down-regulation of IL-12 transcriptional pathway by employing a logical modeling approach based on the Ren´e Thomas formalism. The logical parameters of entities were estimated by using SMBioNet. The Logical model represents all possible dynamics of protein expression involved during course of HCV pathology. Results demonstrated that at chronic stage of infection, though TLR-4 was constantly active but yet it failed to express the NF-κB, AP-1, IL-12 and IFN-γ. This mechanism was indicative of incorporation of core mediated changes in IL-12 regulatory pathway. Moreover, results also indicate that HCV adopts different trajectories to accomplish the persistence of chronic phase of infection. It also implicated that human immune system tries to clear HCV but core is capable of inducing system oscillations to evade the immunity.

  6. Neoadjuvant immunotherapy with chitosan and interleukin-12 to control breast cancer metastasis

    PubMed Central

    Vo, Jimmy LN; Yang, Lirong; Kurtz, Samantha L; Smith, Sean G; Koppolu, Bhanu prasanth; Ravindranathan, Sruthi; Zaharoff, David A

    2015-01-01

    Metastasis accounts for approximately 90% of breast cancer-related deaths. Therefore, novel approaches which prevent or control breast cancer metastases are of significant clinical interest. Interleukin-12 (IL-12)-based immunotherapies have shown promise in controlling metastatic disease, yet modest responses and severe toxicities due to systemic administration of IL-12 in early trials have hindered clinical application. We hypothesized that localized delivery of IL-12 co-formulated with chitosan (chitosan/IL-12) could elicit tumor-specific immunity and provide systemic protection against metastatic breast cancer while minimizing systemic toxicity. Chitosan is a biocompatible polysaccharide derived primarily from the exoskeletons of crustaceans. In a clinically relevant resection model, mice bearing spontaneously metastatic 4T1 mammary adenocarcinomas received intratumoral injections of chitosan/IL-12, or appropriate controls, prior to tumor resection. Neoadjuvant chitosan/IL-12 immunotherapy resulted in long-term tumor-free survival in 67% of mice compared to only 24% or 0% of mice treated with IL-12 alone or chitosan alone, respectively. Antitumor responses following chitosan/IL-12 treatment were durable and provided complete protection against rechallenge with 4T1, but not RENCA renal adenocarcinoma, cells. Lymphocytes from chitosan/IL-12-treated mice demonstrated robust tumor-specific lytic activity and interferon-γ production. Cell-mediated immune memory was confirmed in vivo via clinically relevant delayed-type hypersensitivity (DTH) assays. Comprehensive hematology and toxicology analyses revealed that chitosan/IL-12 induced transient, reversible leukopenia with no changes in critical organ function. Results of this study suggest that neoadjuvant chitosan/IL-12 immunotherapy prior to breast tumor resection is a promising translatable strategy capable of safely inducing to tumor-specific immunity and, in the long term, reducing breast cancer mortality due to

  7. Gene therapy based on interleukin-12 loaded chitosan nanoparticles in a mouse model of fibrosarcoma

    PubMed Central

    Soofiyani, Saiedeh Razi; Hallaj-Nezhadi, Somayeh; Lotfipour, Farzaneh; Hosseini, Akbar Mohammad; Baradaran, Behzad

    2016-01-01

    Objective(s): Interleukin-12 (IL-12) as a cytokine has been proved to have a critical role in stimulating the immune system and has been used as immunotherapeutic agents in cancer gene therapy. Chitosan as a polymer, with high ability of binding to nucleic acids is a good candidate for gene delivery since it is biodegradable, biocompatible and non-allergenic polysaccharide. The objective of the present study was to investigate the effects of cells transfected with IL-12 loaded chitosan nanoparticles on the regression of fibrosarcoma tumor cells (WEHI-164) in vivo. Materials and Methods: WEHI-164 tumor cells were transfected with IL-12 loaded chitosan nanoparticles and then were injected subcutaneously to inoculate tumor in BALB/c mice. Tumor volumes were determined and subsequently extracted after mice sacrifice. The immunohistochemistry staining was performed for analysis of Ki-67 expression (a tumor proliferation marker) in tumor masses. The expression of IL-12 and IFN-γ were studied using real-time polymerase chain reaction and immunoblotting. Results: The group treated with IL-12 loaded chitosan nanoparticles indicated decreasing of tumor mass[r1] volume (P<0.001). The results of western blotting and real-time PCR showed that the IL-12 expression was increased in the group. Immunohistochemistry staining indicated that the Ki-67expression was reduced in the group treated with IL-12 loaded chitosan nanoparticles. Conclusion: IL-12 gene therapy using chitosan nanoparticles has therapeutic effects on the regression of tumor masses in fibrosarcoma mouse model. PMID:27917281

  8. Anti-inflammatory cytokines in asthma and allergy: interleukin-10, interleukin-12, interferon-gamma.

    PubMed Central

    Chung, F

    2001-01-01

    Interleukin-10 (IL-10) is a cytokine derived from CD4+ T-helper type 2 (T(H2)) cells identified as a suppressor of cytokines from T-helper type 1(T(H1)) cells. Interleukin-12 (IL-12) is produced by B cells, macrophages and dendritic cells, and primarily regulates T(H1) cell differentiation, while suppressing the expansion of T(H2) cell clones. Interferon-gamma (IFN-gamma) is a product of T(H1) cells and exerts inhibitory effects on T(H2) cell differentiation. These cytokines have been implicated in the pathogenesis of asthma and allergies. In this context, IL-12 and IFN-gamma production in asthma have been found to be decreased, and this may reduce their capacity to inhibit IgE synthesis and allergic inflammation. IL-10 is a potent inhibitor of monocyte/macrophage function, suppressing the production of many pro-inflammatory cytokines. A relative underproduction of IL-10 from alveolar macrophages of atopic asthmatics has been reported. Therapeutic modulation of T(H1)/T(H2) imbalance in asthma and allergy by mycobacterial vaccine, specific immunotherapy and cytoline-guanosine dinucleotide motif may lead to increases in IL-12 and IFN-gamma production. Stimulation of IL-10 production by antigen-specific T-cells during immunotherapy may lead to anergy through inhibition of CD28-costimulatory molecule signalling by IL-10s anti-inflammatory effect on basophils, mast cells and eosinophils. PMID:11405550

  9. Radiosensitizing effect of intratumoral interleukin-12 gene electrotransfer in murine sarcoma.

    PubMed

    Sedlar, Ales; Kranjc, Simona; Dolinsek, Tanja; Cemazar, Maja; Coer, Andrej; Sersa, Gregor

    2013-01-29

    Interleukin-12 (IL-12) based radiosensitization is an effective way of tumor treatment. Local cytokine production, without systemic shedding, might provide clinical benefit in radiation treatment of sarcomas. Therefore, the aim was to stimulate intratumoral IL-12 production by gene electrotransfer of plasmid coding for mouse IL-12 (mIL-12) into the tumors, in order to explore its radiosensitizing effect after single or multiple intratumoral gene electrotransfer. Solid SA-1 fibrosarcoma tumors, on the back of A/J mice, were treated intratumorally by mIL-12 gene electrotransfer and 24 h later irradiated with a single dose. Treatment effectiveness was measured by tumor growth delay and local tumor control assay (TCD(50) assay). With respect to therapeutic index, skin reaction in the radiation field was scored. The tumor and serum concentrations of cytokines mIL-12 and mouse interferon γ (mIFNγ) were measured. Besides single, also multiple intratumoral mIL-12 gene electrotransfer before and after tumor irradiation was evaluated. Single intratumoral mIL-12 gene electrotransfer resulted in increased intratumoral but not serum mIL-12 and mIFNγ concentrations, and had good antitumor (7.1% tumor cures) and radiosensitizing effect (21.4% tumor cures). Combined treatment resulted in the radiation dose-modifying factor of 2.16. Multiple mIL-12 gene electrotransfer had an even more pronounced antitumor (50% tumor cures) and radiosensitizing (86.7% tumor cures) effect. Single or multiple intratumoral mIL-12 gene electrotransfer resulted in increased intratumoral mIL-12 and mIFNγ cytokine level, and may provide an efficient treatment modality for soft tissue sarcoma as single or adjuvant therapy to tumor irradiation.

  10. Radiosensitizing effect of intratumoral interleukin-12 gene electrotransfer in murine sarcoma

    PubMed Central

    2013-01-01

    Background Interleukin-12 (IL-12) based radiosensitization is an effective way of tumor treatment. Local cytokine production, without systemic shedding, might provide clinical benefit in radiation treatment of sarcomas. Therefore, the aim was to stimulate intratumoral IL-12 production by gene electrotransfer of plasmid coding for mouse IL-12 (mIL-12) into the tumors, in order to explore its radiosensitizing effect after single or multiple intratumoral gene electrotransfer. Methods Solid SA-1 fibrosarcoma tumors, on the back of A/J mice, were treated intratumorally by mIL-12 gene electrotransfer and 24 h later irradiated with a single dose. Treatment effectiveness was measured by tumor growth delay and local tumor control assay (TCD50 assay). With respect to therapeutic index, skin reaction in the radiation field was scored. The tumor and serum concentrations of cytokines mIL-12 and mouse interferon γ (mIFNγ) were measured. Besides single, also multiple intratumoral mIL-12 gene electrotransfer before and after tumor irradiation was evaluated. Results Single intratumoral mIL-12 gene electrotransfer resulted in increased intratumoral but not serum mIL-12 and mIFNγ concentrations, and had good antitumor (7.1% tumor cures) and radiosensitizing effect (21.4% tumor cures). Combined treatment resulted in the radiation dose-modifying factor of 2.16. Multiple mIL-12 gene electrotransfer had an even more pronounced antitumor (50% tumor cures) and radiosensitizing (86.7% tumor cures) effect. Conclusions Single or multiple intratumoral mIL-12 gene electrotransfer resulted in increased intratumoral mIL-12 and mIFNγ cytokine level, and may provide an efficient treatment modality for soft tissue sarcoma as single or adjuvant therapy to tumor irradiation. PMID:23360213

  11. Interleukin-12 plasmid DNA delivery using l-thyroxine-conjugated polyethylenimine nanocarriers

    NASA Astrophysics Data System (ADS)

    Dehshahri, Ali; Sadeghpour, Hossein; Kazemi Oskuee, Reza; Fadaei, Mahin; Sabahi, Zahra; Alhashemi, Samira Hossaini; Mohazabieh, Erfaneh

    2014-05-01

    In this study, l-thyroxine was covalently grafted on 25 kDa branched polyethylenimine (PEI), and the ability of the nano-sized polyplexes for transferring plasmid encoding interleukin-12 (IL-12) gene was evaluated. As there are several problems in systemic administration of recombinant IL-12 protein, local expression of the plasmid encoding IL-12 gene inside the tumor tissue has been considered as an effective alternative approach. The l-thyroxine-conjugated PEI polyplexes were prepared using pUMVC3-hIL12 plasmid, and their transfection activity was determined in HepG2 human liver carcinoma and Neuro2A neuroblastoma cell lines. The polyplexes characterized in terms of DNA condensation ability, particle size, zeta potential, and buffering capacity as well as cytotoxicity and resistance to enzyme digestion. The results revealed that l-thyroxine conjugation of PEI increased gene transfer ability by up to two fold relative to unmodified 25 kDa PEI, the gold standard for non-viral gene delivery, with the highest increase occurring at degrees of conjugation around 10 %. pDNA condensation tests and dynamic light scattering measurements exhibited the ability of PEI conjugates to optimally condense the plasmid DNA into polyplexes in the size range around 200 nm. The modified polymers showed remarkable buffering capacity and protection against enzymatic degradation comparable to that of unmodified PEI. These results suggest that l-thyroxine conjugation of PEI is a simple modification strategy for future investigations aimed at developing a targeting gene vehicle.

  12. Clostridium sporogenes delivers interleukin-12 to hypoxic tumours, producing antitumour activity without significant toxicity.

    PubMed

    Zhang, Y-L; Lü, R; Chang, Z-S; Zhang, W-Q; Wang, Q-B; Ding, S-Y; Zhao, W

    2014-12-01

    Clostridium sporogenes ATCC 3584 is an obligate anaerobe that has been reported to possess excellent tumour-targeting capacity. Here, we use Cl. sporogenes as a vector to deliver IL-12, a potent antitumour cytokine that bears numerous antitumour properties but that has limited clinical applications due to its strong toxicity when delivered systemically. In this study, Cl. sporogenes was genetically engineered to secrete murine IL-12, and its antitumour efficacy and toxicity were investigated in a murine EMT6 mammary carcinoma model. After intravenous injection, Cl. sporogenes was able to selectively settle and reproduce in the tumours without encroaching on normal tissues, resulting in a clear delay of tumour growth and a 14·3% cure rate. Importantly, the mice showed no obvious toxicity-associated side effects, such as diarrhoea and weight loss, during the treatment process. The significant antitumour efficacy and low toxicity of this treatment may be explained by the selective tumour-targeting properties of Cl. sporogenes and by the sustained release of IL-12 accompanying bacterial proliferation. This moderate local IL-12 concentration would not induce the severe response in the entire body, that is inevitable when IL-12 is administered directly. Interleukin-12 (IL-12) is a potent antitumour cytokine, but it is toxic when administrated systemically. This study demonstrates that murine IL-12 can be systemically delivered to hypoxic sites in solid tumours by Clostridium sporogenes, producing a clear delay in tumour growth and a 14·3% cure rate in a mouse tumour model. Importantly, there is no obvious toxicity associated with IL-12 during the treatment process. This result may be accounted for by the excellent tumour-targeting capacity of Cl. sporogenes, targeting IL-12 directly to the tumour site instead of to the entire body. © 2014 The Society for Applied Microbiology.

  13. Tumor regression induced by intratumoral injection of DNA coding for human interleukin 12 into melanoma metastases in gray horses.

    PubMed

    Heinzerling, L M; Feige, K; Rieder, S; Akens, M K; Dummer, R; Stranzinger, G; Moelling, K

    2001-01-01

    Preclinical studies investigating new therapeutic principles against melanoma are presently being carried out in mouse models; however, these are not optimal. Here we describe a novel animal model using gray horses. These animals spontaneously develop metastatic melanoma that resembles human disease and is thus highly relevant for preclinical studies testing new immunotherapy protocols. We found that injection of plasmid DNA coding for the human cytokine interleukin 12 into established metastases induced significant regression in all 12 treated lesions in a total of 7 horses. Complete disappearance was observed in one treated lesion, with no recurrence after 6 months. No adverse events have been observed in any of the animals during and after treatment. These results demonstrate the effectiveness and safety of interleukin 12 encoding plasmid DNA therapy against established metastatic disease in a large animal model and serve as a basis for a clinical trial.

  14. Types of interfaces for homodimer folding and binding.

    PubMed

    Karthikraja, Velmurugan; Suresh, Abishek; Lulu, Sajitha; Kangueane, Uma; Kangueane, Pandjassarame

    2009-09-30

    Homodimers have a role in catalysis and regulation through the formation of stable interfaces. These interfaces are formed through different folding mechanisms such as 2-state without stable intermediate (2S), 3-state with monomer intermediate (3SMI) and 3-state with dimer intermediate (3SDI). Therefore, it is of interest to understand folding mechanism using structural features at the interfaces. Several studies have documented the significance of structural features for the understanding of homodimer folding mechanisms. However, the known features provide limited information for understanding homodimer folding mechanisms. Hence, we created an extended dataset of 47 homodimers (twenty eight 2S, twelve 3SMI and seven 3SDI) to examine the types of interfaces in protein homodimers. 2S are usually small sized, 3SMI are often medium sized and 3SDI often exist as large sized proteins. The ratio of interface to total (I/T) residue is large in 2S and small in 3SMI and 3SDI. Hence, we used I/T measure to group 2S, 3SMI and 3SDI into categories with large I/T (> 50%), moderate I/T (50 - 25%) and small I/T (< 25%) interfaces. The grouping is further sub-grouped based on the type of physical interaction visualized at the interface using representations in two dimensions (2D). 2D representation of the interface shows eight different forms of interactions in these homodimers. 2S homodimers frequently have large I/T and thus, utilize the entire protein structure in the formation of the interface where the individual subunits are heavily inter communicated with each other. This is not true in the case of 3SMI and 3SDI. 3SMI subunits usually interact with each other at the interface with a gentle touch-like contact and hence, they have low I/T ratio. 3SDI are often quite different in interaction compared to 3SMI and their subunits do deeply interact at the interface with only one part of the surface and hence also having low I/T ratio.

  15. Types of interfaces for homodimer folding and binding

    PubMed Central

    Karthikraja, Velmurugan; Suresh, Abishek; Lulu, Sajitha; Kangueane, Uma; Kangueane, Pandjassarame

    2009-01-01

    Homodimers have a role in catalysis and regulation through the formation of stable interfaces. These interfaces are formed through different folding mechanisms such as 2-state without stable intermediate (2S), 3-state with monomer intermediate (3SMI) and 3-state with dimer intermediate (3SDI). Therefore, it is of interest to understand folding mechanism using structural features at the interfaces. Several studies have documented the significance of structural features for the understanding of homodimer folding mechanisms. However, the known features provide limited information for understanding homodimer folding mechanisms. Hence, we created an extended dataset of 47 homodimers (twenty eight 2S, twelve 3SMI and seven 3SDI) to examine the types of interfaces in protein homodimers. 2S are usually small sized, 3SMI are often medium sized and 3SDI often exist as large sized proteins. The ratio of interface to total (I/T) residue is large in 2S and small in 3SMI and 3SDI. Hence, we used I/T measure to group 2S, 3SMI and 3SDI into categories with large I/T (≫ 50%), moderate I/T (50 - 25%) and small I/T (≪ 25%) interfaces. The grouping is further sub-grouped based on the type of physical interaction visualized at the interface using representations in two dimensions (2D). 2D representation of the interface shows eight different forms of interactions in these homodimers. 2S homodimers frequently have large I/T and thus, utilize the entire protein structure in the formation of the interface where the individual subunits are heavily inter communicated with each other. This is not true in the case of 3SMI and 3SDI. 3SMI subunits usually interact with each other at the interface with a gentle touch-like contact and hence, they have low I/T ratio. 3SDI are often quite different in interaction compared to 3SMI and their subunits do deeply interact at the interface with only one part of the surface and hence also having low I/T ratio. PMID:20198182

  16. Resistant mice lacking interleukin-12 become susceptible to Trypanosoma cruzi infection but fail to mount a T helper type 2 response.

    PubMed

    Galvão Da Silva, Ana Paula; Jacysyn, Jacqueline F; De Almeida Abrahamsohn, Ises

    2003-02-01

    Interleukin-12 (IL-12) is essential to resistance to Trypanosoma cruzi infection because it stimulates the synthesis of interferon-gamma (IFN-gamma) that activates macrophages to a parasiticidal effect. Investigation of mice deprived of IL-12 genes (IL-12 knockout mice) has confirmed the important role of IL-12 and IFN-gamma in controlling parasitism in T. cruzi infection. However, it has not yet been addressed whether a shift towards a T helper type 2 (Th2) pattern of cytokine response occurred in these mice that might have contributed to the aggravation of the infection caused by IL-12 deprivation. We examined the course of T. cruzi (Y strain) infection and the regulation of cytokine responses and nitric oxide production in C57BL/6 IL-12 p40-knockout mice. The mutant mice were extremely susceptible to the infection as evidenced by increased parasitaemia, tissue parasitism and mortality in comparison with the control C57BL/6 mouse strain (wild-type) that is resistant to T. cruzi. A severe depletion of parasite-antigen-specific IFN-gamma response, without an increase in IL-4 or IL-10 production, accompanied by reduced levels of nitric oxide production was observed in IL-12 knockout mice. We found no evidence of a shift towards a Th2-type cytokine response. In IL-12 knockout mice, the residual IFN-gamma production is down-regulated by IL-10 but not by IL-4 and nitric oxide production is stimulated by tumour necrosis factor-alpha. Parasite-specific immunoglobulin G1 antibody levels were similar in IL-12 knockout and wild-type mice, whereas IL-12 knockout mice had much higher levels of immunoglobulin G2b.

  17. Interleukin 12 Secretion Enhances Antitumor Efficacy of Oncolytic Herpes Simplex Viral Therapy for Colorectal Cancer

    PubMed Central

    Bennett, Joseph J.; Malhotra, Sandeep; Wong, Richard J.; Delman, Keith; Zager, Jonathan; St-Louis, Maryse; Johnson, Paul; Fong, Yuman

    2001-01-01

    Objective To assess the strategy of combining oncolytic herpes simplex virus (HSV) therapy with immunomodulatory therapy as treatment for experimental colon cancer. The oncolytic HSV recombinant NV1023 and the interleukin 12 (IL-12)-secreting oncolytic NV1042 virus were evaluated in vitro and in vivo with respect to antitumor efficacy. Summary Background Data Genetically engineered, replication-conditional, attenuated HSVs have shown oncolytic activity against a wide variety of solid malignancies. Other strategies for treating cancer have involved immunomodulation and cytokine gene transfer using viral vectors. This study has combined both of these strategies by inserting the murine IL-12 gene into a replication-competent HSV. This approach allows oncolytic therapy to replicate selectively within and lyse tumor cells while providing the host immune system with the cytokine stimulus necessary to recruit and activate inflammatory cells needed to enhance the antitumor effect. Methods NV1023 is a multimutant HSV based on the wild-type HSV-1 F strain. NV1042 was created by insertion of the mIL-12 gene into NV1023. Cytotoxicity and viral proliferation of both NV1023 and NV1042 within murine CT26 colorectal cancer cells were first shown. Cells infected with NV1042 were then shown to produce significant levels of IL-12. Using an experimental flank model of colon cancer, mice were treated with both high and low doses of NV1023 or NV1042 and were followed up for both cure and reduction in tumor burden. Results Both viruses could replicate within and kill CT26 cells in vitro, with 100% cytotoxicity achieved after infection by either virus. Only NV1042 could produce mIL-12. Therapy using high viral doses to treat animals in vivo showed equal efficacy between NV1023 and NV1042, with five of seven cures for each virus. When viral doses were lowered, only the cytokine-producing NV1042 virus could reduce tumor burden and cure animals of their disease. Conclusions Both NV1023 and

  18. Interleukin-12 inhibits pathological neovascularization in mouse model of oxygen-induced retinopathy

    PubMed Central

    Zhou, Yedi; Yoshida, Shigeo; Kubo, Yuki; Kobayashi, Yoshiyuki; Nakama, Takahito; Yamaguchi, Muneo; Ishikawa, Keijiro; Nakao, Shintaro; Ikeda, Yasuhiro; Ishibashi, Tatsuro; Sonoda, Koh-Hei

    2016-01-01

    Hypoxia-induced retinal neovascularization is a major pathological condition in many vision-threatening diseases. In the present study, we determined whether interleukin (IL)-12, a cytokine that regulates angiogenesis, plays a role in the neovascularization in a mouse model of oxygen-induced retinopathy (OIR). We found that the expressions of the mRNAs of both IL-12p35 and IL-12p40 were significantly reduced in the OIR retinas compared to that of the room air-raised control. The sizes of the avascular areas and neovascular tufts were larger in IL-12p40 knock-out (KO) mice than that in wild type (WT) mice. In addition, an intravitreal injection of recombinant IL-12 reduced both avascular areas and neovascular tufts. IL-12 injection enhanced the expressions of interferon-gamma (IFN-γ) and other downstream chemokines. In an in vitro system, IL-12 had no significant effect on tube formation of human retinal microvascular endothelial cells (HRECs). Moreover, a blockade of IFN-γ suppressed the inhibitory effect of IL-12 on pathological neovascularization. These results suggest that IL-12 plays important roles in inhibiting pathological retinal neovascularization. PMID:27312090

  19. Leishmania promastigotes evade interleukin 12 (IL-12) induction by macrophages and stimulate a broad range of cytokines from CD4+ T cells during initiation of infection

    PubMed Central

    1994-01-01

    Leishmania major are intramacrophage parasites whose eradication requires the induction of T helper 1 (Th1) effector cells capable of activating macrophages to a microbicidal state. Interleukin 12 (IL-12) has been recently identified as a macrophage-derived cytokine capable of mediating Th1 effector cell development, and of markedly enhancing interferon gamma (IFN-gamma) production by T cells and natural killer cells. Infection of macrophages in vitro by promastigotes of L. major caused no induction of IL-12 p40 transcripts, whereas stimulation using heat-killed Listeria or bacterial lipopolysaccharide induced readily detectable IL-12 mRNA. Using a competitor construct to quantitate a number of transcripts, a kinetic analysis of cytokine induction during the first few days of infection by L. major was performed. All strains of mice examined, including susceptible BALB/c and resistant C57BL/6, B10.D2, and C3H/HeN, had the appearance of a CD4+ population in the draining lymph nodes that contained transcripts for IL-2, IL-4, and IFN- gamma (and in some cases, IL-10) that peaked 4 d after infection. In resistant mice, the transcripts for IL-2, IL-4, and IL-10 were subsequently downregulated, whereas in susceptible BALB/c mice, these transcripts were only slightly decreased, and IL-4 continued to be reexpressed at high levels. IL-12 transcripts were first detected in vivo by 7 d after infection, consistent with induction by intracellular amastigotes. Challenge of macrophages in vitro confirmed that amastigotes, in contrast to promastigotes, induced IL-12 p40 mRNA. Reexamination of the cytokine mRNA at 4 d revealed expression of IL-13 in all strains analyzed, suggesting that IL-2 and IL-13 may mediate the IL-12-independent production of IFN-gamma during the first days after infection. Leishmania have evolved to avoid inducing IL-12 from host macrophages during transmission from the insect vector, and cause a striking induction of mRNAs for IL-2, IL-4, IL-10, and IL-13 in

  20. Liposomal Doxorubicin Plus Interleukin-12 for AIDS-Related Kaposi’s Sarcoma | Center for Cancer Research

    Cancer.gov

    Kaposi’s sarcoma (KS), a disease characterized by the development of malignant tumors usually in the lower extremities, is a major complication of HIV/AIDS. KS continues to be a problem even with the use of highly active antiretroviral therapy (HAART), today’s standard of care for patients with HIV/AIDS. CCR investigators recently investigated the effects of interleukin-12 (IL-12) on this malignancy in HIV/AIDS patients when combined with pegylated liposomal doxorubicin, an anthracycline. The findings appear in the September 10, 2007, online edition of Blood.

  1. Effect of recombinant interleukin-12 on murine skin regeneration and cell dynamics using in vivo multimodal microscopy

    PubMed Central

    Li, Joanne; Bower, Andrew J.; Vainstein, Vladimir; Gluzman-Poltorak, Zoya; Chaney, Eric J.; Marjanovic, Marina; Basile, Lena A.; Boppart, Stephen A.

    2015-01-01

    Interleukin-12 (IL-12) is a pro-inflammatory cytokine known for its role in immunity, and previous studies have shown that IL-12 provides mitigation of radiation injury. In this study, we utilize a multimodal microscopy system equipped with second harmonic generation (SHG) and fluorescence lifetime imaging microscopy (FLIM) to examine the effect of IL-12 on collagen structure and cellular metabolic activity in vivo during skin wound healing. This preliminary study illustrates the highly dynamic and heterogeneous in vivo microenvironment of the wounded skin. In addition, results suggest that IL-12 triggers a significantly more rapid and greater cellular metabolic response in the wounded animals. These results can elucidate insights into the response mechanism of IL-12 in both wound healing and acute radiation syndrome. PMID:26600994

  2. Potentiated antitumor effects of interleukin 12 and matrix metalloproteinase inhibitor batimastat against B16F10 melanoma in mice.

    PubMed

    Dabrowska, A; Giermasz, A; Marczak, M; Gołab, J; Jakóbisiak, M

    2000-01-01

    The application of antiangiogenic agents in cancer therapy has been studied extensively. Combination of agents with antiangiogenic properties could possibly enhance antitumor effects. Interleukin 12 is a cytokine with potent antitumor activity mediated also via antiangiogenic mechanisms. These effects are attributed to IFN-gamma production stimulated by IL-12. Since IFN-gamma has been reported to augment antitumor effects when combined with one of the metalloproteinase inhibitors--batimastat (BB-94), we have examined a combined treatment with IL-12 and BB-94 in a murine melanoma model. The administration of both agents showed potentiated antitumor activity. Furthermore, we have shown in a tumor-induced angiogenesis model that the combined application of IL-12 and batimastat inhibits the formation of new blood vessels to a greater extent than either agent alone. Our observations show that antiangiogenic effects are at least partly responsible for the enhanced antitumor effects of the combined treatment with IL-12 and BB-94.

  3. Inherited IL-12p40 deficiency: genetic, immunologic, and clinical features of 49 patients from 30 kindreds.

    PubMed

    Prando, Carolina; Samarina, Arina; Bustamante, Jacinta; Boisson-Dupuis, Stéphanie; Cobat, Aurelie; Picard, Capucine; AlSum, Zobaida; Al-Jumaah, Suliman; Al-Hajjar, Sami; Frayha, Husn; Alangari, Abdullah; Al-Mousa, Hamoud; Mobaireek, Khalid F; Ben-Mustapha, Imen; Adimi, Parisa; Feinberg, Jacqueline; de Suremain, Maylis; Jannière, Lucile; Filipe-Santos, Orchidée; Mansouri, Nahal; Stephan, Jean-Louis; Nallusamy, Revathy; Kumararatne, Dinakantha S; Bloorsaz, Mohamad Reza; Ben-Ali, Meriem; Elloumi-Zghal, Houda; Chemli, Jalel; Bouguila, Jihene; Bejaoui, Mohamed; Alaki, Emadia; AlFawaz, Tariq S; Al Idrissi, Eman; ElGhazali, Gehad; Pollard, Andrew J; Murugasu, Belinda; Wah Lee, Bee; Halwani, Rabih; Al-Zahrani, Mohammed; Al Shehri, Mohammed A; Al-Zahrani, Mofareh; Bin-Hussain, Ibrahim; Mahdaviani, Seyed Alireza; Parvaneh, Nima; Abel, Laurent; Mansouri, Davood; Barbouche, Ridha; Al-Muhsen, Saleh; Casanova, Jean-Laurent

    2013-03-01

    Autosomal recessive interleukin (IL)-12 p40 (IL-12p40) deficiency is a rare genetic etiology of mendelian susceptibility to mycobacterial disease (MSMD). We report the genetic, immunologic, and clinical features of 49 patients from 30 kindreds originating from 5 countries (India, Iran, Pakistan, Saudi Arabia, and Tunisia). There are only 9 different mutant alleles of the IL12B gene: 2 small insertions, 3 small deletions, 2 splice site mutations, and 1 large deletion, each causing a frameshift and leading to a premature stop codon, and 1 nonsense mutation. Four of these 9 variants are recurrent, affecting 25 of the 30 reported kindreds, due to founder effects in specific countries. All patients are homozygous and display complete IL-12p40 deficiency. As a result, the patients lack detectable IL-12p70 and IL-12p40 and have low levels of interferon gamma (IFN-γ). The clinical features are characterized by childhood onset of bacille Calmette-Guérin (attenuated Mycobacterium bovis strain) (BCG) and Salmonella infections, with recurrences of salmonellosis (36.4%) more common than recurrences of mycobacterial disease (25%). BCG vaccination led to BCG disease in 40 of the 41 patients vaccinated (97.5%). Multiple mycobacterial infections were rare, observed in only 3 patients, whereas the association of salmonellosis and mycobacteriosis was observed in 9 patients. A few other infections were diagnosed, including chronic mucocutaneous candidiasis (n = 3), nocardiosis (n = 2), and klebsiellosis (n = 1). IL-12p40 deficiency has a high but incomplete clinical penetrance, with 33.3% of genetically affected relatives of index cases showing no symptoms. However, the prognosis is poor, with mortality rates of up to 28.6%. Overall, the clinical phenotype of IL-12p40 deficiency closely resembles that of interleukin 12 receptor β1 (IL-12Rβ1) deficiency. In conclusion, IL-12p40 deficiency is more common than initially thought and should be considered worldwide in patients with MSMD

  4. A Model to Explain How the Bacille Calmette Guérin (BCG) Vaccine Drives Interleukin-12 Production in Neonates

    PubMed Central

    Kativhu, Chido Loveness; Libraty, Daniel H.

    2016-01-01

    The Bacille Calmette Guérin (BCG) vaccine is the only routine vaccination at birth that effectively induces neonatal T-helper 1 (Th1)-polarized immune responses. The primary cytokine that drives CD4+ T-cell Th1 differentiation is interleukin (IL)-12 p70, a heterodimeric cytokine composed of the IL-12 p35 and IL-12 p40 subunits. We therefore examined the mechanisms involved in BCG vaccine stimulation of IL-12 p35 and p40 production from human umbilical cord (neonatal) cells. We found that BCG bacilli did not upregulate IL-12 p35 mRNA production, but upregulated IL-12 p40 mRNA production in a Toll-like receptor (TLR)2-dependent manner, in human neonatal monocyte-derived dendritic cells (mdDCs). The combination of TLR2 signaling, Type I interferon (IFN), and Type II IFN induced maximal levels of IL-12 p35 and p40 mRNA production in human neonatal mdDCs. The cell-free supernatants of reconstituted BCG vaccine vials contained extracellular mycobacterial (BCG) DNA which could induce IFN-α (Type I IFN) production in human neonatal plasmacytoid dendritic cells (pDCs). BCG bacilli also stimulated human neonatal CD16lo natural killer (NK) cells to produce IFN-γ (Type II IFN) in a TLR2-dependent manner. We have therefore proposed a model where BCG vaccine could stimulate the combination of neonatal conventional DCs (cDCs), pDCs, and CD16lo NK cells to produce optimal neonatal IL-12 p35 and p40 (IL-12 p70) production and subsequent CD4+ T-cell Th1 polarization. An adjuvant that emulates the mechanism by which the BCG vaccine stimulates neonatal IL-12 p35 and p40 production could improve vaccine strategies at birth for protection against intracellular pathogens and toxins. PMID:27571272

  5. A Model to Explain How the Bacille Calmette Guérin (BCG) Vaccine Drives Interleukin-12 Production in Neonates.

    PubMed

    Kativhu, Chido Loveness; Libraty, Daniel H

    2016-01-01

    The Bacille Calmette Guérin (BCG) vaccine is the only routine vaccination at birth that effectively induces neonatal T-helper 1 (Th1)-polarized immune responses. The primary cytokine that drives CD4+ T-cell Th1 differentiation is interleukin (IL)-12 p70, a heterodimeric cytokine composed of the IL-12 p35 and IL-12 p40 subunits. We therefore examined the mechanisms involved in BCG vaccine stimulation of IL-12 p35 and p40 production from human umbilical cord (neonatal) cells. We found that BCG bacilli did not upregulate IL-12 p35 mRNA production, but upregulated IL-12 p40 mRNA production in a Toll-like receptor (TLR)2-dependent manner, in human neonatal monocyte-derived dendritic cells (mdDCs). The combination of TLR2 signaling, Type I interferon (IFN), and Type II IFN induced maximal levels of IL-12 p35 and p40 mRNA production in human neonatal mdDCs. The cell-free supernatants of reconstituted BCG vaccine vials contained extracellular mycobacterial (BCG) DNA which could induce IFN-α (Type I IFN) production in human neonatal plasmacytoid dendritic cells (pDCs). BCG bacilli also stimulated human neonatal CD16lo natural killer (NK) cells to produce IFN-γ (Type II IFN) in a TLR2-dependent manner. We have therefore proposed a model where BCG vaccine could stimulate the combination of neonatal conventional DCs (cDCs), pDCs, and CD16lo NK cells to produce optimal neonatal IL-12 p35 and p40 (IL-12 p70) production and subsequent CD4+ T-cell Th1 polarization. An adjuvant that emulates the mechanism by which the BCG vaccine stimulates neonatal IL-12 p35 and p40 production could improve vaccine strategies at birth for protection against intracellular pathogens and toxins.

  6. Interleukin-12 and interleukin-2 alone or in combination against the infection in invasive pulmonary aspergillosis mouse model.

    PubMed

    Zhang, Chang-Ran; Lin, Jian-Cong; Xu, Wen-Ming; Li, Ming; Ye, Hui-Shao; Cui, Wei-Ling; Lin, Qing

    2013-03-01

    Aspergillus fumigatus is an intracellular opportunistic fungus causing invasive pulmonary mycosis, characterised by hyphal invasion and destruction of pulmonary tissue. Th1 cytokines could enhance fungicidal activity. The effects from the combination of interleukin-12 (IL-12) and IL-2 are rarely known in invasive pulmonary aspergillosis infection. To assess the cleaning of A. fumigatus infection in the pulmonary tissues by IL-12 and IL-2, interferon-γ (IFN-γ) was detected in the sera using ELISA, quantification of IFN-γ mRNA using real-time RT-PCR and lung Colony-forming unit was assayed by cultivation. Morphology was analysed by histopathological examination. Our results showed that IL-12 and/or IL-2 could enhance the IFN-γ expression in the pulmonary tissue, reduce the colony load in the pulmonary tissue and increase the survival rate of mouse. The combination of IL-12 and IL-2 could assist in increasing the IFN-γ expression in the pulmonary tissue, but neither reduce colony load in the pulmonary tissue nor increase the survival rate of mouse significantly. It was demonstrated that IL-12 and IL-2 were strong immunomodulatory cytokines as a prerequisite for protecting the host from infectious agents.

  7. Enhanced Delivery of Plasmid Encoding Interleukin-12 Gene by Diethylene Triamine Penta-Acetic Acid (DTPA)-Conjugated PEI Nanoparticles.

    PubMed

    Dehshahri, Ali; Sadeghpour, Hossein; Keykhaee, Maryam; Khalvati, Bahman; Sheikhsaran, Fatemeh

    2016-05-01

    Recombinant therapeutic proteins have been considered as an efficient category of medications used for the treatment of various diseases. Despite their effectiveness, there are some reports on the systemic adverse effects of recombinant therapeutic proteins limiting their wide clinical applications. Among different cytokines used for cancer immunotherapy, interleukin-12 (IL-12) has shown great ability as a powerful antitumor and antiangiogenic agent. However, significant toxic reactions following the systemic administration of IL-12 have led researchers to seek for alternative approaches such as the delivery and local expression of the IL-12 gene inside the tumor tissues. In order to transfer the plasmid encoding IL-12 gene, the most extensively investigated polycationic polymer, polyethylenimine (PEI), was modified by diethylene triamine penta-acetic acid (DTPA) to modulate the hydrophobic-hydrophilic balance of the polymer as well as its toxicity. DTPA-conjugated PEI derivatives were able to form complexes in the size range around 100-180 nm with great condensation ability and protection of the plasmid against enzymatic degradation. The highest gene transfer ability was achieved by the DTPA-conjugated PEI at the conjugation degree of 0.1 % where the level of IL-12 production increased up to twofold compared with that of the unmodified PEI. Results of the present study demonstrated that modulation of the surface positive charge of PEI along with the improvement of the polymer hydrophobic balance could be considered as a successful strategy to develop safe and powerful nanocarriers.

  8. Intranasal Administration of an Inactivated Yersinia pestis Vaccine with Interleukin-12 Generates Protective Immunity against Pneumonic Plague ▿ #

    PubMed Central

    Kumar, Devender; Kirimanjeswara, Girish; Metzger, Dennis W.

    2011-01-01

    Inhalation of Yersinia pestis causes pneumonic plague, which rapidly progresses to death. A previously licensed killed whole-cell vaccine is presently unavailable due to its reactogenicity and inconclusive evidence of efficacy. The present study now shows that vaccination intranasally (i.n.) with inactivated Y. pestis CO92 (iYp) adjuvanted with interleukin-12 (IL-12) followed by an i.n. challenge with a lethal dose of Y. pestis CO92 prevented bacterial colonization and protected 100% of mice from pneumonic plague. Survival of the vaccinated mice correlated with levels of systemic and lung antibodies, reduced pulmonary pathology and proinflammatory cytokines, and the presence of lung lymphoid cell aggregates. Protection against pneumonic plague was partially dependent upon Fc receptors and could be transferred to naïve mice with immune mouse serum. On the other hand, protection was not dependent upon complement, and following vaccination, depletion of CD4 and/or CD8 T cells before challenge did not affect survival. In summary, the results demonstrate the safety, immunogenicity, and protective efficacy of i.n. administered iYp plus IL-12 in a mouse model of pneumonic plague. PMID:21880856

  9. Feline Leukemia Virus DNA Vaccine Efficacy Is Enhanced by Coadministration with Interleukin-12 (IL-12) and IL-18 Expression Vectors

    PubMed Central

    Hanlon, Linda; Argyle, David; Bain, Derek; Nicolson, Lesley; Dunham, Stephen; Golder, Matthew C.; McDonald, Michael; McGillivray, Christine; Jarrett, Oswald; Neil, James C.; Onions, David E.

    2001-01-01

    The expectation that cell-mediated immunity is important in the control of feline leukemia virus (FeLV) infection led us to test a DNA vaccine administered alone or with cytokines that favored the development of a Th1 immune response. The vaccine consisted of two plasmids, one expressing the gag/pol genes and the other expressing the env gene of FeLV-A/Glasgow-1. The genetic adjuvants were plasmids encoding the feline cytokines interleukin-12 (IL-12), IL-18, or gamma interferon (IFN-γ). Kittens were immunized by three intramuscular inoculations of the FeLV DNA vaccine alone or in combination with plasmids expressing IFN-γ, IL-12, or both IL-12 and IL-18. Control kittens were inoculated with empty plasmid. Following immunization, anti-FeLV antibodies were not detected in any kitten. Three weeks after the final immunization, the kittens were challenged by the intraperitoneal inoculation of FeLV-A/Glasgow-1 and were then monitored for a further 15 weeks for the presence of virus in plasma and, at the end of the trial, for latent virus in bone marrow. The vaccine consisting of FeLV DNA with the IL-12 and IL-18 genes conferred significant immunity, protecting completely against transient and persistent viremia, and in five of six kittens protecting against latent infection. None of the other vaccines provided significant protection. PMID:11507187

  10. In vivo activity of plant-based interleukin-12 in the lung of Balb/c mouse

    PubMed Central

    2010-01-01

    Background In the last years, plants are being used for the production of a wide variety of biopharmaceuticals, including cytokines, and have the potential to serve as vehicles for mucosal administration of these molecules. We had previously reported the expression of a cytokine, interleukin-12 (IL-12), in transgenic tomato plants and had demonstrated that it retained its biologic activity in vitro. Findings In this work, we administered crude extracts of IL-12-containing tomato fruits to mice through the intratracheal route, measuring endogenous IL-12 and determining biologic activity by quantification of interferon-gamma (IFN-γ) in lungs and by histological analysis. IFN-γ expression in lungs, as well as histological analysis, indicate that tomato-expressed IL-12 retains its biologic activity and, most importantly, its effects are restricted to the site of administration. Conclusion Our results indicate that the functional activity of tomato-expressed IL-12 is comparable to that of commercial recombinant IL-12 when given via the mucosal route. This opens the possibility of using crude extracts prepared from tomatoes expressing IL-12 for certain immunotherapies. PMID:20507618

  11. Intestinal mononuclear cells primed by systemic interleukin-12 display long-term ability to aggravate colitis in mice.

    PubMed

    Pedrotti, Luciano P; Sena, Angela A; Rodriguez Galán, María Cecilia; Cejas, Hugo; Correa, Silvia G

    2017-03-01

    To address whether the burst of systemic interleukin-12 (IL-12) influences intestinal inflammation elicited by luminal stimuli, we induced IL-12 release by cDNA injection in C57BL/6 mice and simultaneously started dextran sulphate sodium administration. The sequence of the inflammatory response triggered by IL-12 release was characterized by assessing myeloperoxidase activity and histological damage in colon samples on days 1, 3, 5 and 7 after colitis induction. To evaluate the persistence of IL-12 priming, colitis was induced in mice 7 or 60 days after cDNA injection. Under IL-12 influence, the development of acute colitis presented a faster and selective infiltration of inflammatory mononuclear cells in the lamina propria. Recruitment was driven by systemic cytokines rather than luminal antigens. Interestingly, when colitis was triggered 7 or 60 days after the cytokine storm, cells maintained the ability to worsen clinical signs of intestinal inflammation. Together, a systemic IL-12 burst effectively primed intestinal cells that became more prone to develop inflammatory responses. Activation was long-lasting because intestinal cells maintained their inflammatory potential and their ability to aggravate colitis. © 2016 John Wiley & Sons Ltd.

  12. Tailor-made fibroblast-specific and antibiotic-free interleukin 12 plasmid for gene electrotransfer-mediated cancer immunotherapy.

    PubMed

    Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja

    2017-01-01

    Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system.

  13. Interleukin-12 and photocarcinogenesis

    SciTech Connect

    Katiyar, Santosh K.

    2007-11-01

    UV radiation induces immunosuppression and inflammatory responses, as well as oxidative stress and DNA damage, in skin cells and these various effects have been implicated in melanoma and nonmelanoma skin cancers, i.e., photocarcinogenesis. The cytokine interleukin (IL)-12 has been shown to possess potent antitumor activity in a wide variety of murine tumor models. In this review, we summarize the evidence that IL-12 plays a role in preventing photocarcinogenesis, and present a model of its possible mechanisms of action. Treatment of mice with IL-12 prevents UV-induced immunosuppression in a process mediated by repair of UV-induced damaged DNA. After exposure to the photocarcinogenesis protocol, the development of UV-induced tumors is more rapid and the tumor multiplicity and tumor size are significantly greater in IL-12-deficient or knockout (KO) mice than their wild-type counterparts. IL-12-deficiency in mice enhances the proliferation potential of tumor cells, and this may be one of the reasons for the rapid growth of the tumors and their greater size. The rate of malignant transformation of UV-induced papillomas to carcinomas also is higher in the IL-12 KO mice than in their wild-type counterparts in terms of carcinoma incidence and carcinoma multiplicity. UV-induced DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) and sunburn cells is lower, or repaired more rapidly, in wild-type mice than IL-12 KO mice. The IL-12-associated reduction in UV-specific CPDs is due to induction of DNA repair, and particularly enhancement of nucleotide-excision repair. We suggest that endogenous stimulation of IL-12 may protect the skin from UV-induced immunosuppression, DNA damage, and, ultimately, the risk of photocarcinogenesis. Taken together, this information suggests that augmentation of IL-12 should be considered as a strategy for the prevention and treatment of photocarcinogenesis.

  14. Vector description of electric and hydrophobic interactions in protein homodimers.

    PubMed

    Mozo-Villarías, Angel; Cedano, Juan; Querol, Enrique

    2016-05-01

    This article describes the formation of homodimers from their constituting monomers, based on the rules set by a simple model of electric and hydrophobic interactions. These interactions are described in terms of the electric dipole moment (D) and hydrophobic moment vectors (H) of proteins. The distribution of angles formed by the two dipole moments of monomers constituting dimers were analysed, as well as the distribution of angles formed by the two hydrophobic moments. When these distributions were fitted to Gaussian curves, it was found that for biological dimers, the D vectors tend mostly to adopt a perpendicular arrangement with respect to each other, in which the constituting dipoles have the least interaction. A minor population tends towards an antiparallel arrangement implying maximum electric attraction. Also in biological dimers, the H vectors of most monomers tend to interact in such a way that the total hydrophobic moment of the dimer increases with respect to those of the monomers. This shows that hydrophobic moments have a tendency to align. In dimers originating in the crystallisation process, the distribution of angles formed by both hydrophobic and electric dipole moments appeared rather featureless, probably because of unspecific interactions in the crystallisation processes. The model does not describe direct interactions between H and D vectors although the distribution of angles formed by both vectors in dimers was analysed. It was found that in most cases these angles tended to be either small (both moments aligned parallel to each other) or large (antiparallel disposition).

  15. Non-heat pipe/P-40 Stirling engine

    NASA Technical Reports Server (NTRS)

    Haglund, R. A.

    1980-01-01

    The non-heat-pipe receiver/P-40 Stirling engine system design is described. A 25 kW direct-driven induction-type alternator will be mounted directly to the P-40 engine to produce to a 60 Hz, 115/230 volt output.

  16. Interleukin-12 is critical for induction of nitric oxide-mediated immunosuppression following vaccination of mice with attenuated Salmonella typhimurium.

    PubMed

    Schwacha, M G; Eisenstein, T K

    1997-12-01

    Studies from our laboratory have shown that infection of mice with an attenuated strain of Salmonella typhimurium causes a marked suppression in the capacity of splenocytes to generate an in vitro plaque-forming cell (PFC) response to sheep erythrocytes. The suppression has been shown to be mediated by mature, adherent macrophages (Mphis) and nonadherent, precursor Mphis. Nitric oxide has been identified as the suppressor factor. The present study investigated the role of interleukin-12 (IL-12) in the generation of nitric oxide-mediated immunosuppression in this model. Salmonella inoculation resulted in marked suppression of PFC responses and high levels of nitrite production. When mice were treated with anti-IL-12 prior to inoculation, nitrite levels in splenocyte cultures were reduced by 75% and the suppression of PFC responses was prevented. The nonadherent splenocyte fraction from Salmonella-inoculated mice, which contains precursor Mphis and is weakly immunosuppressive, was treated with IL-12 in vitro. IL-12 augmented the capacity of this fraction to suppress PFC responses by normal splenocytes in a coculture system. Additionally, IL-12 induced nitrite and gamma interferon (IFN-gamma) production in a dose-dependent manner. Treatment with anti-IFN-gamma blocked nitrite production and suppression, indicating that IFN-gamma is an important intermediary in the pathway of IL-12-induced immunosuppression. These results indicate that IL-12 is critical for the induction of nitric oxide-mediated immunosuppression following S. typhimurium inoculation and, through its ability to stimulate IFN-gamma production, can induce nitric oxide-producing suppressor Mphis.

  17. Natural Killer Cells and Helicobacter pylori Infection: Bacterial Antigens and Interleukin-12 Act Synergistically To Induce Gamma Interferon Production

    PubMed Central

    Yun, Cheol H.; Lundgren, Anna; Azem, Josef; Sjöling, Åsa; Holmgren, Jan; Svennerholm, Ann-Mari; Lundin, B. Samuel

    2005-01-01

    Helicobacter pylori is known to induce a local immune response, which is characterized by activation of lymphocytes and the production of IFN-γ in the stomach mucosa. Since not only T cells, but also natural killer (NK) cells, are potent producers of gamma interferon (IFN-γ), we investigated whether NK cells play a role in the immune response to H. pylori infection. Our results showed that NK cells were present in both the gastric and duodenal mucosae but that H. pylori infection did not affect the infiltration of NK cells into the gastrointestinal area. Furthermore, we could show that NK cells could be activated directly by H. pylori antigens, as H. pylori bacteria, as well as lysate from H. pylori, induced the secretion of IFN-γ by NK cells. NK cells were also activated without direct contact when separated from the bacteria by an epithelial cell layer, indicating that the activation of NK cells by H. pylori can also occur in vivo, in the infected stomach mucosa. Moreover, the production of IFN-γ by NK cells was greatly enhanced when a small amount of interleukin-12 (IL-12) was added, and this synergistic effect was associated with increased expression of the IL-12 receptor β2. It was further evident that bacterial lysate alone was sufficient to induce the activation of cytotoxicity-related molecules. In conclusion, we demonstrated that NK cells are present in the gastroduodenal mucosa of humans and that NK cells produce high levels of IFN-γ when stimulated with a combination of H. pylori antigen and IL-12. We propose that NK cells play an active role in the local immune response to H. pylori infection. PMID:15731046

  18. Borna disease virus accelerates inflammation and disease associated with transgenic expression of interleukin-12 in the central nervous system.

    PubMed

    Freude, Susanna; Hausmann, Jürgen; Hofer, Markus; Pham-Mitchell, Ngan; Campbell, Iain L; Staeheli, Peter; Pagenstecher, Axel

    2002-12-01

    Targeted expression of biologically active interleukin-12 (IL-12) in astrocytes of the central nervous system (CNS) results in spontaneous neuroimmunological disease of aged mice. Borna disease virus (BDV) can readily multiply in the mouse CNS but does not trigger disease in most strains. Here we show that a large percentage of IL-12 transgenic mice developed severe ataxia within 5 to 10 weeks after infection with BDV. By contrast, no disease developed in mock-infected IL-12 transgenic and wild-type mice until 4 months of age. Neurological symptoms were rare in infected wild-type animals, and if they occurred, these were milder and appeared later. Histological analyses showed that the cerebellum of infected IL-12 transgenic mice, which is the brain region with strongest transgene expression, contained large numbers of CD4(+) and CD8(+) T cells as well as lower numbers of B cells, whereas other parts of the CNS showed only mild infiltration by lymphocytes. The cerebellum of diseased mice further showed severe astrogliosis, calcifications and signs of neurodegeneration. BDV antigen and nucleic acids were present in lower amounts in the inflamed cerebellum of infected transgenic mice than in the noninflamed cerebellum of infected wild-type littermates, suggesting that IL-12 or IL-12-induced cytokines exhibited antiviral activity. We propose that BDV infection accelerates the frequency by which immune cells such as lymphocytes and NK cells enter the CNS and then respond to IL-12 present in the local milieu causing disease. Our results illustrate that infection of the CNS with a virus that is benign in certain hosts can be harmful in such normally disease-resistant hosts if the tissue is unfavorably preconditioned by proinflammatory cytokines.

  19. Interleukin-12 Promotes Pathologic Liver Changes and Death in Mice Coinfected with Schistosoma mansoni and Toxoplasma gondii

    PubMed Central

    Araujo, Maria Ilma; Bliss, Susan K.; Suzuki, Yasuhiro; Alcaraz, Ana; Denkers, Eric Y.; Pearce, Edward J.

    2001-01-01

    We previously demonstrated that mice concurrently infected with Schistosoma mansoni and Toxoplasma gondii undergo accelerated mortality which is preceded by severe liver damage. Abnormally high levels of serum tumor necrosis factor alpha (TNF-α) in the dually infected mice suggested a role for this and related proinflammatory mediators in the pathologic alterations. In order to evaluate the factors involved in increased inflammatory-mediator production and mortality, interleukin-12−/− (IL-12−/−) mice were coinfected with S. mansoni and T. gondii, and survival and immune responses were monitored. These IL-12−/− mice displayed decreased liver damage and prolonged time to death relative to wild-type animals also coinfected with these parasites. Relative to the response of cells from the coinfected wild-type animals, levels of TNF-α, gamma interferon, and NO produced by splenocytes from coinfected IL-12−/− mice were reduced, and levels of IL-5 and IL-10 were increased, with the net result that the immune response of the dually infected IL-12−/− mice was similar to that of the wild-type mice infected with S. mansoni alone. While dually infected wild-type animals succumb in the absence of overt parasitemia, the delayed death in the absence of IL-12 is associated with relatively uncontrolled T. gondii replication. These data support the view that S. mansoni-infected mice are acutely sensitive to infection with T. gondii as a result of their increased hepatic sensitivity to high levels of proinflammatory cytokines; IL-12 and TNF-α are implicated in this process. PMID:11179312

  20. Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice

    PubMed Central

    Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.

    2001-01-01

    Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339

  1. Preparation of chitosan-plasmid DNA nanoparticles encoding interleukin-12 and their expression in CT-26 colon carcinoma cells.

    PubMed

    Hallaj-Nezhadi, Somayeh; Valizadeh, Hadi; Dastmalchi, Siavoush; Baradaran, Behzad; Jalali, Mohammad Barzegar; Dobakhti, Faramarz; Lotfipour, Farzaneh

    2011-01-01

    Interleukin-12 (Il-12) as a cytokine has been proved to possess antitumor effects via stimulating the immune system. Non-viral gene delivery systems exhibit low toxicity and are easier to prepare compared to their viral counterparts. In this study, we aimed to prepare plasmid DNA loaded chitosan nanoparticles for expression of Il-12 and to evaluate their physicochemical characteristics, cytotoxicity and transfection efficiency in Murine CT-26 colon carcinoma cells. Nanoparticles were prepared using a complex coacervation process at different N/P ratios and characterized in terms of size, zeta potential, polydispersity index, morphology, encapsulation efficiency and polyplex formation. The cytotoxicities and transfection efficiencies of the prepared polyplexes were evaluated by MTT assay and ELISA (for hIL-12, p70), respectively. Size and zeta potential varied from 76.73 to 867.03 nm and between 5.68 and 16.77 mV, respectively. Strong attachment of the DNA to chitosan was observed after polyplex preparation. Encapsulation efficiencies were high (72.97-94.87%). The transfection efficiencies of the prepared complexes were obviously higher than those of naked pDNA when N/P ratios were between 16 and 60. Maximum level of phIL-12 expression was obtained at (N/P = 16) with mean particle size of 381.83±82.77 nm (polydispersity index=0.44) indicating the improved transfection of pUMVC3-hIL12 about 2.80 times compared to that of the naked pUMVC3-hIL12. Prepared polyplexes were nontoxic to CT-26 cells. Chitosan-DNA nanoparticles at N/P = 16 with minimal cytotoxicity, can be used as suitable candidate for Il-12 delivery. This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

  2. Deprotonated Dicarboxylic Acid Homodimers: Hydrogen Bonds and Atmospheric Implications

    SciTech Connect

    Hou, Gao-Lei; Valiev, Marat; Wang, Xue-Bin

    2016-03-31

    Dicarboxylic acids represent an important class of water-soluble organic compounds found in the atmosphere. In this work we are studying properties of dicarboxylic acid homodimer complexes (HO2(CH2)nCO2-[HO2(CH2)nCO2H], n = 0-12), as potentially important intermediates in aerosol formation processes. Our approach is based on experimental data from negative ion photoelectron spectra of the dimer complexes combined with updated measurements of the corresponding monomer species. These results are analyzed with quantum-mechanical calculations, which provide further information about equilibrium structures, thermochemical parameters associated with the complex formation, and evaporation rates. We find that upon formation of the dimer complexes the electron binding energies increase by 1.3–1.7 eV (30.0–39.2 kcal/mol), indicating increased stability of the dimerized complexes. Calculations indicate that these dimer complexes are characterized by the presence of strong intermolecular hydrogen bonds with high binding energies and are thermodynamically favorable to form with low evaporation rates. Comparison with previously studied HSO4-[HO2(CH2)2CO2H] complex (J. Phys. Chem. Lett. 2013, 4, 779-785) shows that HO2(CH2)2CO2-[HO2(CH2)2CO2H] has very similar thermochemical properties. These results imply that dicarboxylic acids not only can contribute to the heterogeneous complexes formation involving sulfuric acid and dicarboxylic acids, but also can promote the formation of homogenous complexes by involving dicarboxylic acids themselves.

  3. Chemical shift imprint of intersubunit communication in a symmetric homodimer

    PubMed Central

    Falk, Bradley T.; Sapienza, Paul J.; Lee, Andrew L.

    2016-01-01

    Allosteric communication is critical for protein function and cellular homeostasis, and it can be exploited as a strategy for drug design. However, unlike many protein–ligand interactions, the structural basis for the long-range communication that underlies allostery is not well understood. This lack of understanding is most evident in the case of classical allostery, in which a binding event in one protomer is sensed by a second symmetric protomer. A primary reason why study of interdomain signaling is challenging in oligomeric proteins is the difficulty in characterizing intermediate, singly bound species. Here, we use an NMR approach to isolate and characterize a singly ligated state (“lig1”) of a homodimeric enzyme that is otherwise obscured by rapid exchange with apo and saturated forms. Mixed labeled dimers were prepared that simultaneously permit full population of the lig1 state and isotopic labeling of either protomer. Direct visualization of peaks from lig1 yielded site-specific ligand-state multiplets that provide a convenient format for assessing mechanisms of intersubunit communication from a variety of NMR measurements. We demonstrate this approach on thymidylate synthase from Escherichia coli, a homodimeric enzyme known to be half-the-sites reactive. Resolving the dUMP1 state shows that active site communication occurs not upon the first dUMP binding, but upon the second. Surprisingly, for many sites, dUMP1 peaks are found beyond the limits set by apo and dUMP2 peaks, indicating that binding the first dUMP pushes the enzyme ensemble to further conformational extremes than the apo or saturated forms. The approach used here should be generally applicable to homodimers. PMID:27466406

  4. Presentation of interleukin-12/-23 receptor beta1 deficiency with various clinical symptoms of Salmonella infections.

    PubMed

    Sanal, Ozden; Turul, Tuba; De Boer, Tijtske; Van de Vosse, Esther; Yalcin, Işik; Tezcan, Ilhan; Sun, Cağman; Memis, L; Ottenhoff, Tom H M; Ersoy, Fugen

    2006-01-01

    Clinical disease caused by weakly pathogenic mycobacterial species, Mycobacterium bovis Bacille Calmette-Guérin (BCG) and non-tuberculous environmental mycobacteria (EM), which is known as Mendelian susceptibility to mycobacterial disease (MSMD), is a rare entity defined recently. Infections with the more virulent Mycobacterium species, M. tuberculosis, may have largely gone unnoticed in these patients due to early death. Mutations in five proteins (IFNgammaR1, IFNgammaR2, IL-12/IL-23Rbeta1, IL-12/IL-23p40 and STAT1) have been found in MSMD. These patients are prone to surprisingly few other infectious diseases mainly to salmonellosis. Here we present three IL-12/IL-23Rbeta1 deficient patients from three different families and with different genetic mutations, who presented exclusively with Salmonella infections. Bacteremia and lymph node involvement were common clinical expressions. Leukocytoclastic vasculitis developed in one of these patients. Two patients were not inoculated with BCG, the third patient did not develop BCG infection although BCG vaccine had been given twice at ages of 1 and 7 years. All three patients responded well to antibiotic treatment. In conclusion, patients with chronic, recurrent or complicated Salmonella infections should be screened for MSMD, particularly for IL-12/IL-23p40/IL-12R/-23Rbeta1 deficiency. Conversely, in patients with genetic IL-12/-23Rbeta1 deficiency a full evaluation for Salmonella infection is required. IL-12/IL-23p40/IL-12R/IL-23Rbeta1 deficiency seem to be underdiagnosed in patients with salmonellosis, and since such patients need prolonged therapy, diagnosis is important.

  5. T cell-, interleukin-12-, and gamma interferon-driven viral clearance in measles virus-infected brain tissue.

    PubMed

    Stubblefield Park, Samantha R; Widness, Mi; Levine, Alan D; Patterson, Catherine E

    2011-04-01

    Genetic studies with immunocompetent mice show the importance of both T cells and gamma interferon (IFN-γ) for survival of a measles virus (MV) challenge; however, the direct role of T cells and IFN-γ within the MV-infected brain has not been addressed. Organotypic brain explants represent a successful ex vivo system to define central nervous system (CNS)-specific mechanisms of leukocyte migration, activation, and MV clearance. Within the heterogeneous, brain-derived, primed leukocyte population which reduced MV RNA levels in brain explants by 60%, CD3 T cells are the active antiviral cells, as purified CD3-positive cells are highly antiviral and CD3-negative leukocytes are unable to reduce the viral load. Neutralization of CCL5 and CXCL10 decreases leukocyte migration to areas of infection by 70%. However, despite chemokines directing the migration of T cells to infected neurons, chemokine neutralization revealed that migration is not required for viral clearance, suggesting a cytokine-mediated antiviral mechanism. In accordance with our hypothesis, the ability of leukocytes to clear the virus is abrogated when explants are treated with anti-IFN-γ neutralizing antibodies. IFN-γ applied to infected slices in the absence of primed leukocytes reduces the viral load by more than 80%; therefore, in brain tissue, IFN-γ is both necessary and sufficient to clear MV. Secretion of IFN-γ is stimulated by interleukin-12 (IL-12) in the brain, as neutralization of IL-12 results in loss of antiviral activity and stimulation of leukocytes with IL-12/IL-18 enhances their immune effector function of viral clearance. MV-primed leukocytes can reduce both West Nile and mouse hepatitis viral RNAs, indicating that cytokine-mediated viral clearance occurs in an antigen-independent manner. The IFN-γ signal is transduced within the brain explant by the Jak/STAT signaling pathway, as inhibition of Jak kinases results in a loss of antiviral activity driven by either brain

  6. Intranasal Coadministration of Live Lactococci Producing Interleukin-12 and a Major Cow's Milk Allergen Inhibits Allergic Reaction in Mice▿

    PubMed Central

    Cortes-Perez, Naima G.; Ah-Leung, Sandrine; Bermúdez-Humarán, Luis G.; Corthier, Gérard; Wal, Jean-Michel; Langella, Philippe; Adel-Patient, Karine

    2007-01-01

    The Th1/Th2 balance deregulation toward a Th2 immune response plays a central role in allergy. We previously demonstrated that administration of recombinant Lactococcus lactis strains expressing bovine β-lactoglobulin (BLG), a major cow's milk allergen, partially prevents mice from sensitization. In the present study, we aimed to improve this preventive effect by coadministration of L. lactis BLG and a second recombinant L. lactis strain producing biologically active interleukin-12 (IL-12). This L. lactis strain producing IL-12 was previously used to enhance the Th1 immune response in a tumoral murine model (L. G. Bermúdez-Humarán et al., J. Immunol. 175:7297-7302, 2005). A comparison of the administration of either BLG alone or BLG in the presence of IL-12 was conducted. A BLG-specific primary Th1 immune response was observed only after intranasal coadministration of both L. lactis BLG and IL-12-producing L. lactis, as demonstrated by the induction of serum-specific immunoglobulin G2a (IgG2a) concomitant with gamma interferon secretion by splenocytes, confirming the adjuvanticity of IL-12-producing L. lactis. Immunized mice were further sensitized by intraperitoneal administration of purified BLG, and the allergic reaction was elicited by intranasal challenge with purified BLG. Mice pretreated with BLG in either the presence or the absence of IL-12 were rendered completely tolerant to further allergic sensitization and elicitation. Pretreatment with either L. lactis BLG or L. lactis BLG and IL-12-producing L. lactis induces specific anti-BLG IgG2a production in serum and bronchoalveolar lavage (BAL) fluid. Although specific serum IgE was not affected by these pretreatments, the levels of eosinophilia and IL-5 secretion in BAL fluid were significantly reduced after BLG challenge in the groups pretreated with L. lactis BLG and L. lactis BLG-IL-12-producing L. lactis, demonstrating a decreased allergic reaction. Our data demonstrate for the first time (i) the

  7. RNA of Enterococcus faecalis Strain EC-12 Is a Major Component Inducing Interleukin-12 Production from Human Monocytic Cells

    PubMed Central

    Nishibayashi, Ryoichiro; Inoue, Ryo; Harada, Yuri; Watanabe, Takumi; Makioka, Yuko; Ushida, Kazunari

    2015-01-01

    Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing immunogenic component. However, it was recently revealed that bacterial RNA can be a ligand for Toll-like receptor (TLR) 13, which is only expressed in mice. Because TLR13 is not expressed in humans, the immuno-stimulatory and -modulatory effects of LAB RNA in human cells should be augmented excluding TLR13 contribution. In experiment 1 of this study, the role of LAB RNA in IL-12 induction in human immune cells was studied using three LAB strains, E.faecalis EC-12, Lactobacillus gasseri JCM5344, and Bifidobacterium breve JCM1192. RNase A treatment of heat-killed LAB significantly decreased the IL-12 production of human peripheral blood mononuclear cells on stimulation, while RNase III treatment revealed virtually no effects. Further, IL-12 production against heat-killed E. faecalis EC-12 was abolished by depleting monocytes. These results demonstrated that single stranded RNA (ssRNA) of LAB is a strong inducer of IL-12 production from human monocytes. In experiment 2, major receptor for ssRNA of E. faecalis EC-12 was identified using THP-1 cells, a human monocytic cell line. The type of RNA molecules of E. faecalis EC-12 responsible for IL-12 induction was also identified. IL-12 production induced by the total RNA of E. faecalis EC-12 was significantly reduced by the treatment of siRNA for TLR8 but not for TLR7. Furthermore, both 23S and 16S rRNA, but not mRNA, of E. faecalis EC-12 markedly induced IL-12 production from THP-1 cells. These results suggested that the recognition of ssRNA of E. faecalis EC-12 was mediated by TLR8 and that rRNA was the RNA molecule that exhibited IL-12-inducing ability in human cells. PMID:26083838

  8. Intranasal coadministration of live lactococci producing interleukin-12 and a major cow's milk allergen inhibits allergic reaction in mice.

    PubMed

    Cortes-Perez, Naima G; Ah-Leung, Sandrine; Bermúdez-Humarán, Luis G; Corthier, Gérard; Wal, Jean-Michel; Langella, Philippe; Adel-Patient, Karine

    2007-03-01

    The Th1/Th2 balance deregulation toward a Th2 immune response plays a central role in allergy. We previously demonstrated that administration of recombinant Lactococcus lactis strains expressing bovine beta-lactoglobulin (BLG), a major cow's milk allergen, partially prevents mice from sensitization. In the present study, we aimed to improve this preventive effect by coadministration of L. lactis BLG and a second recombinant L. lactis strain producing biologically active interleukin-12 (IL-12). This L. lactis strain producing IL-12 was previously used to enhance the Th1 immune response in a tumoral murine model (L. G. Bermúdez-Humarán et al., J. Immunol. 175:7297-7302, 2005). A comparison of the administration of either BLG alone or BLG in the presence of IL-12 was conducted. A BLG-specific primary Th1 immune response was observed only after intranasal coadministration of both L. lactis BLG and IL-12-producing L. lactis, as demonstrated by the induction of serum-specific immunoglobulin G2a (IgG2a) concomitant with gamma interferon secretion by splenocytes, confirming the adjuvanticity of IL-12-producing L. lactis. Immunized mice were further sensitized by intraperitoneal administration of purified BLG, and the allergic reaction was elicited by intranasal challenge with purified BLG. Mice pretreated with BLG in either the presence or the absence of IL-12 were rendered completely tolerant to further allergic sensitization and elicitation. Pretreatment with either L. lactis BLG or L. lactis BLG and IL-12-producing L. lactis induces specific anti-BLG IgG2a production in serum and bronchoalveolar lavage (BAL) fluid. Although specific serum IgE was not affected by these pretreatments, the levels of eosinophilia and IL-5 secretion in BAL fluid were significantly reduced after BLG challenge in the groups pretreated with L. lactis BLG and L. lactis BLG-IL-12-producing L. lactis, demonstrating a decreased allergic reaction. Our data demonstrate for the first time (i) the

  9. Interleukin-12B gene polymorphism frequencies in Egyptians and sex-related susceptibility to hepatitis C infection.

    PubMed

    Youssef, Samar Samir; Abd El Aal, Asmaa Mostafa; Nasr, Amal Soliman; el Zanaty, Taher; Seif, Sameh Mohamed

    2013-08-01

    Hepatitis C virus (HCV) infection is a major health problem worldwide. Egypt is the country with the highest HCV infection epidemic in the world. Interleukin (IL)-12 is a cytokine that has been shown to have a potent role as an antiviral cytokine. IL-12 is a heterodimer of the polypeptides p35 and p40. IL-12 B, the gene encoding IL-12 p40, is polymorphic, and a functional single-nucleotide polymorphism (SNP) of the 3'-untranslated region at position rs3212227 was associated with apparent resistance to HCV. The genotype distribution of this polymorphism differs by race. This study is sought to identify the genotype distribution of the IL-12 SNP rs3212227 polymorphism in Egyptians and to assess its role in susceptibility to chronic HCV infection alone or in a sex-dependent way. The study included 238 subjects: 100 healthy controls and 138 patients with HCV infection. The IL-12 SNP rs3212227 was genotyped by the polymerase chain reaction-restriction fragment length polymorphism method (PCR-RFLP). Results showed a genotype frequency of 46%, 39%, and 15% for AA, AC, and CC IL-12 genotypes, respectively. No significant result (P=0.5) was shown in the differential distribution of the IL-12 SNP genotypes between controls and patients with HCV infection. Nonetheless, this difference in the IL-12 genotype distribution was significant (0.005) when it was stratified according to sex; moreover, the C allele distribution in men and women differed with a statistically high significance (P=0.0001) in controls versus HCV patients. In conclusion, the IL-12 SNP rs3212227 polymorphism confers a susceptibility to HCV infection in a sex-dependent way in Egyptians.

  10. Moxibustion inhibits interleukin-12 and tumor necrosis factor alpha and modulates intestinal flora in rat with ulcerative colitis

    PubMed Central

    Wang, Xiao-Mei; Lu, Yuan; Wu, Lu-Yi; Yu, Shu-Guang; Zhao, Bai-Xiao; Hu, Hong-Yi; Wu, Huan-Gan; Bao, Chun-Hui; Liu, Hui-Rong; Wang, Jin-Hai; Yao, Yi; Hua, Xue-Gui; Guo, Hui-Ying; Shen, Li-Rong

    2012-01-01

    AIM: To investigate the effect of moxibustion on intestinal flora and release of interleukin-12 (IL-12) and tumor necrosis factor-α (TNF-α) from the colon in rat with ulcerative colitis (UC). METHODS: A rat model of UC was established by local stimulation of the intestine with supernatant from colonic contents harvested from human UC patients. A total of 40 male Sprague-Dawley rats were randomly divided into the following groups: normal (sham), model (UC), herb-partition moxibustion (HPM-treated), and positive control sulfasalazine (SA-treated). Rats treated with HPM received HPM at acupuncture points ST25 and RN6, once a day for 15 min, for a total of 8 d. Rats in the SA group were perfused with SA twice a day for 8 d. The colonic histopathology was observed by hematoxylin-eosin. The levels of intestinal flora, including Bifidobacterium, Lactobacillus, Escherichia coli (E. coli), and Bacteroides fragilis (B. fragilis), were tested by real-time quantitative polymerase chain reaction to detect bacterial 16S rRNA/DNA in order to determine DNA copy numbers of each specific species. Immunohistochemical assays were used to observe the expression of TNF-α and IL-12 in the rat colons. RESULTS: HPM treatment inhibited immunopathology in colonic tissues of UC rats; the general morphological score and the immunopathological score were significantly decreased in the HPM and SA groups compared with the model group [3.5 (2.0-4.0), 3.0 (1.5-3.5) vs 6.0 (5.5-7.0), P < 0.05 for the general morphological score, and 3.00 (2.00-3.50), 3.00 (2.50-3.50) vs 5.00 (4.50-5.50), P < 0.01 for the immunopathological score]. As measured by DNA copy number, we found that Bifidobacterium and Lactobacillus, which are associated with a healthy colon, were significantly higher in the HPM and SA groups than in the model group (1.395 ± 1.339, 1.461 ± 1.152 vs 0.045 ± 0.036, P < 0.01 for Bifidobacterium, and 0.395 ± 0.325, 0.851 ± 0.651 vs 0.0015 ± 0.0014, P < 0.01 for Lactobacillus). On the

  11. Cetuximab therapy in head and neck cancer: immune modulation with interleukin-12 and other natural killer cell-activating cytokines.

    PubMed

    Luedke, Eric; Jaime-Ramirez, Alena Cristina; Bhave, Neela; Roda, Julie; Choudhary, Moaz Maqbool; Kumar, Bhavna; Teknos, Theodoros N; Carson, William E

    2012-09-01

    Squamous cell carcinoma of the head and neck (SCCHN) is the sixth most common cancer worldwide. Greater than 90% of SCCHN of the oropharynx overexpress the epidermal growth factor receptor (EGFR or HER1). Cetuximab (Erbitux-TM) is a humanized anti-HER1 monoclonal antibody (mAb) that binds to HER1 overexpressing tumor cells. Cetuximab has a direct effect on HER1-positive cancer cells, but it also can activate immune cells that bear receptors for the Fc (constant portion) of IgG such as natural killer (NK) cells. NK cells have an activating Fc receptor for IgG (FcγRIIIa), which mediates Ab dependent cellular cytotoxicity (ADCC) and enhances production of interferon-γ (IFN-γ) in response to Ab-coated targets. Interleukin-12 (IL-12) is a cytokine produced by antigen-presenting cells that stimulates IFN-γ production from NK cells. We hypothesized that IL-12 would enhance the anti-tumor activity of cetuximab by activating the FcR effector mechanisms of NK cells. Expression of HER1 was measured on human papilloma virus (HPV)-positive (UD-SCC2, UM-SCC47) and HPV-negative (Cal27, UM-SCC74B) SCCHN cell lines by immunoblot analysis and flow cytometry. NK cells from normal donors were treated overnight with IL-2 (100 U), IL-12, IL-15, or IL-21 (all 10 ng/mL) and tested for ADCC versus cetuximab-coated cancer cells in a 4 hr (51)Cr assay. Release of cytokines by NK cells in response to cetuximab-coated cells was measured by ELISA. Phosphorylation of the ERK transcription factor in NK cells was measured by flow cytometry. The efficacy of combination therapy with cetuximab plus IL-12 was evaluated in a murine tumor model of head and neck cancer. All cell lines showed >99% expression of HER1 by flow cytometry and immunoblot analysis except UM-SCC74B (73%). Normal NK cells mediated 49.4% lysis of cetuximab-coated SCCHN cell lines as compared to 7.6% lysis of cells treated with control IgG (P = .0002). NK cell lysis of cetuximab-coated SCCHN cells was markedly enhanced by 12 hr

  12. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti

    PubMed Central

    Zhang, Hongwei; Dong, Shengzhang; Chen, Xi; Stanley, David; Beerntsen, Brenda; Feng, Qili; Song, Qisheng

    2017-01-01

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs α and burs β), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. Here, we investigated the hypothesis that bursicon homodimers act in prophylactic immunity in insects, and possibly arthropods, generally, using the mosquito, Aedes aegypti. We found that burs α and burs β are expressed in larvae, pupae and newly emerged adults. Treating newly emerged Ae. aegypti and D. melanogaster adults with recombinant bursicon (r-bursicon) heterodimer led to cuticle tanning in both species. Treating larvae and adults with r-bursicon homodimers led to up-regulation of five anti-microbial peptide (AMP) genes, noting the possibility that bursicon heterodimers also lead to up-regulation of these genes can not been excluded. The induced AMPs effectively suppressed the growth of bacteria in vitro. RNAi knock-down of the transcriptional factor Relish2 abolished the influence of r-bursicon homodimers on AMP production. We infer the bursicon homodimers induce expression of AMP genes via Relish2 in Ae. aegypti, as prophylactic immunity to protect mosquitoes during the vulnerable stages of each molt. PMID:28225068

  13. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti.

    PubMed

    Zhang, Hongwei; Dong, Shengzhang; Chen, Xi; Stanley, David; Beerntsen, Brenda; Feng, Qili; Song, Qisheng

    2017-02-22

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs α and burs β), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. Here, we investigated the hypothesis that bursicon homodimers act in prophylactic immunity in insects, and possibly arthropods, generally, using the mosquito, Aedes aegypti. We found that burs α and burs β are expressed in larvae, pupae and newly emerged adults. Treating newly emerged Ae. aegypti and D. melanogaster adults with recombinant bursicon (r-bursicon) heterodimer led to cuticle tanning in both species. Treating larvae and adults with r-bursicon homodimers led to up-regulation of five anti-microbial peptide (AMP) genes, noting the possibility that bursicon heterodimers also lead to up-regulation of these genes can not been excluded. The induced AMPs effectively suppressed the growth of bacteria in vitro. RNAi knock-down of the transcriptional factor Relish2 abolished the influence of r-bursicon homodimers on AMP production. We infer the bursicon homodimers induce expression of AMP genes via Relish2 in Ae. aegypti, as prophylactic immunity to protect mosquitoes during the vulnerable stages of each molt.

  14. Nicotinamidase/pyrazinamidase of Mycobacterium tuberculosis forms homo-dimers stabilized by disulfide bonds

    PubMed Central

    Rueda, Daniel; Sheen, Patricia; Gilman, Robert H.; Bueno, Carlos; Santos, Marco; Pando-Robles, Victoria; Batista, Cesar V.; Zimic, Mirko

    2014-01-01

    Recombinant wild-pyrazinamidase from H37Rv M. tuberculosis was analyzed by gel electrophoresis under differential reducing conditions to evaluate its quaternary structure. PZAse was fractionated by size exclusion chromatography under non-reducing conditions. PZAse activity was measured and mass spectrometry analysis was performed to determine the identity of proteins by de novo sequencing and to determine the presence of disulfide bonds. This study confirmed that M. tuberculosis wild type PZAse was able to form homo-dimers in vitro. Homo-dimers showed a slightly lower specific PZAse activity compared to monomeric PZAse. PZAse dimers were dissociated into monomers in response to reducing conditions. Mass spectrometry analysis confirmed the existence of disulfide bonds (C72-C138 and C138-C138) stabilizing the quaternary structure of the PZAse homo-dimer. PMID:25199451

  15. Effects of the Japanese Herbal Medicine “Sho-saiko-to” (TJ-9) on Interleukin-12 Production in Patients with HCV-Positive Liver Cirrhosis

    PubMed Central

    Nishimura, Akira; Huang, Xian-Xi; Nobori, Tsutomu; Sakaguchi, Seigo; Suzuki, Hiroyuki

    1999-01-01

    Interleukin-12 (IL-12) is an important cytokine for maintainence of normal systemic defense and bioregulation. The Japanese herbal medicine Sho-saiko-to (TJ-9) has been administered to 1.5 million Japanese patients with chronic liver diseases. TJ-9 is known to significantly suppress cancer development in the liver and has macrobiotic effects. In the present study, we examined the in vitro production of IL-12 by circulating mononuclear cells from liver cirrhosis patients and the effects of TJ-9 on IL-12 production. The monocyte/macrophage fraction and the lymphocyte fraction of peripheral blood were obtained from 11 HCV-positive liver cirrhosis patients and 12 healthy subjects. Interleukin-12 levels in the supernatants were measured using ELISA kits. The levels of IL-12 produced by the patients fractions were significantly lower than those produced by healthy subjects (p < 0.01, p < 0.05). However, when TJ-9 was added to the cultures, the IL-12 production levels in both cell fractions increased approximately three fold, and the levels from the monocyte/macrophage fraction were almost the same as those from healthy subjects. This effect of TJ-9 was attributable to two of its seven herb components, that is, scutellaria root and glycyrrhiza root. One possible mechanism for the macrobiotic effects of TJ-9 on liver cirrhosis patients may be the improvement in IL-12 production. PMID:10636475

  16. Brucella abortus as a potential vaccine candidate: induction of interleukin-12 secretion and enhanced B7.1 and B7.2 and intercellular adhesion molecule 1 surface expression in elutriated human monocytes stimulated by heat-inactivated B. abortus.

    PubMed

    Zaitseva, M; Golding, H; Manischewitz, J; Webb, D; Golding, B

    1996-08-01

    Development of a vaccine which is capable of generating a strong cellular immune response associated with gamma interferon (IFN-gamma) production and cytotoxic T-cell development requires that the immunogen be capable of inducing the secretion of interleukin-12 (IL-12), which is a pivotal factor for the differentiation of Th1 or Tc1 cells. We have previously shown that the heat-inactivated gram-negative bacterium Brucella abortus can induce IFN-gamma secretion by T cells. In the present study, we demonstrate that B. abortus and lipopolysaccharide (LPS) from B. abortus can induce IL-12 p40 mRNA expression and protein secretion by human elutriated monocytes (99% pure). p40 mRNA was detected within 4 h, and p40 protein could be measured at 24 h. This induction was abrogated by anti-CD14 monoclonal antibody, suggesting that monocytes recognize B. abortus via their receptor for LPS. The biological activity of IL-12 secreted by B. abortus-stimulated monocytes was demonstrated by its ability to upregulate IFN-gamma mRNA expression in T cells separated from monocytes and B. abortus by a transwell membrane. The B. abortus-induced IL-12 also enhanced NK cytolytic activity against K562 target cells. B. abortus was shown to rapidly increase the expression of the costimulatory molecules B7.1 and B7.2 and intercellular adhesion molecule 1 on human monocytes. Together, these data indicate that B. abortus can directly activate human monocytes and provide the cytokine milieu which would direct the immune response towards Th1-Tc1 differentiation.

  17. Brucella abortus as a potential vaccine candidate: induction of interleukin-12 secretion and enhanced B7.1 and B7.2 and intercellular adhesion molecule 1 surface expression in elutriated human monocytes stimulated by heat-inactivated B. abortus.

    PubMed Central

    Zaitseva, M; Golding, H; Manischewitz, J; Webb, D; Golding, B

    1996-01-01

    Development of a vaccine which is capable of generating a strong cellular immune response associated with gamma interferon (IFN-gamma) production and cytotoxic T-cell development requires that the immunogen be capable of inducing the secretion of interleukin-12 (IL-12), which is a pivotal factor for the differentiation of Th1 or Tc1 cells. We have previously shown that the heat-inactivated gram-negative bacterium Brucella abortus can induce IFN-gamma secretion by T cells. In the present study, we demonstrate that B. abortus and lipopolysaccharide (LPS) from B. abortus can induce IL-12 p40 mRNA expression and protein secretion by human elutriated monocytes (99% pure). p40 mRNA was detected within 4 h, and p40 protein could be measured at 24 h. This induction was abrogated by anti-CD14 monoclonal antibody, suggesting that monocytes recognize B. abortus via their receptor for LPS. The biological activity of IL-12 secreted by B. abortus-stimulated monocytes was demonstrated by its ability to upregulate IFN-gamma mRNA expression in T cells separated from monocytes and B. abortus by a transwell membrane. The B. abortus-induced IL-12 also enhanced NK cytolytic activity against K562 target cells. B. abortus was shown to rapidly increase the expression of the costimulatory molecules B7.1 and B7.2 and intercellular adhesion molecule 1 on human monocytes. Together, these data indicate that B. abortus can directly activate human monocytes and provide the cytokine milieu which would direct the immune response towards Th1-Tc1 differentiation. PMID:8757841

  18. A Set of Computationally Designed Orthogonal Antiparallel Homodimers that Expands the Synthetic Coiled-Coil Toolkit

    PubMed Central

    2015-01-01

    Molecular engineering of protein assemblies, including the fabrication of nanostructures and synthetic signaling pathways, relies on the availability of modular parts that can be combined to give different structures and functions. Currently, a limited number of well-characterized protein interaction components are available. Coiled-coil interaction modules have been demonstrated to be useful for biomolecular design, and many parallel homodimers and heterodimers are available in the coiled-coil toolkit. In this work, we sought to design a set of orthogonal antiparallel homodimeric coiled coils using a computational approach. There are very few antiparallel homodimers described in the literature, and none have been measured for cross-reactivity. We tested the ability of the distance-dependent statistical potential DFIRE to predict orientation preferences for coiled-coil dimers of known structure. The DFIRE model was then combined with the CLASSY multistate protein design framework to engineer sets of three orthogonal antiparallel homodimeric coiled coils. Experimental measurements confirmed the successful design of three peptides that preferentially formed antiparallel homodimers that, furthermore, did not interact with one additional previously reported antiparallel homodimer. Two designed peptides that formed higher-order structures suggest how future design protocols could be improved. The successful designs represent a significant expansion of the existing protein-interaction toolbox for molecular engineers. PMID:25337788

  19. Relish2 mediates bursicon homodimer-induced prophylactic immunity in the mosquito Aedes aegypti

    USDA-ARS?s Scientific Manuscript database

    Bursicon is a neuropeptide hormone consisting of two cystine-knot proteins (burs a and burs ß), responsible for cuticle tanning and other developmental processes in insects. Recent studies show that each bursicon subunit forms homodimers that induce prophylactic immunity in Drosophila melanogaster. ...

  20. Excited states of proton-bound DNA/RNA base homodimers: pyrimidines.

    PubMed

    Féraud, Géraldine; Berdakin, Matias; Dedonder, Claude; Jouvet, Christophe; Pino, Gustavo A

    2015-02-12

    We are presenting the electronic photofragment spectra of the protonated pyrimidine DNA base homodimers. Only the thymine dimer exhibits a well structured vibrational progression, while the protonated monomer shows broad vibrational bands. This shows that proton bonding can block some nonradiative processes present in the monomer.

  1. Phosphorylated Nuclear Receptor CAR Forms a Homodimer To Repress Its Constitutive Activity for Ligand Activation.

    PubMed

    Shizu, Ryota; Osabe, Makoto; Perera, Lalith; Moore, Rick; Sueyoshi, Tatsuya; Negishi, Masahiko

    2017-05-15

    The nuclear receptor CAR (NR1I3) regulates hepatic drug and energy metabolism as well as cell fate. Its activation can be a critical factor in drug-induced toxicity and the development of diseases, including diabetes and tumors. CAR inactivates its constitutive activity by phosphorylation at threonine 38. Utilizing receptor for protein kinase 1 (RACK1) as the regulatory subunit, protein phosphatase 2A (PP2A) dephosphorylates threonine 38 to activate CAR. Here we demonstrate that CAR undergoes homodimer-monomer conversion to regulate this dephosphorylation. By coexpression of two differently tagged CAR proteins in Huh-7 cells, mouse primary hepatocytes, and mouse livers, coimmunoprecipitation and two-dimensional gel electrophoresis revealed that CAR can form a homodimer in a configuration in which the PP2A/RACK1 binding site is buried within its dimer interface. Epidermal growth factor (EGF) was found to stimulate CAR homodimerization, thus constraining CAR in its inactive form. The agonistic ligand CITCO binds directly to the CAR homodimer and dissociates phosphorylated CAR into its monomers, exposing the PP2A/RACK1 binding site for dephosphorylation. Phenobarbital, which is not a CAR ligand, binds the EGF receptor, reversing the EGF signal to monomerize CAR for its indirect activation. Thus, the homodimer-monomer conversion is the underlying molecular mechanism that regulates CAR activation, by placing phosphorylated threonine 38 as the common target for both direct and indirect activation of CAR. Copyright © 2017 American Society for Microbiology.

  2. Structures of the Yeast Ribonucleotide Reductase Rnr2 and Rnr4 Homodimers

    SciTech Connect

    Sommerhalter, M.; Voegtli, W.C.; Perlstein, D.L.; Ge, J.; Stubbe, J.; Rosenzweig, A.C.

    2010-03-08

    Class I ribonucleotide reductases (RNRs) catalyze the reduction of ribonucleotides to deoxyribonucleotides. Eukaryotic RNRs comprise two subunits, the R1 subunit, which contains substrate and allosteric effector binding sites, and the R2 subunit, which houses a catalytically essential diiron-tyrosyl radical cofactor. In Saccharomyces cerevisiae, there are two variants of the R2 subunit, called Rnr2 and Rnr4. Rnr4 is unique in that it lacks three iron-binding residues conserved in all other R2s. Nevertheless, Rnr4 is required to activate Rnr2, and the functional species in vivo is believed to be a heterodimeric complex between the two proteins. The crystal structures of the Rnr2 and Rnr4 homodimers have been determined and are compared to that of the heterodimer. The homodimers are very similar to the heterodimer and to mouse R2 in overall fold, but there are several key differences. In the Rnr2 homodimer, one of the iron-binding helices, helix {alpha}B, is not well-ordered. In the heterodimer, interactions with a loop region connecting Rnr4 helices {alpha}A and {alpha}3 stabilize this Rnr2 helix, which donates iron ligand Asp 145. Sequence differences between Rnr2 and Rnr4 prevent the same interactions from occurring in the Rnr2 homodimer. These findings provide a structural rationale for why the heterodimer is the preferred complex in vivo. The active-site region in the Rnr4 homodimer reveals interactions not apparent in the heterodimer, supporting previous conclusions that this subunit does not bind iron. When taken together, these results support a model in which Rnr4 stabilizes Rnr2 for cofactor assembly and activity.

  3. The antibody-based delivery of interleukin-12 to the tumor neovasculature eradicates murine models of cancer in combination with paclitaxel.

    PubMed

    Pasche, Nadine; Wulhfard, Sarah; Pretto, Francesca; Carugati, Elisa; Neri, Dario

    2012-08-01

    Interleukin-12 (IL12) is a potent proinflammatory cytokine with antitumor activity. Its heterodimeric nature makes it compatible with a large variety of different immunocytokine formats. Here we report the design, production, and characterization of a novel immunocytokine, based on the fusion of the F8 antibody (specific to the alternatively spliced EDA domain of fibronectin, a marker of tumor neovasculature) with IL12 (termed IL12-F8-F8). We developed a novel immunocytokine based on the sequential fusion of interleukin-12 as a single polypeptide with two F8 antibodies in single-chain Fv (scFv) format. The fusion protein was characterized in vitro, and its targeting performance was assessed in vivo. The immunocytokine antitumor activity was studied as monotherapy as well as in combination therapies in three different murine tumor models. Moreover, depletion experiments and tumor analysis revealed a dominant role of natural killer cells for the mechanism of action. IL12-F8-F8 can be produced in mammalian cells, yielding a product of good pharmaceutical quality, capable of selective localization on the tumor neovasculature in vivo, as judged by quantitative biodistribution analysis with radioiodinated protein preparations. The protein potently inhibited tumor growth in three different immunocompetent syngeneic models of cancer. The treatment was generally well tolerated. Moreover, the IL12-F8-F8 fusion protein could be produced both with murine IL12 (mIL12) and with human IL12 (hIL12). The potent antitumor activity of mIL12-F8-F8, studied alone or in combination with paclitaxel in different tumor models, paves the way to the clinical development of the fully human immunocytokine.

  4. From Homodimer to Heterodimer and Back: Elucidating the TonB Energy Transduction Cycle.

    PubMed

    Gresock, Michael G; Kastead, Kyle A; Postle, Kathleen

    2015-11-01

    The TonB system actively transports large, scarce, and important nutrients through outer membrane (OM) transporters of Gram-negative bacteria using the proton gradient of the cytoplasmic membrane (CM). In Escherichia coli, the CM proteins ExbB and ExbD harness and transfer proton motive force energy to the CM protein TonB, which spans the periplasmic space and cyclically binds OM transporters. TonB has two activity domains: the amino-terminal transmembrane domain with residue H20 and the periplasmic carboxy terminus, through which it binds to OM transporters. TonB is inactivated by all substitutions at residue H20 except H20N. Here, we show that while TonB trapped as a homodimer through its amino-terminal domain retained full activity, trapping TonB through its carboxy terminus inactivated it by preventing conformational changes needed for interaction with OM transporters. Surprisingly, inactive TonB H20A had little effect on homodimerization through the amino terminus and instead decreased TonB carboxy-terminal homodimer formation prior to reinitiation of an energy transduction cycle. That result suggested that the TonB carboxy terminus ultimately interacts with OM transporters as a monomer. Our findings also suggested the existence of a separate equimolar pool of ExbD homodimers that are not in contact with TonB. A model is proposed where interaction of TonB homodimers with ExbD homodimers initiates the energy transduction cycle, and, ultimately, the ExbD carboxy terminus modulates interactions of a monomeric TonB carboxy terminus with OM transporters. After TonB exchanges its interaction with ExbD for interaction with a transporter, ExbD homodimers undergo a separate cycle needed to re-energize them. Canonical mechanisms of active transport across cytoplasmic membranes employ ion gradients or hydrolysis of ATP for energy. Gram-negative bacterial outer membranes lack these resources. The TonB system embodies a novel means of active transport across the outer

  5. From Homodimer to Heterodimer and Back: Elucidating the TonB Energy Transduction Cycle

    PubMed Central

    Gresock, Michael G.; Kastead, Kyle A.

    2015-01-01

    ABSTRACT The TonB system actively transports large, scarce, and important nutrients through outer membrane (OM) transporters of Gram-negative bacteria using the proton gradient of the cytoplasmic membrane (CM). In Escherichia coli, the CM proteins ExbB and ExbD harness and transfer proton motive force energy to the CM protein TonB, which spans the periplasmic space and cyclically binds OM transporters. TonB has two activity domains: the amino-terminal transmembrane domain with residue H20 and the periplasmic carboxy terminus, through which it binds to OM transporters. TonB is inactivated by all substitutions at residue H20 except H20N. Here, we show that while TonB trapped as a homodimer through its amino-terminal domain retained full activity, trapping TonB through its carboxy terminus inactivated it by preventing conformational changes needed for interaction with OM transporters. Surprisingly, inactive TonB H20A had little effect on homodimerization through the amino terminus and instead decreased TonB carboxy-terminal homodimer formation prior to reinitiation of an energy transduction cycle. That result suggested that the TonB carboxy terminus ultimately interacts with OM transporters as a monomer. Our findings also suggested the existence of a separate equimolar pool of ExbD homodimers that are not in contact with TonB. A model is proposed where interaction of TonB homodimers with ExbD homodimers initiates the energy transduction cycle, and, ultimately, the ExbD carboxy terminus modulates interactions of a monomeric TonB carboxy terminus with OM transporters. After TonB exchanges its interaction with ExbD for interaction with a transporter, ExbD homodimers undergo a separate cycle needed to re-energize them. IMPORTANCE Canonical mechanisms of active transport across cytoplasmic membranes employ ion gradients or hydrolysis of ATP for energy. Gram-negative bacterial outer membranes lack these resources. The TonB system embodies a novel means of active transport

  6. Encapsulation and Characterization of Proton-Bound Amine Homodimers in a Water Soluble, Self-Assembled Supramolecular Host

    SciTech Connect

    Pluth, Michael; Fiedler, Dorothea; Mugridge, Jeffrey; Bergman, Robert; Raymond, Kenneth

    2008-10-01

    Cyclic amines can be encapsulated in a water-soluble self-assembled supramolecular host upon protonation. The hydrogen bonding ability of the cyclic amines, as well as the reduced degrees of rotational freedom, allows for the formation of proton-bound homodimers inside of the assembly which are otherwise not observable in aqueous solution. The generality of homodimer formation was explored with small N-alkyl aziridines, azetidines, pyrrolidines and piperidines. Proton-bound homodimer formation is observed for N-alkylaziridines (R = methyl, isopropyl, tert-butyl), N-alkylazetidines (R = isopropyl, tertbutyl), and N-methylpyrrolidine. At high concentration, formation of a proton-bound homotrimer is observed in the case of N-methylaziridine. The homodimers stay intact inside the assembly over a large concentration range, thereby suggesting cooperative encapsulation. Both G3(MP2)B3 and G3B3 calculations of the proton-bound homodimers were used to investigate the enthalpy of the hydrogen bond in the proton-bound homodimers and suggest that the enthalpic gain upon formation of the proton-bound homodimers may drive guest encapsulation.

  7. Modulation of the FGF14:FGF14 homodimer interaction through short peptide fragments

    PubMed Central

    Ali, Syed; Shavkunov, Alexander; Panova, Neli; Stoilova-McPhie, Svetla; Laezza, Fernanda

    2016-01-01

    Fibroblast growth factor 14 (FGF14) is a member of the intracellular FGF (iFGFs) family and a functionally relevant component of the neuronal voltage-gated Na+ (Nav) channel complex. Through a monomeric interaction with the intracellular C-terminus of neuronal Nav channels, FGF14 modulates Na+ currents in an Nav isoform-specific manner serving as a fine-tuning regulator of excitability. Previous studies based on the highly homologous FGF13 homodimer crystal structure have proposed a conserved protein:protein interaction (PPI) interface common to both Nav channel binding and iFGF homodimer formation. This interface could provide a novel target for drug design against neuronal Nav channels. Here, we provide the first in-cell reconstitution of the FGF14:FGF14 protein complex and measure the dimer interaction using the split-luciferase complementation assay (LCA). Based on the FGF14 dimer structure generated in silico, we designed short peptide fragments against the FGF14 dimer interface. One of these fragments, FLPK aligns with the pocket defined by the β12-strand and β8-β9 loop, reducing the FGF14:FGF14 dimer interaction by 25% as measured by LCA. We further compared the relative interaction strength of FGF14 wild type homodimers with FGF14 hetero- and homodimers carrying double N mutations at the Y153 and V155 residues, located at the β8-β9 loop. The Y153N/V155N double mutation counteracts the FLPK effect by increasing the strength of the dimer interaction. These data suggest that the β12 strand of FGF14 might serve as scaffold for drug design against neuronal FGF14 dimers and Nav channels. PMID:25426956

  8. HorC, a hop-resistance related protein, presumably functions in homodimer form.

    PubMed

    Iijima, Kazumaru; Suzuki, Koji; Asano, Shizuka; Ogata, Tomoo; Kitagawa, Yasushi

    2009-08-01

    To determine whether two HorC molecules coordinately form a single unit, the functional properties of covalently linked dimers of HorC encoded by tandemly fused horC genes were studied. Lactobacillus brevis introduced with the fused horC genes and a single horC gene exhibited same degree of resistance to hop compounds and cetyltrimethylammonium bromide. This suggests that HorC functions as a homodimer.

  9. Organization of the mitochondrial apoptotic BAK pore: oligomerization of the BAK homodimers.

    PubMed

    Aluvila, Sreevidya; Mandal, Tirtha; Hustedt, Eric; Fajer, Peter; Choe, Jun Yong; Oh, Kyoung Joon

    2014-01-31

    The multidomain pro-apoptotic Bcl-2 family proteins BAK and BAX are believed to form large oligomeric pores in the mitochondrial outer membrane during apoptosis. Formation of these pores results in the release of apoptotic factors including cytochrome c from the intermembrane space into the cytoplasm, where they initiate the cascade of events that lead to cell death. Using the site-directed spin labeling method of electron paramagnetic resonance (EPR) spectroscopy, we have determined the conformational changes that occur in BAK when the protein targets to the membrane and forms pores. The data showed that helices α1 and α6 disengage from the rest of the domain, leaving helices α2-α5 as a folded unit. Helices α2-α5 were shown to form a dimeric structure, which is structurally homologous to the recently reported BAX "BH3-in-groove homodimer." Furthermore, the EPR data and a chemical cross-linking study demonstrated the existence of a hitherto unknown interface between BAK BH3-in-groove homodimers in the oligomeric BAK. This novel interface involves the C termini of α3 and α5 helices. The results provide further insights into the organization of the BAK oligomeric pores by the BAK homodimers during mitochondrial apoptosis, enabling the proposal of a BAK-induced lipidic pore with the topography of a "worm hole."

  10. α-Catenin homodimers are recruited to phosphoinositide-activated membranes to promote adhesion.

    PubMed

    Wood, Megan N; Ishiyama, Noboru; Singaram, Indira; Chung, Connie M; Flozak, Annette S; Yemelyanov, Alex; Ikura, Mitsu; Cho, Wonhwa; Gottardi, Cara J

    2017-09-05

    A unique feature of α-catenin localized outside the cadherin-catenin complex is its capacity to form homodimers, but the subcellular localization and functions of this form of α-catenin remain incompletely understood. We identified a cadherin-free form of α-catenin that is recruited to the leading edge of migrating cells in a phosphatidylinositol 3-kinase-dependent manner. Surface plasmon resonance analysis shows that α-catenin homodimers, but not monomers, selectively bind phosphatidylinositol-3,4,5-trisphosphate-containing lipid vesicles with high affinity, where three basic residues, K488, K493, and R496, contribute to binding. Chemical-induced dimerization of α-catenin containing a synthetic dimerization domain promotes its accumulation within lamellipodia and elaboration of protrusions with extended filopodia, which are attenuated in the α-catenin(KKR<3A) mutant. Cells restored with a full-length, natively homodimerizing form of α-catenin(KKR<3A) display reduced membrane recruitment, altered epithelial sheet migrations, and weaker cell-cell adhesion compared with WT α-catenin. These findings show that α-catenin homodimers are recruited to phosphoinositide-activated membranes to promote adhesion and migration, suggesting that phosphoinositide binding may be a defining feature of α-catenin function outside the cadherin-catenin complex. © 2017 Wood et al.

  11. Assembly of Bak homodimers into higher order homooligomers in the mitochondrial apoptotic pore

    PubMed Central

    Mandal, Tirtha; Shin, Seungjin; Aluvila, Sreevidya; Chen, Hui-Chen; Grieve, Carter; Choe, Jun-Yong; Cheng, Emily H.; Hustedt, Eric J.; Oh, Kyoung Joon

    2016-01-01

    In mitochondrial apoptosis, Bak is activated by death signals to form pores of unknown structure on the mitochondrial outer membrane via homooligomerization. Cytochrome c and other apoptotic factors are released from the intermembrane space through these pores, initiating downstream apoptosis events. Using chemical crosslinking and double electron electron resonance (DEER)-derived distance measurements between specific structural elements in Bak, here we clarify how the Bak pore is assembled. We propose that previously described BH3-in-groove homodimers (BGH) are juxtaposed via the ‘α3/α5’ interface, in which the C-termini of helices α3 and α5 are in close proximity between two neighboring Bak homodimers. This interface is observed concomitantly with the well-known ‘α6:α6’ interface. We also mapped the contacts between Bak homodimers and the lipid bilayer based on EPR spectroscopy topology studies. Our results suggest a model for the lipidic Bak pore, whereby the mitochondrial targeting C-terminal helix does not change topology to accommodate the lining of the pore lumen by BGH. PMID:27488021

  12. Rock bream (Oplegnathus fasciatus) IL-12p40: identification, expression, and effect on bacterial infection.

    PubMed

    Zhang, Lu; Zhang, Bao-Cun; Hu, Yong-Hua

    2014-08-01

    IL-12p40, also called IL-12β, is a subunit of the proinflammatory cytokines interleukin (IL)-12 and IL-23. In teleost, IL-12p40 homologues have been identified in several species, however, the biological function of fish IL-12p40 is essentially unknown. In this work, we reported the identification and analysis of an IL-12p40, OfIL-12p40, from rock bream (Oplegnathus fasciatus). OfIL-12p40 is composed of 361 amino acids and possesses a conserved IL-12p40 domain and a WSxWS signature motif characteristic of known IL-12p40. Constitutive expression of OfIL-12p40 occurred in multiple tissues and was highest in kidney. Experimental infection with bacterial pathogen upregulated the expression of OfIL-12p40 in kidney and spleen in a time-dependent manner. Purified recombinant OfIL-12p40 (rOfIL-12p40) stimulated the respiratory burst activity of peripheral blood leukocytes in a dose-dependent manner. rOfIL-12p40 also enhanced the resistance of rock bream against bacterial infection and upregulated the expression of innate immune genes in kidney. Taken together, these results indicate that OfIL-12p40 possesses cytokine-like property and plays a role in immune defense against bacterial infection.

  13. Cloning and characterization of an adenoviral vector for highly efficient and doxycycline-suppressible expression of bioactive human single-chain interleukin 12 in colon cancer.

    PubMed

    Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

    2007-06-26

    Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. VP16 transactivator-mediated and doxycycline-regulated expression

  14. Co-expression of interleukin 12 enhances antitumor effects of a novel chimeric promoter-mediated suicide gene therapy in an immunocompetent mouse model

    SciTech Connect

    Xu, Yu; Liu, Zhengchun; Kong, Haiyan; Sun, Wenjie; Liao, Zhengkai; Zhou, Fuxiang; Xie, Conghua; and others

    2011-09-09

    Highlights: {yields} A novel chimeric promoter consisting of CArG element and hTERT promoter was developed. {yields} The promoter was characterized with radiation-inducibility and tumor-specificity. {yields} Suicide gene system driven by the promoter showed remarkable cytotoxicity in vitro. {yields} Co-expression of IL12 enhanced the promoter mediated suicide gene therapy in vivo. -- Abstract: The human telomerase reverse transcriptase (hTERT) promoter has been widely used in target gene therapy of cancer. However, low transcriptional activity limited its clinical application. Here, we designed a novel dual radiation-inducible and tumor-specific promoter system consisting of CArG elements and the hTERT promoter, resulting in increased expression of reporter genes after gamma-irradiation. Therapeutic and side effects of adenovirus-mediated horseradish peroxidase (HRP)/indole-3-acetic (IAA) system downstream of the chimeric promoter were evaluated in mice bearing Lewis lung carcinoma, combining with or without adenovirus-mediated interleukin 12 (IL12) gene driven by the cytomegalovirus promoter. The combination treatment showed more effective suppression of tumor growth than those with single agent alone, being associated with pronounced intratumoral T-lymphocyte infiltration and minor side effects. Our results suggest that the combination treatment with HRP/IAA system driven by the novel chimeric promoter and the co-expression of IL12 might be an effective and safe target gene therapy strategy of cancer.

  15. Endotoxin free hyaluronan and hyaluronan fragments do not stimulate TNF-α, interleukin-12 or upregulate co-stimulatory molecules in dendritic cells or macrophages

    PubMed Central

    Dong, Yifei; Arif , Arif; Olsson, Mia; Cali, Valbona; Hardman, Blair; Dosanjh, Manisha; Lauer, Mark; Midura, Ronald J.; Hascall, Vincent C.; Brown, Kelly L.; Johnson, Pauline

    2016-01-01

    The extracellular matrix glycosaminoglycan, hyaluronan, has been described as a regulator of tissue inflammation, with hyaluronan fragments reported to stimulate innate immune cells. High molecular mass hyaluronan is normally present in tissues, but upon inflammation lower molecular mass fragments are generated. It is unclear if these hyaluronan fragments induce an inflammatory response or are a consequence of inflammation. In this study, mouse bone marrow derived macrophages and dendritic cells (DCs) were stimulated with various sizes of hyaluronan from different sources, fragmented hyaluronan, hyaluronidases and heavy chain modified-hyaluronan (HA-HC). Key pro-inflammatory molecules, tumour necrosis factor alpha, interleukin-1 beta, interleukin-12, CCL3, and the co-stimulatory molecules, CD40 and CD86 were measured. Only human umbilical cord hyaluronan, bovine testes and Streptomyces hyaluronlyticus hyaluronidase stimulated macrophages and DCs, however, these reagents were found to be contaminated with endotoxin, which was not fully removed by polymyxin B treatment. In contrast, pharmaceutical grade hyaluronan and hyaluronan fragments failed to stimulate in vitro-derived or ex vivo macrophages and DCs, and did not induce leukocyte recruitment after intratracheal instillation into mouse lungs. Hence, endotoxin-free pharmaceutical grade hyaluronan does not stimulate macrophages and DCs in our inflammatory models. These results emphasize the importance of ensuring hyaluronan preparations are endotoxin free. PMID:27869206

  16. Evaluation of a technetium-99m labeled bombesin homodimer for GRPR imaging in prostate cancer.

    PubMed

    Yu, Zilin; Carlucci, Giuseppe; Ananias, Hildo J K; Dierckx, Rudi A J O; Liu, Shuang; Helfrich, Wijnand; Wang, Fan; de Jong, Igle J; Elsinga, Philip H

    2013-02-01

    Multimerization of peptides can improve the binding characteristics of the tracer by increasing local ligand concentration and decreasing dissociation kinetics. In this study, a new bombesin homodimer was developed based on an ε-aminocaproic acid-bombesin(7-14) (Aca-bombesin(7-14)) fragment, which has been studied for targeting the gastrin-releasing peptide receptor (GRPR) in prostate cancer. The bombesin homodimer was conjugated to 6-hydrazinopyridine-3-carboxylic acid (HYNIC) and labeled with (99m)Tc for SPECT imaging. The in vitro binding affinity to GRPR, cell uptake, internalization and efflux kinetics of the radiolabeled bombesin dimer were investigated in the GRPR-expressing human prostate cancer cell line PC-3. Biodistribution and the GRPR-targeting potential were evaluated in PC-3 tumor-bearing athymic nude mice. When compared with the bombesin monomer, the binding affinity of the bombesin dimer is about ten times lower. However, the (99m)Tc labeled bombesin dimer showed a three times higher cellular uptake at 4 h after incubation, but similar internalization and efflux characters in vitro. Tumor uptake and in vivo pharmacokinetics in PC-3 tumor-bearing mice were comparable. The tumor was visible on the dynamic images in the first hour and could be clearly distinguished from non-targeted tissues on the static images after 4 h. The GRPR-targeting ability of the (99m)Tc labeled bombesin dimer was proven in vitro and in vivo. This bombesin homodimer provides a good starting point for further studies on enhancing the tumor targeting activity of bombesin multimers.

  17. Interferon-α and interleukin-12 are induced, respectively, by double-stranded DNA and single-stranded RNA in human myeloid dendritic cells

    PubMed Central

    Katashiba, Yuichi; Miyamoto, Rie; Hyo, Akira; Shimamoto, Keiko; Murakami, Naoko; Ogata, Makoto; Amakawa, Ryuichi; Inaba, Muneo; Nomura, Shosaku; Fukuhara, Shirou; Ito, Tomoki

    2011-01-01

    Dendritic cells (DCs) are initiators of innate immunity and acquired immunity as cells linking these two bio-defence systems through the production of cytokines such as interferon-α (IFN-α) and interleukin-12 (IL-12). Nucleic acids such as DNA from damaged cells or pathogens are important activators not only for anti-microbial innate immune responses but also in the pathogenesis of IFN-related autoimmune diseases. Plasmacytoid DCs are regarded as the main effectors for the DNA-mediated innate immunity by possessing DNA-sensing toll-like receptor 9 (TLR9). We here found that double-stranded DNA (dsDNA) complexed with lipotransfectants triggered activation of human monocyte-derived DCs (moDCs), leading to the preferential production of IFN-α but not IL-12. This indicates that myeloid DCs also function as supportive effectors against the invasion of pathogenic microbes through the DNA-mediated activation in innate immunity. The dsDNA with lipotransfectants can be taken up by moDCs without co-localization of endosomal LAMP1 staining, and the dsDNA-mediated IFN-α production was not impaired by chloroquine. These findings indicate that moDC activation by dsDNA does not involve the endosomal TLR pathway. In contrast, single-stranded RNA (ssRNA) stimulated moDCs to secrete IL-12 but not IFN-α. This process was inhibited by chloroquine, suggesting an involvement of the TLR pathway in ssRNA-mediated moDC activation. As might be inferred from our findings, myeloid DCs may function as a traffic control between innate immunity via IFN-α production and acquired immunity via IL-12 production, depending on the type of nucleic acids. Our results provide a new insight into the biological action of myeloid DCs underlying the DNA-mediated activation of protective or pathogenic immunity. PMID:20875078

  18. Interferon-α and interleukin-12 are induced, respectively, by double-stranded DNA and single-stranded RNA in human myeloid dendritic cells.

    PubMed

    Katashiba, Yuichi; Miyamoto, Rie; Hyo, Akira; Shimamoto, Keiko; Murakami, Naoko; Ogata, Makoto; Amakawa, Ryuichi; Inaba, Muneo; Nomura, Shosaku; Fukuhara, Shirou; Ito, Tomoki

    2011-02-01

    Dendritic cells (DCs) are initiators of innate immunity and acquired immunity as cells linking these two bio-defence systems through the production of cytokines such as interferon-α (IFN-α) and interleukin-12 (IL-12). Nucleic acids such as DNA from damaged cells or pathogens are important activators not only for anti-microbial innate immune responses but also in the pathogenesis of IFN-related autoimmune diseases. Plasmacytoid DCs are regarded as the main effectors for the DNA-mediated innate immunity by possessing DNA-sensing toll-like receptor 9 (TLR9). We here found that double-stranded DNA (dsDNA) complexed with lipotransfectants triggered activation of human monocyte-derived DCs (moDCs), leading to the preferential production of IFN-α but not IL-12. This indicates that myeloid DCs also function as supportive effectors against the invasion of pathogenic microbes through the DNA-mediated activation in innate immunity. The dsDNA with lipotransfectants can be taken up by moDCs without co-localization of endosomal LAMP1 staining, and the dsDNA-mediated IFN-α production was not impaired by chloroquine. These findings indicate that moDC activation by dsDNA does not involve the endosomal TLR pathway. In contrast, single-stranded RNA (ssRNA) stimulated moDCs to secrete IL-12 but not IFN-α. This process was inhibited by chloroquine, suggesting an involvement of the TLR pathway in ssRNA-mediated moDC activation. As might be inferred from our findings, myeloid DCs may function as a traffic control between innate immunity via IFN-α production and acquired immunity via IL-12 production, depending on the type of nucleic acids. Our results provide a new insight into the biological action of myeloid DCs underlying the DNA-mediated activation of protective or pathogenic immunity.

  19. High Interleukin-12 Levels May Prevent an Increase in the Amount of Fungi in the Gastrointestinal Tract during the First Years of Diabetes Mellitus Type 1

    PubMed Central

    Kowalewska, Beata; Szmigiero-Kawko, Małgorzata; Wąż, Piotr; Myśliwiec, Małgorzata

    2016-01-01

    The objective of the research was to investigate serum levels of interleukin-12 (IL12) in relation to percentage of yeast-like fungi colonies residing in the gastrointestinal tract in children and adolescents with type 1 diabetes mellitus (T1DM). The study involved 83 children and adolescents, including 53 T1DM patients and 30 healthy control subjects. In the studied population biochemical tests were performed and yeast-like fungi were identified in the faeces. Moreover, IL12 absorbance was measured and measurements of Candida albicans IgG and IgM antibodies were performed with microplate reader ChroMate 4300 (Awareness Technology, Inc., USA) at wavelength λ = 450 nm. In the group of T1DM children and adolescents with disease duration ≤ 2 years, high levels of IL12 were found with lower percentage of yeast-like fungal colonies versus T1DM patients with disease duration > 2 years and ≤5 years, as well as versus T1DM patients with disease duration > 5 years. Additionally, serum levels of IL12 were found to be decreasing by 18.1 pg/ml with each year of diabetes duration. IL12 serum levels were also found to be decreasing by 52.9 pg/ml with each 1% increase in HbA1c. We suggest that high IL12 levels can inhibit infection with yeast-like fungi colonizing the gastrointestinal tract in children and adolescents with T1DM. Further studies are needed to confirm the antifungal activity of IL12. PMID:28127111

  20. Interleukin 12B (IL12B) Genetic Variation and Pulmonary Tuberculosis: A Study of Cohorts from The Gambia, Guinea-Bissau, United States and Argentina

    PubMed Central

    Hill, Philip C.; Wejse, Christian; Bisseye, Cyrille; Olesen, Rikke; Edwards, Todd L.; Gilbert, John R.; Myers, Jamie L.; Stryjewski, Martin E.; Abbate, Eduardo; Estevan, Rosa; Hamilton, Carol D.; Tacconelli, Alessandra; Novelli, Giuseppe; Brunetti, Ercole; Aaby, Peter; Sodemann, Morten; Østergaard, Lars; Adegbola, Richard; Williams, Scott M.; Scott, William K.; Sirugo, Giorgio

    2011-01-01

    We examined whether polymorphisms in interleukin-12B (IL12B) associate with susceptibility to pulmonary tuberculosis (PTB) in two West African populations (from The Gambia and Guinea-Bissau) and in two independent populations from North and South America. Nine polymorphisms (seven SNPs, one insertion/deletion, one microsatellite) were analyzed in 321 PTB cases and 346 controls from Guinea-Bissau and 280 PTB cases and 286 controls from The Gambia. For replication we studied 281 case and 179 control African-American samples and 221 cases and 144 controls of European ancestry from the US and Argentina. First-stage single locus analyses revealed signals of association at IL12B 3′ UTR SNP rs3212227 (unadjusted allelic p = 0.04; additive genotypic p = 0.05, OR = 0.78, 95% CI [0.61–0.99]) in Guinea-Bissau and rs11574790 (unadjusted allelic p = 0.05; additive genotypic p = 0.05, OR = 0.76, 95% CI [0.58–1.00]) in The Gambia. Association of rs3212227 was then replicated in African-Americans (rs3212227 allelic p = 0.002; additive genotypic p = 0.05, OR = 0.78, 95% CI [0.61–1.00]); most importantly, in the African-American cohort, multiple significant signals of association (seven of the nine polymorphisms tested) were detected throughout the gene. These data suggest that genetic variation in IL12B, a highly relevant candidate gene, is a risk factor for PTB in populations of African ancestry, although further studies will be required to confirm this association and identify the precise mechanism underlying it. PMID:21339808

  1. The Safety and Immunogenicity of an Interleukin-12-Enhanced Multiantigen DNA Vaccine Delivered by Electroporation for the Treatment of HIV-1 Infection

    PubMed Central

    Jacobson, Jeffrey M.; Zheng, Lu; Wilson, Cara C.; Tebas, Pablo; Matining, Roy M.; Egan, Michael A.; Eldridge, John; Landay, Alan L.; Clifford, David B.; Luetkemeyer, Anne F.; Tiu, Jennifer; Martinez, Ana; Janik, Jennifer; Spitz, Teresa A.; Hural, John; McElrath, Juliana; Frahm, Nicole

    2015-01-01

    Background Therapeutic vaccination is being studied in eradication and “functional cure” strategies for HIV-1. The Profectus Biosciences (Tarrytown, NY) multiantigen (MAG) HIV-1 DNA vaccine encodes HIV-1 Gag/Pol, Nef/Tat/Vif, and Envelope, and interleukin-12 (IL-12) and is delivered by electroporation (EP) combined with intramuscular injection (IM-EP). Methods Sixty-two HIV-1-infected patients on antiretroviral therapy (plasma HIV-1 RNA levels ≤200 copies/mL; CD4+ T-cell counts ≥500 cells/mm3) were randomly allocated 5:1 to receive vaccine or placebo. At weeks 0, 4 and 12, four consecutive cohorts received 3000 μg HIV MAG pDNA with 0, 50, 250, or 1000 μg of IL-12 pDNA by IM-EP. A 5th cohort received HIV MAG pDNA plus 1000 μg of IL-12 pDNA by standard IM injection. Results CD4+ T cells expressing IL-2 in response to Gag and Pol and interferon-γ responses to Gag, Pol, and Env increased from baseline to week 14 in the low-dose (50-μg) IL-12 arm vs. placebo (P < 0.05; intracellular cytokine staining). The total increase in the IL-2 expressing CD4+ T-cell responses to any antigen was also higher in the low-dose IL-12 arm vs. placebo (P = 0.04). Cytokine responses by CD8 T cells to HIV antigens were not increased in any vaccine arm relative to placebo. Conclusions HIV-1 MAG/low-dose IL-12 DNA vaccine delivered by IM-EP augmented CD4+ but not CD8+ T-cell responses to multiple HIV-1 antigens. PMID:26761518

  2. Influence of Yersinia pseudotuberculosis outer proteins (Yops) on interleukin-12, tumor necrosis factor alpha and nitric oxide production by peritoneal macrophages.

    PubMed

    Monnazzi, Luis Gustavo Silva; Carlos, Iracilda Zeppone; de Medeiros, Beatriz Maria Machado

    2004-06-15

    An essential key to pathogenicity in Yersinia is the presence of a 70 kb plasmid (pYV) which encodes a type-III secretion system and several virulence outer proteins whose main function is to enable the bacteria to survive in the host. Thus, a specific immune response is needed in which cytokines are engaged. The aim of this study was to assess the influence of Yersinia outer proteins (Yops) released by Yersinia pseudotuberculosis on the production of the proinflammatory cytokines, interleukin-12 (IL-12), and tumor necrosis factor alpha (TNF-alpha), and nitric oxide (NO) by murine peritoneal macrophages. To this end, female Swiss mice were infected intravenously with wild-type Y. pseudotuberculosis or with mutant strains unable to secrete specific Yops (YopE, YopH, YopJ, YopM, and YpkA). On the 7th, 14th, 21st, and 28th days after infection, the animals were sacrificed and the cytokines and NO were assayed in the peritoneal macrophages culture supernatants. A fall in NO production was observed during the course of infection with all the strains tested, though during the infection with the strains that did not secrete YopE and YopH, the suppression occurred later. There was, in general, an unchanged or sometimes increased production of TNF-alpha between the 7th and the 21st day after infection, compared to the control group, followed by an abrupt decrease on the last day of infection. The IL-12 production was also suppressed during the infection, with most of the strains tested, except with those that did not secrete YopJ and YopE. The results suggest that Yops may suppress IL-12, TNF-alpha, and NO production and that the most important proteins involved in this suppression are YopE and YopH.

  3. Combination of interleukin-12 gene therapy, metronomic cyclophosphamide and DNA cancer vaccination directs all arms of the immune system towards tumor eradication.

    PubMed

    Denies, Sofie; Cicchelero, Laetitia; Van Audenhove, Isabel; Sanders, Niek N

    2014-08-10

    In this work a combination therapy that acts upon the immune suppressive, the innate and specific arms of the immune system is proposed. This combination therapy, which consists of intratumoral interleukin-12 (IL-12) gene therapy, human tyrosinase (hTyr) DNA vaccination and metronomic cyclophosphamide (CPX), was evaluated in a B16-F10 mouse model. The following groups were compared: (1) no treatment, (2) control vector, (3) intratumoral IL-12 gene therapy, (4) intratumoral IL-12 gene therapy+metronomic CPX, (5) intratumoral IL-12 gene therapy+metronomic CPX+hTyr DNA vaccination. Next to clinical efficacy and safety, we characterized acute effects of IL-12 and anti-tumor immune response after a second tumor challenge. All treatment groups showed increased survival and higher cure rates than control groups. Survival of non-cured mice was increased when metronomic CPX was combined with IL-12 gene therapy. Furthermore, mice that received metronomic CPX had significantly lower percentages of regulatory T cells. Addition of the hTyr DNA vaccine increased cure rate and resulted in increased survival compared to other treatment groups. We also demonstrated that the manifest necrosis within days after IL-12 gene therapy is at least partly due to IL-12 mediated activation of NK cells. All cured mice were resistant to a second challenge. A humoral memory response against the tumor cells was observed in all groups that received IL-12 gene therapy, while a cellular memory response was observed only in the vaccinated mice. In conclusion, every component of this combination treatment contributed a unique immunologic trait with associated clinical benefits.

  4. Interleukin-12-Producing CD103+ CD11b− CD8+ Dendritic Cells Are Responsible for Eliciting Gut Intraepithelial Lymphocyte Response against Encephalitozoon cuniculi

    PubMed Central

    Moretto, Magali M.; Harrow, Danielle I.; Hawley, Teresa S.

    2015-01-01

    Microsporidia, which belong to the kingdom Fungi, are important opportunistic pathogens in HIV-infected populations and organ transplant recipients that are often associated with a broad range of symptoms, such as diarrhea, nephritis, and encephalitis. Natural infection occurs via the oral route, and as a consequence, gut immunity plays an important role in restricting the dissemination of these pathogens. Studies from our laboratory have reported that the pathogens induce a rapid intraepithelial lymphocyte (IEL) response important for host protection. Although mucosal dendritic cells (DC) are likely involved in triggering an antigen-specific IEL response, the specific subset(s) responsible has yet to be identified. Toward this goal, we demonstrate a very important role for mucosal CD11b− CD8+ DC in the initiation of an antigen-specific IEL in vivo. Effectively, after Encephalitozoon cuniculi infection, CD11b− CD8+ DC were activated in the lamina propria (LP) and acquired the ability to process retinoic acid (RA). However, this subset did not produce interleukin 12 (IL-12) but upregulated CD103, which is essential for migration to the mesenteric lymph nodes (MLN). Interestingly, CD103+ CD11b− CD8+ DC in the MLN, in addition to processing RA, also secreted IL-12 and were responsible for gut imprinting specificity on mucosal CD8 T cells. To the best of our knowledge, this is the first report describing the importance of MLN CD103+ CD11b− CD8+ DC isolated from infected animals in the generation of an IEL response against a live pathogen. PMID:26416905

  5. Independent contributions of GR-1+ leukocytes and Fas/FasL interactions to induce apoptosis following interleukin-12 gene therapy in a metastatic model of prostate cancer.

    PubMed

    Sanford, M A; Yan, Y; Canfield, S E; Hassan, W; Selleck, W A; Atkinson, G; Chen, S H; Hall, S J

    2001-08-10

    In a mouse model of prostate cancer, adenovirus-mediated interleukin-12 (Ad.mIL-12) gene therapy resulted in significant growth inhibition of both the injected primary tumor and synchronous metastases. Within 2 days of vector injection, two distinct patterns of apoptosis were detected within the primary tumor, the inhibition of which with a caspase inhibitor substantially negated growth suppression. The dominant pattern displayed localized sheets of apoptotic cells in close association with necrosis containing polymorphic neutrophils (PMNs). Depletion of PMNs resulted in the loss of this pattern of apoptosis and reduced growth suppression. A second major wave of growth suppression within the primary tumor was mediated by an immune response. Natural killer (NK) cell activity was detected within tumor-infiltrating lymphocytes (TIL) by the eighth day post-vector injection, the depletion of which resulted in a significant loss of survival enhancement. A more modest role for T cells was identified, which in the absence of documented cytotoxic T lymphocyte (CTL) activity may be related to a significant reduction in interferon-gamma (IFN-gamma) levels found in mice depleted of T cells, thereby reducing the secondary influences of IFN-gamma. However, depletion of NK cells or T cells had no discernible negative effect on IL-12-mediated anti-metastatic activity. Attention focused on the role of IFN-gamma, observed following Ad.mIL-12 therapy, to mediate the diffuse pattern of apoptosis seen in the primary and metastatic lesions. In vitro studies noted the ability of IFN-gamma to up-regulate tumor cell expression of Fas and FasL to mediate apoptosis, whereas in vivo blockage of Fas/FasL interactions with soluble Fas resulted in a modest reduction in primary tumor growth suppression but complete abrogation within metastatic lesions.

  6. A safety and efficacy study of local delivery of interleukin-12 transgene by PPC polymer in a model of experimental glioma.

    PubMed

    Sonabend, Adam M; Velicu, Simona; Ulasov, Ilya V; Han, Yu; Tyler, Betty; Brem, Henry; Matar, Majed M; Fewell, Jason G; Anwer, Khursheed; Lesniak, Maciej S

    2008-02-01

    Interleukin-12 (IL-12) triggers an antitumoral immune response and an antiangiogenic effect against cancer. In this study, we tested a novel polymeric vehicle for IL-12 gene therapy along with adjuvant local biodegradable carmustine (BCNU) chemotherapy for the treatment of malignant glioma. Highly concentrated DNA/PPC (polyethylenimine covalently modified with methoxypolyethyleneglycol and cholesterol) complexes were used to deliver a murine plasmid encoding IL-12 (pmIL-12). For toxicity assessment, mice received intracranial injections with different volumes of pmIL-12/PPC. For efficacy, mice with intracranial GL261 glioma were treated with local delivery of pmIL-12/PPC and/or BCNU-containing polymers. Intracranial injections of 5-10 microl of pmIL-12/PPC were well tolerated and led to IL-12 expression in the brains of treated animals. Treatment with pmIL-12/PPC led to a significant increase in survival compared with untreated mice (median survival 57 days; 25% long-term survival >95 vs. 45 days for control; P<0.05). Treatment with BCNU led to a significant increase in survival compared with untreated mice, with 75% of treated mice having a long-term survival >95 days, (P<0.05). Most importantly, the combination of BCNU and pmIL-12/PPC led to a survival of 100% of the mice for 95 days after treatment (P<0.0001). This novel strategy is safe and effective for the treatment of malignant glioma. The synergy resultant from the combination of locally administered pmIL-12/PPC and BCNU suggests a role for this approach in the treatment of malignant brain tumors.

  7. Therapeutic effect of interleukin 12 on mouse haemangiosarcomas is not associated with an increased anti-tumour cytotoxic T-lymphocyte activity.

    PubMed Central

    Vizler, C.; Rosato, A.; Calderazzo, F.; Quintieri, L.; Fruscella, P.; Wainstok de Calmanovici, R.; Mantovani, A.; Vecchi, A.; Zanovello, P.; Collavo, D.

    1998-01-01

    In syngeneic mice, the H5V polyoma middle-T oncogene-transformed endothelioma cell line induces Kaposi's sarcoma-like cavernous haemangiomas that regress transiently, probably because of an anti-tumour immune response, but eventually grow progressively and kill the host. To evaluate the generation of tumour-specific cytotoxic T lymphocytes (CTLs), spleen cells of tumour-bearing mice were restimulated with irradiated H5V cells in mixed leucocyte-tumour cell cultures. Tumour-specific CTLs were demonstrable only when low numbers of H5V stimulator cells were used (<1 H5V cell per 50 splenocytes). We found that H5V cells secrete immunosuppressive mediators because CTL generation was blocked when H5V cells culture supernatants were added to allogeneic mixed leucocyte cultures. As numerous tumour-derived immunosuppressive mediators may interfere with interleukin 12 (IL-12) production, we tested whether IL-12 treatment of the tumour-bearing mice would augment their immune response and thus suppress tumour growth. Indeed, IL-12 inhibited tumour growth and prevented mortality, but did not increase anti-H5V CTL generation either in vitro or in vivo. Moreover, the anti-tumour activity in IL-12-treated mice was abrogated by anti-interferon (IFN)-gamma monoclonal antibody (MAb) co-administration. These results strongly suggest that the anti-tumour effect of IL-12 is principally mediated by IFN-gamma release that in turn blocks H5V cell proliferation and induces the release of factors that suppress angiogenesis. PMID:9484826

  8. The Safety and Immunogenicity of an Interleukin-12-Enhanced Multiantigen DNA Vaccine Delivered by Electroporation for the Treatment of HIV-1 Infection.

    PubMed

    Jacobson, Jeffrey M; Zheng, Lu; Wilson, Cara C; Tebas, Pablo; Matining, Roy M; Egan, Michael A; Eldridge, John; Landay, Alan L; Clifford, David B; Luetkemeyer, Anne F; Tiu, Jennifer; Martinez, Ana L; Janik, Jennifer; Spitz, Teresa A; Hural, John; McElrath, Juliana; Frahm, Nicole

    2016-02-01

    Therapeutic vaccination is being studied in eradication and "functional cure" strategies for HIV-1. The Profectus Biosciences multiantigen (MAG) HIV-1 DNA vaccine encodes HIV-1 Gag/Pol, Nef/Tat/Vif, and Envelope, and interleukin-12 (IL-12) and is delivered by electroporation combined with intramuscular injection (IM-EP). Sixty-two HIV-1-infected patients on antiretroviral therapy (plasma HIV-1 RNA levels ≤ 200 copies/mL; CD4(+) T-cell counts ≥ 500 cells/mm(3)) were randomly allocated 5:1 to receive vaccine or placebo. At weeks 0, 4, and 12, 4 consecutive cohorts received 3000 μg HIV MAG pDNA with 0, 50, 250, or 1000 μg of IL-12 pDNA by IM-EP. A fifth cohort received HIV MAG pDNA and 1000 μg of IL-12 pDNA by standard IM injection. CD4(+) T cells expressing IL-2 in response to Gag and Pol and interferon-γ responses to Gag, Pol, and Env increased from baseline to week 14 in the low-dose (50-μg) IL-12 arm vs. placebo (P < 0.05; intracellular cytokine staining). The total increase in the IL-2-expressing CD4 T-cell responses to any antigen was also higher in the low-dose IL-12 arm vs. placebo (P = 0.04). Cytokine responses by CD8 T cells to HIV antigens were not increased in any vaccine arm relative to placebo. HIV-1 MAG/low-dose IL-12 DNA vaccine delivered by IM-EP augmented CD4(+) but not CD8(+) T-cell responses to multiple HIV-1 antigens.

  9. Polymorphisms in genes of interleukin 12 and its receptors and their association with protection against severe malarial anaemia in children in western Kenya.

    PubMed

    Zhang, Lyna; Prather, Donald; Vanden Eng, Jodi; Crawford, Sara; Kariuki, Simon; ter Kuile, Feiko; Terlouw, Dianne; Nahlen, Bernard; Lal, Altaf A; Slutsker, Laurence; Udhayakumar, Venkatachalam; Shi, Ya Ping

    2010-03-29

    Malarial anaemia is characterized by destruction of malaria infected red blood cells and suppression of erythropoiesis. Interleukin 12 (IL12) significantly boosts erythropoietic responses in murine models of malarial anaemia and decreased IL12 levels are associated with severe malarial anaemia (SMA) in children. Based on the biological relevance of IL12 in malaria anaemia, the relationship between genetic polymorphisms of IL12 and its receptors and SMA was examined. Fifty-five tagging single nucleotide polymorphisms covering genes encoding two IL12 subunits, IL12A and IL12B, and its receptors, IL12RB1 and IL12RB2, were examined in a cohort of 913 children residing in Asembo Bay region of western Kenya. An increasing copy number of minor variant (C) in IL12A (rs2243140) was significantly associated with a decreased risk of SMA (P = 0.006; risk ratio, 0.52 for carrying one copy of allele C and 0.28 for two copies). Individuals possessing two copies of a rare variant (C) in IL12RB1 (rs429774) also appeared to be strongly protective against SMA (P = 0.00005; risk ratio, 0.18). In addition, children homozygous for another rare allele (T) in IL12A (rs22431348) were associated with reduced risk of severe anaemia (SA) (P = 0.004; risk ratio, 0.69) and of severe anaemia with any parasitaemia (SAP) (P = 0.004; risk ratio, 0.66). In contrast, AG genotype for another variant in IL12RB1 (rs383483) was associated with susceptibility to high-density parasitaemia (HDP) (P = 0.003; risk ratio, 1.21). This study has shown strong associations between polymorphisms in the genes of IL12A and IL12RB1 and protection from SMA in Kenyan children, suggesting that human genetic variants of IL12 related genes may significantly contribute to the development of anaemia in malaria patients.

  10. Silibinin inhibits ultraviolet B radiation-induced DNA-damage and apoptosis by enhancing interleukin-12 expression in JB6 cells and SKH-1 hairless mouse skin.

    PubMed

    Narayanapillai, Sreekanth; Agarwal, Chapla; Deep, Gagan; Agarwal, Rajesh

    2014-06-01

    Recent studies have demonstrated silibinin efficacy against ultraviolet B (UVB)-induced skin carcinogenesis via different mechanisms in cell lines and animal models; however, its role in regulating interleukin-12 (IL-12), an immunomodulatory cytokine that reduces UVB-induced DNA damage and apoptosis, is not known. Here, we report that UVB irradiation causes caspase 3 and PARP cleavage and apoptosis, and addition of recombinant IL-12 or silibinin immediately after UVB significantly protects UVB-induced apoptosis in JB6 cells. IL-12 antibody-mediated blocking of IL-12 activity compromised the protective effects of both IL-12 and silibinin. Both silibinin and IL-12 also accelerated the repair of UVB-caused cyclobutane-pyrimidine dimers (CPDs) in JB6 cells. Additional studies confirmed that indeed silibinin causes a significant increase in IL-12 levels in UVB-irradiated JB6 cells as well as in mouse skin epidermis, and that similar to cell-culture findings, silibinin topical application immediately after UVB exposure causes a strong protection against UVB-induced TUNEL positive cells in epidermis possibly through a significantly accelerated repair of UVB-caused CPDs. Together, these findings for the first time provide an important insight regarding the pharmacological mechanism wherein silibinin induces endogenous IL-12 in its efficacy against UVB-caused skin damages. In view of the fact that an enhanced endogenous IL-12 level could effectively remove UVB-caused DNA damage and associated skin cancer, our findings suggest that the use of silibinin in UVB-damaged human skin would also be a practical and translational strategy to manage solar radiation-caused skin damages as well as skin cancer. © 2013 Wiley Periodicals, Inc.

  11. Claudin-2 Forms Homodimers and Is a Component of a High Molecular Weight Protein Complex*

    PubMed Central

    Van Itallie, Christina M.; Mitic, Laura L.; Anderson, James M.

    2011-01-01

    Tight junctions are multiprotein complexes that form the fundamental physiologic and anatomic barrier between epithelial and endothelial cells, yet little information is available about their molecular organization. To begin to understand how the transmembrane proteins of the tight junction are organized into multiprotein complexes, we used blue native-PAGE (BN-PAGE) and cross-linking techniques to identify complexes extracted from MDCK II cells and mouse liver. In nonionic detergent extracts from MDCK II cells, the tight junction integral membrane protein claudin-2 was preferentially isolated as a homodimer, whereas claudin-4 was monomeric. Analysis of the interactions between chimeras of claudin-2 and -4 are consistent with the transmembrane domains of claudin-2 being responsible for dimerization, and mutational analysis followed by cross-linking indicated that the second transmembrane domains were arranged in close proximity in homodimers. BN-PAGE of mouse liver membrane identified a relatively discrete high molecular weight complex containing at least claudin-1, claudin-2, and occludin; the difference in the protein complex sizes between cultured cells and tissues may reflect differences in tight junction protein or lipid composition or post-translational modifications. Our results suggest that BN-PAGE may be a useful tool in understanding tight junction structure. PMID:21098027

  12. Photoelectron spectroscopy and density functional theory studies on the uridine homodimer radical anions.

    PubMed

    Ko, Yeon Jae; Storoniak, Piotr; Wang, Haopeng; Bowen, Kit H; Rak, Janusz

    2012-11-28

    We report the photoelectron spectrum (PES) of the homogeneous dimer anion radical of uridine, (rU)(2)(●-). It features a broad band consisting of an onset of ∼1.2 eV and a maximum at the electron binding energy (EBE) ranging from 2.0 to 2.5 eV. Calculations performed at the B3LYP∕6-31++G∗∗ level of theory suggest that the PES is dominated by dimeric radical anions in which one uridine nucleoside, hosting the excess charge on the base moiety, forms hydrogen bonds via its O8 atom with hydroxyl of the other neutral nucleoside's ribose. The calculated adiabatic electron affinities (AEAGs) and vertical detachment energies (VDEs) of the most stable homodimers show an excellent agreement with the experimental values. The anionic complexes consisting of two intermolecular uracil-uracil hydrogen bonds appeared to be substantially less stable than the uracil-ribose dimers. Despite the fact that uracil-uracil anionic homodimers are additionally stabilized by barrier-free electron-induced proton transfer, their relative thermodynamic stabilities and the calculated VDEs suggest that they do not contribute to the experimental PES spectrum of (rU)(2)(●-).

  13. Photoelectron spectroscopy and density functional theory studies on the uridine homodimer radical anions

    NASA Astrophysics Data System (ADS)

    Jae Ko, Yeon; Storoniak, Piotr; Wang, Haopeng; Bowen, Kit H.; Rak, Janusz

    2012-11-01

    We report the photoelectron spectrum (PES) of the homogeneous dimer anion radical of uridine, (rU)2•-. It features a broad band consisting of an onset of ˜1.2 eV and a maximum at the electron binding energy (EBE) ranging from 2.0 to 2.5 eV. Calculations performed at the B3LYP/6-31++G** level of theory suggest that the PES is dominated by dimeric radical anions in which one uridine nucleoside, hosting the excess charge on the base moiety, forms hydrogen bonds via its O8 atom with hydroxyl of the other neutral nucleoside's ribose. The calculated adiabatic electron affinities (AEAGs) and vertical detachment energies (VDEs) of the most stable homodimers show an excellent agreement with the experimental values. The anionic complexes consisting of two intermolecular uracil-uracil hydrogen bonds appeared to be substantially less stable than the uracil-ribose dimers. Despite the fact that uracil-uracil anionic homodimers are additionally stabilized by barrier-free electron-induced proton transfer, their relative thermodynamic stabilities and the calculated VDEs suggest that they do not contribute to the experimental PES spectrum of (rU)2•-.

  14. The HhH domain of the human DNA repair protein XPF forms stable homodimers.

    PubMed

    Das, Devashish; Tripsianes, Konstantinos; Jaspers, Nicolaas G J; Hoeijmakers, Jan H J; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E

    2008-03-01

    The human XPF-ERCC1 protein complex plays an essential role in nucleotide excision repair by catalysing positioned nicking of a DNA strand at the 5' side of the damage. We have recently solved the structure of the heterodimeric complex of the C-terminal domains of XPF and ERCC1 (Tripsianes et al., Structure 2005;13:1849-1858). We found that this complex comprises a pseudo twofold symmetry axis and that the helix-hairpin-helix motif of ERCC1 is required for DNA binding, whereas the corresponding domain of XPF is functioning as a scaffold for complex formation with ERCC1. Despite the functional importance of heterodimerization, the C-terminal domain of XPF can also form homodimers in vitro. We here compare the stabilities of homodimeric and heterodimeric complexes of the C-terminal domains of XPF and ERCC1. The higher stability of the XPF HhH complexes under various experimental conditions, determined using CD and NMR spectroscopy and mass spectrometry, is well explained by the structural differences that exist between the HhH domains of the two complexes. The XPF HhH homodimer has a larger interaction interface, aromatic stacking interactions, and additional hydrogen bond contacts as compared to the XPF/ERCC1 HhH complex, which accounts for its higher stability.

  15. Production of mouse interleukin-12 is greater in tobacco hairy roots grown in a mist reactor than in an airlift reactor.

    PubMed

    Liu, Chunzhao; Towler, Melissa J; Medrano, Giuliana; Cramer, Carole L; Weathers, Pamela J

    2009-03-01

    We compared the growth and productivity of a tobacco line of hairy roots that produces murine interleukin 12 (mIL-12) grown in three different culture systems: shake flasks, an airlift reactor, and a scalable mist reactor. Of the total mIL-12 produced by cultures grown in shake flasks ( approximately 434.8 microg L(-1)), almost 21% was recovered from the medium. In contrast to roots harvested from shake flasks and the mist reactor, roots were not uniformly distributed in the airlift reactor. Roots formed a dense ring around the wall of the reactor and surrounding the central rising column of fine aeration bubbles. Root quality was also better in both the shake flasks and mist reactor than in the airlift reactor. There were more pockets of dark roots in the airlift reactor suggesting some of the roots were nutrient starved. Although the best root growth (7 g DW L(-1)) was in the shake flasks, both reactors produced about the same, but less dry mass, nearly 5 g DW L(-1). Total mIL-12 concentration was highest in the mist reactor at 5.3 microg g(-1) FW, but productivity, 31 microg g(-1) FW day(-1) was highest in shake flasks. Roots grown in the mist reactor produced about 49.5% more mIL-12 than roots grown in the airlift reactor. Protease activity in the media increased steadily during culture of the roots in all three systems. The comparisons of protease activity, protein and mIL-12 levels done in the shake flask system suggest that the increase in proteases associated with progression into stationary phase is most detrimental to mIL-12 concentration. This is the first description of the design and operation of a scalable version of a mist bioreactor that uses a plastic bag. This also the first report of reasonable production levels of functional mIL-12, or any protein, produced by hairy roots grown in a mist reactor. Results will prove useful for further optimization and scale-up studies of plant-produced therapeutic proteins.

  16. HemaMax™, a Recombinant Human Interleukin-12, Is a Potent Mitigator of Acute Radiation Injury in Mice and Non-Human Primates

    PubMed Central

    Basile, Lena A.; Ellefson, Dolph; Gluzman-Poltorak, Zoya; Junes-Gill, Katiana; Mar, Vernon; Mendonca, Sarita; Miller, Joseph D.; Tom, Jamie; Trinh, Alice; Gallaher, Timothy K.

    2012-01-01

    HemaMax, a recombinant human interleukin-12 (IL-12), is under development to address an unmet medical need for effective treatments against acute radiation syndrome due to radiological terrorism or accident when administered at least 24 hours after radiation exposure. This study investigated pharmacokinetics, pharmacodynamics, and efficacy of m-HemaMax (recombinant murine IL-12), and HemaMax to increase survival after total body irradiation (TBI) in mice and rhesus monkeys, respectively, with no supportive care. In mice, m-HemaMax at an optimal 20 ng/mouse dose significantly increased percent survival and survival time when administered 24 hours after TBI between 8–9 Gy (p<0.05 Pearson's chi-square test). This survival benefit was accompanied by increases in plasma interferon-γ (IFN-γ) and erythropoietin levels, recovery of femoral bone hematopoiesis characterized with the presence of IL-12 receptor β2 subunit–expressing myeloid progenitors, megakaryocytes, and osteoblasts. Mitigation of jejunal radiation damage was also examined. At allometrically equivalent doses, HemaMax showed similar pharmacokinetics in rhesus monkeys compared to m-HemaMax in mice, but more robustly increased plasma IFN-γ levels. HemaMax also increased plasma erythropoietin, IL-15, IL-18, and neopterin levels. At non-human primate doses pharmacologically equivalent to murine doses, HemaMax (100 ng/Kg and 250 ng/Kg) administered at 24 hours after TBI (6.7 Gy/LD50/30) significantly increased percent survival of HemaMax groups compared to vehicle (p<0.05 Pearson's chi-square test). This survival benefit was accompanied by a significantly higher leukocyte (neutrophils and lymphocytes), thrombocyte, and reticulocyte counts during nadir (days 12–14) and significantly less weight loss at day 12 compared to vehicle. These findings indicate successful interspecies dose conversion and provide proof of concept that HemaMax increases survival in irradiated rhesus monkeys by promoting

  17. Neoadjuvant administration of Semliki Forest virus expressing interleukin-12 combined with attenuated Salmonella eradicates breast cancer metastasis and achieves long-term survival in immunocompetent mice.

    PubMed

    Kramer, M Gabriela; Masner, Martín; Casales, Erkuden; Moreno, María; Smerdou, Cristian; Chabalgoity, José A

    2015-09-07

    Metastatic breast cancer is a major cause of death among women worldwide; therefore efficient therapeutic strategies are extremely needed. In this work we have developed a gene therapy- and bacteria-based combined neoadjuvant approach and evaluated its antitumor effect in a clinically relevant animal model of metastatic breast cancer. 2×10(8) particles of a Semliki Forest virus vector expressing interleukin-12 (SFV-IL-12) and/or 2×10(7) units of an aroC (-) Samonella Typhimurium strain (LVR01) were injected into 4T1 tumor nodules orthotopically implanted in mice. Tumors were surgically resected and long-term survival was determined. IL-12 and interferon-γ were quantified by Enzyme-Linked ImmunoSorbent Assay, bacteria was visualized by inmunohistochemistry and the number of lung metastasis was calculated with a clonogenic assay. SFV-IL-12 and LVR01 timely inoculated and followed by surgical resection of tumors succeeded in complete inhibition of lethal lung metastasis and long-term survival in 90% of treated mice. The combined therapy was markedly synergistic compared to each treatment alone, since SFV-IL-12 monotherapy showed a potent antiangiogenic effect, being able to inhibit tumor growth and extend survival, but could not prevent establishment of distant metastasis and death of tumor-excised animals. On the other hand, LVR01 alone also showed a significant, although limited, antitumor potential, despite its ability to invade breast cancer cells and induce granulocyte recruitment. The efficacy of the combined therapy depended on the order in which both factors were administered; inasmuch the therapeutic effect was only observed when SFV-IL-12 was administered previous to LVR01, whereas administration of LVR01 before SFV-IL-12 had negligible antitumor activity. Moreover, pre-treatment with LVR01 seemed to suppress SFV-IL-12 antiangiogenic effects associated to lower IL-12 expression in this group. Re-challenged mice were unable to reject a second 4T1 tumor

  18. Requirement for natural killer cell-produced interferon gamma in defense against murine cytomegalovirus infection and enhancement of this defense pathway by interleukin 12 administration

    PubMed Central

    1995-01-01

    killing at levels comparable to those observed in control-treated mice. The consequences of interleukin 12 (IL-12) administration, a known potent inducer of IFN- gamma production by NK cells, were evaluated in MCMV-infected mice. Low IL-12 doses, i.e., 1 ng/d, increased NK cell cytotoxicity and IFN-gamma production up to twofold and resulted in improved antiviral status; virus-induced hepatitis was decreased as much as fivefold, and viral burdens were decreased to levels below detection.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:7561678

  19. Spectral-luminescent and photochemical characteristics of homodimers of the styrylcyanine dye Sbt in solutions.

    PubMed

    Kurtaliev, Eldar N

    2011-10-15

    The influence of concentration, solvent nature on the intermolecular interaction and its spectroscopic manifestations in solutions of styrylcyanine dye Sbt ((E)-2-(4-(dimethylamino)styryl)-3-methylbenzo[d]thiazol-3-ium iodide) and its homodimers, i.e. dyes with two interconnected chromophores, was studied. It was found out that, depending on the concentration, the structure of dye molecules, the nature of the solvent various forms of associated molecules are forms; each of these forms is manifested in the spectra of absorption and fluorescence in its own way. It is shown that the intensity of the main absorption band of the studied dyes in aqueous solutions and in a mixture of water+ethanol decreases in the process of light irradiation and a new band is observed in the region of shorter wavelengths; the intensity of the new band increases with increase of radiation exposure of solutions.

  20. The PRiMA-linked Cholinesterase Tetramers Are Assembled from Homodimers

    PubMed Central

    Chen, Vicky P.; Xie, Heidi Q.; Chan, Wallace K. B.; Leung, K. Wing; Chan, Gallant K. L.; Choi, Roy C. Y.; Bon, Suzanne; Massoulié, Jean; Tsim, Karl W. K.

    2010-01-01

    Acetylcholinesterase (AChE) is anchored onto cell membranes by the transmembrane protein PRiMA (proline-rich membrane anchor) as a tetrameric globular form that is prominently expressed in vertebrate brain. In parallel, the PRiMA-linked tetrameric butyrylcholinesterase (BChE) is also found in the brain. A single type of AChE-BChE hybrid tetramer was formed in cell cultures by co-transfection of cDNAs encoding AChET and BChET with proline-rich attachment domain-containing proteins, PRiMA I, PRiMA II, or a fragment of ColQ having a C-terminal GPI addition signal (QN-GPI). Using AChE and BChE mutants, we showed that AChE-BChE hybrids linked with PRiMA or QN-GPI always consist of AChET and BChET homodimers. The dimer formation of AChET and BChET depends on the catalytic domains, and the assembly of tetramers with a proline-rich attachment domain-containing protein requires the presence of C-terminal “t-peptides” in cholinesterase subunits. Our results indicate that PRiMA- or ColQ-linked cholinesterase tetramers are assembled from AChET or BChET homodimers. Moreover, the PRiMA-linked AChE-BChE hybrids occur naturally in chicken brain, and their expression increases during development, suggesting that they might play a role in cholinergic neurotransmission. PMID:20566626

  1. NFATc2 recruits cJun homodimers to an NFAT site to synergistically activate interleukin-2 transcription

    PubMed Central

    Walters, Ryan D.; Drullinger, Linda F.; Kugel, Jennifer F.; Goodrich, James A.

    2013-01-01

    Transcription of interleukin-2 (IL-2), a pivotal cytokine in the mammalian immune response, is induced by NFAT and AP-1 transcriptional activators in stimulated T cells. NFATc2 and cJun drive high levels of synergistic human IL-2 transcription, which requires a unique interaction between the C-terminal activation domain of NFATc2 and cJun homodimers. Here we studied the mechanism by which this interaction contributes to synergistic activation of IL-2 transcription. We found that NFATc2 can recruit cJun homodimers to the −45 NFAT element, which lacks a neighboring AP-1 site. The bZip domain of cJun is sufficient to interact with the C-terminal activation domain of NFATc2 in the absence of DNA and this interaction is inhibited by AP-1 DNA. When the −45 NFAT site was replaced by either a NFAT/AP-1 composite site or a single AP-1 site the specificity for cJun homodimers in synergistically activating IL-2 transcription was lost, and cJun/cFos heterodimers strongly activated transcription. These studies support a model in which IL-2 transcriptional synergy is mediated by the unique recruitment of a cJun homodimer to the −45 NFAT site by NFATc2, where it acts as a co-activator for IL-2 transcription. PMID:23665382

  2. Heterodimers and homodimers of inhibin subunits have different paracrine action in the modulation of luteinizing hormone-stimulated androgen biosynthesis

    SciTech Connect

    Hsueh, A.J.W.; Dahl, K.D.; Vaughan, J.; Tucker, E.; Rivier, J.; Bardin, C.W.; Vale, W.

    1987-07-01

    Inhibin, a gonadal hormone capable of preferential suppression of pituitary follicle-stimulating hormone (FSH) secretion, has recently been purified. The major form of this protein is an ..cap alpha beta.. heterodimer encoded by two separate genes. In contrast to the FSH-suppressing action of the ..cap alpha beta.. heterodimer, the ..beta beta.. homodimer stimulates FSH secretion. Luteinizing hormone (LH)-secreting pituitary cells and gonadal androgen-producing cells have long been shown to form a closed-loop feedback axis. Based on recent studies demonstrated the FSH stimulation of inhibin biosynthesis by ovarian granulosa and testis Sertoli cells, an additional closed-loop feedback axis exists between pituitary FSH- and gonadal inhibin-producing cells. Because uncharacterized Sertoli cell factors have been suggested to either stimulate or inhibit androgen production by testicular Leydig cells, the authors have tested the intragonadal paracrine actions of heterodimers and homodimers of inhibin subunits. In primary cultures of testis cells, the ..cap alpha beta.. heterodimer of inhibin enhances Leydig cell androgen biosynthesis stimulated by LH, whereas the ..beta beta.. homodimer suppresses androgen production. The data indicate that the inhibin-related gene products synthesized by Sertoli and granulosa cells may form heterodimers or homodimers to serve as intragonadal paracrine signals in the modulation of LH-stimulated androgen biosynthesis and allow cross-communication between the two feedback loops.

  3. COUP-TF II homodimers are formed in preference to heterodimers with RXR alpha or TR beta in intact cells.

    PubMed Central

    Butler, A J; Parker, M G

    1995-01-01

    Chicken ovalbumin upstream promoter-transcription factor (COUP-TF) represses the transcriptional activity of a number of nuclear receptors, including that of retinoid receptors (RAR and RXR) and thyroid hormone receptors (TR). Since COUP-TF is capable of binding to DNA in vitro either as a homodimer or as a heterodimer with RXR or TR, it has not been possible to distinguish between competitive DNA binding and heterodimer formation as a mechanism to account for the repression. Using a two-hybrid system we have investigated the dimerisation properties of COUP-TF II in intact cells. In conditions where COUP-TF II homodimers and RXR alpha-RAR alpha heterodimers were formed we were unable to detect the formation of heterodimers between COUP-TF II and RXR alpha. Moreover, we were unable to detect an interaction between COUP-TF II and RXR alpha on DNA. Similarly COUP-TF II homodimers and RXR alpha-TR beta heterodimers are favoured over COUP-TF II-TR beta heterodimers. We conclude that the formation of functionally inactive heterodimers is unlikely to represent a general mechanism by which COUP-TF represses the transcriptional activity of nuclear receptors and favour a model in which repression is mediated by COUP-TF homodimers competing for binding to DNA. Images PMID:7479078

  4. A stable double-stranded DNA-ethidium homodimer complex: Application to picogram fluorescence detection of DNA in agarose gels

    SciTech Connect

    Glazer, A.N.; Mathies, R.A. Lawrence Berkeley Laboratory, CA ); Peck, K. )

    1990-05-01

    The complex between double-stranded DNA and ethidium homodimer (5,5{prime}-diazadecamethylene)bis(3,8-diamino-6-phenylphenanthridinium) cation, formed at a ratio of 1 homodimer per 4 or 5 base pairs, is stable in agarose gels under the usual conditions for electrophoresis. This unusual stability allows formation of the complex before electrophoresis and then separation and detection in the absence of background stain. Competition experiments between the performed DNA-ethidium homodimer complex and a 50-fold molar excess of unlabeled DNA show that approximately one-third of the dye is retained within the original complex independent of the duration of the competition. However, dye-extraction experiments show that these are not covalent complexes. After electrophoretic separation, detection of bands containing 25 pg of DNA was readily achieved in 1-mm thick agarose gels with laser excitation at 488 nm and a scanning confocal fluorescence imaging system. The band intensity was linear with the amount of DNA applied from 0.2 to 1.0 ng per lane and with the number of kilobase pairs (kbp) per band within a lane. Analysis of an aliquot of a polymerase-chain-reaction mixture permitted ready detection of 80 pg of a 1.6-kbp amplified fragment. The use of the ethidium homodimer complex together with laser excitation for DNA detection on gels is at least two orders of magnitude more sensitive than conventional fluorescence-based procedures. The homodimer-DNA complex exemplifies a class of fluorescent probes where the intercalation of dye chromophores in DNA forms a stable, highly fluorescent ensemble.

  5. A stable double-stranded DNA-ethidium homodimer complex: application to picogram fluorescence detection of DNA in agarose gels.

    PubMed Central

    Glazer, A N; Peck, K; Mathies, R A

    1990-01-01

    The complex between double-stranded DNA and ethidium homodimer (5,5'-diazadecamethylene)bis(3,8-diamino-6-phenylphenanthridini um) cation, formed at a ratio of 1 homodimer per 4 or 5 base pairs, is stable in agarose gels under the usual conditions for electrophoresis. This unusual stability allows formation of the complex before electrophoresis and then separation and detection in the absence of background stain. Competition experiments between the preformed DNA-ethidium homodimer complex and a 50-fold molar excess of unlabeled DNA show that approximately one-third of the dye is retained within the original complex independent of the duration of the competition. However, dye-extraction experiments show that these are not covalent complexes. After electrophoretic separation, detection of bands containing 25 pg of DNA was readily achieved in 1-mm thick agarose gels with laser excitation at 488 nm and a scanning confocal fluorescence imaging system. The band intensity was linear with the amount of DNA applied from 0.2 to 1.0 ng per lane and with the number of kilobase pairs (kbp) per band within a lane. Analysis of an aliquot of a polymerase-chain-reaction mixture permitted ready detection of 80 pg of a 1.6-kbp amplified fragment. The use of the ethidium homodimer complex together with laser excitation for DNA detection on gels is at least two orders of magnitude more sensitive than conventional fluorescence-based procedures. The homodimer-DNA complex exemplifies a class of fluorescent probes where the intercalation of dye chromophores in DNA forms a stable, highly fluorescent ensemble. Images PMID:2339125

  6. Insect Neuropeptide Bursicon Homodimers Induce Innate Immune and Stress Genes during Molting by Activating the NF-κB Transcription Factor Relish

    PubMed Central

    Li, Sheng; Gilbert, Lawrence I.; Stanley, David; Song, Qisheng

    2012-01-01

    Background Bursicon is a heterodimer neuropeptide composed of two cystine knot proteins, bursicon α (burs α) and bursicon β (burs β), that elicits cuticle tanning (melanization and sclerotization) through the Drosophila leucine-rich repeats-containing G protein-coupled receptor 2 (DLGR2). Recent studies show that both bursicon subunits also form homodimers. However, biological functions of the homodimers have remained unknown until now. Methodology/Principal Findings In this report, we show in Drosophila melanogaster that both bursicon homodimers induced expression of genes encoding antimicrobial peptides (AMPs) in neck-ligated adults following recombinant homodimer injection and in larvae fat body after incubation with recombinant homodimers. These AMP genes were also up-regulated in 24 h old unligated flies (when the endogenous bursicon level is low) after injection of recombinant homodimers. Up-regulation of AMP genes by the homodimers was accompanied by reduced bacterial populations in fly assay preparations. The induction of AMP expression is via activation of the NF-κB transcription factor Relish in the immune deficiency (Imd) pathway. The influence of bursicon homodimers on immune function does not appear to act through the heterodimer receptor DLGR2, i.e. novel receptors exist for the homodimers. Conclusions/Significance Our results reveal a mechanism of CNS-regulated prophylactic innate immunity during molting via induced expression of genes encoding AMPs and genes of the Turandot family. Turandot genes are also up-regulated by a broader range of extreme insults. From these data we infer that CNS-generated bursicon homodimers mediate innate prophylactic immunity to both stress and infection during the vulnerable molting cycle. PMID:22470576

  7. Aryl hydrocarbon receptor modulates NADPH oxidase activity via direct transcriptional regulation of p40phox expression.

    PubMed

    Wada, Taira; Sunaga, Hiroshi; Ohkawara, Reiko; Shimba, Shigeki

    2013-05-01

    A member of the NADPH oxidase subunits, p40(phox) plays an important role in the regulation of NADPH oxidase activity and the subsequent production of reactive oxygen species (ROS). In this study, we show that mouse p40(phox) is a novel transcriptional target of the aryl hydrocarbon receptor (AhR), known as a dioxin receptor or xenobiotic receptor, in the liver. Treatment of mice with 3-methylcholanthrene (3MC) increased p40(phox) gene expression in the liver, but this induction of p40(phox) gene expression was diminished by the deletion of the AhR gene in the liver. Consistent with the in vivo results, the expression of the p40(phox) gene was increased in 3MC-treated Hepa1c1c7 cells in an AhR-dependent manner. In addition, promoter analysis established p40(phox) as a transcriptional target of AhR. Studies using the RNA-interference technique revealed that p40(phox) is involved in the increase of NADPH oxidase activity and the subsequent ROS production in AhR-activated Hepa1c1c7 cells. Consequently, the results obtained here may provide a novel molecular mechanism for ROS production after exposure to dioxins.

  8. Metal-Mediated Affinity and Orientation Specificity in a Computationally Designed Protein Homodimer

    SciTech Connect

    Der, Bryan S.; Machius, Mischa; Miley, Michael J.; Mills, Jeffrey L.; Szyperski, Thomas; Kuhlman, Brian

    2015-10-15

    Computationally designing protein-protein interactions with high affinity and desired orientation is a challenging task. Incorporating metal-binding sites at the target interface may be one approach for increasing affinity and specifying the binding mode, thereby improving robustness of designed interactions for use as tools in basic research as well as in applications from biotechnology to medicine. Here we describe a Rosetta-based approach for the rational design of a protein monomer to form a zinc-mediated, symmetric homodimer. Our metal interface design, named MID1 (NESG target ID OR37), forms a tight dimer in the presence of zinc (MID1-zinc) with a dissociation constant <30 nM. Without zinc the dissociation constant is 4 {micro}M. The crystal structure of MID1-zinc shows good overall agreement with the computational model, but only three out of four designed histidines coordinate zinc. However, a histidine-to-glutamate point mutation resulted in four-coordination of zinc, and the resulting metal binding site and dimer orientation closely matches the computational model (C{alpha} rmsd = 1.4 {angstrom}).

  9. Regulation of the PI3K pathway through a p85α monomer–homodimer equilibrium

    PubMed Central

    Cheung, Lydia WT; Walkiewicz, Katarzyna W; Besong, Tabot MD; Guo, Huifang; Hawke, David H; Arold, Stefan T; Mills, Gordon B

    2015-01-01

    The canonical action of the p85α regulatory subunit of phosphatidylinositol 3-kinase (PI3K) is to associate with the p110α catalytic subunit to allow stimuli-dependent activation of the PI3K pathway. We elucidate a p110α-independent role of homodimerized p85α in the positive regulation of PTEN stability and activity. p110α-free p85α homodimerizes via two intermolecular interactions (SH3:proline-rich region and BH:BH) to selectively bind unphosphorylated activated PTEN. As a consequence, homodimeric but not monomeric p85α suppresses the PI3K pathway by protecting PTEN from E3 ligase WWP2-mediated proteasomal degradation. Further, the p85α homodimer enhances the lipid phosphatase activity and membrane association of PTEN. Strikingly, we identified cancer patient-derived oncogenic p85α mutations that target the homodimerization or PTEN interaction surface. Collectively, our data suggest the equilibrium of p85α monomer–dimers regulates the PI3K pathway and disrupting this equilibrium could lead to disease development. DOI: http://dx.doi.org/10.7554/eLife.06866.001 PMID:26222500

  10. Halogen transfer through halogen bonds in halogen-bound ammonia homodimers.

    PubMed

    Crugeiras, Juan; Ríos, Ana

    2016-11-16

    Ab initio MP2(full)/aug-cc-pVTZ calculations have been carried out to investigate the halogen transfer between haloamines and ammonia. The results show that the formation of a halogen bond complex between ammonia and the protonated N-haloamine is a preliminary step in the halogen transfer process. The complexation energies, optimized geometries, topology of electron density and potential energy surfaces for halogen transfer in these complexes have been analysed. It has been found that halogen-bound ammonia homodimers ([H3NXNH3](+), with X = Cl, Br, I) formed by interaction between NH3 and H3NX(+) are symmetric, and energetically more stable than the corresponding complexes formed between NH3 and H2NX. Calculated potential energy surfaces for the transfer of the central halogen atom between the two NH3 units in [H3NXNH3](+) show single well and double well potentials for short and large N-N distances, respectively. The particular case of fluorine complexes has also been analysed. The results provide an explanation for some of the experimental facts observed for halogen transfer reactions between amines in aqueous solution.

  11. Optical determination of the electronic coupling and intercalation geometry of thiazole orange homodimer in DNA

    NASA Astrophysics Data System (ADS)

    Cunningham, Paul D.; Bricker, William P.; Díaz, Sebastián A.; Medintz, Igor L.; Bathe, Mark; Melinger, Joseph S.

    2017-08-01

    Sequence-selective bis-intercalating dyes exhibit large increases in fluorescence in the presence of specific DNA sequences. This property makes this class of fluorophore of particular importance to biosensing and super-resolution imaging. Here we report ultrafast transient anisotropy measurements of resonance energy transfer (RET) between thiazole orange (TO) molecules in a complex formed between the homodimer TOTO and double-stranded (ds) DNA. Biexponential homo-RET dynamics suggest two subpopulations within the ensemble: 80% intercalated and 20% non-intercalated. Based on the application of the transition density cube method to describe the electronic coupling and Monte Carlo simulations of the TOTO/dsDNA geometry, the dihedral angle between intercalated TO molecules is estimated to be 81° ± 5°, corresponding to a coupling strength of 45 ± 22 cm-1. Dye intercalation with this geometry is found to occur independently of the underlying DNA sequence, despite the known preference of TOTO for the nucleobase sequence CTAG. The non-intercalated subpopulation is inferred to have a mean inter-dye separation distance of 19 Å, corresponding to coupling strengths between 0 and 25 cm-1. This information is important to enable the rational design of energy transfer systems that utilize TOTO as a relay dye. The approach used here is generally applicable to determining the electronic coupling strength and intercalation configuration of other dimeric bis-intercalators.

  12. ABCG2 membrane transporter in mature human erythrocytes is exclusively homodimer.

    PubMed

    Leimanis, Mara L; Georges, Elias

    2007-03-09

    The human ABCG2 protein, a member of ABC transporter family, was shown to transport anti-cancer drugs and normal cell metabolites. Earlier studies have demonstrated the expression of ABCG2 in hematopoietic stem cells and erythroid cells; however little is known about the expression and activity of ABCG2 in mature erythrocytes. In this report, we show that ABCG2 in mature human erythrocytes migrates with an apparent molecular mass of 140 kDa, under reducing conditions, on Fairbanks SDS gel system. In contrast, tumor cells expressing higher levels of ABCG2 show no detectable homodimers, when resolved under identical reducing conditions. Analysis of the same membrane extracts from tumor cells and human erythrocytes on Laemmli SDS gel system, where samples are boiled in the presence of increasing concentrations of disulfide reducing conditions and then analyzed, migrate with an apparent molecular mass of 70 kDa or a monomer. Drug transport studies using Pheophorbide A, a substrate of ABCG2, show the protein to be active in erythrocytes. Furthermore, Fumitremorgin C, a specific inhibitor of ABCG2 increases the accumulation of Pheophorbide A in erythrocytes and drug-resistant cells but not in the parental drug-sensitive cells. Given the ability of ABCG2 to transport protoprophyrin IX or heme, these findings may have implications on the normal function of erythrocytes.

  13. Phosphorylation and activation of p40 tyrosine kinase by casein kinase-1.

    PubMed

    Vila, J; Payne, D M; Zioncheck, T F; Harrison, M L; Itarte, E; Weber, M J

    1990-05-07

    Because examination of regulatory trans-phosphorylations can help elucidate the cellular functions of tyrosyl protein kinases, we have investigated the effects of phosphorylation by casein kinase-1 on the activity of the p40 tyrosyl protein kinase. We find that casein kinase-1 can phosphorylate the p40 tyrosyl kinase on serine and threonine residues, in part on a unique tryptic peptide. The phosphorylation induces a substantial increase in the tyrosyl protein kinase activity of p40, in contrast to most instances in which serine/threonine phosphorylation inhibits activity of tyrosyl protein kinases. These findings raise the possibility that p40 might be part of a protein phosphorylation network in which casein kinase-1 participates.

  14. Probing intermolecular protein-protein interactions in the calcium-sensing receptor homodimer using bioluminescence resonance energy transfer (BRET).

    PubMed

    Jensen, Anders A; Hansen, Jakob L; Sheikh, Søren P; Bräuner-Osborne, Hans

    2002-10-01

    The calcium-sensing receptor (CaR) belongs to family C of the G-protein coupled receptor superfamily. The receptor is believed to exist as a homodimer due to covalent and non-covalent interactions between the two amino terminal domains (ATDs). It is well established that agonist binding to family C receptors takes place at the ATD and that this causes the ATD dimer to twist. However, very little is known about the translation of the ATD dimer twist into G-protein coupling to the 7 transmembrane moieties (7TMs) of these receptor dimers. In this study we have attempted to delineate the agonist-induced intermolecular movements in the CaR homodimer using the new bioluminescence resonance energy transfer technique, BRET2, which is based on the transference of energy from Renilla luciferase (Rluc) to the green fluorescent protein mutant GFP2. We tagged CaR with Rluc and GFP2 at different intracellular locations. Stable and highly receptor-specific BRET signals were obtained in tsA cells transfected with Rluc- and GFP2-tagged CaRs under basal conditions, indicating that CaR is constitutively dimerized. However, the signals were not enhanced by the presence of agonist. These results could indicate that at least parts of the two 7TMs of the CaR homodimer are in close proximity in the inactivated state of the receptor and do not move much relative to one another upon agonist activation. However, we cannot exclude the possibility that the BRET technology is unable to register putative conformational changes in the CaR homodimer induced by agonist binding because of the bulk sizes of the Rluc and GFP2 molecules.

  15. Native Serotonin 5-HT2C Receptors Are Expressed as Homodimers on the Apical Surface of Choroid Plexus Epithelial Cells

    PubMed Central

    Grinde, Ellinor; Lindsley, Tara; Teitler, Milt; Mancia, Filippo; Cowan, Ann; Mazurkiewicz, Joseph E.

    2015-01-01

    G protein–coupled receptors (GPCRs) are a prominent class of plasma membrane proteins that regulate physiologic responses to a wide variety of stimuli and therapeutic agents. Although GPCR oligomerization has been studied extensively in recombinant cells, it remains uncertain whether native receptors expressed in their natural cellular environment are monomers, dimers, or oligomers. The goal of this study was to determine the monomer/oligomer status of a native GPCR endogenously expressed in its natural cellular environment. Native 5-HT2C receptors in choroid plexus epithelial cells were evaluated using fluorescence correlation spectroscopy (FCS) with photon counting histogram (PCH). An anti–5-HT2C fragment antigen binding protein was used to label native 5-HT2C receptors. A known monomeric receptor (CD-86) served as a control for decoding the oligomer status of native 5-HT2C receptors by molecular brightness analysis. FCS with PCH revealed molecular brightness values for native 5-HT2C receptors equivalent to the molecular brightness of a homodimer. 5-HT2C receptors displayed a diffusion coefficient of 5 × 10−9 cm2/s and were expressed at 32 receptors/μm2 on the apical surface of choroid plexus epithelial cells. The functional significance and signaling capabilities of the homodimer were investigated in human embryonic kidney 293 cells using agonists that bind in a wash-resistant manner to one or both protomers of the homodimer. Whereas agonist binding to one protomer resulted in G protein activation, maximal stimulation required occupancy of both protomers. This study is the first to demonstrate the homodimeric structure of 5-HT2C receptors endogenously expressed in their native cellular environment, and identifies the homodimer as a functional signaling unit. PMID:25609374

  16. Apelin receptor homodimer-oligomers revealed by single-molecule imaging and novel G protein-dependent signaling

    PubMed Central

    Cai, Xin; Bai, Bo; Zhang, Rumin; Wang, Chunmei; Chen, Jing

    2017-01-01

    The apelin receptor (APJ) belongs to family A of the G protein-coupled receptors (GPCRs) and is a potential pharmacotherapeutic target for heart failure, hypertension, and other cardiovascular diseases. There is evidence APJ heterodimerizes with other GPCRs; however, the existence of APJ homodimers and oligomers remains to be investigated. Here, we measured APJ monomer-homodimer-oligomer interconversion by monitoring APJ dynamically on cells and compared their proportions, spatial arrangement, and mobility using total internal reflection fluorescence microscopy, resonance energy transfer, and proximity biotinylation. In cells with <0.3 receptor particles/μm2, approximately 60% of APJ molecules were present as dimers or oligomers. APJ dimers were present on the cell surface in a dynamic equilibrium with constant formation and dissociation of receptor complexes. Furthermore, we applied interference peptides and MALDI-TOF mass spectrometry to confirm APJ homo-dimer and explore the dimer-interfaces. Peptides corresponding to transmembrane domain (TMD)1, 2, 3, and 4, but not TMD5, 6, and 7, disrupted APJ dimerization. APJ mutants in TMD1 and TMD2 also decreased bioluminescence resonance energy transfer of APJ dimer. APJ dimerization resulted in novel functional characteristics, such as a distinct G-protein binding profile and cell responses after agonist stimulation. Thus, dimerization may serve as a unique mechanism for fine-tuning APJ-mediated functions. PMID:28091541

  17. Structure of a Thyroid Hormone Receptor DNA-Binding Domain Homodimer Bound to an Inverted Palindrome DNA Response Element

    SciTech Connect

    Chen, Yi; Young, Matthew A.

    2010-10-22

    Thyroid hormone receptor (TR), as a member of the nuclear hormone receptor family, can recognize and bind different classes of DNA response element targets as either a monomer, a homooligomer, or a heterooligomer. We report here the first crystal structure of a homodimer TR DNA-binding domain (DBD) in complex with an inverted repeat class of thyroid response element (TRE). The structure shows a nearly symmetric structure of the TR DBD assembled on the F2 TRE where the base recognition contacts in the homodimer DNA complex are conserved relative to the previously published structure of a TR-9-cis-retinoic acid receptor heterodimer DNA complex. The new structure also reveals that the T-box region of the DBD can function as a structural hinge that enables a large degree of flexibility in the position of the C-terminal extension helix that connects the DBD to the ligand-binding domain. Although the isolated TR DBDs exist as monomers in solution, we have measured highly cooperative binding of the two TR DBD subunits onto the inverted repeat DNA sequence. This suggests that elements of the DBD can influence the specific TR oligomerization at target genes, and it is not just interactions between the ligand-binding domains that are responsible for TR oligomerization at target genes. Mutational analysis shows that intersubunit contacts at the DBD C terminus account for some, but not all, of the cooperative homodimer TR binding to the inverted repeat class TRE.

  18. Cholate-solubilized erythrocyte glucose transporters exist as a mixture of homodimers and homotetramers.

    PubMed

    Hebert, D N; Carruthers, A

    1991-05-14

    The molecular size of purified, human erythrocyte glucose transport protein (GLUT1) solubilized in cholic acid was determined by size-exclusion chromatography (SEC) and sucrose gradient ultracentrifugation. GLUT1 purified in the presence of dithiothreitol (GLUT1 + DTT) is resolved as a complex of average Stokes' radius 5.74 nm by SEC. This complex displays D-glucose-inhibitable cytochalasin B binding and, upon reconstitution into proteoliposomes, catalyzes cytochalasin B inhibitable D-glucose transport. GLUT1 purified in the absence of dithiothreitol (GLUT1-DTT) is resolved by SEC as at least two particles of average Stokes' radii 5.74 (minor component) and 7.48 nm (major component). Solubilization of GLUT1-DTT in the presence of dithiothreitol reduces the amount of 7.48-nm complex and increases the amount of 5.74-nm complex resolved by SEC. GLUT1-DTT displays D-glucose-inhibitable cytochalasin B binding and, upon reconstitution into proteoliposomes, catalyzes cytochalasin B inhibitable D-glucose transport. Sucrose gradient ultracentrifugation of GLUT1 + DTT in cholate resolves GLUT1 into two components of 4.8 and 7.6 S. The 4.8S complex is the major component of GLUT1 + DTT. The reverse profile is observed upon sucrose gradient ultracentrifugation of GLUT1-DTT. SEC of human erythrocyte membrane proteins resolves GLUT1 as a major broad peak of average Stokes' radius 7.48 nm and a minor component of 5.74 nm. Both components are characterized by D-glucose-inhibitable cytochalasin B binding. Purified GLUT1 is associated with approximately 26 tightly bound lipid molecules per monomer of transport protein. These data suggest that purified GLUT1 exists as a mixture of homodimers and homotetramers in cholate-lipid micelles and that the presence of reductant during solubilization favors dimer formation.

  19. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    NASA Astrophysics Data System (ADS)

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2009-03-01

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium ( St UPh) was determined with high accuracy. The structure was refined at 1.80 Å resolution to R work = 16.1% and R free = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 Å, 1.042°, and 0.071°, respectively. The coordinate error estimated by the Luzzati plot is 0.166 Å. The coordinate error based on the maximum likelihood is 0.199 Å. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure of the homodimer St UPh in the complex with a K+ ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).

  20. Comparative analysis of three-dimensional structures of homodimers of uridine phosphorylase from Salmonella typhimurium in the unligated state and in a complex with potassium ion

    SciTech Connect

    Lashkov, A. A.; Zhukhlistova, N. E.; Gabdulkhakov, A. G.; Mikhailov, A. M.

    2009-03-15

    The spatial organization of the homodimer of unligated uridine phosphorylase from Salmonella typhimurium (St UPh) was determined with high accuracy. The structure was refined at 1.80 A resolution to R{sub work} = 16.1% and R{sub free} = 20.0%. The rms deviations for the bond lengths, bond angles, and chiral angles are 0.006 A, 1.042{sup o}, and 0.071{sup o}, respectively. The coordinate error estimated by the Luzzati plot is 0.166 A. The coordinate error based on the maximum likelihood is 0.199 A. A comparative analysis of the spatial organization of the homodimer in two independently refined structures and the structure of the homodimer St UPh in the complex with a K{sup +} ion was performed. The substrate-binding sites in the homodimers StUPhs in the unligated state were found to act asynchronously. In the presence of a potassium ion, the three-dimensional structures of the subunits in the homodimer are virtually identical, which is apparently of importance for the synchronous action of both substrate-binding sites. The atomic coordinates of the refined structure of the homodimer and structure factors have been deposited in the Protein Data Bank (PDB ID code 3DPS).

  1. Functional analysis of the p40 and p75 proteins from Lactobacillus casei BL23.

    PubMed

    Bäuerl, Christine; Pérez-Martínez, Gaspar; Yan, Fang; Polk, D Brent; Monedero, Vicente

    2010-01-01

    The genomes of Lactobacillus casei/paracasei and Lactobacillus rhamnosus strains carry two genes encoding homologues of p40 and p75 from L. rhamnosus GG, two secreted proteins which display anti-apoptotic and cell protective effects on human intestinal epithelial cells. p40 and p75 carry cysteine, histidine-dependent aminohydrolase/peptidase (CHAP) and NLPC/P60 domains, respectively, which are characteristic of proteins with cell-wall hydrolase activity. In L. casei BL23 both proteins were secreted to the growth medium and were also located at the bacterial cell surface. The genes coding for both proteins were inactivated in this strain. Inactivation of LCABL_00230 (encoding p40) did not result in a significant difference in phenotype, whereas a mutation in LCABL_02770 (encoding p75) produced cells that formed very long chains. Purified glutathione-S-transferase (GST)-p40 and -p75 fusion proteins were able to hydrolyze the muropeptides from L. casei cell walls. Both fusions bound to mucin, collagen and to intestinal epithelial cells and, similar to L. rhamnosus GG p40, stimulated epidermal growth factor receptor phosphorylation in mouse intestine ex vivo. These results indicate that extracellular proteins belonging to the machinery of cell-wall metabolism in the closely related L. casei/paracasei-L. rhamnosus group are most likely involved in the probiotic effects described for these bacteria.

  2. Functional Analysis of the p40 and p75 Proteins from Lactobacillus casei BL23

    PubMed Central

    Bäuerl, Christine; Pérez-Martínez, Gaspar; Yan, Fang; Polk, D. Brent; Monedero, Vicente

    2011-01-01

    The genomes of Lactobacillus casei/paracasei and Lactobacillus rhamnosus strains carry two genes encoding homologues of p40 and p75 from L. rhamnosus GG, two secreted proteins which display anti-apoptotic and cell protective effects on human intestinal epithelial cells. p40 and p75 carry cysteine, histidine-dependent aminohydrolase/peptidase (CHAP) and NLPC/P60 domains, respectively, which are characteristic of proteins with cell-wall hydrolase activity. In L. casei BL23 both proteins were secreted to the growth medium and were also located at the bacterial cell surface. The genes coding for both proteins were inactivated in this strain. Inactivation of LCABL_00230 (encoding p40) did not result in a significant difference in phenotype, whereas a mutation in LCABL_02770 (encoding p75) produced cells that formed very long chains. Purified glutathione-S-transferase (GST)-p40 and -p75 fusion proteins were able to hydrolyze the muropeptides from L. casei cell walls. Both fusions bound to mucin, collagen and to intestinal epithelial cells and, similar to L. rhamnosus GG p40, stimulated epidermal growth factor receptor phosphorylation in mouse intestine ex vivo. These results indicate that extracellular proteins belonging to the machinery of cell-wall metabolism in the closely related L. casei/paracasei-L. rhamnosus group are most likely involved in the probiotic effects described for these bacteria PMID:21178363

  3. Role of Anthocyanin-enriched Purple-fleshed Sweet Potato P40 in Colorectal Cancer Prevention

    PubMed Central

    Lim, Soyoung; Xu, Jianteng; Kim, Jaeyong; Chen, Tzu-Yu; Su, Xiaoyu; Standard, Joseph; Carey, Edward; Griffin, Jason; Herndon, Betty; Katz, Benjamin; Tomich, John; Wang, Weiqun

    2013-01-01

    Scope Anthocyanins, the natural pigments in plant foods, have been associated with cancer prevention. However, the content of anthocyanins in staple foods is typically low and the mechanisms by which they exert anti-cancer activity is not yet fully defined. Methods and results We selected an anthocyanin-enriched purple-fleshed sweet potato clone, P40, and investigated its potential anti-cancer effect in both in vitro cell culture and in vivo animal model. In addition to a high level of total phenolics and antioxidant capacity, P40 possesses a high content of anthocyanins at 7.5 mg/g dry matter. Treatment of human colonic SW480 cancer cells with P40 anthocyanin extracts at 0–40 μM of peonidin-3-glucoside equivalent resulted in a dose-dependent decrease in cell number due to cytostatic arrest of cell cycle at G1 phase but not cytotoxicity. Furthermore, dietary P40 at 10–30% significantly suppressed azoxymethane-induced formation of aberrant crypt foci in the colons of CF-1 mice in conjunction with, at least in part, a lesser proliferative PCNA and a greater apoptotic caspase-3 expression in the colon mucosal epithelial cells. Conclusion These observations, coupled with both in vitro and in vivo studies reported here, suggest anthocyanin-enriched sweet potato P40 may protect against colorectal cancer by inducing cell cycle arrest, anti-proliferative and apoptotic mechanisms. PMID:23784800

  4. Cooperative Signaling between Homodimers of Metabotropic Glutamate Receptors 1 and 5

    PubMed Central

    Sevastyanova, Tatyana N.

    2014-01-01

    Metabotropic glutamate receptors (mGluRs) function as dimers. Recent work suggests that mGluR1 and mGluR5 may physically interact, but the nature and functional consequences of this relationship have not been addressed. In this study, the functional and pharmacological consequences of this interaction were investigated. Using heterologous expression of mGluR cDNA in rat sympathetic neurons from the superior cervical ganglion and inhibition of the native calcium currents as an assay for receptor activation, a functional interdependence between mGluR1 and mGluR5 was demonstrated. In neurons coexpressing these receptors, combining a selective mGluR1 competitive antagonist with either an mGluR1- or mGluR5-selective negative allosteric modulator (NAM) BAY36-7620 [(3aS,6aS)-hexahydro-5-methylene-6a-(2-naphthalenylmethyl)-1H-cyclopenta[c]furan-1-one] or MPEP [2-methyl-6-(phenylethynyl)pyridine hydrochloride], respectively, strongly occluded signaling by both receptors to an approximately equal degree. By contrast, in cells coexpressing mGluR1 and mGluR2, combining the same mGluR1 competitive inhibitor with an mGluR1 or mGluR2 NAM yielded partial and full inhibition of the response, respectively, as expected for independently acting receptors. In neurons expressing mGluR1 and mGluR5, the selective NAMs each strongly inhibited the response to glutamate, suggesting that these receptors do not interact as heterodimers, which would not be inhibited by selective NAMs. Finally, evidence for a similar mGluR1/mGluR5 functional dependence is shown in medium spiny striatal neurons. Together, these data demonstrate cooperative signaling between mGluR1 and mGluR5 in a manner inconsistent with heterodimerization, and thus suggest an interaction between homodimers. PMID:25113912

  5. A Subset of Malignant Phyllodes Tumors Express p63 and p40

    PubMed Central

    Cimino-Mathews, Ashley; Sharma, Rajni; Illei, Peter B.; Vang, Russell; Argani, Pedram

    2015-01-01

    Breast phyllodes tumors are rare fibroepithelial neoplasms of variable grade, and one key differential of malignant phyllodes on core biopsy is sarcomatoid carcinoma. p63 is reported to be sensitive and specific for sarcomatoid carcinoma, with rare expression in phyllodes in limited series. The p63 deltaNp63 isoform, p40, is postulated to be more specific for squamous differentiation but has not previously been evaluated in breast phyllodes or sarcomatoid carcinoma. Tissue microarrays containing 34 unambiguous phyllodes tumors (10 benign, 10 borderline, 14 malignant), 13 sarcomatoid carcinomas, and 10 fibroadenomas were labeled by immunohistochemistry for p63, p40, CD34, and cytokeratins AE1/AE3, 34betaE12, and CK8/18. No borderline phyllodes tumor, benign phyllodes tumor, or fibroadenoma labeled with p63, p40, or cytokeratin. However, p63 labeled 57% malignant phyllodes tumors and 62% sarcomatoid carcinomas, and p40 labeled 29% malignant phyllodes (focal) and 46% sarcomatoid carcinomas. Among established markers, cytokeratins labeled 21% malignant phyllodes tumors (focal) and 100% sarcomatoid carcinomas. CD34 labeled 57% malignant phyllodes tumors and no sarcomatoid carcinomas. Focal p63, p40, and cytokeratin labeling can be seen in malignant phyllodes tumors but not in lowergrade fibroepithelial lesions, and immunoreactivity with these markers alone is not diagnostic of sarcomatoid carcinoma on core needle biopsy. In the differential diagnosis of malignant phyllodes, p40 is a more specific but less sensitive marker of sarcomatoid carcinoma than p63. These results are consistent with the sarcoma literature in which p63 labeling has been increasingly reported and suggest caution in classifying malignant spindle cell tumors of the breast on core biopsy. PMID:25046342

  6. RNA and a cell wall component of Enterococcus faecalis IC-1 are required for phagocytosis and interleukin 12 production by the mouse macrophage cell line J774.1.

    PubMed

    Nakase, Junpei; Ukawa, Yuuichi; Takemoto, Syoji; Kubo, Takayoshi; Sagesaka, Yuko M; Aoki-Yoshida, Ayako; Totsuka, Mamoru

    2017-04-13

    Enterococcus faecalis is a resident lactic acid bacterium in the human intestine. Its immunostimulatory action was reported to be enhanced by heat sterilization. To investigate its beneficial actions, we evaluated the ability of 10 E. faecalis strains to induce interleukin-12 (IL-12) production in a mouse macrophage cell line, J774.1 and found that the strain, E. faecalis IC-1, had a potent IL-12-inducing ability. Furthermore, we investigated the underlying mechanism by treating IC-1 cells with RNase or lysozyme. Its activity almost disappeared and an antagonist of Toll-like receptor (TLR) 7 inhibited this activity. Moreover, lysozyme-treated IC-1 bacteria were not phagocytized by J774.1 cells, and did not induce IL-12 production. Based on our results, we propose that macrophages recognize the cell wall components of IC-1, leading to phagocytosis. The IC-1 RNA is then recognized by TLR7, which induces the production of IL-12.

  7. Modulation of the Immune Response to DNA Vaccine Encoding Gene of 8-kDa Subunit of Echinococcus granulosus Antigen B Using Murine Interleukin-12 Plasmid in BALB/c Mice

    PubMed Central

    AZIZI, Hakim; KAZEMI, Bahram; BANDEHPOUR, Mojgan; MOHEBALI, Mehdi; KHAMESIPOUR, Ali; ARYAEIPOUR, Mojgan; YAGHOOBI, Hajar; ROKNI, Mohammad Bagher

    2016-01-01

    Background: The current study was designed to evaluate immune responses induced by DNA vaccines encoding 8-kDa subunit of antigen B (HydI) of Echinococcus granulosus and murine interleukin 12 (IL-12) as genetic adjuvants in BALB/c mice. Methods: Expression plasmid pcDNA3.1 containing HydI (pcHyd1) as vaccine along with the murine interleukin 12 (pcMIL12) as adjuvant were used. Thirty-five mice in the five experimental groups received PBS, empty pcDNA3.1, pcHydІ, pcMIL-12, and pcHydІ+ pcMIL-12 in days zero, 14th and 28th. Two weeks after the last immunization, evaluation of the immune response was performed by evaluating the proliferation of splenic lymphocytes, IFN-γ and IL-4, determination of IgG isotyping titer. Results: Mice that received the pcHydI+pcMIL12 exhibited higher levels of lymphocyte proliferation compared to mice that received the pcHydI alone (P<0.001), and produced significantly more IFN-γ in comparison to other groups (P< 0.001). In addition, they produced significantly less IL-4 than mice receiving the PBS and the empty plasmid (P<0.023). The IgG2a levels were clearly higher in pcHydI+pcMIL12 group in comparison with the groups of pcHydI alone, empty plasmid, and PBS. In contrast, IgG1 was elevated in the group of pcHydI. Conclusion: Co-delivery of IL-12 with DNA encoding 8-kDa subunit of antigen B was effective significantly in inducing the immune response in mice. PMID:28127359

  8. The Ability to Form Homodimers Is Essential for RDM1 to Function in RNA-Directed DNA Methylation

    PubMed Central

    Sasaki, Taku; Lorković, Zdravko J.; Liang, Shih-Chieh; Matzke, Antonius J. M.; Matzke, Marjori

    2014-01-01

    RDM1 (RNA-DIRECTED DNA METHYLATION1) is a small plant-specific protein required for RNA-directed DNA methylation (RdDM). RDM1 interacts with RNA polymerase II (Pol II), ARGONAUTE4 (AGO4), and the de novo DNA methyltransferase DOMAINS REARRANGED METHYLTRANSFERASE2 (DRM2) and binds to methylated single stranded DNA. As the only protein identified so far that interacts directly with DRM2, RDM1 plays a pivotal role in the RdDM mechanism by linking the de novo DNA methyltransferase activity to AGO4, which binds short interfering RNAs (siRNAs) that presumably base-pair with Pol II or Pol V scaffold transcripts synthesized at target loci. RDM1 also acts together with the chromatin remodeler DEFECTIVE IN RNA-DIRECTED DNA METHYLATION1 (DRD1) and the structural-maintenance-of-chromosomes solo hinge protein DEFECTIVE IN MERISTEM SILENCING3 (DMS3) to form the DDR complex, which facilitates synthesis of Pol V scaffold transcripts. The manner in which RDM1 acts in both the DDR complex and as a factor bridging DRM2 and AGO4 remains unclear. RDM1 contains no known protein domains but a prior structural analysis suggested distinct regions that create a hydrophobic pocket and promote homodimer formation, respectively. We have tested several mutated forms of RDM1 altered in the predicted pocket and dimerization regions for their ability to complement defects in RdDM and transcriptional gene silencing, support synthesis of Pol V transcripts, form homodimers, and interact with DMS3. Our results indicate that the ability to form homodimers is essential for RDM1 to function fully in the RdDM pathway and may be particularly important during the de novo methylation step. PMID:24498436

  9. The Asymmetric Binding of PGC-1α to the ERRα and ERRγ Nuclear Receptor Homodimers Involves a Similar Recognition Mechanism

    PubMed Central

    Takacs, Maria; Petoukhov, Maxim V.; Atkinson, R. Andrew; Roblin, Pierre; Ogi, François-Xavier; Demeler, Borries; Potier, Noelle; Chebaro, Yassmine; Dejaegere, Annick; Svergun, Dmitri I.; Moras, Dino; Billas, Isabelle M. L.

    2013-01-01

    Background PGC-1α is a crucial regulator of cellular metabolism and energy homeostasis that functionally acts together with the estrogen-related receptors (ERRα and ERRγ) in the regulation of mitochondrial and metabolic gene networks. Dimerization of the ERRs is a pre-requisite for interactions with PGC-1α and other coactivators, eventually leading to transactivation. It was suggested recently (Devarakonda et al) that PGC-1α binds in a strikingly different manner to ERRγ ligand-binding domains (LBDs) compared to its mode of binding to ERRα and other nuclear receptors (NRs), where it interacts directly with the two ERRγ homodimer subunits. Methods/Principal Findings Here, we show that PGC-1α receptor interacting domain (RID) binds in an almost identical manner to ERRα and ERRγ homodimers. Microscale thermophoresis demonstrated that the interactions between PGC-1α RID and ERR LBDs involve a single receptor subunit through high-affinity, ERR-specific L3 and low-affinity L2 interactions. NMR studies further defined the limits of PGC-1α RID that interacts with ERRs. Consistent with these findings, the solution structures of PGC-1α/ERRα LBDs and PGC-1α/ERRγ LBDs complexes share an identical architecture with an asymmetric binding of PGC-1α to homodimeric ERR. Conclusions/Significance These studies provide the molecular determinants for the specificity of interactions between PGC-1α and the ERRs, whereby negative cooperativity prevails in the binding of the coactivators to these receptors. Our work indicates that allosteric regulation may be a general mechanism controlling the binding of the coactivators to homodimers. PMID:23874451

  10. Different epidermal growth factor (EGF) receptor ligands show distinct kinetics and biased or partial agonism for homodimer and heterodimer formation.

    PubMed

    Macdonald-Obermann, Jennifer L; Pike, Linda J

    2014-09-19

    The EGF receptor has seven different cognate ligands. Previous work has shown that these different ligands are capable of inducing different biological effects, even in the same cell. To begin to understand the molecular basis for this variation, we used luciferase fragment complementation to measure ligand-induced dimer formation and radioligand binding to study the effect of the ligands on subunit-subunit interactions in EGF receptor (EGFR) homodimers and EGFR/ErbB2 heterodimers. In luciferase fragment complementation imaging studies, amphiregulin (AREG) functioned as a partial agonist, inducing only about half as much total dimerization as the other three ligands. However, unlike the other ligands, AREG showed biphasic kinetics for dimer formation, suggesting that its path for EGF receptor activation involves binding to both monomers and preformed dimers. EGF, TGFα, and betacellulin (BTC) appear to mainly stimulate receptor activation through binding to and dimerization of receptor monomers. In radioligand binding assays, EGF and TGFα exhibited increased affinity for EGFR/ErbB2 heterodimers compared with EGFR homodimers. By contrast, BTC and AREG showed a similar affinity for both dimers. Thus, EGF and TGFα are biased agonists, whereas BTC and AREG are balanced agonists with respect to selectivity of dimer formation. These data suggest that the differences in biological response to different EGF receptor ligands may result from partial agonism for dimer formation, differences in the kinetic pathway utilized to generate activated receptor dimers, and biases in the formation of heterodimers versus homodimers. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Serotonin-2A homodimers are needed for signalling via both phospholipase A2 and phospholipase C in transfected CHO cells.

    PubMed

    Iglesias, Alba; Cimadevila, Marta; Cadavid, María Isabel; Loza, María Isabel; Brea, José

    2017-04-05

    Different ligands differentially activate phospholipase A2 (PLA2) and phospholipase C (PLC) signalling pathways that are coupled to the serotonin 2A (5-HT2A) receptor, a class-A G-protein coupled receptor (GPCR). The serotonin 5-HT2A receptor has been shown to be expressed as a homodimer displaying some ligands negative cooperativity between protomers in the PLA2 signalling pathway. We hypothesized that the homodimeric complex is the minimum functional unit required for activation of the PLA2 and PLC pathways by the serotonin 5-HT2A receptor. To investigate this hypothesis, we partially blocked the serotonin 5-HT2A receptors with ritanserin and measured PLA2 and PLC activity simultaneously. We subsequently added the competitive antagonist spiperone to release the inactivator through a crosstalk mechanism and thus allow the dimer to return to a reactive state. Partial inactivation of the homodimer by ritanserin binding decreased the activity of the receptor by 59±13% and 70±4% in the PLA2 and PLC pathways respectively (P<0.001), with no difference in the potency of the serotonin (5-HT) was observed. The subsequent binding of spiperone released ritanserin due to the crosstalk between protomers and recovery of the receptor activity to 74±7% and 72±4%. Negative cooperativity between protomers in the dimer was maintained during arachidonic acid (AA) release after blocking ritanserin, as indicated by the biphasic inhibition curves for clozapine over 1μM serotonin (5-HT) in these conditions. These findings provide evidence that serotonin 5-HT2A receptors must be expressed as homodimers in order to activate both the PLA2 and PLC signalling pathways. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Characterisation and stability of anthocyanins in purple-fleshed sweet potato P40.

    PubMed

    Xu, Jianteng; Su, Xiaoyu; Lim, Soyoung; Griffin, Jason; Carey, Edward; Katz, Benjamin; Tomich, John; Smith, J Scott; Wang, Weiqun

    2015-11-01

    Purple-fleshed sweet potato P40 has been shown to prevent colorectal cancer in a murine model. This study is to identify anthocyanins by using HPLC/MS-MS and assess the stability during various cooking conditions. P40 possesses a high content of anthocyanins up to 14 mg/g dry matter. Total 12 acylated anthocyanins are identified. Top three anthocyanins, e.g., cyanidin 3-caffeoyl-p-hydroxybenzoyl sophoroside-5-glucoside, peonidin 3-caffeoyl sophoroside-5-glucoside, and cyanidin 3-(6"-caffeoyl-6"-feruloylsophoroside)-5-glucoside, account for half of the anthocyanin contents. Over 80% of anthocyanins measured by acid hydrolysis were cyanidin derivatives, indicating P40 is unique when compared with other purple-fleshed sweet potatoes that usually contain more peonidin than cyanidin. Steaming, pressure cooking, microwaving, and frying but not baking significantly reduced 8-16% of total anthocyanin contents. Mono-acylated anthocyanins showed a higher resistance against heat than di- and non-acylated. Among of which, cyanidin 3-p-hydroxybenzoylsophoroside-5-glucoside exhibited the best thermal stability. The stable acylated and cyanidin-predominated anthocyanins in P40 may provide extra benefits for cancer prevention. Copyright © 2014 Elsevier Ltd. All rights reserved.

  13. ThWRKY4 from Tamarix hispida Can Form Homodimers and Heterodimers and Is Involved in Abiotic Stress Responses.

    PubMed

    Wang, Liuqiang; Zheng, Lei; Zhang, Chunrui; Wang, Yucheng; Lu, Mengzhu; Gao, Caiqiu

    2015-11-13

    WRKY proteins are a large family of transcription factors that are involved in diverse developmental processes and abiotic stress responses in plants. However, our knowledge of the regulatory mechanisms of WRKYs participation in protein-protein interactions is still fragmentary, and such protein-protein interactions are fundamental in understanding biological networks and the functions of proteins. In this study, we report that a WRKY protein from Tamarix hispida, ThWRKY4, can form both homodimers and heterodimers with ThWRKY2 and ThWRKY3. In addition, ThWRKY2 and ThWRKY3 can both bind to W-box motif with binding affinities similar to that of ThWRKY4. Further, the expression patterns of ThWRKY2 and ThWRKY3 are similar to that of ThWRKY4 when plants are exposed to abscisic acid (ABA). Subcellular localization shows that these three ThWRKY proteins are nuclear proteins. Taken together, these results demonstrate that ThWRKY4 is a dimeric protein that can form functional homodimers or heterodimers that are involved in abiotic stress responses.

  14. Crystal structure of endonuclease G in complex with DNA reveals how it nonspecifically degrades DNA as a homodimer

    PubMed Central

    Lin, Jason L. J.; Wu, Chyuan-Chuan; Yang, Wei-Zen; Yuan, Hanna S.

    2016-01-01

    Endonuclease G (EndoG) is an evolutionarily conserved mitochondrial protein in eukaryotes that digests nucleus chromosomal DNA during apoptosis and paternal mitochondrial DNA during embryogenesis. Under oxidative stress, homodimeric EndoG becomes oxidized and converts to monomers with diminished nuclease activity. However, it remains unclear why EndoG has to function as a homodimer in DNA degradation. Here, we report the crystal structure of the Caenorhabditis elegans EndoG homologue, CPS-6, in complex with single-stranded DNA at a resolution of 2.3 Å. Two separate DNA strands are bound at the ββα-metal motifs in the homodimer with their nucleobases pointing away from the enzyme, explaining why CPS-6 degrades DNA without sequence specificity. Two obligatory monomeric CPS-6 mutants (P207E and K131D/F132N) were constructed, and they degrade DNA with diminished activity due to poorer DNA-binding affinity as compared to wild-type CPS-6. Moreover, the P207E mutant exhibits predominantly 3′-to-5′ exonuclease activity, indicating a possible endonuclease to exonuclease activity change. Thus, the dimer conformation of CPS-6 is essential for maintaining its optimal DNA-binding and endonuclease activity. Compared to other non-specific endonucleases, which are usually monomeric enzymes, EndoG is a unique dimeric endonuclease, whose activity hence can be modulated by oxidation to induce conformational changes. PMID:27738134

  15. ThWRKY4 from Tamarix hispida Can Form Homodimers and Heterodimers and Is Involved in Abiotic Stress Responses

    PubMed Central

    Wang, Liuqiang; Zheng, Lei; Zhang, Chunrui; Wang, Yucheng; Lu, Mengzhu; Gao, Caiqiu

    2015-01-01

    WRKY proteins are a large family of transcription factors that are involved in diverse developmental processes and abiotic stress responses in plants. However, our knowledge of the regulatory mechanisms of WRKYs participation in protein–protein interactions is still fragmentary, and such protein–protein interactions are fundamental in understanding biological networks and the functions of proteins. In this study, we report that a WRKY protein from Tamarix hispida, ThWRKY4, can form both homodimers and heterodimers with ThWRKY2 and ThWRKY3. In addition, ThWRKY2 and ThWRKY3 can both bind to W-box motif with binding affinities similar to that of ThWRKY4. Further, the expression patterns of ThWRKY2 and ThWRKY3 are similar to that of ThWRKY4 when plants are exposed to abscisic acid (ABA). Subcellular localization shows that these three ThWRKY proteins are nuclear proteins. Taken together, these results demonstrate that ThWRKY4 is a dimeric protein that can form functional homodimers or heterodimers that are involved in abiotic stress responses. PMID:26580593

  16. The active form of the norovirus RNA-dependent RNA polymerase is a homodimer with cooperative activity.

    PubMed

    Högbom, Martin; Jäger, Katrin; Robel, Ivonne; Unge, Torsten; Rohayem, Jacques

    2009-02-01

    Norovirus (NV) is a leading cause of gastroenteritis worldwide and a major public health concern. So far, the replication strategy of NV remains poorly understood, mainly because of the lack of a cell system to cultivate the virus. In this study, the function and the structure of a key viral enzyme of replication, the RNA-dependent RNA polymerase (RdRp, NS7), was examined. The overall structure of the NV NS7 RdRp was determined by X-ray crystallography to a 2.3 A (0.23 nm) resolution (PDB ID 2B43), displaying a right-hand fold typical of the template-dependent polynucleotide polymerases. Biochemical analysis evidenced that NV NS7 RdRp is active as a homodimer, with an apparent K(d) of 0.649 microM and a positive cooperativity (Hill coefficient n(H)=1.86). Crystals of the NV NS7 homodimer displayed lattices containing dimeric arrangements with high shape complementarity statistics. This experimental data on the structure and function of the NV RdRp may set the cornerstone for the development of polymerase inhibitors to control the infection with NV, a medically relevant pathogen.

  17. Formation of retinoid X receptor homodimers leads to repression of T3 response: hormonal cross talk by ligand-induced squelching.

    PubMed Central

    Lehmann, J M; Zhang, X K; Graupner, G; Lee, M O; Hermann, T; Hoffmann, B; Pfahl, M

    1993-01-01

    Thyroid hormone receptors (TRs) form heterodimers with retinoid X receptors (RXRs). Heterodimerization is required for efficient TR DNA binding to most response elements and transcriptional activation by thyroid hormone. RXRs also function as auxiliary proteins for several other receptors. In addition, RXR alpha can be induced by specific ligands to form homodimers. Here we report that RXR-specific retinoids that induce RXR homodimers are effective repressors of the T3 response. We provide evidence that this repression by RXR-specific ligands occurs by sequestering of RXR from TR-RXR heterodimers into RXR homodimers. This ligand-induced squelching may represent an important mechanism by which RXR-specific retinoids and 9-cis retinoic acid mediate hormonal cross talk among a subfamily of nuclear receptors activated by structurally unrelated ligands. Images PMID:8246986

  18. The effects of nonidet P40 on the function of rat peritoneal mast cells in vitro.

    PubMed

    Batchelor, K W; Stanworth, D R

    1981-01-01

    1 Treatment of purified rat peritoneal mast cells at 37 degrees C with concentrations of the non-ionic detergent nonidet P40 (NP40) up to 0.005% (v/v) failed to reduce their viability. 2 There was a marked reduction in the histamine releasing capacity of NP40-treated mast cells upon challenge with a variety of selective (adrenocorticotrophic hormone 1-24 (Synacthen), rabbit anti-rat IgE antiserum, adenosine triphosphate (ATP) and the calcium ionophore, A 23187) and non-selective (rabbit anti-rat mast cell antiserum plus complement) histamine liberators. 3 Nonidet P40 (0.005%) was found to reduce the activity of a mast cell membrane 'ecto-enzyme', calcium-activated ATPase, by about 45% when presented at the time of its assay.

  19. Prismatic-cased Li/(CF(x))n P-40 Cell Performance under Resistive Loads

    NASA Technical Reports Server (NTRS)

    King, L. M.; Margalit, N.

    1996-01-01

    It was concluded that the P-40 cell performed well in the -23.5 deg. C to 71 deg. range with resistive loads from 1.35 ohms to 675 ohms. Storage with subsequent discharge: tests performed to date show little self-discharge up to 2 years. And good pulse capability with 3, 2, and 1 ohm loads at 0, 24, and 49 deg. C.

  20. Nonidet P40 and the retrograde transport of horseradish peroxidase in undamaged visceral nerves.

    PubMed

    Rogers, R C; Liholtz, L A; Ebly, E M

    1982-06-01

    The cell bodies of origin of peripheral nerves, in particular visceral nerves, are often difficult to identify using standard horseradish peroxidase (HRP) methods. The non-ionic surfactant Nonidet-P40, when applied to intact peripheral nerve along with HRP, allows the investigator to examine the neurons of origin of the nerve without cutting the fibers or injecting label into its peripheral terminal field.

  1. Prismatic-cased Li/(CF(x))n P-40 Cell Performance under Resistive Loads

    NASA Technical Reports Server (NTRS)

    King, L. M.; Margalit, N.

    1996-01-01

    It was concluded that the P-40 cell performed well in the -23.5 deg. C to 71 deg. range with resistive loads from 1.35 ohms to 675 ohms. Storage with subsequent discharge: tests performed to date show little self-discharge up to 2 years. And good pulse capability with 3, 2, and 1 ohm loads at 0, 24, and 49 deg. C.

  2. Nonidet P-40 extraction of lymphocyte plasma membrane. Characterization of the insoluble residue.

    PubMed

    Davies, A A; Wigglesworth, N M; Allan, D; Owens, R J; Crumpton, M J

    1984-04-01

    Purified preparations of lymphocyte plasma membrane were extracted exhaustively with Nonidet P-40 in Dulbecco's phosphate-buffered saline medium. The insoluble fraction, as defined by sedimentation at 10(6) g-min, contained about 10% of the membrane protein as well as cholesterol and phospholipid. The lipid/protein ratio, cholesterol/phospholipid ratio and sphingomyelin content were increased in the residue. Density-gradient centrifugation suggested that the lipid and protein form a common entity. As judged by sodium dodecyl sulphate/polyacrylamide-gel electrophoresis, the Nonidet P-40-insoluble fractions of the plasma membranes of human B lymphoblastoid cells and pig mesenteric lymph-node lymphocytes possessed similar qualitative polypeptide compositions but differed quantitatively. Both residues comprised major polypeptides of Mr 28 000, 33 000, 45 000 and 68 000, together with a prominent band of Mr 120 000 in the human and of Mr 200 000 in the pig. The polypeptides of Mr 28 000, 33 000, 68 000 and 120 000 were probably located exclusively in the Nonidet P-40-insoluble residue, which also possessed a 4-fold increase in 5'-nucleotidase specific activity. The results indicate that a reproducible fraction of lymphocyte plasma membrane is insoluble in non-ionic detergents and that this fraction possesses a unique polypeptide composition. By analogy with similar studies with erythrocyte ghosts, it appears likely that the polypeptides are located on the plasma membrane's cytoplasmic face.

  3. Homodimer of p50 (NF kappa B1) does not introduce a substantial directed bend into DNA according to three different experimental assays.

    PubMed Central

    Kuprash, D V; Rice, N R; Nedospasov, S A

    1995-01-01

    Transcription factors can distort the conformation of the DNA double helix upon binding to their target sites. Previously, studies utilizing circular permutation--electrophoretic mobility shift assay suggested that the homodimer of p50 (NF kappa B1), canonical NF-kappa B (p65-p50), as well as several non-canonical NF-kappa B/Rel complexes, may induce substantial DNA bending at the binding site. Here we have applied three additional experimental approaches, helical phasing analysis, minicircle binding and cyclization kinetics, and conclude that the homodimer of p50 introduces virtually no directed bend into the consensus kappa B sequences GGGACTTTCC or GGGAATTCCC. Images PMID:7885838

  4. Structure of the homodimer of uridine phosphorylase from Salmonella typhimurium in the native state at 1.9 Å resolution

    NASA Astrophysics Data System (ADS)

    Timofeev, V. I.; Pavlyuk, B. F.; Lashkov, A. A.; Seregina, T. A.; Gabdulkhakov, A. G.; Vaĭnshteĭn, B. K.; Mikhaĭlov, A. M.

    2007-11-01

    Uridine phosphorylase ( UPh) belongs to pyrimidine nucleoside phosphorylases. This enzyme catalyzes cleavage of the C-N glycoside bond in uridine to form uracil and ribose-1’-phosphate. Uridine phosphorylase supplies cells with nucleotide precursors by catalyzing the phosphorolysis of purine and pyrimidine nucleosides. This is an alternative to de novo nucleotide synthesis. The three-dimensional structure of native uridine phosphorylase from Salmonella typhimurium ( StUPh) in a new crystal form was solved and refined at 1.90 Å resolution ( R st = 20.37%; R free = 24.69%; the rmsd of bond lengths and bond angles are 0.009 Å and 1.223°, respectively). A homodimer containing two asynchronously functioning active sites was demonstrated to be the minimum structural unit necessary for function of the hexameric StUPh molecule ( L 33 L 2). Each active site is formed by amino acid residues of both subunits.

  5. Thermal and chemical unfolding pathways of PaSdsA1 sulfatase, a homo-dimer with topologically interlinked chains.

    PubMed

    Aguirre, César; Goto, Yuji; Costas, Miguel

    2016-01-01

    Understanding the mechanisms as to how interlinked proteins entangle and fold is a challenge. PaSdsA1 sulfatase is a homo-dimer containing two zinc atoms per monomer. The monomer chains are interlinked in a dimerization domain. To study the unfolding pathways denaturation experiments were performed. In the native protein three forms coexist in chemical equilibrium, each with a different number of zinc atoms. In the chemical unfolding of the holo-dimers the entanglement of the chains is preserved and acts as a 'folding seed', allowing the unfolding process to be reversible. Thermal irreversible unfolding of the holo-dimers favours dissociation, producing monomers that are SDS-stabilized. The thermal unfolding of these monomers is reversible. However, it is not possible to form dimers from unfolded monomers.

  6. A novel EID family member, EID-3, inhibits differentiation and forms a homodimer or heterodimer with EID-2

    SciTech Connect

    Sasajima, Yuka; Tanaka, Hiroyuki; Miyake, Satoshi; Yuasa, Yasuhito . E-mail: yuasa.monc@tmd.ac.jp

    2005-08-05

    The EID family members, i.e., E1A-like inhibitor of differentiation-1 (EID-1) and EID-1-like inhibitor of differentiation-2 (EID-2), were identified as negative regulators of cellular differentiation. EID-1 seems to inhibit differentiation by blocking histone acetyltransferase activity and EID-2 possibly inhibits differentiation through binding to class I histone deacetylases (HDACs). Here, we report a novel inhibitor of differentiation exhibiting homology with EID-2 termed EID-3 (EID-2-like inhibitor of differentiation-3). Like EID-2, EID-3 inhibited MyoD- and GR{alpha}-dependent transcription and blocked muscle differentiation in cultured cells by binding to class I HDACs. Unlike that of EID-2, the C-terminus, but not the N-terminus, of EID-3 was required for nuclear localization. EID-3 formed a homodimer or heterodimer with EID-2. These results suggest that EID-3 inhibits differentiation by blocking transcription as a complex in cells.

  7. Enhanced Interleukin-12 and CD40 Ligand Activities but Reduced Staphylococcus aureus Cowan 1-Induced Responses Suggest a Generalized and Progressively Impaired Type 1 Cytokine Pattern for Human Schistosomiasis

    PubMed Central

    Montenegro, Silvia M. L.; Abath, Frederico G. C.; Domingues, Ana Lúcia C.; Melo, Wlademir G.; Morais, Clarice N. L.; Coutinho, Eridan M.; Mahanty, Siddhartha; Wynn, Thomas A.

    2002-01-01

    Whole-blood-cell cultures from schistosomiasis patients were stimulated with a variety of T-cell-dependent and T-cell-independent stimuli to determine whether the defect in type 1 cytokine expression observed following helminth infection is associated with alterations in interleukin-12 (IL-12) or CD40 ligand (CD40L) responsiveness. Cultures from uninfected individuals produced abundant gamma interferon in response to Staphylococcus aureus Cowan 1 (SAC), while patients with intestinal and hepatosplenic disease displayed intermediate and weak responses, respectively. Importantly, the decrease in type 1 cytokine expression was not attributed to defects in IL-12- or CD40L-induced activity. Indeed, schistosomiasis patients displayed heightened responses and even produced more biologically active IL-12 when stimulated with SAC and CD40L than did uninfected controls. Finally, additional studies suggested only a partial role for IL-10, since intestinal patients were the only group that overproduced this downregulatory cytokine. Together, these studies demonstrate that the type 1 deficiency in chronic hepatosplenic schistosomiasis is not related to specific defects in IL-12, IL-10, or CD40L activity, although changes in the functional status of antigen-presenting cells appear to be involved. PMID:12379664

  8. The effects of Alcea rosea L., Malva sylvestris L. and Salvia libanotica L. water extracts on the production of anti-egg albumin antibodies, interleukin-4, gamma interferon and interleukin-12 in BALB/c mice.

    PubMed

    El Ghaoui, Walid Bou Jaber; Ghanem, Elsa Bou; Chedid, Lara Abou; Abdelnoor, Alexander M

    2008-12-01

    Polysaccharides obtained from certain plants have been reported to have immunomodulatory properties. As a consequence of these reports the aim of this study was to investigate some immunomodulatory properties of water extracts of Alcea rosea L. (ARE), Malva sylvestris L. (MSE) and Salvia libanotica L. (SLE).Groups of egg albumin (EA)-immunized and -non-immunized Balb/c mice were treated with the carbohydrate-rich water extracts. Mice from each group were bled and their spleens removed at 3, 6 and 10 days post-immunization/treatment. Anti-egg albumin antibody levels in the processed sera were determined by an enzyme linked immunosorbent assay (ELISA). RNA was extracted from spleen cells and interleukin-4 (IL-4), interleukin-12 (IL-12) and gamma-interferon transcripts were determined by the reverse transcription polymerase chain reaction (RT-PCR).ARE appeared to boost the antibody response to EA, but had no effect on IL-4 and gamma-interferon gene transcription. MSE and SLE appeared to have no effect on anti-EA antibody production, but enhanced IL-12 and gamma-interferon gene transcription. MSE appeared to switch off, and SLE had no effect on, IL-4 transcription.In conclusion, it appears that ARE is a B-lymphocyte polyclonal activator, and MSE and SLE are macrophage and T helper-1 (Th-1) activators. (c) 2008 John Wiley & Sons, Ltd.

  9. A single intratumoral injection of a fiber-mutant adenoviral vector encoding interleukin 12 induces remarkable anti-tumor and anti-metastatic activity in mice with Meth-A fibrosarcoma.

    PubMed

    Gao, Jian-Qing; Sugita, Toshiki; Kanagawa, Naoko; Iida, Keisuke; Eto, Yusuke; Motomura, Yoshiaki; Mizuguchi, Hiroyuki; Tsutsumi, Yasuo; Hayakawa, Takao; Mayumi, Tadanori; Nakagawa, Shinsaku

    2005-03-25

    Cytokine-encoding viral vectors are considered to be promising in cancer gene immunotherapy. Interleukin 12 (IL-12) has been used widely for anti-tumor treatment, but the administration route and tumor characteristics strongly influence therapeutic efficiency. Meth-A fibrosarcoma has been demonstrated to be insensitive to IL-12 treatment via systemic administration. In the present study, we developed an IL-12-encoding fiber-mutant adenoviral vector (AdRGD-IL-12) that showed enhanced gene transfection efficiency in Meth-A tumor cells, and the production of IL-12 p70 in the culture supernatant from transfected cells was confirmed by ELISA. In therapeutic experiments, a single low-dose (2 x 10(7) plaque-forming units) intratumoral injection of AdRGD-IL-12 elicited pronounced anti-tumor activity and notably prolonged the survival of Meth-A fibrosarcoma-bearing mice. Immunohistochemical staining revealed that the IL-12 vector induced the accumulation of T cells in tumor tissue. Furthermore, intratumoral administration of the vector induced an anti-metastasis effect as well as long-term specific immunity against syngeneic tumor challenge.

  10. Adenovirus-mediated tumor-specific combined gene therapy using Herpes simplex virus thymidine/ganciclovir system and murine interleukin-12 induces effective antitumor activity against medullary thyroid carcinoma.

    PubMed

    Yamazaki, Masanori; Straus, Francis H; Messina, Marinella; Robinson, Bruce G; Takeda, Teiji; Hashizume, Kiyoshi; DeGroot, Leslie J

    2004-01-01

    The present treatment of advanced and metastatic medullary thyroid carcinoma (MTC) is unsatisfactory. Tissue-specific cancer gene therapy is a novel alternative approach. We developed a recombinant adenovirus expressing Herpes simplex type 1 thymidine kinase (HSVtk) driven by a modified CALC-I promoter TCP (AdTCPtk). Infection with this virus showed efficient cytotoxic effect on MTC cell lines (rMTC and TT cells) after treatment with ganciclovir (GCV) in vitro. In a syngenic WAG/Rij rat model, the combination of AdTCPtk/GCV treatment with administration of murine interleukin-12 (mIL-12) expressing adenovirus under control of TCP (AdTCPmIL-12) resulted in effective growth suppression of tumor at the treated site and also at a distant untreated site, in comparison to treatment with AdTCPtk/GCV or AdTCPmIL-12 alone. Moreover, intravenous injection of AdTCPtk, or AdTCPtk+AdTCPmIL-12, followed by administration of GCV, did not cause evident toxicity after administration of GCV. These results indicate that this combined system can provide an effective therapy for metastatic MTC with minimal toxicity.

  11. Allosteric interactions across native adenosine-A3 receptor homodimers: quantification using single-cell ligand-binding kinetics

    PubMed Central

    May, Lauren T.; Bridge, Lloyd J.; Stoddart, Leigh A.; Briddon, Stephen J.; Hill, Stephen J.

    2011-01-01

    A growing awareness indicates that many G-protein-coupled receptors (GPCRs) exist as homodimers, but the extent of the cooperativity across the dimer interface has been largely unexplored. Here, measurement of the dissociation kinetics of a fluorescent agonist (ABA-X-BY630) from the human A1 or A3 adenosine receptors expressed in CHO-K1 cells has provided evidence for highly cooperative interactions between protomers of the A3-receptor dimer in single living cells. In the absence of competitive ligands, the dissociation rate constants of ABA-X-BY630 from A1 and A3 receptors were 1.45 ± 0.05 and 0.57 ± 0.07 min−1, respectively. At the A3 receptor, this could be markedly increased by both orthosteric agonists and antagonists [15-, 9-, and 19-fold for xanthine amine congener (XAC), 5′-(N-ethyl carboxamido)adenosine (NECA), and adenosine, respectively] and reduced by coexpression of a nonbinding (N250A) A3-receptor mutant. The changes in ABA-X-BY630 dissociation were much lower at the A1 receptor (1.5-, 1.4-, and 1.5-fold). Analysis of the pEC50 values of XAC, NECA, and adenosine for the ABA-X-BY630-occupied A3-receptor dimer yielded values of 6.0 ± 0.1, 5.9 ± 0.1, and 5.2 ± 0.1, respectively. This study provides new insight into the spatial and temporal specificity of drug action that can be provided by allosteric modulation across a GPCR homodimeric interface.—May, L. T., Bridge, L. J., Stoddart, L. A., Briddon, S. J., Hill, S. J. Allosteric interactions across native adenosine-A3 receptor homodimers: quantification using single-cell ligand-binding kinetics. PMID:21715680

  12. Communication between the ERRalpha homodimer interface and the PGC-1alpha binding surface via the helix 8-9 loop.

    PubMed

    Greschik, Holger; Althage, Magnus; Flaig, Ralf; Sato, Yoshiteru; Chavant, Virginie; Peluso-Iltis, Carole; Choulier, Laurence; Cronet, Philippe; Rochel, Natacha; Schüle, Roland; Strömstedt, Per-Erik; Moras, Dino

    2008-07-18

    Although structural studies on the ligand-binding domain (LBD) have established the general mode of nuclear receptor (NR)/coactivator interaction, determinants of binding specificity are only partially understood. The LBD of estrogen receptor-alpha (ERalpha), for example, interacts only with a region of peroxisome proliferator-activated receptor coactivator (PGC)-1alpha, which contains the canonical LXXLL motif (NR box2), whereas the LBD of estrogen-related receptor-alpha (ERRalpha) also binds efficiently an untypical, LXXYL-containing region (NR box3) of PGC-1alpha. Surprisingly, in a previous structural study, the ERalpha LBD has been observed to bind NR box3 of transcriptional intermediary factor (TIF)-2 untypically via LXXYL, whereas the ERRalpha LBD binds this region of TIF-2 only poorly. Here we present a new crystal structure of the ERRalpha LBD in complex with a PGC-1alpha box3 peptide. In this structure, residues N-terminal of the PGC-1alpha LXXYL motif formed contacts with helix 4, the loop connecting helices 8 and 9, and with the C terminus of the ERRalpha LBD. Interaction studies using wild-type and mutant PGC-1alpha and ERRalpha showed that these contacts are functionally relevant and are required for efficient ERRalpha/PGC-1alpha interaction. Furthermore, a structure comparison between ERRalpha and ERalpha and mutation analyses provided evidence that the helix 8-9 loop, which differs significantly in both nuclear receptors, is a major determinant of coactivator binding specificity. Finally, our results revealed that in ERRalpha the helix 8-9 loop allosterically links the LBD homodimer interface with the coactivator cleft, thus providing a plausible explanation for distinct PGC-1alpha binding to ERRalpha monomers and homodimers.

  13. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  14. Novel homodimer model of the β-adrenergic receptor in complex with free fatty acids and cholesterol: first-principles calculation studies

    PubMed Central

    Nakano, Yuka; Watanabe, Yasuo; Ito, Yoshihiko; Yamada, Shizuo; Tokiwa, Hiroaki

    2012-01-01

    We propose a theoretical novel homodimer model of the β- adrenergic receptor (βAR) in complex with a heterogeneous mixture of free fatty acids (FFAs) and cholesterol based on first-principles calculations. We used the density-functional-based tight binding with dispersion (DFTB-D) method, which accurately evaluates van der Waals interactions between FFAs and amino acid residues in the receptor. The calculations suggest that a stable homodimer of bAR can form a complex with FFAs and cholesterol by extensive van der Waals interactions in the cell membrane, and that the heterogeneous composition of the FFAs is important for the stability of the homodimer complex. The stable van der Waals interactions propagate from one of the bAR to the other through the cholesterol and FFAs in the homodimer complex. The energy propagation in the complex has the potential to enhance molecular signaling in adipocytes, because the stability of the complex can influence anti-adiposity effects after oral treatment of the FFA components. PMID:23275728

  15. Novel homodimer model of the β-adrenergic receptor in complex with free fatty acids and cholesterol: first-principles calculation studies.

    PubMed

    Nakano, Yuka; Watanabe, Yasuo; Ito, Yoshihiko; Yamada, Shizuo; Tokiwa, Hiroaki

    2012-01-01

    We propose a theoretical novel homodimer model of the β- adrenergic receptor (βAR) in complex with a heterogeneous mixture of free fatty acids (FFAs) and cholesterol based on first-principles calculations. We used the density-functional-based tight binding with dispersion (DFTB-D) method, which accurately evaluates van der Waals interactions between FFAs and amino acid residues in the receptor. The calculations suggest that a stable homodimer of bAR can form a complex with FFAs and cholesterol by extensive van der Waals interactions in the cell membrane, and that the heterogeneous composition of the FFAs is important for the stability of the homodimer complex. The stable van der Waals interactions propagate from one of the bAR to the other through the cholesterol and FFAs in the homodimer complex. The energy propagation in the complex has the potential to enhance molecular signaling in adipocytes, because the stability of the complex can influence anti-adiposity effects after oral treatment of the FFA components.

  16. A new quadruple hydrogen-bonding module with a DDAA array: formation of a stable homodimer without competition from undesired hydrogen-bonded dimers.

    PubMed

    Hisamatsu, Yosuke; Shirai, Naohiro; Ikeda, Shin-ichi; Odashima, Kazunori

    2009-10-01

    A new DDAA hydrogen-bonding module (UImp-2), based on a ureidoimidazo[1,2-a]pyrimidine structure, forms a highly stable homodimer (K(dim) > 1.1 x 10(5) M(-1) in CDCl(3)) without competition from undesired hydrogen-bonded dimers.

  17. Electrophoretic separation of A gamma and G gamma human globin chains in Nonidet P-40.

    PubMed

    Guerrasio, A; Saglio, G; Mazza, U; Pich, P; Camaschella, C; Ricco, G; Gianazza, E; Righetti, P G

    1979-11-15

    Electrophoresis in cellulose acetate in the presence of 3% Nonidet P-40 can resolve two neutral genetic variants, A gamma and G gamma human fetal globin chains. The ratio of these two chains, determined by densitometry of the electrophoretic strips, is in excellent agreement with the Gly-Ala ratio obtained by chemical analysis of the cyanogen bromide fragment gamma CB3. It is suggested that the detergent binds preferentially to the hydrophobic amino acid segment 133-141 in the A gamma chain, thus masking either a Lys or an Arg residue at the two extremes.

  18. An HLA-B27 Homodimer Specific Antibody Recognizes a Discontinuous Mixed-Disulfide Epitope as Identified by Affinity-Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Iuraşcu, Marius-Ionuţ; Marroquin Belaunzanar, Osiris; Cozma, Claudia; Petrausch, Ulf; Renner, Christoph; Przybylski, Michael

    2016-06-01

    HLA-B27 homodimer formation is believed to be a hallmark of HLA-B27 associated spondyloarthritides. Recently, we have generated a homodimer-specific monoclonal antibody (HD6) and have demonstrated that HLA-B27 homodimer complexes are present on monocytes of healthy HLA-B27 gene carriers at low levels, with significantly increased levels at active disease. The capability of the HD6 antibody to discriminate between correctly formed HLA-B27 heterotrimers and pathology-associated homodimers is striking and cannot be explained by the primary structure of HLA-B27. We hypothesized that HD6 accesses a unique epitope and used affinity-mass spectrometry for its identification. The HD6 antibody was immobilized on an activated sepharose affinity column, and HLA-B27 homodimer characterized for affinity. The epitope was identified by proteolytic epitope excision and MALDI mass spectrometry, and shown to comprise a discontinuous Cys-203- 257-Cys mixed-disulfide peptide structure that is not accessible in HLA-B27 heterotrimers due to protection by noncovalently linked β2-microglobulin. The epitope peptides were synthesized by solid phase peptide synthesis, and the two monomeric peptide components, HLA-B27(203-219) and HLA-B27(257-273), as well as the homo- and hetero-dimeric disulfide linked combinations prepared. The affinity binding constants KD towards the antibodies were determined using a surface acoustic wave (SAW) biosensor, and showed the highest affinity with a KD of approximately 40 nM to the HD6 antibody for the (203-219)-SS-(257-273) mixed disulfide epitope.

  19. Phosphorylation of phosphatase inhibitor-2 (i-2) by a bovine thymus tyrosine protein kinase, p40

    SciTech Connect

    DePaoli-Roach, A.A.; Votaw, P.; Zioncheck, T.F.; Harrison, M.L.; Geahlen, R.L.

    1987-05-01

    Phosphatase inhibitor-2, a heat stable protein of Mr 22,800, is a regulatory component of the ATP-Mg-dependent phosphatase. It has been shown that in the cell tyrosine kinase activation can result in altered phosphorylation at serine and/or threonine residues, but the mechanism involved is unknown. The authors have found that i-2 is a substrate for a tyrosine specific protein kinase, p40, purified from bovine thymus. The purified enzyme is a monomer of Mr 40,000 that is autophosphorylated at tyrosine residue(s). The stoichiometry of phosphorylation of i-2 by this tyrosine protein kinase is up to 1 mol of phosphate per mol of i-2. Phosphoaminoacid analysis revealed that all the phosphate introduced was associated with tyrosine residues. Mapping of TSP-tryptic peptides by TLE and isoelectric focusing showed one major labeled fragment. Using the ATP-Mg-dependent phosphatase, a lesser extent of phosphorylation of i-2 by p40 was obtained although partial activation of the phosphatase was observed. The effect on the activity was not due to FA/GSK-3 contamination. These results could provide an important link between tyrosine protein kinase activity and modulation of phosphorylation at serine and/or threonine residues.

  20. Interleukin-12- and Gamma Interferon-Dependent Innate Immunity Are Essential and Sufficient for Long-Term Survival of Passively Immunized Mice Infected with Herpes Simplex Virus Type 1

    PubMed Central

    Vollstedt, Sabine; Franchini, Marco; Alber, Gottfried; Ackermann, Mathias; Suter, Mark

    2001-01-01

    Interferon (IFN) type I (alpha/beta IFN [IFN-α/β]) is very important in directly controlling herpes simplex virus type I (HSV-1) replication as well as in guiding and upregulating specific immunity against this virus. By contrast, the roles of IFN type II (IFN-γ) and antibodies in the defense against HSV-1 are not clear. Mice without a functional IFN system and no mature B and T cells (AGR mice) did not survive HSV-1 infection in the presence or absence of neutralizing antibodies to the virus. Mice without a functional IFN type I system and with no mature B and T cells (AR129 mice) were unable to control infection with as little as 10 PFU of HSV-1 strain F. By contrast, in the presence of passively administered neutralizing murine antibodies to HSV-1, some AR129 mice survived infection with up to104 PFU of HSV-1. This acute immune response was dependent on the presence of interleukin-12 (IL-12) p75. Interestingly, some virus-infected mice stayed healthy for several months, at which time antibody to HSV-1 was no longer detectable. Treatment of these virus-exposed mice with dexamethasone led to death in approximately 40% of the mice. HSV-1 was found in brains of mice that did not survive dexamethasone treatment, whereas HSV-1 was absent in those that survived the treatment. We conclude that in the presence of passively administered HSV-1-specific antibodies, the IL-12-induced IFN-γ-dependent innate immune response is able to control low doses of virus infection. Surprisingly, in a significant proportion of these mice, HSV-1 appears to persist in the absence of antibodies and specific immunity. PMID:11559791

  1. The potential of interleukin 12 receptor beta 2 (IL12RB2) and tumor necrosis factor receptor superfamily member 8 (TNFRSF8) gene as diagnostic biomarkers of oral lichen planus (OLP).

    PubMed

    Jeon, Seung-Ho; Jeon, Eun-Hyoung; Lee, Jin-Yong; Kim, Yeon-Sun; Yoon, Hye-Jung; Hong, Sam-Pyo; Lee, Jong-Ho

    2015-01-01

    This study evaluated the potential of interleukin 12 receptor beta 2 and tumor necrosis factor receptor superfamily member 8 as diagnostic biomarkers of oral lichen planus (OLP). The mRNA expression of IL12RB2 and TNFRSF8 in FFPE OLP samples (OLP group, n = 38) were investigated with quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis and compared to those of chronic non-specific mucositis (Non-OLP group, n = 25) and normal mucosa (Normal group, n = 18). Predictive modeling of the expression of IL12RB2 and TNFRSF8 was constructed using support vector machine (SVM), random forest (RF), linear discriminant analysis (LDA), neural network (NN) and naive Bayes (NB) methods. Normalized expression of IL12RB2 in the OLP group (3.78 ± 1.67) was significantly higher than the Normal group (1.97 ± 1.12), but lower than the Non-OLP group (6.86 ± 1.67). TNFRSF8 gene expression in the OLP group (7.46 ± 1.51) was significantly higher than the Normal group (2.90 ± 1.61), but no significant difference was found between the OLP and Non-OLP groups. The ratio of IL12RB2/TNFRSF8 in the OLP group (0.52 ± 0.23) was significantly lower than the Normal group (0.74 ± 0.39) and the Non-OLP group (1.07 ± 0.38). In the predictive modeling, the area under receiver operating characteristic (ROC) curves (AUC) ranged from 0.83-0.92 and their accuracy was higher than 0.75 in all methods. The IL12RB2/TNFRSF8 ratio can be a useful diagnostic tool for OLP.

  2. Immunization of Cats against Feline Immunodeficiency Virus (FIV) Infection by Using Minimalistic Immunogenic Defined Gene Expression Vector Vaccines Expressing FIV gp140 Alone or with Feline Interleukin-12 (IL-12), IL-16, or a CpG Motif

    PubMed Central

    Leutenegger, Christian M.; Boretti, Felicitas S.; Mislin, Caroline N.; Flynn, J. Norman; Schroff, Matthias; Habel, Andre; Junghans, Claas; Koenig-Merediz, Sven A.; Sigrist, Brigitte; Aubert, Andre; Pedersen, Niels C.; Wittig, Burghardt; Lutz, Hans

    2000-01-01

    Four groups of cats, each containing four animals, were immunized at 0, 3, and 6 weeks with minimalistic immunogenic defined gene expression vector (MIDGE) vaccines containing the gene(s) for feline immunodeficiency virus (FIV) gp140, FIV gp140 and feline interleukin-12 (IL-12), FIV gp140 and feline IL-16, or FIV gp140 and a CpG motif. MIDGEs were coated onto gold beads and injected intradermally with a gene gun. A fifth group of four cats were immunized in an identical manner but with blank gold beads. All cats were challenge exposed to virulent FIV 4 weeks following the final immunization, and the course of infection was monitored. The two groups of cats immunized with the FIV gp140 gene alone or with blank gold particles became highly viremic and seroconverted as early as 4 weeks after infection. In contrast, three of four cats immunized with FIV gp140 in combination with feline IL-12 failed to become viremic or seropositive, as has been shown elsewhere (F. S. Boretti, C. M. Leutenegger, C. Mislin, et al., AIDS 14:1749–1757, 2000). Here we show the effect of IL-12 when used as an adjuvant on the viral RNA and DNA load and on the cytokine profile. In addition, the two groups of cats immunized either with gp140 and IL-16 or with gp140 and the CpG had greatly reduced viremia. Protection correlated weakly with cytotoxic T-lymphocyte activity and increased cytokine transcription of IL-12, gamma interferon, and IL-10 by peripheral blood mononuclear cells in the postchallenge period. This study extends the data on IL-12 and provides new results on CpG motifs and IL-16 used as adjuvants in the FIV cat model. PMID:11044089

  3. Clinical Impact of Immune Microenvironment in Stage I Lung Adenocarcinoma: Tumor Interleukin-12 Receptor β2 (IL-12Rβ2), IL-7R, and Stromal FoxP3/CD3 Ratio Are Independent Predictors of Recurrence

    PubMed Central

    Suzuki, Kei; Kadota, Kyuichi; Sima, Camelia S.; Nitadori, Jun-ichi; Rusch, Valerie W.; Travis, William D.; Sadelain, Michel; Adusumilli, Prasad S.

    2013-01-01

    Purpose Mounting evidence suggests that tumor-infiltrating immune cells have prognostic value for patients with solid organ malignancies. Our aim was to investigate the prognostic significance of the immune microenvironment in patients with stage I lung adenocarcinoma (ADC). Patients and Methods Using tissue microarray and immunohistochemistry, we investigated eight types of tumor-infiltrating immune cells in the tumor nest and tumor-associated stroma as well as tumor expression of five cytokines in a uniform cohort of 956 patients with stage I lung ADC (478 each in training and validation cohorts). Results Although a high density of stromal forkhead box P3 (FoxP3) –positive cells was associated with shorter recurrence-free probability (RFP; P = .043), the relative proportion of stromal FoxP3 to CD3 was a stronger predictor of recurrence (5-year RFP, 85% for high v 77% for low ratio; P = .004). High expression of tumor interleukin-12 receptor β2 (IL-12Rβ2) was associated with better outcome (5-year RFP, 90% for high v 80% for low expression; P = .026), whereas high expression of tumor IL-7R was associated with worse outcome (5-year RFP, 76% for high v 86% for low expression; P = .001). In multivariate analysis, these immune markers were independently associated with recurrence. Although IL-7R remained significant for poor overall survival, all the markers remained prognostic for recurrence in patients with stages IA and IB disease as well as for patients with tumors ≤ 2 cm. Conclusion Our investigation confirms the biologic and prognostic significance of the tumor immune microenvironment for patients with stage I lung ADC and provides support for its use to stratify clinical outcome and immunotherapeutic interventions. PMID:23269987

  4. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression

    PubMed Central

    Sin, Jeong-Im

    2009-01-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-γ and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested. PMID:19740332

  5. Suppression of antitumour protective cytotoxic T lymphocyte responses to a human papillomavirus 16 E7 DNA vaccine by coinjection of interleukin-12 complementary DNA: involvement of nitric oxide in immune suppression.

    PubMed

    Sin, Jeong-Im

    2009-09-01

    Interleukin-12 (IL-12) has been shown to enhance cellular immunity in vitro and in vivo. The beneficial roles of IL-12 as a DNA vaccine adjuvant have been commonly observed. Here the impact of IL-12 complementary DNA (cDNA) as an adjuvant for a human papillomavirus (HPV) type 16 E7 DNA vaccine is investigated in a mouse tumour model. Coinjection of E7 DNA vaccine with IL-12 cDNA completely suppressed antigen-specific cytotoxic T-lymphocyte (CTL) responses, leading to a complete loss of antitumour protection from a tumour cell challenge. In addition, antigen-specific antibody and T helper cell proliferative responses were also suppressed by IL-12 cDNA coinjection. This inhibition was observed over different IL-12 cDNA doses. Furthermore, separate leg injections of IL-12 and E7 cDNAs suppressed antigen-specific CTL and tumour protective responses, but not antibody and T helper cell proliferative responses, suggesting different pathways for suppression of these two separate responses. Further knockout animal studies demonstrated that interferon-gamma and nitric oxide are not directly associated with suppression of antigen-specific antibody responses by IL-12 cDNA coinjection. However, nitric oxide was found to be involved in suppression of antigen-specific CTL and tumour protective responses by IL-12 cDNA coinjection. These data suggest that coinjection of IL-12 cDNA results in suppression of E7-specific CTL responses through nitric oxide, leading to a loss of antitumour resistance in this DNA vaccine model. This study further shows that the adjuvant effect of IL-12 is dependent on the antigen types tested.

  6. An Optimized Hepatitis C Virus E2 Glycoprotein Core Adopts a Functional Homodimer That Efficiently Blocks Virus Entry.

    PubMed

    McCaffrey, Kathleen; Boo, Irene; Owczarek, Catherine M; Hardy, Matthew P; Perugini, Matthew A; Fabri, Louis; Scotney, Pierre; Poumbourios, Pantelis; Drummer, Heidi E

    2017-03-01

    The hepatitis C virus (HCV) envelope glycoprotein E2 is the major target of broadly neutralizing antibodies in vivo and is the focus of efforts in the rational design of a universal B cell vaccine against HCV. The E2 glycoprotein exhibits a high degree of amino acid variability which localizes to three discrete regions: hypervariable region 1 (HVR1), hypervariable region 2 (HVR2), and the intergenotypic variable region (igVR). All three variable regions contribute to immune evasion and/or isolate-specific structural variations, both important considerations for vaccine design. A high-resolution structural definition of the intact HCV envelope glycoprotein complex containing E1 and E2 remains to be elucidated, while crystallographic structures of a recombinant E2 ectodomain failed to resolve HVR1, HVR2, and a major neutralization determinant adjacent to HVR1. To obtain further information on E2, we characterized the role of all three variable regions in E2 ectodomain folding and function in the context of a recombinant ectodomain fragment (rE2). We report that removal of the variable regions accelerates binding to the major host cell receptor CD81 and that simultaneous deletion of HVR2 and the igVR is required to maintain wild-type CD81-binding characteristics. The removal of the variable regions also rescued the ability of rE2 to form a functional homodimer. We propose that the rE2 core provides novel insights into the role of the variable motifs in the higher-order assembly of the E2 ectodomain and may have implications for E1E2 structure on the virion surface. IMPORTANCE Hepatitis C virus (HCV) infection affects ∼2% of the population globally, and no vaccine is available. HCV is a highly variable virus, and understanding the presentation of key antigenic sites at the virion surface is important for the design of a universal vaccine. This study investigates the role of three surface-exposed variable regions in E2 glycoprotein folding and function in the context

  7. Activation of Epidermal Growth Factor Receptor Mediates Mucin Production Stimulated by p40, a Lactobacillus rhamnosus GG-derived Protein*

    PubMed Central

    Wang, Lihong; Cao, Hailong; Liu, Liping; Wang, Bangmao; Walker, W. Allan; Acra, Sari A.; Yan, Fang

    2014-01-01

    The mucus layer coating the gastrointestinal tract serves as the first line of intestinal defense against infection and injury. Probiotics promote mucin production by goblet cells in the intestine. p40, a Lactobacillus rhamnosus GG-derived soluble protein, has been shown to transactivate the EGF receptor (EGFR) in intestinal epithelial cells, which is required for inhibition of apoptosis and preservation of barrier function in the colon, thereby ameliorating intestinal injury and colitis. Because activation of EGFR has been shown to up-regulate mucin production in goblet cells, the purpose of this study was to investigate the effects and mechanisms of p40 regulation of mucin production. p40 activated EGFR and its downstream target, Akt, in a concentration-dependent manner in LS174T cells. p40 stimulated Muc2 gene expression and mucin production in LS174T cells, which were abolished by inhibition of EGFR kinase activity, down-regulation of EGFR expression by EGFR siRNA transfection, or suppression of Akt activation. Treatment with p40 increased mucin production in the colonic epithelium, thus thickening the mucus layer in the colon of wild type, but not of Egfrwa5 mice, which have a dominant negative mutation in the EGFR kinase domain. Furthermore, inhibition of mucin-type O-linked glycosylation suppressed the effect of p40 on increasing mucin production and protecting intestinal epithelial cells from TNF-induced apoptosis in colon organ culture. Thus, these results suggest that p40-stimulated activation of EGFR mediates up-regulation of mucin production, which may contribute to the mechanisms by which p40 protects the intestinal epithelium from injury. PMID:24895124

  8. Construction of a hybrid β-hexosaminidase subunit capable of forming stable homodimers that hydrolyze GM2 ganglioside in vivo

    PubMed Central

    Tropak, Michael B; Yonekawa, Sayuri; Karumuthil-Melethil, Subha; Thompson, Patrick; Wakarchuk, Warren; Gray, Steven J; Walia, Jagdeep S; Mark, Brian L; Mahuran, Don

    2016-01-01

    Tay-Sachs or Sandhoff disease result from mutations in either the evolutionarily related HEXA or HEXB genes encoding respectively, the α- or β-subunits of β-hexosaminidase A (HexA). Of the three Hex isozymes, only HexA can interact with its cofactor, the GM2 activator protein (GM2AP), and hydrolyze GM2 ganglioside. A major impediment to establishing gene or enzyme replacement therapy based on HexA is the need to synthesize both subunits. Thus, we combined the critical features of both α- and β-subunits into a single hybrid µ-subunit that contains the α-subunit active site, the stable β-subunit interface and unique areas in each subunit needed to interact with GM2AP. To facilitate intracellular analysis and the purification of the µ-homodimer (HexM), CRISPR-based genome editing was used to disrupt the HEXA and HEXB genes in a Human Embryonic Kidney 293 cell line stably expressing the µ-subunit. In association with GM2AP, HexM was shown to hydrolyze a fluorescent GM2 ganglioside derivative both in cellulo and in vitro. Gene transfer studies in both Tay-Sachs and Sandhoff mouse models demonstrated that HexM expression reduced brain GM2 ganglioside levels. PMID:26966698

  9. Impaired Endothelial Nitric Oxide Synthase Homodimer Formation Triggers Development of Transplant Vasculopathy - Insights from a Murine Aortic Transplantation Model

    PubMed Central

    Oberhuber, Rupert; Riede, Gregor; Cardini, Benno; Bernhard, David; Messner, Barbara; Watschinger, Katrin; Steger, Christina; Brandacher, Gerald; Pratschke, Johann; Golderer, Georg; Werner, Ernst R.; Maglione, Manuel

    2016-01-01

    Transplant vasculopathy (TV) represents a major obstacle to long-term graft survival and correlates with severity of ischemia reperfusion injury (IRI). Donor administration of the nitric oxide synthases (NOS) co-factor tetrahydrobiopterin has been shown to prevent IRI. Herein, we analysed whether tetrahydrobiopterin is also involved in TV development. Using a fully allogeneic mismatched (BALB/c to C57BL/6) murine aortic transplantation model grafts subjected to long cold ischemia time developed severe TV with intimal hyperplasia (α-smooth muscle actin positive cells in the neointima) and endothelial activation (increased P-selectin expression). Donor pretreatment with tetrahydrobiopterin significantly minimised these changes resulting in only marginal TV development. Severe TV observed in the non-treated group was associated with increased protein oxidation and increased occurrence of endothelial NOS monomers in the aortic grafts already during graft procurement. Tetrahydrobiopterin supplementation of the donor prevented all these early oxidative changes in the graft. Non-treated allogeneic grafts without cold ischemia time and syngeneic grafts did not develop any TV. We identified early protein oxidation and impaired endothelial NOS homodimer formation as plausible mechanistic explanation for the crucial role of IRI in triggering TV in transplanted aortic grafts. Therefore, targeting endothelial NOS in the donor represents a promising strategy to minimise TV. PMID:27883078

  10. Structure of the human NF-kappaB p52 homodimer-DNA complex at 2.1 A resolution.

    PubMed Central

    Cramer, P; Larson, C J; Verdine, G L; Müller, C W

    1997-01-01

    The crystal structure of human NF-kappaB p52 in its specific complex with the natural kappaB DNA binding site MHC H-2 has been solved at 2.1 A resolution. Whereas the overall structure resembles that of the NF-kappaB p50-DNA complex, pronounced differences are observed within the 'insert region'. This sequence segment differs in length between different Rel proteins. Compared with NF-kappaB p50, the compact alpha-helical insert region element is rotated away from the core of the N-terminal domain, opening up a mainly polar cleft. The insert region presents potential interaction surfaces to other proteins. The high resolution of the structure reveals many water molecules which mediate interactions in the protein-DNA interface. Additional complexity in Rel protein-DNA interaction comes from an extended interfacial water cavity that connects residues at the edge of the dimer interface to the central DNA bases. The observed water network might acount for differences in binding specificity between NF-kappaB p52 and NF-kappaB p50 homodimers. PMID:9384586

  11. Albumin Homodimers in Patients with Cirrhosis: Clinical and Prognostic Relevance of a Novel Identified Structural Alteration of the Molecule

    PubMed Central

    Baldassarre, Maurizio; Domenicali, Marco; Naldi, Marina; Laggetta, Maristella; Giannone, Ferdinando A.; Biselli, Maurizio; Patrono, Daniela; Bertucci, Carlo; Bernardi, Mauro; Caraceni, Paolo

    2016-01-01

    Decompensated cirrhosis is associated to extensive post-transcriptional changes of human albumin (HA). This study aims to characterize the occurrence of HA homodimerization in a large cohort of patients with decompensated cirrhosis and to evaluate its association with clinical features and prognosis. HA monomeric and dimeric isoforms were identified in peripheral blood by using a HPLC-ESI-MS technique in 123 cirrhotic patients hospitalized for acute decompensation and 50 age- and sex-comparable healthy controls. Clinical and biochemical parameters were recorded and patients followed up to one year. Among the monomeric isoforms identified, the N- and C-terminal truncated and the native HA underwent homodimerization. All three homodimers were significantly more abundant in patients with cirrhosis, acute-on-chronic liver failure and correlate with the prognostic scores. The homodimeric N-terminal truncated isoform was independently associated to disease complications and was able to stratify 1-year survival. As a result of all these changes, the monomeric native HA was significantly decreased in patients with cirrhosis, being also associated with a poorer prognosis. In conclusion homodimerization is a novel described structural alteration of the HA molecule in decompensated cirrhosis and contributes to the progressive reduction of the monomeric native HA, the only isoform provided of structural and functional integrity. PMID:27782157

  12. Construction of a hybrid β-hexosaminidase subunit capable of forming stable homodimers that hydrolyze GM2 ganglioside in vivo.

    PubMed

    Tropak, Michael B; Yonekawa, Sayuri; Karumuthil-Melethil, Subha; Thompson, Patrick; Wakarchuk, Warren; Gray, Steven J; Walia, Jagdeep S; Mark, Brian L; Mahuran, Don

    2016-01-01

    Tay-Sachs or Sandhoff disease result from mutations in either the evolutionarily related HEXA or HEXB genes encoding respectively, the α- or β-subunits of β-hexosaminidase A (HexA). Of the three Hex isozymes, only HexA can interact with its cofactor, the GM2 activator protein (GM2AP), and hydrolyze GM2 ganglioside. A major impediment to establishing gene or enzyme replacement therapy based on HexA is the need to synthesize both subunits. Thus, we combined the critical features of both α- and β-subunits into a single hybrid µ-subunit that contains the α-subunit active site, the stable β-subunit interface and unique areas in each subunit needed to interact with GM2AP. To facilitate intracellular analysis and the purification of the µ-homodimer (HexM), CRISPR-based genome editing was used to disrupt the HEXA and HEXB genes in a Human Embryonic Kidney 293 cell line stably expressing the µ-subunit. In association with GM2AP, HexM was shown to hydrolyze a fluorescent GM2 ganglioside derivative both in cellulo and in vitro. Gene transfer studies in both Tay-Sachs and Sandhoff mouse models demonstrated that HexM expression reduced brain GM2 ganglioside levels.

  13. Oncogenic BRAF Deletions That Function as Homodimers and Are Sensitive to Inhibition by RAF Dimer Inhibitor LY3009120.

    PubMed

    Chen, Shih-Hsun; Zhang, Youyan; Van Horn, Robert D; Yin, Tinggui; Buchanan, Sean; Yadav, Vipin; Mochalkin, Igor; Wong, Swee Seong; Yue, Yong Gang; Huber, Lysiane; Conti, Ilaria; Henry, James R; Starling, James J; Plowman, Gregory D; Peng, Sheng-Bin

    2016-03-01

    We have identified previously undiscovered BRAF in-frame deletions near the αC-helix region of the kinase domain in pancreatic, lung, ovarian, and thyroid cancers. These deletions are mutually exclusive with KRAS mutations and occur in 4.21% of KRAS wild-type pancreatic cancer. siRNA knockdown in cells harboring BRAF deletions showed that the MAPK activity and cell growth are BRAF dependent. Structurally, the BRAF deletions are predicted to shorten the β3/αC-helix loop and hinder its flexibility by locking the helix in the active αC-helix-in conformation that favors dimer formation. Expression of L485-P490-deleted BRAF is able to transform NIH/3T3 cells in a BRAF dimer-dependent manner. BRAF homodimer is confirmed to be the dominant RAF dimer by proximity ligation assays in BRAF deletion cells, which are resistant to the BRAF inhibitor vemurafenib and sensitive to LY3009120, a RAF dimer inhibitor. In tumor models with BRAF deletions, LY3009120 has shown tumor growth regression, whereas vemurafenib is inactive. This study discovered oncogenic BRAF deletions with a distinct activation mechanism dependent on the BRAF dimer formation in tumor cells. LY3009120 is active against these cells and represents a potential treatment option for patients with cancer with these BRAF deletions, or other atypical BRAF mutations where BRAF functions as a dimer. ©2016 American Association for Cancer Research.

  14. wrwyrggrywrw is a single-chain functional analog of the Holliday junction-binding homodimer, (wrwycr)2.

    PubMed

    Rideout, Marc C; Naili, Ilham; Boldt, Jeffrey L; Flores-Fujimoto, America; Patra, Sukanya; Rostron, Jason E; Segall, Anca M

    2013-02-01

    DNA repair pathways in bacteria that use homologous recombination involve the formation and subsequent resolution of Holliday junction (HJ) intermediates. We have previously identified several hexameric peptides that bind to HJs and interfere with HJ processing enzymes in vitro. The peptide WRWYCR and its D-amino acid stereoisomer wrwycr, are potent antibacterial agents. These hexapeptides must form homodimers in order to interact stably with HJs, and inhibit bacterial growth, and this represents a potential limitation. Herein we describe a disulfide bond-independent inhibitor, WRWYRGGRYWRW and its D-stereoisomer wrwyrggrywrw. We have characterized these single-chain, linear analogs of the hexapeptides, and show that in addition to effectively binding to HJs, and inhibiting the activity of DNA repair enzymes that process HJs, they have equal or greater potency against Gram-positive and Gram-negative bacterial growth. The analogs were also shown to cause DNA damage in bacteria, and disrupt the integrity of the bacterial cytoplasmic membrane. Finally, we found that they have little toxicity toward several eukaryotic cell types at concentrations needed to inhibit bacterial growth. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. wrwyrggrywrw is a single-chain functional analog of the Holliday junction-binding homodimer, (wrwycr)2

    PubMed Central

    Rideout, Marc C.; Naili, Ilham; Boldt, Jeffrey L.; Flores-Fujimoto, America; Patra, Sukanya; Rostron, Jason E.; Segall, Anca M.

    2013-01-01

    DNA repair pathways in bacteria that use homologous recombination involve the formation and subsequent resolution of Holliday junction (HJ) intermediates. We have previously identified several hexameric peptides that bind to HJs and interfere with HJ processing enzymes in vitro. The peptide WRWYCR and its D-amino acid stereoisomer wrwycr, are potent antibacterial agents. These hexapeptides must form homodimers in order to interact stably with HJs, and inhibit bacterial growth, and this represents a potential limitation. Herein we describe a disulfide bond-independent inhibitor, WRWYRGGRYWRW and its D-stereoisomer wrwyrggrywrw. We have characterized these single-chain, linear analogs of the hexapeptides, and show that in addition to effectively binding to HJs, and inhibiting the activity of DNA repair enzymes that process HJs, they have equal or greater potency against Gram-positive and Gram-negative bacterial growth. The analogs were also shown to cause DNA damage in bacteria, and disrupt the integrity of the bacterial cytoplasmic membrane. Finally, we found that they have little toxicity toward several eukaryotic cell types at concentrations needed to inhibit bacterial growth. PMID:23291222

  16. Sulfasalazine Treatment Suppresses the Formation of HLA-B27 Heavy Chain Homodimer in Patients with Ankylosing Spondylitis.

    PubMed

    Yu, Hui-Chun; Lu, Ming-Chi; Huang, Kuang-Yung; Huang, Hsien-Lu; Liu, Su-Qin; Huang, Hsien-Bin; Lai, Ning-Sheng

    2015-12-29

    Human leukocytic antigen-B27 heavy chain (HLA-B27 HC) has the tendency to fold slowly, in turn gradually forming a homodimer, (B27-HC)₂ via a disulfide linkage to activate killer cells and T-helper 17 cells and inducing endoplasmic reticulum (ER) stress to trigger the IL-23/IL-17 axis for pro-inflammatory reactions. All these consequences lead to the pathogenesis of ankylosing spondylitis (AS). Sulfasalazine (SSA) is a common medication used for treatment of patients with AS. However, the effects of SSA treatment on (B27-HC)₂ formation and on suppression of IL-23/IL-17 axis of AS patients remain to be determined. In the current study, we examine the (B27-HC)₂ of peripheral blood mononuclear cells (PBMC), the mean grade of sarcoiliitis and lumbar spine Bath Ankylosing Spondylitis Radiology Index (BASRI) scores of 23 AS patients. The results indicated that AS patients without (B27-HC)₂ on PBMC showed the lower levels of mean grade of sarcoiliitis and the lumbar spine BASRI scores. In addition, after treatment with SSA for four months, the levels of (B27-HC)₂ on PBMCs were significantly reduced. Cytokines mRNA levels, including TNFα, IL-17A, IL-17F and IFNγ, were also significantly down-regulated in PBMCs. However, SSA treatment did not affect the levels of IL-23 and IL-23R mRNAs.

  17. PDGF A chain homodimers drive proliferation of bipotential (O-2A) glial progenitor cells in the developing rat optic nerve.

    PubMed Central

    Pringle, N; Collarini, E J; Mosley, M J; Heldin, C H; Westermark, B; Richardson, W D

    1989-01-01

    The bipotential glial progenitor cells (O-2A progenitors), which during development of the rat optic nerve give rise to oligodendrocytes and type 2 astrocytes, are stimulated to divide in culture by platelet-derived growth factor (PDGF), and there is evidence that PDGF is important for development of the O-2A cell lineage in vivo. We have visualized PDGF mRNA in the rat optic nerve by in situ hybridization, and its spatial distribution is compatible with the idea that type 1 astrocytes are the major source of PDGF in the nerve. We can detect mRNA encoding the A chain, but not the B chain of PDGF in the brain and optic nerve, suggesting that the major form of PDGF in the central nervous system is a homodimer of A chains (PDGF-AA). PDGF-AA is a more potent mitogen for O-2A progenitor cells than is PDGF-BB, while the reverse is true for human or rat fibroblasts. Fibroblasts display two types of PDGF receptors, type A receptors which bind to all three dimeric isoforms of PDGF, and type B receptors which bind PDGF-BB and PDGF-AB, but have low affinity for PDGF-AA. Our results suggest that O-2A progenitor cells possess predominantly type A receptors, and proliferate during development in response to PDGF-AA secreted by type 1 astrocytes. Images PMID:2545439

  18. PDGF A chain homodimers drive proliferation of bipotential (O-2A) glial progenitor cells in the developing rat optic nerve.

    PubMed

    Pringle, N; Collarini, E J; Mosley, M J; Heldin, C H; Westermark, B; Richardson, W D

    1989-04-01

    The bipotential glial progenitor cells (O-2A progenitors), which during development of the rat optic nerve give rise to oligodendrocytes and type 2 astrocytes, are stimulated to divide in culture by platelet-derived growth factor (PDGF), and there is evidence that PDGF is important for development of the O-2A cell lineage in vivo. We have visualized PDGF mRNA in the rat optic nerve by in situ hybridization, and its spatial distribution is compatible with the idea that type 1 astrocytes are the major source of PDGF in the nerve. We can detect mRNA encoding the A chain, but not the B chain of PDGF in the brain and optic nerve, suggesting that the major form of PDGF in the central nervous system is a homodimer of A chains (PDGF-AA). PDGF-AA is a more potent mitogen for O-2A progenitor cells than is PDGF-BB, while the reverse is true for human or rat fibroblasts. Fibroblasts display two types of PDGF receptors, type A receptors which bind to all three dimeric isoforms of PDGF, and type B receptors which bind PDGF-BB and PDGF-AB, but have low affinity for PDGF-AA. Our results suggest that O-2A progenitor cells possess predominantly type A receptors, and proliferate during development in response to PDGF-AA secreted by type 1 astrocytes.

  19. The Escherichia coli cell division protein ZipA forms homodimers prior to association with FtsZ.

    PubMed

    Skoog, Karl; Daley, Daniel O

    2012-02-21

    ZipA is an essential component of the cell division machinery in E. coli and other closely related bacteria. It is an integral membrane protein that binds to FtsZ, tethering it to the inner membrane. ZipA also induces bundling of FtsZ protofilaments and may play a role in regulating FtsA activity; however, the molecular details behind these observations are not clear. In this study we have analyzed the oligomeric state of ZipA in vivo, by chemical cross-linking, and in vitro, by native gel electrophoresis (BN-PAGE). Our data indicate that ZipA can self-associate as a homodimer and that this self-interaction is not dependent on the FtsZ-binding domain. This observation rules out the possibility that FtsZ polymers mediate the ZipA self-interaction. Given this observation, it is possible that a certain population of ZipA is recruited to the division septum in a homodimeric form.

  20. Molecular size and amino acid composition of H-2d antigen solubilized in Nonidet P-40.

    PubMed

    Rossowski, W; Kloczewiak, M; Radzikowski, C; Strzadala, L

    1976-01-01

    H-2d antigenic material solubilized by the detergent Nonidet P-40 from L-1210 mouse leukemia cells was isolated by gel filtration on Bio-Gel P-100. A single peak eluted in the void volume consisted of about 90% protein, 8% hexose and traces of sialic acids. In sedimentation velocity runs, the antigen sedimented as a single peak of 3-1 S. Molecular weight determined by sedimentation equilibrium as well as calculated from amino acid composition was found to be in the range of 53,000 daltons and approx. 45,000-51,000 when calculated from sodium dodecyl sulfate polyacrylamide gel electrophoresis. Secondary structure of H-2d glycoprotein was predicted from the amino acid composition. For NP-40-solubilized H-2d antigen, about 34% of helix, 13% beta sheet and 41% turns was found.

  1. IL-12/23p40-dependent clearance of Anaplasma phagocytophilum in the murine model of human anaplasmosis.

    PubMed

    Pedra, Joao H F; Tao, Jian; Sutterwala, Fayyaz S; Sukumaran, Bindu; Berliner, Nancy; Bockenstedt, Linda K; Flavell, Richard A; Yin, Zhinan; Fikrig, Erol

    2007-08-01

    Human anaplasmosis is an emerging infectious disease transmitted by ticks that can be potentially fatal in the immunocompromised and the elderly. The mechanisms of defense against the causative agent, Anaplasma phagocytophilum, are not completely understood; however, interferon (IFN)-gamma plays an important role in pathogen clearance. Here, we show that IFN-gamma is regulated through an early IL-12/23p40-dependent mechanism. Interleukin (IL)-12/23p40 is regulated in macrophages and dendritic cells after activation by microbial agonists and cytokines and constitutes a subunit of IL-12 and IL-23. IL-12/23p40-deficient mice displayed an increased A. phagocytophilum burden, accelerated thrombocytopenia and increased neutrophil numbers in the spleen at day 6 postinfection. Infection of MyD88- and mitogen-activated kinase kinase 3 (MKK3)-deficient mice suggested that the early susceptibility due to IL-12/23p40 deficiency was not dependent on signaling through MyD88 or MKK3. The lack of IL-12/23p40 reduced IFN-gamma production in both CD4(+) and CD8(+) T cells although the effect was more pronounced in CD4(+) T cells. Our data suggest that the immune response against A. phagocytophilum is a multifactorial and cooperative process. The IL-12/23p40 subunit drives the CD4(+) Th1 immune response in the early phase of infection and IL-12/23p40-independent mechanisms ultimately contribute to pathogen elimination from the host.

  2. Effect of p40tax trans-activator of human T cell lymphotropic virus type I on expression of autoantigens.

    PubMed

    Banki, K; Ablonczy, E; Nakamura, M; Perl, A

    1994-03-01

    The possibility of a retroviral etiology has long been raised in a number of autoimmune disorders. More recently, Sjögren's syndrome and rheumatoid arthritis were noted in transgenic mice carrying the tax gene of human T cell leukemia virus type I (HTLV-I). To evaluate the involvement of HTLV-I Tax in autoimmunity, its effect on expression of autoantigens was investigated. A metallothionein promoter-driven p40tax expression plasmid, pMAXRHneo-1, was stably transfected into Molt4 and Jurkat cells and the p40tax protein was induced with CdCl2. trans-Activation or trans-repression of autoantigens by HTLV-I Tax was studied by Western blot analysis utilizing autoantigen-specific murine monoclonal and rabbit polyvalent antibodies as well as sera from 161 autoimmune patients. Induction of p40tax of HTLV-I had no significant effect on levels of expression of common autoantigens U1 snRNP, Sm, Ro, La, HSP-70, topoisomerase I/Scl70, PCNA, and HRES-1. Expression of two potentially novel autoantigens, 44 and 46 kDa, was induced by p40tax as detected by sera of progressive systemic sclerosis patients, BAK and VAR. By contrast, expression of 24- and 34-kDa proteins was suppressed in response to induction of p40tax as detected by sera of systemic lupus erythematosus patients PUS and HOR. Because none of these patients were infected by HTLV-I, a protein functionally similar to p40tax may be involved in eliciting autoantigen expression and a subsequent autoantibody response in a minority of patients with PSS and SLE. Sera of autoimmune patients may also be utilized to detect novel proteins trans-activated or trans-repressed by p40tax of HTLV-I.

  3. A conserved proline residue in the leucine zipper region of AtbZIP34 and AtbZIP61 in Arabidopsis thaliana interferes with the formation of homodimer

    SciTech Connect

    Shen Huaishun; Cao Kaiming; Wang Xiping

    2007-10-19

    Two putative Arabidopsis E group bZIP transcript factors, AtbZIP34 and AtbZIP61, are nuclear-localized and their transcriptional activation domain is in their N-terminal region. By searching GenBank, we found other eight plant homologues of AtbZIP34 and AtbZIP61. All of them have a proline residue in the third heptad of zipper region. Yeast two-hybrid assay and EMSA showed that AtbZIP34 and AtbZIP61 could not form homodimer while their mutant forms, AtbZIP34m and AtbZIP61m, which the proline residue was replaced by an alanine residue in the zipper region, could form homodimer and bind G-box element. These results suggest that the conserved proline residue interferes with the homodimer formation. However, both AtbZIP34 and AtbZIP61 could form heterodimers with members of I group and S group transcription factors in which some members involved in vascular development. So we speculate that AtbZIP34 and AtbZIP61 may participate in plant development via interacting with other group bZIP transcription factors.

  4. BMP2/7 heterodimer is a stronger inducer of bone regeneration in peri-implant bone defects model than BMP2 or BMP7 homodimer.

    PubMed

    Sun, Ping; Wang, Jingxiao; Zheng, Yuanna; Fan, Yi; Gu, Zhiyuan

    2012-01-01

    This study aimed to compare the effects of bone morphogenetic protein BMP2/7 heterodimer and BMP homodimers on bone regeneration in bone defects model. Identical peri-implant bone defects model were created using proper controls on the frontal skull in 18 minipigs. Collagen sponges with low-dose (30 ng/mL) BMP2/7 heterodimer, BMP2 or BMP7 homodimer were filled in the defects. New bone formation and the expression of type I collagen (Col1), alkaline phosphatase (ALP) and osteocalcin (OCN) were evaluated after 2, 3, and 6 weeks of implantation. BMP2/7 resulted in significantly higher new bone areas percentage in the defect region than BMP2 and BMP7 (p<0.05). Immunohistochemical staining of Col1, ALP and OCN was stronger in BMP2/7 group than BMP2, BMP7 and control group (p<0.05). These results demonstrate that BMP2/7 heterodimer is a stronger inducer of osteoblastogenesis and could be applied at low dose to reduce the cost and side effects of BMP homodimers.

  5. Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant

    SciTech Connect

    Atwell, Shane; Brouillette, Christie G.; Conners, Kris; Emtage, Spencer; Gheyi, Tarun; Guggino, William B.; Hendle, Jorg; Hunt, John F.; Lewis, Hal A.; Lu, Frances; Protasevich, Irina I.; Rodgers, Logan A.; Romero, Rich; Wasserman, Stephen R.; Weber, Patricia C.; Wetmore, Diana; Zhang, Feiyu F.; Zhao, Xun

    2010-04-26

    Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646({Delta}405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-{angstrom} resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The {Delta}F508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

  6. Definition of the surface in the thyroid hormone receptor ligand binding domain for association as homodimers and heterodimers with retinoid X receptor.

    PubMed

    Ribeiro, R C; Feng, W; Wagner, R L; Costa, C H; Pereira, A C; Apriletti, J W; Fletterick, R J; Baxter, J D

    2001-05-04

    Thyroid hormone receptors (TRs) bind as homodimers or heterodimers with retinoid X receptors (RXRs) to DNA elements with diverse orientations of AGGTCA half-sites. We performed a comprehensive x-ray crystal structure-guided mutation analysis of the TR ligand binding domain (TR LBD) surface to map the functional interface for TR homodimers and heterodimers with RXR in the absence and/or in the presence of DNA. We also identified the molecular contacts in TR LBDs crystallized as dimers. The results show that crystal dimer contacts differ from those found in the functional studies. We found that identical TR LBD residues found in helices 10 and 11 are involved in TR homodimerization and heterodimerization with RXR. Moreover, the same TR LBD surface is operative for dimerization with direct repeats spaced by 4 base pairs (DR-4) and with the inverted palindrome spaced by 6 base pairs (F2), but not with TREpal (unspaced palindrome), where homodimers appear to be simply two monomers binding independently to DNA. We also demonstrate that interactions between the TR and RXR DNA binding domains stabilize TR-RXR heterodimers on DR-4. The dimer interface can be functional in the cell, because disruption of key residues impairs transcriptional activity of TRs mediated through association with RXR LBD linked to GAL4 DNA-binding domain.

  7. Structural Analysis of Guanylyl Cyclase-Activating Protein-2 (GCAP-2) Homodimer by Stable Isotope-Labeling, Chemical Cross-Linking, and Mass Spectrometry

    NASA Astrophysics Data System (ADS)

    Pettelkau, Jens; Thondorf, Iris; Theisgen, Stephan; Lilie, Hauke; Schröder, Thomas; Arlt, Christian; Ihling, Christian H.; Sinz, Andrea

    2013-12-01

    The topology of the GCAP-2 homodimer was investigated by chemical cross-linking and high resolution mass spectrometry. Complementary conducted size-exclusion chromatography and analytical ultracentrifugation studies indicated that GCAP-2 forms a homodimer both in the absence and in the presence of Ca2+. In-depth MS and MS/MS analysis of the cross-linked products was aided by 15 N-labeled GCAP-2. The use of isotope-labeled protein delivered reliable structural information on the GCAP-2 homodimer, enabling an unambiguous discrimination between cross-links within one monomer (intramolecular) or between two subunits (intermolecular). The limited number of cross-links obtained in the Ca2+-bound state allowed us to deduce a defined homodimeric GCAP-2 structure by a docking and molecular dynamics approach. In the Ca2+-free state, GCAP-2 is more flexible as indicated by the higher number of cross-links. We consider stable isotope-labeling to be indispensable for deriving reliable structural information from chemical cross-linking data of multi-subunit protein assemblies.

  8. Two new crystal forms of the choline-binding domain of the major pneumococcal autolysin: insights into the dynamics of the active homodimer.

    PubMed

    Fernández-Tornero, Carlos; García, Ernesto; López, Rubens; Giménez-Gallego, Guillermo; Romero, Antonio

    2002-08-02

    Very little is known about the in vivo regulation of the catalytic activity of the major pneumococcal autolysin (LytA), a surface-exposed enzyme that rules the self-destruction of pneumococcal cells through degradation of their peptidoglycan backbone. Two new crystal forms of the cell wall anchoring domain of LytA were obtained, and their structures were solved and refined to 2.4A and 2.8A resolution. The domain is a homodimer with a boomerang-like shape in which the tertiary structure of each monomer is comprised by six independent beta hairpins arranged in a superhelical fashion. Choline molecules at the hydrophobic interface of consecutive hairpins maintain this unique structure. The C-terminal hairpin (last 13 residues of LytA) in the solenoid is responsible for the formation of the catalytically active homodimer. Although the general fold in the structures derived from both crystal forms is essentially the same, two different conformations of the basic homodimer are observed. Biochemical approaches have demonstrated the fundamental role of the 11 C-terminal residues in the catalytic activity of LytA. The studies reported here reveal the importance of some amino acid residues at the C terminus in the determination of the relative distance of the active dimeric form of the autolysin, which appears to be essential for the catalytic activity of this enzyme.

  9. The human peroxisomal ABC half transporter ALDP functions as a homodimer and accepts acyl-CoA esters.

    PubMed

    van Roermund, Carlo W T; Visser, Wouter F; Ijlst, Lodewijk; van Cruchten, Arno; Boek, Maxim; Kulik, Wim; Waterham, Hans R; Wanders, Ronald J A

    2008-12-01

    Peroxisomes play a major role in human cellular lipid metabolism, including the beta-oxidation of fatty acids. The most frequent peroxisomal disorder is X-linked adrenoleukodystrophy (X-ALD), which is caused by mutations in the ABCD1 gene. The protein involved, called ABCD1, or alternatively ALDP, is a member of the ATP-binding-cassette (ABC) transporter family and is located in the peroxisomal membrane. The biochemical hallmark of X-ALD is the accumulation of very long-chain fatty acids (VLCFAs), due to an impaired peroxisomal beta-oxidation. Although this suggests a role of ALDP in VLCFA import, no experimental evidence is available to substantiate this. In the yeast Saccharomyces cerevisiae, peroxisomes are the exclusive site of fatty acid beta-oxidation. Earlier work has shown that uptake of fatty acids into peroxisomes may occur via two routes, either as free fatty acids thus requiring intraperoxisomal activation into acyl-CoA esters or as long-chain acyl-CoA esters. The latter route involves the two peroxisomal half ABC transporters Pxa1p and Pxa2p that form a heterodimeric complex in the peroxisomal membrane. Using different strategies, including the analysis of intracellular acyl-CoA esters by tandem-MS, we show that the Pxa1p/Pxa2p heterodimer is involved in the transport of a spectrum of acyl-CoA esters. Interestingly, we found that the mutant phenotype of the pxa1/pxa2Delta mutant can be rescued, at least partially, by the sole expression of the human ABCD1 cDNA coding for ALDP, the protein that is defective in the human disease X-linked adrenoleukodystrophy. Our data indicate that ALDP can function as a homodimer and is involved in the transport of acyl-CoA esters across the peroxisomal membrane.

  10. On a fully closed state of native human type-1 VDAC enriched in Nonidet P40.

    PubMed

    Thinnes, Friedrich P; Burckhardt, Gerhard

    2012-11-01

    There is indication that human type-1 VDAC/Porin31HL complexes, when purified from highly enriched cell membrane preparations of human B-lymphocytes by classical ion-exchange chromatography in the detergent Nonidet P40, rest in fully closed state, its N-terminus being accessible for mAbs. Cholesterol appears to be involved as a channel modulator. The channel switches to anion-selective or "open state" while being incorporated into black membranes at zero transmembrane potential. In this case, its N-terminus is hidden in the channel lumen. The cation-selective or "closed state" can be induced by transmembrane potentials beyond 30 mV, the N-terminus putatively now being positioned outside the channel lumen. The latter situation might allow one to decide if type-1 VDAC, preincubated with adequate antibodies against its N-terminal part, would enter black membranes in fully closed state or stay in the application medium, respectively, may be complexed to dimers.

  11. Properties of a ribonucleoprotein particle isolated from Nonidet P-40-treated Rous sarcoma virus.

    PubMed

    Davis, N L; Rueckert, R R

    1972-11-01

    A ribonucleoprotein particle containing about 20% ribonucleic acid (RNA), and containing little if any phospholipid or glucosamine, was recovered in high yield after treatment of Schmidt-Ruppin strain of Rous sarcoma virus and B77 virus with the nonionic detergent Nonidet P-40. This structure, which probably derives from the internal ribonucleoprotein filament described in electron microscopy studies, contained 80 to 90% of the viral 60 to 70S RNA and only about 10% of the protein present in intact virions. It sedimented in glycerol density gradients at approximately 130S and had a buoyant density in sucrose of about 1.34 g/ml. Studies with (32)P-labeled virus indicated that the ribonucleoprotein particle contained approximately 30 4S RNA molecules per 10(7) daltons of high-molecular-weight viral RNA. Intact virions contained about 70 4S RNA molecules per 10(7) daltons of high-molecular-weight RNA. Electrophoretic studies in dodecyl sulfate-containing polyacrylamide gels showed that the ribonucleoprotein particle contained only 5 of the 11 polypeptides found in the virion; of these the major component was a polypeptide weighing 14,000 daltons.

  12. Use of substitute Nonidet P-40 nonionic detergents in intracellular tubulin polymerization assays for screening of microtubule targeting agents.

    PubMed

    Sinha, S; Field, J J; Miller, J H

    2017-06-01

    Shell Chemical Company Nonidet P-40 has been used for decades in many biochemical assays as a nonionic, nondenaturing detergent; however, Shell no longer manufactures this product. Four commercially available substitutes were investigated and their activities titrated in an intracellular tubulin polymerization assay. Although claimed by the supply companies to be identical to the Shell Nonidet P-40, all four substitutes were about 10-fold more potent and needed to be diluted accordingly. As microtubule targeting drugs are a major class of anticancer agent, and many researchers use the intracellular tubulin polymerization assay, this information is important to help troubleshoot assay development with the new substitutes. As the Shell Nonidet P-40 has been used in many biochemical buffers, these results will be of general interest to the biochemical, cell, and molecular research community.

  13. A subset of malignant phyllodes tumors express p63 and p40: a diagnostic pitfall in breast core needle biopsies.

    PubMed

    Cimino-Mathews, Ashley; Sharma, Rajni; Illei, Peter B; Vang, Russell; Argani, Pedram

    2014-12-01

    Breast phyllodes tumors are rare fibroepithelial neoplasms of variable grade, and one key differential of malignant phyllodes on core biopsy is sarcomatoid carcinoma. p63 is reported to be sensitive and specific for sarcomatoid carcinoma, with rare expression in phyllodes in limited series. The p63 deltaNp63 isoform, p40, is postulated to be more specific for squamous differentiation but has not previously been evaluated in breast phyllodes or sarcomatoid carcinoma. Tissue microarrays containing 34 unambiguous phyllodes tumors (10 benign, 10 borderline, 14 malignant), 13 sarcomatoid carcinomas, and 10 fibroadenomas were labeled by immunohistochemistry for p63, p40, CD34, and cytokeratins AE1/AE3, 34betaE12, and CK8/18. No borderline phyllodes tumor, benign phyllodes tumor, or fibroadenoma labeled with p63, p40, or cytokeratin. However, p63 labeled 57% malignant phyllodes tumors and 62% sarcomatoid carcinomas, and p40 labeled 29% malignant phyllodes (focal) and 46% sarcomatoid carcinomas. Among established markers, cytokeratins labeled 21% malignant phyllodes tumors (focal) and 100% sarcomatoid carcinomas. CD34 labeled 57% malignant phyllodes tumors and no sarcomatoid carcinomas. Focal p63, p40, and cytokeratin labeling can be seen in malignant phyllodes tumors but not in lower-grade fibroepithelial lesions, and immunoreactivity with these markers alone is not diagnostic of sarcomatoid carcinoma on core needle biopsy. In the differential diagnosis of malignant phyllodes, p40 is a more specific but less sensitive marker of sarcomatoid carcinoma than p63. These results are consistent with the sarcoma literature in which p63 labeling has been increasingly reported and suggest caution in classifying malignant spindle cell tumors of the breast on core biopsy.

  14. Quantum process tomography of excitonic dimers from two-dimensional electronic spectroscopy. I. General theory and applications to homodimers

    SciTech Connect

    Yuen-Zhou, J.; Aspuru-Guzik, Alan

    2011-01-01

    Is it possible to infer the time evolving quantum state of a multichromophoric system from a sequence of two-dimensional electronic spectra (2D-ES) as a function of waiting time? Here we provide a positive answer for a tractable model system: a coupled dimer. After exhaustively enumerating the Liouville pathways associated to each peak in the 2D-ES, we argue that by judiciously combining the information from a series of experiments varying the polarization and frequency components of the pulses, detailed information at the amplitude level about the input and output quantum states at the waiting time can be obtained. This possibility yields a quantum process tomography (QPT) of the single-exciton manifold, which completely characterizes the open quantum system dynamics through the reconstruction of the process matrix. In this manuscript, we present the general theory as well as specific and numerical results for a homodimer, for which we prove that signals stemming from coherence to population transfer and vice versa vanish upon isotropic averaging, therefore, only allowing for a partial QPT in such case. However, this fact simplifies the spectra, and it follows that only two polarization controlled experiments (and no pulse-shaping requirements) suffice to yield the elements of the process matrix, which survive under isotropic averaging. Redundancies in the 2D-ES amplitudes allow for the angle between the two site transition dipole moments to be self-consistently obtained, hence simultaneously yielding structural and dynamical information of the dimer. Model calculations are presented, as well as an error analysis in terms of the angle between the dipoles and peak amplitude extraction. In the second article accompanying this study, we numerically exemplify the theory for heterodimers and carry out a detailed error analysis for such case. This investigation reveals an exciting quantum information processing (QIP) approach to spectroscopic experiments of excitonic

  15. [Cloning and functional research of Arp2/3-P40/ARPC1 subunit of Sf9 cells].

    PubMed

    Han, Shi-Li; Mu, Jing-Fang; Zhang, Yong-Li; Chen, Xin-Wen; Wang, Yun; Li, Lu-Lin

    2012-11-01

    The baculovirus-induced actin polymerization is mainly associated with the virus nucleocapsid protein P78/83, which is homologous with WASP proteins that can activate Arp2/3 complex and induce the actin polymerization. In order to explore the role of Arp2/3 complex in the baculovirus replication, the P40 subunit of Arp2/3 complex from Sf9 (Spodoptera frugiperda 9) cell line was cloned and characterized. Immunofluorescent microscopy assay indicated that P40 was recruited to the inner-side of nuclear membrane during virus infection, which was in accordance with nuclear F-actin distribution in virus-infected cells as documented in our previous research, suggesting P40 could be used to track Arp2/3 complex subcellular distribution changes during virus infection. In addition, co-immunoprecipitation assay demonstrated that P40 interacted with P78/83 only in virus-infected cells, suggesting that actin polymerization induced by P78/83-Arp2/3 complex during baculovirus infection was regulated by some unidentified virus factors.

  16. Antitumor effect of Batf2 through IL-12 p40 up-regulation in tumor-associated macrophages.

    PubMed

    Kanemaru, Hisashi; Yamane, Fumihiro; Fukushima, Kiyoharu; Matsuki, Takanori; Kawasaki, Takahiro; Ebina, Isao; Kuniyoshi, Kanako; Tanaka, Hiroki; Maruyama, Kenta; Maeda, Kazuhiko; Satoh, Takashi; Akira, Shizuo

    2017-08-29

    The development of effective treatments against cancers is urgently needed, and the accumulation of CD8(+) T cells within tumors is especially important for cancer prognosis. Although their mechanisms are still largely unknown, growing evidence has indicated that innate immune cells have important effects on cancer progression through the production of various cytokines. Here, we found that basic leucine zipper transcription factor ATF-like 2 (Batf2) has an antitumor effect. An s.c. inoculated tumor model produced fewer IL-12 p40(+) macrophages and activated CD8(+) T cells within the tumors of Batf2(-/-) mice compared with WT mice. In vitro studies also revealed that the IL-12 p40 expression was significantly lower in Batf2(-/-) macrophages following their stimulation by toll-like receptor ligands, such as R848. Additionally, we found that BATF2 interacts with p50/p65 and promotes IL-12 p40 expression. In conclusion, Batf2 has an antitumor effect through the up-regulation of IL-12 p40 in tumor-associated macrophages, which eventually induces CD8(+) T-cell activation and accumulation within the tumor.

  17. Polymorphous low grade adenocarcinoma has a consistent p63+/p40- immunophenotype that helps distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma.

    PubMed

    Rooper, Lisa; Sharma, Rajni; Bishop, Justin A

    2015-03-01

    Polymorphous low grade adenocarcinoma (PLGA) is a tumor of minor salivary glands that exhibits considerable morphologic overlap with adenoid cystic carcinoma and cellular pleomorphic adenoma, especially in small biopsy specimens. Unlike these other tumor types. PLGAs do not harbor a myoepithelial component, yet their frequent positivity for p63 diminishes the usefulness of this particular myoepithelial marker as a discriminating immunostain. p40 is an antibody that recognizes ΔNp63, a p63 isoform that is more specific for true myoepithelial differentiation. As such, p40 immunostaining could help distinguish PLGAs from adenoid cystic carcinomas and pleomorphic adenomas. In this study, p63 and p40 immunohistochemistry was performed on paraffin embedded, formalin fixed tissue from 11 PLGAs, 101 adenoid cystic carcinomas, and 31 pleomorphic adenomas. All 11 PLGAs (100 %) were positive for p63 but completely negative for p40. Among adenoid cystic carcinomas, 91 of 101 (90 %) were positive for p63 and 90/101 (89 %) were positive for p40. The single discordant p63+/p40- adenoid cystic carcinoma exhibited solid architecture and high grade features not typically seen in PLGA. Among pleomorphic adenomas, 21/31 (68 %) were positive for p63 and 13/31 (42 %) were positive for p40. For the pleomorphic adenomas, the discordant p63+/p40- staining pattern was seen only in the overtly mesenchymal chondromyxoid stroma. The cellular epithelial component of the pleomorphic adenomas demonstrated concordant p63+/p40+ or p63-/p40- immunophenotypes. PLGA consistently exhibits a p63+/p40- immunophenotype that can help distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma, tumors that characteristically demonstrate concordant p63 and p40 immunostaining patterns. A p63/p40 immunohistochemical panel can provide a valuable tool for making the distinction between these morphologically similar but clinically divergent entities.

  18. BMP-2/6 Heterodimer Is More Effective than BMP-2 or BMP-6 Homodimers as Inductor of Differentiation of Human Embryonic Stem Cells

    PubMed Central

    Valera, Elvira; Isaacs, Michael J.; Kawakami, Yasuhiko; Izpisúa Belmonte, Juan Carlos; Choe, Senyon

    2010-01-01

    Background Bone Morphogenetic Protein (BMP) signaling pathways are involved in differentiation of stem cells into diverse cell types, and thus BMPs can be used as main guidance molecules for in vitro differentiation of human stem cells. Methodology/Principal Findings We have analyzed the ability for inducing differentiation of the heterodimer BMP-2/BMP-6 (BMP-2/6) compared to the homodimers BMP-2 or BMP-6, using human embryonic stem (hES) cells H9 as model system. When incubated in a medium with high concentration of basic fibroblastic growth factor (FGF2), 100 ng/ml of human recombinant BMPs induced morphological changes and differentiation of hES cells in 24 to 48 hours. After 5 days, expression of differentiation markers was induced and quantified by quantitative PCR (qPCR) and flow cytometry. BMP-2/6 exhibited stronger activity for the induction of the expression of trophectodermal (CDX2) and endodermal (SOX17, GATA4, AFP) markers than BMP-2 or BMP-6 homodimers. BMP-2/6 also induced the expression of BMPR2 gene more effectively than BMP-2 or BMP-6 when used at the same concentration and time. Moreover, the percentage of cells expressing the surface endodermal marker CXCR4 was also increased for the heterodimer when compared to both homodimers. BMP-2/6 was a more potent activator of Smad-dependent (SMAD1/5) and Smad-independent signaling (mitogen-activated protein kinases ERK and p38) than BMP-2 and BMP-6, and the activation of these pathways might play a role in its increased potency for inducing hES cell differentiation. Conclusions/Significance Therefore, we conclude that BMP-2/6 is more potent than BMP-2 or BMP-6 for inducing differentiation of hES cells, and it can be used as a more powerful substitute of these BMPs in in vitro differentiation guidance. PMID:20567515

  19. BMP-2/6 heterodimer is more effective than BMP-2 or BMP-6 homodimers as inductor of differentiation of human embryonic stem cells.

    PubMed

    Valera, Elvira; Isaacs, Michael J; Kawakami, Yasuhiko; Izpisúa Belmonte, Juan Carlos; Choe, Senyon

    2010-06-17

    Bone Morphogenetic Protein (BMP) signaling pathways are involved in differentiation of stem cells into diverse cell types, and thus BMPs can be used as main guidance molecules for in vitro differentiation of human stem cells. We have analyzed the ability for inducing differentiation of the heterodimer BMP-2/BMP-6 (BMP-2/6) compared to the homodimers BMP-2 or BMP-6, using human embryonic stem (hES) cells H9 as model system. When incubated in a medium with high concentration of basic fibroblastic growth factor (FGF2), 100 ng/ml of human recombinant BMPs induced morphological changes and differentiation of hES cells in 24 to 48 hours. After 5 days, expression of differentiation markers was induced and quantified by quantitative PCR (qPCR) and flow cytometry. BMP-2/6 exhibited stronger activity for the induction of the expression of trophectodermal (CDX2) and endodermal (SOX17, GATA4, AFP) markers than BMP-2 or BMP-6 homodimers. BMP-2/6 also induced the expression of BMPR2 gene more effectively than BMP-2 or BMP-6 when used at the same concentration and time. Moreover, the percentage of cells expressing the surface endodermal marker CXCR4 was also increased for the heterodimer when compared to both homodimers. BMP-2/6 was a more potent activator of Smad-dependent (SMAD1/5) and Smad-independent signaling (mitogen-activated protein kinases ERK and p38) than BMP-2 and BMP-6, and the activation of these pathways might play a role in its increased potency for inducing hES cell differentiation. Therefore, we conclude that BMP-2/6 is more potent than BMP-2 or BMP-6 for inducing differentiation of hES cells, and it can be used as a more powerful substitute of these BMPs in in vitro differentiation guidance.

  20. The Same Periplasmic ExbD Residues Mediate In Vivo Interactions between ExbD Homodimers and ExbD-TonB Heterodimers ▿ †

    PubMed Central

    Ollis, Anne A.; Postle, Kathleen

    2011-01-01

    The TonB system couples cytoplasmic membrane proton motive force to TonB-gated outer membrane transporters for active transport of nutrients into the periplasm. In Escherichia coli, cytoplasmic membrane proteins ExbB and ExbD promote conformational changes in TonB, which transmits this energy to the transporters. The only known energy-dependent interaction occurs between the periplasmic domains of TonB and ExbD. This study identified sites of in vivo homodimeric interactions within ExbD periplasmic domain residues 92 to 121. ExbD was active as a homodimer (ExbD2) but not through all Cys substitution sites, suggesting the existence of conformationally dynamic regions in the ExbD periplasmic domain. A subset of homodimeric interactions could not be modeled on the nuclear magnetic resonance (NMR) structure without significant distortion. Most importantly, the majority of ExbD Cys substitutions that mediated homodimer formation also mediated ExbD-TonB heterodimer formation with TonB A150C. Consistent with the implied competition, ExbD homodimer formation increased in the absence of TonB. Although ExbD D25 was not required for their formation, ExbD dimers interacted in vivo with ExbB. ExbD-TonB interactions required ExbD transmembrane domain residue D25. These results suggested a model where ExbD2 assembled with ExbB undergoes a transmembrane domain-dependent transition and exchanges partners in localized homodimeric interfaces to form an ExbD2-TonB heterotrimer. The findings here were also consistent with our previous hypothesis that ExbD guides the conformation of the TonB periplasmic domain, which itself is conformationally dynamic. PMID:21984795

  1. The same periplasmic ExbD residues mediate in vivo interactions between ExbD homodimers and ExbD-TonB heterodimers.

    PubMed

    Ollis, Anne A; Postle, Kathleen

    2011-12-01

    The TonB system couples cytoplasmic membrane proton motive force to TonB-gated outer membrane transporters for active transport of nutrients into the periplasm. In Escherichia coli, cytoplasmic membrane proteins ExbB and ExbD promote conformational changes in TonB, which transmits this energy to the transporters. The only known energy-dependent interaction occurs between the periplasmic domains of TonB and ExbD. This study identified sites of in vivo homodimeric interactions within ExbD periplasmic domain residues 92 to 121. ExbD was active as a homodimer (ExbD(2)) but not through all Cys substitution sites, suggesting the existence of conformationally dynamic regions in the ExbD periplasmic domain. A subset of homodimeric interactions could not be modeled on the nuclear magnetic resonance (NMR) structure without significant distortion. Most importantly, the majority of ExbD Cys substitutions that mediated homodimer formation also mediated ExbD-TonB heterodimer formation with TonB A150C. Consistent with the implied competition, ExbD homodimer formation increased in the absence of TonB. Although ExbD D25 was not required for their formation, ExbD dimers interacted in vivo with ExbB. ExbD-TonB interactions required ExbD transmembrane domain residue D25. These results suggested a model where ExbD(2) assembled with ExbB undergoes a transmembrane domain-dependent transition and exchanges partners in localized homodimeric interfaces to form an ExbD(2)-TonB heterotrimer. The findings here were also consistent with our previous hypothesis that ExbD guides the conformation of the TonB periplasmic domain, which itself is conformationally dynamic.

  2. Base-pairing energies of proton-bound homodimers determined by guided ion beam tandem mass spectrometry: application to cytosine and 5-substituted cytosines.

    PubMed

    Yang, Bo; Wu, R R; Rodgers, M T

    2013-11-19

    Base-pairing interactions in proton-bound dimers of cytosine (C(+)·C) are the major forces responsible for stabilization of DNA i-motif conformations. Permethylation of cytosine in extended (CCG)·(CGG)n trinucleotide repeats has been shown to cause fragile-X syndrome, the most widespread inherited cause of mental retardation in humans. Oligonucleotides containing 5-bromo- or 5-fluorocytosine can bind to proteins that selectively bind methylated DNA, suggesting that halogenated cytosine damage products can potentially mimic methylation signals. However, the influence of methylation or halogenation on the base-pairing energies (BPEs) of proton-bound dimers of cytosine and their impact on the stability of DNA i-motif conformations is presently unknown. To address this, proton-bound homodimers of cytosine and 5-methyl-, 5-fluoro-, 5-bromo-, and 5-iodocytosine are investigated in detail both experimentally and theoretically. The BPEs of proton-bound homodimers of cytosine and the modified cytosines are measured by threshold collision-induced dissociation (TCID) techniques. 5-Methylation of cytosine is found to increase the BPE and would therefore tend to stabilize DNA i-motif conformations. In contrast, 5-halogenation lowers the BPE. However, the BPEs of the proton-bound 5-halocytosine homodimers examined here still significantly exceed that of Watson-Crick G·C base pairs, such that DNA i-motif conformations should be preserved in the presence of these modifications. Excellent agreement between TCID measured and B3LYP calculated BPEs is found, suggesting that B3LYP calculations can be used to provide reliable energetic predictions for related systems.

  3. Homodimers of cytosine and 1-methylcytosine. A DFT study of geometry, relative stability and H-NMR shifts in gas-phase and selected solvents.

    PubMed

    Paytakov, Guvanchmyrat; Gorb, Leonid; Stepanyugin, Andriy; Samiylenko, Svitlana; Hovorun, Dmytro; Leszczynski, Jerzy

    2014-03-01

    Dimers of cytosine and its N¹-methylated counterpart were investigated in gas-phase and in various solvents including chloroform, dimethylsulfoxide, and water. The studies were performed at DFT/M06-2X/6-31+G(d,p) level of theory. Relative stabilities of tautomers of cytosine solvated explicitly by a small number of solvent molecules were evaluated. Further solvation effect calculations for homodimers were carried out with conductor-like polarizable continuum model (CPCM). H-NMR shifts and IR frequencies for optimized structures were calculated and compared with available experimental data.

  4. Knockout of p47 phox uncovers a critical role of p40 phox in reactive oxygen species production in microvascular endothelial cells.

    PubMed

    Fan, Lampson M; Teng, Lei; Li, Jian-Mei

    2009-10-01

    p40(phox) is an important regulatory subunit of NADPH oxidase, but its role in endothelial reactive oxygen species (ROS) production remains unknown. Using coronary microvascular endothelial cells isolated from wild-type and p47(phox) knockout mice, we found that knockout of p47(phox) increased the level of p40(phox) expression, whereas depletion of p40(phox) in wild-type cells increased p47(phox) expression. In both cases, the basal ROS production (without agonist stimulation) was well preserved. Double knockout of p40(phox) and p47(phox) dramatically reduced (approximately 65%) ROS production and cells started to die. The transcriptional regulation of p40(phox) and p47(phox) expressions involves HBP1. p40(phox) was prephosphorylated in resting cells. PMA stimulation induced p40(phox) swift dephosphorylation (within 1 minute) in parallel with the start of p47(phox) phosphorylation. p40(phox) was then rephosphorylated, and this was accompanied with an increase in ROS production. Depletion of p40(phox) resulted in approximately 67% loss in agonist-induced ROS production despite the presence of p47(phox). These were further supported by experiments on mouse aortas stimulated with angiotensin II. p40(phox) is prephosphorylated in resting endothelial cells and can compensate p47(phox) in keeping basal ROS production. Dephosphorylation of p40(phox) is a prerequisite for agonist-induced p47(phox) phosphorylation, and p40(phox) through its dynamic dephosphorylation and rephosphorylation is involved in the regulation of agonist-induced ROS production.

  5. Knockout of p47phox Uncovers a Critical Role of p40phox in Reactive Oxygen Species Production in Microvascular Endothelial Cells

    PubMed Central

    Fan, Lampson M.; Teng, Lei; Li, Jian-Mei

    2010-01-01

    Objective p40phox is an important regulatory subunit of NADPH oxidase, but its role in endothelial reactive oxygen species (ROS) production remains unknown. Methods and Results Using coronary microvascular endothelial cells isolated from wild-type and p47phox knockout mice, we found that knockout of p47phox increased the level of p40phox expression, whereas depletion of p40phox in wild-type cells increased p47phox expression. In both cases, the basal ROS production (without agonist stimulation) was well preserved. Double knockout of p40phox and p47phox dramatically reduced (≈65%) ROS production and cells started to die. The transcriptional regulation of p40phox and p47phox expressions involves HBP1. p40phox was prephosphorylated in resting cells. PMA stimulation induced p40phox swift dephosphorylation (within 1 minute) in parallel with the start of p47phox phosphorylation. p40phox was then rephosphorylated, and this was accompanied with an increase in ROS production. Depletion of p40phox resulted in ≈67% loss in agonist-induced ROS production despite the presence of p47phox. These were further supported by experiments on mouse aortas stimulated with angiotensin II. Conclusion p40phox is prephosphorylated in resting endothelial cells and can compensate p47phox in keeping basal ROS production. Dephosphorylation of p40phox is a prerequisite for agonist-induced p47phox phosphorylation, and p40phox through its dynamic dephosphorylation and rephosphorylation is involved in the regulation of agonist-induced ROS production. PMID:19608974

  6. 1H NMR determination of the self-association of an acridine homodimer and its complexation with ethidium bromide in aqueous solution

    NASA Astrophysics Data System (ADS)

    Evstigneev, M. P.; Evstigneev, V. P.; Davies, D. B.

    2006-02-01

    1H NMR spectroscopy (500 MHz) has been used to investigate the self-association in aqueous buffered solution of a bis-intercalator, acridine homodimer (AcrH), and its hetero-association with the aromatic dye, ethidium bromide (EB). The equilibrium constants and thermodynamical parameters (enthalpy and entropy) of self-association have been determined from the observed concentration and temperature dependences of chemical shifts of AcrH protons and the results are consistent with a model consisting of at least four distinct forms of AcrH molecules in solution: unfolded (U), folded (F), a dimer formed from two folded molecules (F 2) and a trimer formed from three folded molecules (F 3). It has also been shown that ethidium bromide complexes strongly to the dimer form (F 2) of the bis-acridine molecule, AcrH. Comparison of the calculated association parameters of AcrH with the previously studied ethidium homodimer (EBH) revealed a correlation between the effectiveness of complexation and the length of chain connecting the chromophores of a bis-intercalator.

  7. 1H NMR investigation of the self-association of ethidium homodimer and its complexation with propidium iodide in aqueous solution

    NASA Astrophysics Data System (ADS)

    Veselkov, A. N.; Evstigneev, M. P.; Veselkov, D. A.; Hernandez Santiago, A. A.; Davies, D. B.

    2004-03-01

    The self-association of a bis-intercalator, ethidium homodimer (EBH), and its hetero-association with phenanthridine dye, propidium iodide (PI), have been studied by 1D and 2D 1H NMR spectroscopy using the analysis of proton chemical shifts changes in aqueous solution as a function of concentration and temperature. Experimental results have shown that dynamic equilibrium in solution includes different conformational states of EBH molecules: folded (F) and unfolded (U) forms, a dimer form (F 2) where an aromatic chromophore of one of EBH molecules is inserted (intercalated) between the linked chromophores of the other homodimer molecule and a trimer complex (F 3) with two partitially intercalated aromatic chromophores between the chromophores of the folded EBH molecule. It has been found that EBH associates with propidium iodide forming 1:1 complex, where PI is inserted between the chromophores of the folded form, and 1:2 complex resulting from intercalation of PI into F 2 EBH dimer. Thermodynamical parameters of EBH self-association and complexation between EBH and PI have been determined and conclusions about the nature of the physical forces responsible for the formation of intermolecular complexes have been made.

  8. CD8+ immunoregulatory cells in the graft-versus-host reaction: CD8 T cells activate dendritic cells to secrete interleukin-12/interleukin-18 and induce T helper 1 autoantibody

    PubMed Central

    Noble, Alistair; Leggat, Jamie A; Inderberg, Else M

    2003-01-01

    Initiation of cell-mediated immunity or autoimmunity requires secretion of interleukin (IL)-12 from dendritic cells (DC), which drives the generation of T helper 1 (Th1) effector cells in synergy with IL-18. Induction of IL-12 can be triggered by microbial stimuli but also requires signals from activated T cells. We investigated interactions between alloreactive CD4 and CD8 T cells in mixed lymphocyte reactions (MLR) in vitro and in the graft-versus-host reaction (GVHR) in vivo. In a parent-into-F1 model of GVHR, donor CD8 cells were found to suppress the hyper-immunoglobulin E (IgE) syndrome, anti-DNA immunoglobulin G1 (IgG1) autoantibodies and donor CD4-cell expansion, but were essential for Th1-dependent immunoglobulin G2a (IgG2a) autoantibody production and release of serum IL-12 p40. In vitro, addition of alloreactive CD8 cells to CD4 cells and mature DC enhanced Th1 development. CD4 and CD8 T cells induced IL-18 from DC and primed for IL-12 p70 secretion via interferon-γ (IFN-γ) or tumour necrosis factor-α (TNF-α). However CD8 T cells, but not CD4 cells, released IFN-γ/TNF-α after primary stimulation. The data suggest that rapid release of inflammatory cytokines from central memory-type CD8 cells early in immunity is critical for induction of Th1 cells via DC activation and IL-12 production. This pathway could provide a means for amplification of cell-mediated autoimmunity in the absence of microbial stimuli. PMID:12871213

  9. Levan (beta-2, 6-fructan), a major fraction of fermented soybean mucilage, displays immunostimulating properties via Toll-like receptor 4 signalling: induction of interleukin-12 production and suppression of T-helper type 2 response and immunoglobulin E production.

    PubMed

    Xu, Q; Yajima, T; Li, W; Saito, K; Ohshima, Y; Yoshikai, Y

    2006-01-01

    Products from the fermentation process of soybeans by Bacillus subtilis (natto) have been shown to possess anti-tumour and immunomodulatory activities. However, the formulations previously examined were not chemically pure, and this is a major limitation for elucidation of the molecular mechanisms for their activities. In order to determine which components in soybean mucilage exert immunostimulatory activities, we examined the activities of their purified forms in vitro and in vivo in mice. B. subtilis (natto) and fractions including levan and poly-gamma-glutamic acid (gamma-PGA) from fermented soybean mucilage were prepared. Levels of cytokine production by mouse macrophage cells after treatment with the fractions were measured by means of ELISA. In vivo effect of levan delivered intragastrically on ovalbumin (OVA)-specific T-helper type 2 (Th2) response with IgE production was examined in BALB/c mice that had been immunized intraperitoneally with OVA. Results Levan but neither gamma-PGA nor killed B. subtilis (natto) was found to exert strong activity to induce production of IL-12 p40 and TNF-alpha by macrophage cell lines in vitro. of experiments using Toll-like receptor (TLR) 4-deficient mice and TLR4-transfected human cell line indicated that TLR4 is involved in pattern recognition of levan. Oral administration of levan in vivo significantly reduced the serum levels of OVA-specific IgE and Th2 response to OVA in mice immunized with OVA. Levan is an immunostimulatory moiety in products from the fermentation process of B. subtilis (natto) and may be useful for prevention of allergic disorders with IgE production.

  10. Immunoblotting technique for the detection of allergens of Aspergillus fumigatus: influence of Nonidet P-40 on the sensitivity.

    PubMed

    Wijnands, L M; Deisz, W D; van Leusden, F M

    1999-01-01

    Immunoblotting provides a useful technique for the study of antigens, antibodies and allergens. To overcome problems regarding the loss of antigenic properties during the blotting and developing procedures, several solutions have been described. The inclusion of Nonidet P-40, recommended to increase the sensitivity of developing procedures for immunoblots, in an existing procedure for the detection of allergens of Aspergillus fumigatus, however, led to decreased sensitivity of the method.

  11. A lactobacillus rhamnosus GG-derived soluble protein, p40, stimulates ligand release from intestinal epithelial cells to transactivate epidermal growth factor receptor

    USDA-ARS?s Scientific Manuscript database

    Protein p40, a Lactobacillus rhamnosus GG (LGG)-derived soluble protein, ameliorates intestinal injury and colitis, reduces apoptosis and preserves barrier function by activation of EGF receptor (EGFR) in intestinal epithelial cells. The aim of this study was to determine the mechanisms by which p40...

  12. Mast cell growth-enhancing activity (MEA) is structurally related and functionally identical to the novel mouse T cell growth factor P40/TCGFIII (interleukin 9).

    PubMed

    Hültner, L; Druez, C; Moeller, J; Uyttenhove, C; Schmitt, E; Rüde, E; Dörmer, P; Van Snick, J

    1990-06-01

    We have previously shown that certain bone marrow-derived mast cell (BMMC) lines proliferate in response to a mast cell growth-enhancing activity (MEA) that is distinct from interleukin (IL) 3 and IL 4. Here we provide evidence that MEA is identical with the recently cloned mouse T cell growth factor P40. The evidence is as follows: (a) recombinant P40 displayed all the biological activities ascribed to MEA: it supported the growth of MEA-sensitive BMMC lines, it induced IL 6 secretion by these cells, and it enhanced survival of primary mast cell cultures; (b) highly purified MEA stimulated the growth of P40-dependent cell lines; (c) a rabbit monospecific antiserum directed against P40 specifically inhibited the action of MEA on BMMC; (d) specific binding sites for P40 were detected on BMMC and (e) MEA competed with P40 for binding to P40-dependent T cells, indicating that the two molecules interact with the same receptor. These observations further extend the range of biological activities ascribed to P40 and warrant its proposed designation as IL9.

  13. Clozapine and other competitive antagonists reactivate risperidone-inactivated h5-HT7 receptors: radioligand binding and functional evidence for GPCR homodimer protomer interactions

    PubMed Central

    Toohey, Nicole; Knight, Jessica A.; Klein, Michael T.; Smith, Carol

    2011-01-01

    Rationale The h5-HT7 receptor is subject to inactivation by risperidone and 9-OH-risperidone, apparently through a pseudo-irreversible complex formed between these drugs and the receptor. Although risperidone and 9-OH-risperidone (“inactivating antagonists”) completely inactivate the receptor, only 50% of the receptors form a pseudo-irreversible complex with these drugs. Objectives This study aims to more fully determine the mechanism(s) responsible for the novel effects of risperidone and 9-OH-risperidone and to determine if the inactivation can be reversed (reactivation). Methods The ability of non-inactivating drugs (competitive antagonists) to dissociate wash-resistant [3H]risperidone binding from h5-HT7 receptors was investigated. Also, the ability of non-inactivating drugs to reactivate inactivated h5-HT7 receptors was investigated, using cAMP accumulation as a functional endpoint. Results The competitive (non-inactivating) antagonists clozapine and mesulergine released the wash-resistant [3H]risperidone binding to the h5-HT7 receptor. The competitive antagonists clozapine, SB269970, mianserin, cyproheptadine, mesulergine, and ICI169369 reactivated the risperidone-inactivated h5-HT7 receptors in a concentration-dependent manner. The potencies for reactivation closely match the affinities of these drugs for the h5-HT7 receptor (r2=0.95), indicating that the reactivating antagonists are binding to and producing their effects through the orthosteric binding site of the h5-HT7 receptor. Bioluminescence resonance energy transfer analyses indicate that the h5-HT7 receptor forms homodimers. Conclusions The ability of the non-inactivating drugs to bind h5-HT7 orthosteric sites and reverse the wash-resistant effects of risperidone or 9-OH-risperidone, also bound to h5-HT7 orthosteric sites, is evidence for protomer–protomer interactions between h5-HT7 homodimers. This is the first demonstration of a non-mutated G-protein-coupled receptor homodimer engaging in

  14. An in Vitro and in Vivo Investigation of Bivalent Ligands That Display Preferential Binding and Functional Activity for Different Melanocortin Receptor Homodimers.

    PubMed

    Lensing, Cody J; Freeman, Katie T; Schnell, Sathya M; Adank, Danielle N; Speth, Robert C; Haskell-Luevano, Carrie

    2016-04-14

    Pharmacological probes for the melanocortin receptors have been utilized for studying various disease states including cancer, sexual function disorders, Alzheimer's disease, social disorders, cachexia, and obesity. This study focused on the design and synthesis of bivalent ligands to target melanocortin receptor homodimers. Lead ligands increased binding affinity by 14- to 25-fold and increased cAMP signaling potency by 3- to 5-fold compared to their monovalent counterparts. Unexpectedly, different bivalent ligands showed preferences for particular melanocortin receptor subtypes depending on the linker that connected the binding scaffolds, suggesting structural differences between the various dimer subtypes. Homobivalent compound 12 possessed a functional profile that was unique from its monovalent counterpart providing evidence of the discrete effects of bivalent ligands. Lead compound 7 significantly decreased feeding in mice after intracerebroventricular administration. To the best of our knowledge, this is the first report of a melanocortin bivalent ligand's in vivo physiological effects.

  15. Both JrWRKY2 and JrWRKY7 of Juglans regia mediate responses to abiotic stresses and abscisic acid through formation of homodimers and interaction.

    PubMed

    Yang, G; Zhang, W; Liu, Z; Yi-Maer, A-Y; Zhai, M; Xu, Z

    2017-03-01

    WRKY transcription factors belong to a large protein family that is involved in diverse developmental processes and abiotic stress responses. Currently, there is little understanding of the role of WRKY transcription factors in regulatory mechanisms in plants, especially in the protein-protein interactions that are essential for biological regulatory functions and networks. In the present study, yeast one-hybrid, yeast two-hybrid, transient expression and quantitative RT-PCR were applied to investigate the potential characteristics of two WRKY proteins from Juglans regia, JrWRKY2 (GenBank Accession No. KU057089) and JrWRKY7 (GenBank Accession No. KP784651). JrWRKY2 and JrWRKY7 can form homodimers and interact with each other. JrWRKY2 and JrWRKY7 can bind to W-box motifs. Similarly high levels of transcription were found for JrWRKY2 and JrWRKY7 under NaCl and polyethylene glycol (PEG) stresses, as well as at different developmental stages, e.g., the pistil or terminal leaf. JrWRKY2 and JrWRKY7 were transiently overexpressed in an independent manner in the terminal leaf. Analyses of superoxide dismutase (SOD) and peroxidase (POD) activities, proline and malondialdehyde (MDA) contents, and electrolyte leakage rate showed that JrWRKY2 and JrWRKY7 overexpression improved plant tolerance to NaCl, PEG, abscisic acid, and cold stress. Additionally, JrWRKY2 and JrWRKY7 overexpression elevated transcription of SOD, POD, glutathione peroxidase (GPX), catalase (CAT), ascorbate peroxidase (APX), and MYB genes, but downregulated the expression of NAC. Overall, the results demonstrate that JrWRKY2 and JrWRKY7 are dimeric proteins that can form functional homodimers and interact with each other and that they are involved in abiotic stress responses.

  16. Latent membrane protein 1 of Epstein-Barr virus sensitizes cancer cells to cisplatin by enhancing NF-κB p50 homodimer formation and downregulating NAPA expression.

    PubMed

    Wu, Zchong-Zcho; Chow, Kai-Ping N; Kuo, Tzu-Ching; Chang, Yu-Sun; Chao, Chuck C-K

    2011-12-15

    Expression of the oncogenic latent membrane protein 1 (LMP1) of Epstein-Barr virus is involved in the pathogenesis of nasopharyngeal carcinoma (NPC) and lymphoma. In previous studies, we found that expression of LMP1 was sufficient to transform BALB/c-3T3 cells. In contrast, other studies have shown that LMP1 induces apoptosis in a NF-κB-dependent manner and also inhibits the growth of tumors in mice, thereby indicating that LMP1 may produce various biological effects depending on the biological and cellular context. Still, the mechanism underlying the pro-apoptotic activity of LMP1 remains unclear. In the present study, we found that LMP1 inhibits the expression of NAPA, an endoplasmic reticulum SNARE protein that possesses anti-apoptotic properties against the DNA-damaging drug cisplatin. Accordingly, LMP1-transformed BALB/c-3T3 cells were sensitized to cisplatin-induced apoptosis, whereas no sensitization effect was noted following treatment with the mitotic spindle-damaging drugs vincristine and taxol. Knockdown of LMP1 with antisense oligonucleotides restored NAPA protein level and rendered the cells resistant to cisplatin. Similarly, overexpression of NAPA reduced the effect of LMP1 and induced resistance to cisplatin. LMP1 was shown to upregulate the NF-κB subunit p50, leading to formation of p50 homodimers on the NAPA promoter. These findings suggest that the viral protein LMP1 may sensitize cancer cells to cisplatin chemotherapy by downregulating NAPA and by enhancing the formation of p50 homodimers which in turn inhibit the expression of NF-κB regulated anti-apoptotic genes. These findings provide an explanatory mechanism for the pro-apoptotic activity of LMP1 as well as new therapeutic targets to control tumor growth.

  17. Use of the α-mannosidase I inhibitor kifunensine allows the crystallization of apo CTLA-4 homodimer produced in long-term cultures of Chinese hamster ovary cells

    PubMed Central

    Yu, Chao; Crispin, Max; Sonnen, Andreas F.-P.; Harvey, David J.; Chang, Veronica T.; Evans, Edward J.; Scanlan, Christopher N.; Stuart, David I.; Gilbert, Robert J. C.; Davis, Simon J.

    2011-01-01

    Glycoproteins present problems for structural analysis since they often have to be glycosylated in order to fold correctly and because their chemical and conformational heterogeneity generally inhibits crystallization. It is shown that the α-mannosidase I inhibitor kifunensine, which has previously been used for the purpose of glycoprotein crystallization in short-term (3–5 d) cultures, is apparently stable enough to be used to produce highly endoglycosidase H-sensitive glycoprotein in long-term (3–4 week) cultures of stably transfected Chinese hamster ovary (CHO) cells. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry-based analysis of the extracellular region of the cytotoxic T-lymphocyte antigen 4 (CTLA-4; CD152) homodimer expressed in long-term CHO cell cultures in the presence of kifunensine revealed that the inhibitor restricted CTLA-4 glycan processing to Man9GlcNAc2 and Man5GlcNAc2 structures. Complex-type glycans were undetectable, suggesting that the inhibitor was active for the entire duration of the cultures. Endoglycosidase treatment of the homodimer yielded protein that readily formed orthorhombic crystals with unit-cell parameters a = 43.9, b = 51.5, c = 102.9 Å and space group P212121 that diffracted to Bragg spacings of 1.8 Å. The results indicate that kifunensine will be effective in most, if not all, transient and long-term mammalian cell-based expression systems. PMID:21795794

  18. DNA-binding affinity and transcriptional activity of the RelA homodimer of nuclear factor kappa B are not correlated.

    PubMed

    Mulero, Maria Carmen; Huang, De-Bin; Nguyen, H Thien; Wang, Vivien; Li, Yidan; Biswas, Tapan; Ghosh, Gourisankar

    2017-09-21

    The nuclear factor kappa B (NF-κB) transcription factor family regulates genes involved in cell proliferation and inflammation. The promoters of these genes often contain NF-κB binding sites (κB sites) arranged in tandem. How NF-κB activates transcription through these multiple sites is incompletely understood. We report here an X-ray crystal structure of homodimers comprising the RelA DNA binding domain containing the Rel homology region (RHR) in NF-κB bound to an E-selectin promoter fragment with tandem κB sites. This structure revealed that two dimers bind asymmetrically to the symmetrically arranged κB sites at which multiple cognate contacts between one dimer to the corresponding DNA are broken. Since simultaneous RelA RHR dimer binding to tandem sites in solution was anti-cooperative, we inferred that asymmetric RelA RHR binding with fewer contacts likely indicates a dissociative binding mode. We found that both κB sites are essential for reporter gene activation by full-length RelA homodimer, suggesting that dimers facilitate DNA binding to each other even though their stable co-occupation is not promoted. Promoter variants with altered spacing and orientation of tandem κB sites displayed unexpected reporter activities that were not explained by solution-binding pattern of RelA RHR. Remarkably, full-length RelA bound all DNAs with a weaker affinity and specificity. Moreover, the transactivation domain (AD) played a negative role in DNA binding. These observations suggest that other nuclear factors influence full-length RelA binding to DNA by neutralizing AD negative effect. We propose that DNA binding by NF-κB dimers is highly complex and modulated by facilitated association-dissociation processes. Copyright © 2017, The American Society for Biochemistry and Molecular Biology.

  19. Carcinogenic heavy metals replace Ca{sup 2+} for DNA binding and annealing activities of mono-ubiquitinated annexin A1 homodimer

    SciTech Connect

    Hirata, Aiko; Corcoran, George B.; Hirata, Fusao

    2010-10-01

    Mono-ubiquitinated annexin A1 was purified from rat liver nuclei. The homodimer form of mono-ubiquitinated annexin A1 was able to unwind dsDNA in a Mg{sup 2+}- and ATP-dependent manner, and to anneal ssDNA in a Ca{sup 2+}-dependent manner. Phospholipids decreased the concentration of Ca{sup 2+} required for maximal annealing activity. Heavy metals such as As{sup 3+}, Cr{sup 6+}, Pb{sup 2+} and Cd{sup 2+} substituted for Ca{sup 2+} in the ssDNA binding and annealing activities of annexin A1. While these metals inhibited the unwinding of dsDNA by nuclear annexin A1 in the presence of Mg{sup 2+} and ATP, they enhanced dsDNA-dependent ATPase activity of annexin A1. Heavy metals may have produced dsDNA, a substrate for the DNA unwinding reaction, via the DNA annealing reaction. DNA synthesomes were isolated from L5178Y tk(+/-) mouse lymphoma cells in exponential growth, and were found to contain helicase activities. The As{sup 3+}- or Cr{sup 6+}-induced increases in ssDNA binding activity of DNA synthesomes were reduced by a mono-specific anti-annexin A1 antibody, but not by anti-Ig antibody. Anti-annexin A1 antibody also blocked the inhibitory and stimulatory effects of As{sup 3+} or Cr{sup 6+} towards DNA unwinding and annealing activities of DNA synthesomes. Based on these observations, it can be concluded that the effects of heavy metals on DNA annealing and unwinding activities are mediated, at least in substantial part, through actions of the mono-ubiquitinated annexin A1 homodimer.

  20. Cerebrospinal Fluid IL-12p40, CXCL13 and IL-8 as a Combinatorial Biomarker of Active Intrathecal Inflammation

    PubMed Central

    Bielekova, Bibiana; Komori, Mika; Xu, Quangang; Reich, Daniel S.; Wu, Tianxia

    2012-01-01

    Diagnosis and management of the neuroinflammatory diseases of the central nervous system (CNS) are hindered by the lack of reliable biomarkers of active intrathecal inflammation. We hypothesized that measuring several putative inflammatory biomarkers simultaneously will augment specificity and sensitivity of the biomarker to the clinically useful range. Based on our pilot experiment in which we measured 18 inflammatory biomarkers in 10-fold concentrated cerebrospinal fluid (CSF) derived from 16 untreated patients with highly active multiple sclerosis (MS) we selected a combination of three CSF biomarkers, IL-12p40, CXCL13 and IL-8, for further validation. Concentrations of IL-12p40, CXCL13 and IL-8 were determined in a blinded fashion in CSF samples from an initial cohort (n = 72) and a confirmatory cohort (n = 167) of prospectively collected, untreated subjects presenting for a diagnostic work-up of possible neuroimmunological disorder. Diagnostic conclusion was based on a thorough clinical workup, which included laboratory assessment of the blood and CSF, neuroimaging and longitudinal follow-up. Receiver operating characteristic (ROC) curve analysis in conjunction with principal component analysis (PCA), which was used to combine information from all three biomarkers, assessed the diagnostic value of measured biomarkers. Each of the three biomarkers was significantly increased in MS and other inflammatory neurological disease (OIND) in comparison to non-inflammatory neurological disorder patients (NIND) at least in one cohort. However, considering all three biomarkers together improved accuracy of predicting the presence of intrathecal inflammation to the consistently good to excellent range (area under the ROC curve = 0.868–0.924). Future clinical studies will determine if a combinatorial biomarker consisting of CSF IL-12p40, CXCL13 and IL-8 provides utility in determining the presence of active intrathecal inflammation in diagnostically uncertain

  1. P40 and P90 from Mpn142 are Targets of Multiple Processing Events on the Surface of Mycoplasma pneumoniae

    PubMed Central

    Widjaja, Michael; Berry, Iain J.; Pont, Elsa J.; Padula, Matthew P.; Djordjevic, Steven P.

    2015-01-01

    Mycoplasma pneumoniae is a significant cause of community acquired pneumonia globally. Despite having a genome less than 1 Mb in size, M. pneumoniae presents a structurally sophisticated attachment organelle that (i) provides cell polarity, (ii) directs adherence to receptors presented on respiratory epithelium, and (iii) plays a major role in cell motility. The major adhesins, P1 (Mpn141) and P30 (Mpn453), are localised to the tip of the attachment organelle by the surface accessible cleavage fragments P90 and P40 derived from Mpn142. Two events play a defining role in the formation of P90 and P40; removal of a leader peptide at position 26 (23SLA↓NTY28) during secretion to the cell surface and cleavage at amino acid 455 (452GPL↓RAG457) generating P40 and P90. Liquid Chromatography Tandem Mass Spectrometry (LC-MS/MS) analysis of tryptic peptides generated by digesting size-fractionated cell lysates of M. pneumoniae identified 15 cleavage fragments of Mpn142 ranging in mass from 9–84 kDa. Further evidence for the existence of cleavage fragments of Mpn142 was generated by mapping tryptic peptides to proteins recovered from size fractionated eluents from affinity columns loaded with heparin, fibronectin, fetuin, actin, plasminogen and A549 surface proteins as bait. To define the sites of cleavage in Mpn142, neo-N-termini in cell lysates of M. pneumoniae were dimethyl-labelled and characterised by LC-MS/MS. Our data suggests that Mpn142 is cleaved to generate adhesins that are auxiliary to P1 and P30.

  2. PtdIns(3)P-DEPENDENT AND INDEPENDENT FUNCTIONS OF p40PHOX IN ACTIVATION OF THE NEUTROPHIL NADPH OXIDASE

    PubMed Central

    Bissonnette, Sarah A.; Glazier, Christina M.; Stewart, Mary Q.; Brown, Glenn E.; Ellson, Chris D.; Yaffe, Michael B.

    2009-01-01

    In response to bacterial infection, the neutrophil NADPH oxidase assembles on phagolysosomes to catalyze the transfer of electrons from NADPH to oxygen, forming superoxide and downstream reactive oxygen species (ROS). The active oxidase is composed of a membrane-bound cytochrome together with three cytosolic phox proteins, p40phox, p47phox and p67phox, and the small GTPase Rac2, and is regulated through a process involving Protein Kinase Cs, MAP kinases, and PI 3-kinases. The role of p40phox remains less well defined than those of p47phox and p67phox. We investigated the biological role of p40phox in differentiated PLB-985 neutrophils, and show that depletion of endogenous p40phox using lentiviral shRNA reduces ROS production and impairs bacterial killing under conditions where p67phox levels remain constant. Biochemical studies using a cytosol-reconstituted permeabilized human neutrophil cores system that recapitulates intracellular oxidase activation revealed that depletion of p40phox reduces both the maximal rate and total amount of ROS produced without altering the KM of the oxidase for NADPH. Using a series of mutants, p47PX-p40phox chimeras, and deletion constructs, we found that the p40phox PX domain has PtdIns(3)P-dependent and independent functions. Translocation of p67phox requires the PX domain but not 3-phosphoinositide binding. Activation of the oxidase by p40phox, however, requires both PtdIns(3)P binding and an SH3 domain competent to bind to poly-Pro ligands. Mutations that disrupt the closed auto-inhibited form of full-length p40phox can increase oxidase activity ∼2.5-fold above that of wild-type p40phox, but maintain the requirement for PX and SH3 domain function. We present a model where p40phox translocates p67phox to the region of the cytochrome and subsequently switches the oxidase to an activated state dependent upon PtdIns(3)P and SH3 domain engagement. PMID:18029359

  3. Identification and immuno-electron microscopy localization of p40, a protein component of immunosuppressive virus-like particles from Leptopilina heterotoma

    PubMed Central

    Chiu, Hsiling; Morales, Jorge; Govind, Shubha

    2009-01-01

    Lamellocytes are specialized larval blood cells of Drosophila that carry out encapsulation of metazoan pathogens such as parasitoid wasps. Large virus-like particles (VLPs) from two closely related virulent parasitoid wasp species, Leptopilina heterotoma and Leptopilina victoriae, suppress the host encapsulation response by promoting lysis of lamellocytes. The molecular basis of VLP–lamellocyte interaction and lamellocyte lysis is not understood. Here, it was shown that mature VLPs are composed of at least four major proteins. Polyclonal antisera against the most abundant L. heterotoma VLP protein, p40, cross-reacted with the most abundant L. victoriae VLP protein, p47.5. Immuno-electron microscopy (EM) of the long gland–reservoir complex revealed that p40 was expressed early in VLP biogenesis and was detected along with VLP precursors within the long gland cells and lumen. In the reservoir, VLPs had an angular core, resembled mature particles and p40 was detected outside the VLP cores. Immuno-EM staining of mature VLPs from both species localized the p40 and p47.5 proteins largely to the periphery of the VLPs and along the VLP spike-like projections. p40 staining was observed in VLP-treated host haemocytes. In vitro, anti-p40 antibody almost completely blocked the ability of L. heterotoma VLPs to promote lamellocyte lysis. Anti-p40 antibody blocked lysis by L. victoriae VLPs by >50 %. It is proposed that the VLP surface proteins p40 and p47.5 share antigenic determinants and significantly contribute to the strong virulence of their Hymenopteran hosts. PMID:16432035

  4. Proton-bound dimers of nitrogen heterocyclic molecules: Substituent effects on the structures and binding energies of homodimers of diazine, triazine, and fluoropyridine

    SciTech Connect

    Attah, Isaac K.; Platt, Sean P.; Meot-Ner, Michael; El-Shall, M. S.; Aziz, Saadullah G.; Alyoubi, Abdulrahman O.

    2014-03-21

    The bonding energies of proton-bound homodimers BH{sup +}B were measured by ion mobility equilibrium studies and calculated at the DFT B3LYP/6-311++G{sup **} level, for a series of nitrogen heterocyclic molecules (B) with electron-withdrawing in-ring N and on-ring F substituents. The binding energies (ΔH°{sub dissoc}) of the proton-bound dimers (BH{sup +}B) vary significantly, from 29.7 to 18.1 kcal/mol, decreasing linearly with decreasing the proton affinity of the monomer (B). This trend differs significantly from the constant binding energies of most homodimers of other organic nitrogen and oxygen bases. The experimentally measured ΔH°{sub dissoc} for (1,3-diazine){sub 2}H{sup +}, i.e., (pyrimidine){sub 2}H{sup +} and (3-F-pyridine){sub 2}H{sup +} are 22.7 and 23.0 kcal/mol, respectively. The measured ΔH°{sub dissoc} for the pyrimidine{sup ·+}(3-F-pyridine) radical cation dimer (19.2 kcal/mol) is signifcantly lower than that of the proton-bound homodimers of pyrimidine and 3-F-pyridine, reflecting the stronger interaction in the ionic H-bond of the protonated dimers. The calculated binding energies for (1,2-diazine){sub 2}H{sup +}, (pyridine){sub 2}H{sup +}, (2-F-pyridine){sub 2}H{sup +}, (3-F-pyridine){sub 2}H{sup +}, (2,6-di-F-pyridine){sub 2}H{sup +}, (4-F-pyridine){sub 2}H{sup +}, (1,3-diazine){sub 2}H{sup +}, (1,4-diazine){sub 2}H{sup +}, (1,3,5-triazine){sub 2}H{sup +}, and (pentafluoropyridine){sub 2}H{sup +} are 29.7, 24.9, 24.8, 23.3, 23.2, 23.0, 22.4, 21.9, 19.3, and 18.1 kcal/mol, respectively. The electron-withdrawing substituents form internal dipoles whose electrostatic interactions contribute to both the decreased proton affinities of (B) and the decreased binding energies of the protonated dimers BH{sup +}B. The bonding energies also vary with rotation about the hydrogen bond, and they decrease in rotamers where the internal dipoles of the components are aligned efficiently for inter-ring repulsion. For compounds substituted at the 3 or 4

  5. Proton-bound dimers of nitrogen heterocyclic molecules: Substituent effects on the structures and binding energies of homodimers of diazine, triazine, and fluoropyridine

    NASA Astrophysics Data System (ADS)

    Attah, Isaac K.; Platt, Sean P.; Meot-Ner Mautner, Michael; El-Shall, M. S.; Aziz, Saadullah G.; Alyoubi, Abdulrahman O.

    2014-03-01

    The bonding energies of proton-bound homodimers BH+B were measured by ion mobility equilibrium studies and calculated at the DFT B3LYP/6-311++G** level, for a series of nitrogen heterocyclic molecules (B) with electron-withdrawing in-ring N and on-ring F substituents. The binding energies (ΔH°dissoc) of the proton-bound dimers (BH+B) vary significantly, from 29.7 to 18.1 kcal/mol, decreasing linearly with decreasing the proton affinity of the monomer (B). This trend differs significantly from the constant binding energies of most homodimers of other organic nitrogen and oxygen bases. The experimentally measured ΔH°dissoc for (1,3-diazine)2H+, i.e., (pyrimidine)2H+ and (3-F-pyridine)2H+ are 22.7 and 23.0 kcal/mol, respectively. The measured ΔH°dissoc for the pyrimidine.+(3-F-pyridine) radical cation dimer (19.2 kcal/mol) is signifcantly lower than that of the proton-bound homodimers of pyrimidine and 3-F-pyridine, reflecting the stronger interaction in the ionic H-bond of the protonated dimers. The calculated binding energies for (1,2-diazine)2H+, (pyridine)2H+, (2-F-pyridine)2H+, (3-F-pyridine)2H+, (2,6-di-F-pyridine)2H+, (4-F-pyridine)2H+, (1,3-diazine)2H+, (1,4-diazine)2H+, (1,3,5-triazine)2H+, and (pentafluoropyridine)2H+ are 29.7, 24.9, 24.8, 23.3, 23.2, 23.0, 22.4, 21.9, 19.3, and 18.1 kcal/mol, respectively. The electron-withdrawing substituents form internal dipoles whose electrostatic interactions contribute to both the decreased proton affinities of (B) and the decreased binding energies of the protonated dimers BH+B. The bonding energies also vary with rotation about the hydrogen bond, and they decrease in rotamers where the internal dipoles of the components are aligned efficiently for inter-ring repulsion. For compounds substituted at the 3 or 4 (meta or para) positions, the lowest energy rotamers are T-shaped with the planes of the two rings rotated by 90° about the hydrogen bond, while the planar rotamers are weakened by repulsion between the

  6. Identification of the major proteins of an immune modulating fraction from adult Fasciola hepatica released by Nonidet P40.

    PubMed

    Morphew, Russell M; Hamilton, Clare M; Wright, Hazel A; Dowling, David J; O'Neill, Sandra M; Brophy, Peter M

    2013-01-31

    Fasciola hepatica NP-40 released protein extract (FhNPE) exhibits potent Th1 immunosuppressive properties in vitro and in vivo. However, the protein composition of this active fraction, responsible for Th1 immune modulatory activity, has yet to be resolved. Therefore, FhNPE, a Nonidet P-40 extract, was subjected to a proteomic analysis in order to identify individual protein components. This was performed using an in house F. hepatica EST database following 2D electrophoresis combined with de novo sequencing based mass spectrometry. The identified proteins, a mixture of excretory/secretory and membrane-associated proteins, are associated with stress response and chaperoning, energy metabolism and cytoskeletal components. The immune modulatory properties of these identified protein(s) are discussed and HSP70 from F. hepatica is highlighted as a potential host immune modulator for future study.

  7. Homo-Dimers of Vanillin and Apocynin Decrease Metastatic Potential of Human Cancer Cells by Inhibiting the FAK/PI3K/Akt Signaling Pathway.

    PubMed

    Jantaree, Phatcharida; Lirdprapamongkol, Kriengsak; Kaewsri, Wilailak; Thongsornkleeb, Charnsak; Choowongkomon, Kiattawee; Atjanasuppat, Korakot; Ruchirawat, Somsak; Svasti, Jisnuson

    2017-03-01

    The spread of cancer cells to distant organs, in a process called metastasis, is the main factor that contributes to most death in cancer patients. Vanillin, the vanilla flavoring agent, has been shown to suppress metastasis in a mouse model. Here, we evaluated the anti-metastatic potential of the food additive divanillin, the homo-dimer of vanillin, and their structurally related compounds, apocynin and diapocynin, in hepatocellular carcinoma cells. The Transwell invasion assay showed that the dimeric forms exhibited higher potency than vanillin and apocynin in inhibiting invasion, with IC50 values of 23.3±7.4 to 41.3±4.2 μM for the dimers, which are 26-34 fold lower than IC50 values of vanillin and apocynin (p<0.05). Both monomeric and dimeric forms target regulation of the invasion process, by inhibiting phosphorylation of FAK and Akt. Molecular docking studies suggested that the dimers should bind more tightly than vanillin and apocynin to the Y397 pocket of FAK FERM domain. Thus, the food additive divanillin has greater anti-metastatic potential than the flavoring agent vanillin.

  8. Liquid-phase electron microscopy of molecular drug response in breast cancer cells reveals irresponsive cell subpopulations related to lack of HER2 homodimers.

    PubMed

    Peckys, Diana B; Korf, Ulrike; Wiemann, Stefan; de Jonge, Niels

    2017-08-09

    The development of drug resistance in cancer poses a major clinical problem. An example is human epidermal growth factor receptor 2 (HER2) overexpressing breast cancer often treated with anti-HER2 antibody therapies, such as trastuzumab. Since drug resistance is rooted mainly in tumor cell heterogeneity, we examined the drug effect in different subpopulations of SKBR3 breast cancer cells, and compared the results with a drug resistant cell line, HCC1954. Correlative light microscopy and liquid-phase scanning transmission electron microscopy (STEM) were used to quantitatively analyze HER2 responses upon drug binding, whereby many tens of whole cells were imaged. Trastuzumab was found to selectively cross-link and down regulate HER2 homodimers from the plasma membranes of bulk cancer cells. In contrast, HER2 resided mainly as monomers in rare subpopulations of resting- and cancer stem cells (CSCs), and these monomers were not internalized after drug binding. The HER2 distribution was hardly influenced by trastuzumab for the HCC1954 cells. These findings show that resting cells and CSCs are irresponsive to the drug, and thus point towards a molecular explanation behind the origin of drug resistance. This analytical method is broadly applicable to study membrane protein interactions in the intact plasma membrane, while accounting for cell heterogeneity. © 2017 by The American Society for Cell Biology.

  9. The APC/C subunit Cdc16/Cut9 is a contiguous tetratricopeptide repeat superhelix with a homo-dimer interface similar to Cdc27

    PubMed Central

    Zhang, Ziguo; Kulkarni, Kiran; Hanrahan, Sarah J; Thompson, Andrew J; Barford, David

    2010-01-01

    The anaphase-promoting complex/cyclosome (APC/C), an E3 ubiquitin ligase responsible for controlling cell cycle transitions, is a multisubunit complex assembled from 13 different proteins. Numerous APC/C subunits incorporate multiple copies of the tetratricopeptide repeat (TPR). Here, we report the crystal structure of Schizosaccharomyces pombe Cut9 (Cdc16/Apc6) in complex with Hcn1 (Cdc26), showing that Cdc16/Cut9 is a contiguous TPR superhelix of 14 TPR units. A C-terminal block of TPR motifs interacts with Hcn1, whereas an N-terminal TPR block mediates Cdc16/Cut9 self-association through a homotypic interface. This dimer interface is structurally related to the N-terminal dimerization domain of Cdc27, demonstrating that both Cdc16/Cut9 and Cdc27 form homo-dimers through a conserved mechanism. The acetylated N-terminal Met residue of Hcn1 is enclosed within a chamber created from the Cut9 TPR superhelix. Thus, in complex with Cdc16/Cut9, the N-acetyl-Met residue of Hcn1, a putative degron for the Doa10 E3 ubiquitin ligase, is inaccessible for Doa10 recognition, protecting Hcn1/Cdc26 from ubiquitin-dependent degradation. This finding may provide a structural explanation for a mechanism to control the stoichiometry of proteins participating in multisubunit complexes. PMID:20924356

  10. A Binuclear Zinc Interaction Fold Discovered in the Homodimer of Alzheimer's Amyloid-β Fragment with Taiwanese Mutation D7H.

    PubMed

    Polshakov, Vladimir I; Mantsyzov, Alexey B; Kozin, Sergey A; Adzhubei, Alexei A; Zhokhov, Sergey S; van Beek, Wouter; Kulikova, Alexandra A; Indeykina, Maria I; Mitkevich, Vladimir A; Makarov, Alexander A

    2017-06-01

    Zinc-induced oligomerization of amyloid-β peptide (Aβ) produces potentially pathogenic agents of Alzheimer's disease. Mutations and modifications in the metal binding domain 1-16 of Aβ peptide crucially affect its zinc-induced oligomerization by changing intermolecular zinc mediated interface. The 3D structure of this interface appearing in a range of Aβ species is a prospective drug target for disease modifying therapy. Using NMR spectroscopy, EXAFS spectroscopy, mass spectrometry, and isothermal titration calorimetry the interaction of zinc ions with Aβ fragments 1-7 and 1-10 carrying familial Taiwanese mutation D7H was studied. Zinc ions induce formation of a stable homodimer formed by the two peptide chains fastened by two zinc ions and stacking interactions of imidazole rings. A binuclear zinc interaction fold in the dimer structure was discovered. It can be used for designing zinc-regulated proteins and zinc-mediated self-assembling peptides. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Replication-specific conversion of the Staphylococcus aureus pT181 initiator protein from an active homodimer to an inactive heterodimer.

    PubMed Central

    Rasooly, A; Wang, P Z; Novick, R P

    1994-01-01

    The Staphylococcus aureus rolling circle plasmid pT181 regulates its replication by controlling the synthesis of its initiator protein RepC. RepC is inactivated during pT181 replication by the addition of an oligodeoxynucleotide, giving rise to a new form, RepC*. We analyzed RepC and RepC* in four classes of mutants: plasmid copy number mutants, two classes of RepC mutants affecting different portions of the protein and oriC (origin) mutants. We have found that in the cell with wild-type RepC there are similar relative amounts of RepC and RepC*, regardless of copy number, and that the conversion of RepC to RepC* is replication dependent. Genetic and biochemical evidence is presented that RepC functions as a dimer and that during replication the RepC homodimer is converted to the RepC/RepC* heterodimer. Images PMID:7957090

  12. Risperidone-Induced Inactivation and Clozapine-Induced Reactivation of Rat Cortical Astrocyte 5-Hydroxytryptamine7 Receptors: Evidence for In Situ G Protein-Coupled Receptor Homodimer Protomer Cross-Talk

    PubMed Central

    Smith, Carol; Toohey, Nicole; Knight, Jessica A.; Klein, Michael T.

    2011-01-01

    We have reported previously novel drug-induced inactivation and reactivation of human 5-hydroxytryptamine7 (5-HT7) receptors in a recombinant cell line. To explain these novel observations, a homodimer structure displaying protomer-protomer cross-talk was proposed. To determine whether these novel observations and interpretations are due to an artifactual G protein-coupled receptor (GPCR) mechanism unique to the recombinant cell line, we explored the properties of r5-HT7 receptors expressed by cortical astrocytes in primary culture. As in the recombinant cell line, risperidone, 9-OH-risperidone, methiothepin, and bromocriptine were found to potently inactivate r5-HT7 receptors. As in the recombinant cell line, exposure of risperidone-inactivated astrocyte r5-HT7 receptors to competitive antagonists resulted in the reactivation of r5-HT7 receptors. The potencies of the reactivating drugs closely correlated with their affinities for h5-HT7 receptors. These results indicate the novel inactivating and reactivating property of drugs is not due to an artifact of the recombinant cell line expressing h5-HT7 receptors but is an intrinsic property of 5-HT7 receptors in vitro and ex vivo. This evidence suggests that a native (nonmutated) GPCR, in its native membrane environment (cortical astrocyte primary culture), can function as a homodimer with protomer-protomer cross-talk. Homodimers may be a common GPCR structure. The experimental design used in our studies can be used to explore the properties of other GPCRs in their native forms in recombinant cells, primary cultures expressing the endogenous GPCRs, and possibly in vivo. The homodimer structure and protomer-protomer cross-talk offer new avenues of research into receptor dysfunction in disease states and the development of novel drugs. PMID:21062995

  13. Seventeen copies of the human 37 kDa laminin receptor precursor/p40 ribosome-associated protein gene are processed pseudogenes arisen from retropositional events.

    PubMed

    Jackers, P; Clausse, N; Fernandez, M; Berti, A; Princen, F; Wewer, U; Sobel, M E; Castronovo, V

    1996-02-07

    A cDNA coding for a 37 kDa polypeptide has been identified in several species as both the potential precursor of the 67 kDa laminin receptor (37LRP) and a putative ribosome-associated protein (p40). Interestingly, increased expression of this polypeptide (37LRP/p40) is consistently observed in invasive and metastatic cancer cells and is associated with poor prognosis. Southern-blot analysis of human genomic DNA predicted multiple copies of the 37LRP/p40 gene. In this study, we report that the number of copies of this sequence in the human genome is 26 +/- 2. We have sequenced and analyzed 19 genomic clones corresponding to the 37LRP/p40 gene and found that they were all processed pseudogenes. They all lack intronic sequences and show multiple genetic alterations leading in some cases to the appearance of stop codons. Moreover, they all bear characteristic features of retroposons as the presence of a poly(A)-tail at their 3' end and short direct repeated flanking DNA sequences. None of the pseudogenes analyzed present cis-elements in their 5' flanking region such as TATA or GC boxes. Our date reveal that over 50% of the 37LRP/p40 gene copies are pseudogenes most probably generated by retropositional events. The finding of multiple pseudogenes for the 37LRP/p40 suggests that the accumulation of several copies of this gene might have given a survival advantage to the cell in the course of evolution.

  14. Effector-repressor interactions, binding of a single effector molecule to the operator-bound TtgR homodimer mediates derepression.

    PubMed

    Terán, Wilson; Krell, Tino; Ramos, Juan Luis; Gallegos, María-Trinidad

    2006-03-17

    The RND family transporter TtgABC and its cognate repressor TtgR from Pseudomonas putida DOT-T1E were both shown to possess multidrug recognition properties. Structurally unrelated molecules such as chloramphenicol, butyl paraben, 1,3-dihydroxynaphthalene, and several flavonoids are substrates of TtgABC and activate pump expression by binding to the TtgR-operator complex. Isothermal titration calorimetry was employed to determine the thermodynamic parameters for the binding of these molecules to TtgR. Dissociation constants were in the range from 1 to 150 microm, the binding stoichiometry was one effector molecule per dimer of TtgR, and the process was driven by favorable enthalpy changes. Although TtgR exhibits a large multidrug binding profile, the plant-derived compounds phloretin and quercetin were shown to bind with the highest affinity (K(D) of around 1 microm), in contrast to other effectors (chloramphenicol and aromatic solvents) for which exhibited a more reduced affinity. Structure-function studies of effectors indicate that the presence of aromatic rings as well as hydroxyl groups are determinants for TtgR binding. The binding of TtgR to its operator DNA does not alter the protein effector profile nor the effector binding stoichiometry. Moreover, we demonstrate here for the first time that the binding of a single effector molecule to the DNA-bound TtgR homodimer induces the dissociation of the repressor-operator complex. This provides important insight into the molecular mechanism of effector-mediated derepression.

  15. CD8 Raft localization is induced by its assembly into CD8alpha beta heterodimers, Not CD8alpha alpha homodimers.

    PubMed

    Pang, Dick John; Hayday, Adrian C; Bijlmakers, Marie-José

    2007-05-04

    The coreceptor CD8 is expressed as a CD8alphabeta heterodimer on major histocompatibility complex class I-restricted TCRalphabeta T cells, and as a CD8alphaalpha homodimer on subsets of memory T cells, intraepithelial lymphocytes, natural killer cells, and dendritic cells. Although the role of CD8alphaalpha is not well understood, it is increasingly clear that this protein is not a functional homologue of CD8alphabeta. On major histocompatibility complex class I-restricted T cells, CD8alphabeta is a more efficient TCR coreceptor than CD8alphaalpha. This property has for the mouse protein been attributed to the recruitment of CD8alphabeta into lipid rafts, which is dependent on CD8beta palmitoylation. Here, these divergent distributions of CD8alphabeta and CD8alphaalpha are demonstrated for the human CD8 proteins as well. However, although palmitoylation of both CD8alpha and CD8beta chains was detected, this modification did not contribute to raft localization. In contrast, arginines in the cytoplasmic domain are crucial for raft localization of CD8betabeta. Most strikingly, the assembly of a non-raft localized CD8beta chain with a non-raft localized CD8alpha chain resulted in raft-localized CD8alphabeta heterodimers. Using chimeric CD8 proteins, this property of the heterodimer was found to be determined by the assembly of CD8alpha and CD8beta extracellular regions. The presence of two CD8alpha extracellular regions, on the other hand, appears to preclude raft localization. Thus, heterodimer formation and raft association are intimately linked for CD8alphabeta. These results emphasize that lipid raft localization is a key feature of human CD8alphabeta that clearly distinguishes it from CD8alphaalpha.

  16. 16 kDa heat shock protein from heat-inactivated Mycobacterium tuberculosis is a homodimer - suitability for diagnostic applications with specific llama VHH monoclonals.

    PubMed

    Srivastava, Saurabh K; Ruigrok, Vincent J B; Thompson, Natalie J; Trilling, Anke K; Heck, Albert J R; van Rijn, Cees; Beekwilder, Jules; Jongsma, Maarten A

    2013-01-01

    The 16 kDa heat shock protein (HSP) is an immuno-dominant antigen, used in diagnosis of infectious Mycobacterium tuberculosis (M.tb.) causing tuberculosis (TB). Its use in serum-based diagnostics is limited, but for the direct identification of M.tb. bacteria in sputum or cultures it may represent a useful tool. Recently, a broad set of twelve 16 kDa specific heavy chain llama antibodies (VHH) has been isolated, and their utility for diagnostic applications was explored. To identify the epitopes recognized by the nine (randomly selected from a set of twelve 16 kDa specific VHH antibodies) distinct VHH antibodies, 14 overlapping linear epitopes (each 20 amino acid long) were characterized using direct and sandwich ELISA techniques. Seven out of 14 epitopes were recognized by 8 out of 9 VHH antibodies. The two highest affinity binders B-F10 and A-23 were found to bind distinct epitopes. Sandwich ELISA and SPR experiments showed that only B-F10 was suitable as secondary antibody with both B-F10 and A-23 as anchoring antibodies. To explain this behavior, the epitopes were matched to the putative 3D structure model. Electrospray ionization time-of-flight mass spectrometry and size exclusion chromatography were used to determine the higher order conformation. A homodimer model best explained the differential immunological reactivity of A-23 and B-F10 against heat-treated M.tb. lysates. The concentrations of secreted antigens of M.tb. in sputum are too low for immunological detection and existing kits are only used for identifying M.tb. in cultures. Here we describe how specific combinations of VHH domains could be used to detect the intracellular HSP antigen. Linked to methods of pre-concentrating M.tb. cells prior to lysis, HSP detection may enable the development of protein-based diagnostics of sputum samples and earlier diagnosis of diseases.

  17. Biophysical characterization of the b-HLH-LZ of ΔMax, an alternatively spliced isoform of Max found in tumor cells: Towards the validation of a tumor suppressor role for the Max homodimers

    PubMed Central

    Maltais, Loïka; Montagne, Martin; Bédard, Mikaël; Tremblay, Cynthia; Soucek, Laura

    2017-01-01

    It is classically recognized that the physiological and oncogenic functions of Myc proteins depend on specific DNA binding enabled by the dimerization of its C-terminal basic-region-Helix-Loop-Helix-Leucine Zipper (b-HLH-LZ) domain with that of Max. However, a new paradigm is emerging, where the binding of the c-Myc/Max heterodimer to non-specific sequences in enhancers and promoters drives the transcription of genes involved in diverse oncogenic programs. Importantly, Max can form a stable homodimer even in the presence of c-Myc and bind DNA (specific and non-specific) with comparable affinity to the c-Myc/Max heterodimer. Intriguingly, alterations in the Max gene by germline and somatic mutations or changes in the gene product by alternative splicing (e.g. ΔMax) were recently associated with pheochromocytoma and glioblastoma, respectively. This has led to the proposition that Max is, by itself, a tumor suppressor. However, the actual mechanism through which it exerts such an activity remains to be elucidated. Here, we show that contrary to the WT motif, the b-HLH-LZ of ΔMax does not homodimerize in the absence of DNA. In addition, although ΔMax can still bind the E-box sequence as a homodimer, it cannot bind non-specific DNA in that form, while it can heterodimerize with c-Myc and bind E-box and non-specific DNA as a heterodimer with high affinity. Taken together, our results suggest that the WT Max homodimer is important for attenuating the binding of c-Myc to specific and non-specific DNA, whereas ΔMax is unable to do so. Conversely, the splicing of Max into ΔMax could provoke an increase in overall chromatin bound c-Myc. According to the new emerging paradigm, the splicing event and the stark reduction in homodimer stability and DNA binding should promote tumorigenesis impairing the tumor suppressor activity of the WT homodimer of Max. PMID:28350847

  18. Biophysical characterization of the b-HLH-LZ of ΔMax, an alternatively spliced isoform of Max found in tumor cells: Towards the validation of a tumor suppressor role for the Max homodimers.

    PubMed

    Maltais, Loïka; Montagne, Martin; Bédard, Mikaël; Tremblay, Cynthia; Soucek, Laura; Lavigne, Pierre

    2017-01-01

    It is classically recognized that the physiological and oncogenic functions of Myc proteins depend on specific DNA binding enabled by the dimerization of its C-terminal basic-region-Helix-Loop-Helix-Leucine Zipper (b-HLH-LZ) domain with that of Max. However, a new paradigm is emerging, where the binding of the c-Myc/Max heterodimer to non-specific sequences in enhancers and promoters drives the transcription of genes involved in diverse oncogenic programs. Importantly, Max can form a stable homodimer even in the presence of c-Myc and bind DNA (specific and non-specific) with comparable affinity to the c-Myc/Max heterodimer. Intriguingly, alterations in the Max gene by germline and somatic mutations or changes in the gene product by alternative splicing (e.g. ΔMax) were recently associated with pheochromocytoma and glioblastoma, respectively. This has led to the proposition that Max is, by itself, a tumor suppressor. However, the actual mechanism through which it exerts such an activity remains to be elucidated. Here, we show that contrary to the WT motif, the b-HLH-LZ of ΔMax does not homodimerize in the absence of DNA. In addition, although ΔMax can still bind the E-box sequence as a homodimer, it cannot bind non-specific DNA in that form, while it can heterodimerize with c-Myc and bind E-box and non-specific DNA as a heterodimer with high affinity. Taken together, our results suggest that the WT Max homodimer is important for attenuating the binding of c-Myc to specific and non-specific DNA, whereas ΔMax is unable to do so. Conversely, the splicing of Max into ΔMax could provoke an increase in overall chromatin bound c-Myc. According to the new emerging paradigm, the splicing event and the stark reduction in homodimer stability and DNA binding should promote tumorigenesis impairing the tumor suppressor activity of the WT homodimer of Max.

  19. Localized interleukin-12 delivery for immunotherapy of solid tumours.

    PubMed

    Wei, Louis Z; Xu, Yixin; Nelles, E Megan; Furlonger, Caren; Wang, James C M; Di Grappa, Marco A; Khokha, Rama; Medin, Jeffrey A; Paige, Christopher J

    2013-11-01

    Interleukin (IL)-12 is the key cytokine in the initiation of a Th1 response and has shown promise as an anti-cancer agent; however, clinical trials involving IL-12 have been unsuccessful due to toxic side-effects. To address this issue, lentiviral vectors were used to transduce tumour cell lines that were injected as an autologous tumour cell vaccine. The focus of the current study was to test the efficacy of this approach in a solid tumour model. SCCVII cells that were transduced to produce IL-12 at different concentrations were then isolated. Subcutaneous injection of parental SCCVII cells results in tumour development, while a mixture of IL-12-producing and non-producing cells results in tumour clearance. Interestingly, when comparing mice injected a mixture of SCCVII and either high IL-12-producing tumour cells or low IL-12-producing tumour cells, we observed that mixtures containing small amounts of high producing cells lead to tumour clearance, whereas mixtures containing large amounts of low producing cells fail to elicit protection, despite the production of equal amounts of total IL-12 in both mixtures. Furthermore, immunizing mice with IL-12-producing cells leads to the establishment of both local and systemic immunity against challenge with SCCVII. Using depletion antibodies, it was shown that both CD4(+) and CD8(+) cells are crucial for therapy. Lastly, we have established cell clones of other solid tumour cell lines (RM-1, LLC1 and moto1.1) that produce IL-12. Our results show that the delivery of IL-12 by cancer cells is an effective route for immune activation. © 2013 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  20. Assembly-induced folding regulates interleukin 12 biogenesis and secretion.

    PubMed

    Reitberger, Susanne; Haimerl, Pascal; Aschenbrenner, Isabel; Esser-von Bieren, Julia; Feige, Matthias J

    2017-05-12

    Members of the IL-12 family perform essential functions in immunoregulation by connecting innate and adaptive immunity and are emerging therapeutic targets. They are unique among other interleukins in forming heterodimers that arise from extensive subunit sharing within the family, leading to the production of at least four functionally distinct heterodimers from only five subunits. This raises important questions about how the assembly of IL-12 family members is regulated and controlled in the cell. Here, using cell-biological approaches, we have dissected basic principles that underlie the biogenesis of the founding member of the family, IL-12. Within the native IL-12 heterodimer, composed of IL-12α and IL-12β, IL-12α possesses three intramolecular and one intermolecular disulfide bridges. We show that, in isolation, IL-12α fails to form its native structure but, instead, misfolds, forming incorrect disulfide bonds. Co-expression of its β subunit inhibits misfolding and thus allows secretion of biologically active heterodimeric IL-12. On the basis of these findings, we identified the disulfide bonds in IL-12α that are critical for assembly-induced secretion and biological activity of IL-12 versus misfolding and degradation of IL-12α. Surprisingly, two of the three disulfide bridges in IL-12α are dispensable for IL-12 secretion, stability, and biological activity. Extending our findings, we show that misfolding also occurs for IL-23α, another IL-12 family protein. Our results indicate that assembly-induced folding is key in IL-12 family biogenesis and secretion. The identification of essential disulfide bonds that underlie this process lays the basis for a simplified yet functional IL-12 cytokine. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Early infiltration of p40IL12+CCR7+CD11b+ cells is critical for fibrosis development

    PubMed Central

    Correa‐Costa, Matheus; Azevedo, Hatylas; Silva, Reinaldo Correia; Cruz, Mario Costa; Almeida, Maira Estanislau Soares; Hiyane, Meire Ioshie; Moreira‐Filho, Carlos Alberto; Santos, Marinilce Fagundes; Perez, Katia Regina; Cuccovia, Iolanda Midea; Camara, Niels Olsen Saraiva

    2016-01-01

    Abstract Introduction Macrophages are heterogeneous and thus can be correlated with distinct tissue outcomes after injury. Conflicting data have indicated that the M2‐related phenotype directly triggers fibrosis. Conversely, we hypothesize here that the inflammatory milieu provided by early infiltration of pro‐inflammatory macrophages dictates tissue scarring after injury. Methods and Results We first determined that tissue‐localized macrophages exhibit a pro‐inflammatory phenotype (p40IL12+CCR7+CD11b+) during the early phase of a chronic injury model, in contrast to a pro‐resolving phenotype (Arg1+IL10+CD206+CD11b+) at a later stage. Then, we evaluated the effects of injecting macrophages differentiated in vitro in the presence of IFNγ + LPS or IL4 + IL13 or non‐differentiated macrophages (hereafter, M0) on promoting inflammation and progression of chronic injury in macrophage‐depleted mice. In addition to enhancing the expression of pro‐inflammatory cytokines, the injection of M (IFNγ + LPS), but not M (IL4 + IL13) or M0, accentuated fibrosis while augmenting levels of anti‐inflammatory molecules, increasing collagen deposition and impairing organ function. We observed a similar profile after injection of sorted CCR7+CD11b+ cells and a more pronounced effect of M (IFNγ + LPS) cells originated from Stat6−/− mice. The injection of M (IFNγ + LPS) cells was associated with the up‐regulation of inflammation‐ and fibrosis‐related proteins (Thbs1, Mmp7, Mmp8, and Mmp13). Conclusions Our results suggest that pro‐inflammatory macrophages promote microenvironmental changes that may lead to fibrogenesis by inducing an inflammatory milieu that alters a network of extracellular‐related genes, culminating in tissue fibrosis. PMID:27621813

  2. Comparison of Aileron Control Characteristics as Determined in Flight Tests of P-36, P-40, Spitfire, and Hurricane Pursuit Airplanes

    NASA Technical Reports Server (NTRS)

    Phillips, William H.

    1942-01-01

    The Army Air Force has made available several pursuit-type airplanes for quantitative investigation of their flying and handling qualities. One Item of special interest obtained from the results of the investigation is a comparison of the aileron control characteristics of the P-36, P-40, Hawker Hurricane, and Supermarine Spitfire airplanes. Figure 1 shows the design characteristics of the ailerons and the control sticks of the four airplanes. Aileron effectiveness may be expressed in terms of the helix angle generated by the wing tip in a steady roll. This angle is given by the expression pb/2V, where p is the rolling velocity, b the wing span, and V the true airspeed, expressed in consistent units. This quantity is convenient to use because, although it does not rep resent directly the rolling velocity of airplanes of different spans or airplanes operating at different speeds, it provides a satisfactory basis for computing the rate of roll and the time required to bank a given amount under any given set of conditions. The ratio of pb/2V obtained in any roll to the maximum value reached with full aileron deflection indicates the fraction of the maximum aileron travel that was reached. A complete discussion of this criterion for aileron effectiveness is given in reference 1. The aileron effectiveness of the various airplanes is compared in the following table on the basis of the response obtained with stick forces of 30 and 5 pounds. A force of 30 pounds is somewhat less than the greatest stick force exerted by the pilot. Repeated flight measurements have shown, however, that this force is a reasonable upper limit for maneuvering at high speeds.

  3. Solubilisation effect of Nonidet P-40, triton X-100 and CHAPS in the detection of MHC-like glycoproteins.

    PubMed

    Labeta, M O; Fernandez, N; Festenstein, H

    1988-08-09

    We have analysed the differential solubilisation effect of three detergents on cell-membrane histocompatibility glycoproteins. Two nonionic detergents (Nonidet P-40 and Triton X-100) which are extensively used in the extraction of MHC proteins and a zwitterionic detergent (CHAPS) which is sulphobetaine derivative of cholic acid were used. An AKR (H-2k) derived spontaneous leukaemic cell line--424--was used as the experimental model. In this tumour cell line a class I-like antigen is expressed but not directly detected by cell-binding radioimmunoassay or immunoprecipitation from NP-40 or Triton X-100 solubilised glycoproteins. However, 46 kDa and 12 kDa bands consistent with the classical H-2 class I pattern were seen by SDS-PAGE after immunoprecipitation with the 34.5.8 anti-H-2Dd MoAb using CHAPS solubilised 424 glycoproteins. The H-2Dd-reactive molecule appears to be associated with at least one of the syngeneic class I specificities (H-2Kk, H-2Dk) and not accessible to react with the specific anti H-2Dd MoAb. The detergents NP-40 and Triton X-100 appear to be less efficient than CHAPS in breaking protein-protein interactions. This property of CHAPS permitted the adequate solubilisation of the novel antigen and its direct detection. The results of this study suggest that the alternative use of a non-denaturing zwitterionic detergent may contribute to the detection and characterisation of MHC-related, membrane-bound proteins of tumours and normal cells.

  4. Induction of asymmetry into homodimers.

    PubMed

    Bardsley, B; Cho, Y R; Westwell, M S; Williams, D H

    1998-01-01

    The self-regulation of biological signalling receptors via homodimerization is discussed in relation to the symmetry changes occurring when these receptors bind their target ligand. The idea of positive and negative cooperativity between dimerization and ligand binding, mediated by changes in the symmetry of the system as a source of signalling control is considered; an analogy made with the homodimerization of a glycopeptide antibiotic, ristocetin A, which displays negative cooperativity. Finally, the regulation of the bacterial aspartate receptor and the human growth hormone receptor is discussed as a function of ligand-induced asymmetry.

  5. Difference in extractability of estradiol- and tamoxifen-receptor complex in the nuclei from MCF-7 cells with Nonidet P-40.

    PubMed

    Ikeda, M; Omukai, Y; Hosokawa, K; Senoo, T

    1984-05-01

    The extraction of [3H]estradiol- and [3H]tamoxifen-receptor complex in the nuclei from MCF-7 cells with the nonionic detergent Nonidet P-40 has been studied. We found that there is a striking difference in the extractability of estradiol- and tamoxifen-receptor complex from nuclei with 0.5% Nonidet P-40. The nuclear bound estradiol-receptor complex is scarcely extractable with Nonidet P-40. In contrast, almost all of the nuclear bound tamoxifen-receptor complex is extractable. The nuclear [3H]tamoxifen-receptor complex extracted in the presence of Nonidet P-40 sediments in two peaks at 7 S and 5 S. The latter sedimentation rate is the same with that of the nuclear [3H]tamoxifen-receptor complex extracted with 0.4 M KCl. The nuclear [3H]estradiol-receptor complex extracted with 0.4 M KCl sediments at 4 S. The results suggest that interaction of tamoxifen-receptor complex with chromatin is different from that of estradiol-receptor complex.

  6. Direct evidence that p40x of human T-cell leukemia virus type I is a trans-acting transcriptional activator.

    PubMed Central

    Seiki, M; Inoue, J; Takeda, T; Yoshida, M

    1986-01-01

    Human T-cell leukemia virus type I has a unique sequence, pX, between the env gene and the 3'LTR (long terminal repeat). This sequence codes for p40x, which was proposed to trans-activate transcription from the LTR. Recently, we identified novel pX proteins coded by frame III, which mostly overlaps frame IV (x-lor, coding for p40x), in a region also overlapped by frame II. To determine which product is responsible for the trans-acting function, we constructed an active provirus clone, pMTPX, that contained a genomic fragment of the env, pX and 3'LTR, and introduced site-directed mutations into the active site. The effects of various deletions and point mutations that distinguished each of the overlapping open reading frames (ORFs), II, III and IV, on trans-activation of pLTR-CAT were treated by co-transfection assays. The results showed that only mutations which affected p40x expression resulted in loss of activity for transcriptional activation. These findings clearly indicate that p40x coded by frame IV is responsible for the transcriptional activation of the LTR. This conclusion was confirmed by studies on expression of cDNA of pX mRNA. Images Fig. 3. Fig. 4. PMID:3011413

  7. A transcriptional enhancer sequence of HTLV-I is responsible for trans-activation mediated by p40 chi HTLV-I.

    PubMed Central

    Fujisawa, J; Seiki, M; Sato, M; Yoshida, M

    1986-01-01

    Human T-cell leukemia virus type I (HTLV-I) contains a unique sequence pX that is located between env and the 3' long terminal repeat (LTR) and codes for three pX proteins, p40 chi, pp27 chi-III and pp21 chi-III. One of these proteins, p40 chi, was previously shown to activate transcription from the LTR in a trans-acting manner, which suggested that it activated some cellular genes involved in leukemogenesis. In this study, the sequences in the LTR responsible for this trans-activation were analyzed. Construction of deletion mutants of the LTR in pLTR-CAT and measurement of their activities in trans-activated expression of the CAT gene showed that sequences upstream of the TATA box were responsible for the trans-activation mediated by p40 chi. The active unit was identified as an enhancer sequence containing direct repeats by inserting it into an enhancer-minus SV40 promoter. Thus, it was concluded that an enhancer sequence in HTLV-I LTR is responsible, at least in part, for transcriptional trans-activation mediated by the viral product p40 chi. Images Fig.2. Fig.4. PMID:3011423

  8. A Phase I Double Blind, Placebo-Controlled, Randomized Study of the Safety and Immunogenicity of Electroporated HIV DNA with or without Interleukin 12 in Prime-Boost Combinations with an Ad35 HIV Vaccine in Healthy HIV-Seronegative African Adults

    PubMed Central

    Ingabire, Rosine; Nanvubya, Annet; Anzala, Omu; Karita, Etienne; Hayes, Peter; Kopycinski, Jakub; Dally, Len; Hannaman, Drew; Egan, Michael A.; Eldridge, John H.; Syvertsen, Kristen; Lehrman, Jennifer; Rasmussen, Beth; Gilmour, Jill; Cox, Josephine H.; Fast, Patricia E.; Schmidt, Claudia

    2015-01-01

    Background Strategies to enhance the immunogenicity of DNA vaccines in humans include i) co-administration of molecular adjuvants, ii) intramuscular administration followed by in vivo electroporation (IM/EP) and/or iii) boosting with a different vaccine. Combining these strategies provided protection of macaques challenged with SIV; this clinical trial was designed to mimic the vaccine regimen in the SIV study. Methods Seventy five healthy, HIV-seronegative adults were enrolled into a phase 1, randomized, double-blind, placebo-controlled trial. Multi-antigenic HIV (HIVMAG) plasmid DNA (pDNA) vaccine alone or co-administered with pDNA encoding human Interleukin 12 (IL-12) (GENEVAX IL-12) given by IM/EP using the TriGrid Delivery System was tested in different prime-boost regimens with recombinant Ad35 HIV vaccine given IM. Results All local reactions but one were mild or moderate. Systemic reactions and unsolicited adverse events including laboratory abnormalities did not differ between vaccine and placebo recipients. No serious adverse events (SAEs) were reported. T cell and antibody response rates after HIVMAG (x3) prime—Ad35 (x1) boost were independent of IL-12, while the magnitude of interferon gamma (IFN-γ) ELISPOT responses was highest after HIVMAG (x3) without IL-12. The quality and phenotype of T cell responses shown by intracellular cytokine staining (ICS) were similar between groups. Inhibition of HIV replication by autologous T cells was demonstrated after HIVMAG (x3) prime and was boosted after Ad35. HIV specific antibodies were detected only after Ad35 boost, although there was a priming effect with 3 doses of HIVMAG with or without IL-12. No anti-IL-12 antibodies were detected. Conclusion The vaccines were safe, well tolerated and moderately immunogenic. Repeated administration IM/EP was well accepted. An adjuvant effect of co-administered plasmid IL-12 was not detected. Trial Registration ClinicalTrials.gov NCT01496989 PMID:26252526

  9. The Human Sodium-Glucose Cotransporter (hSGLT1) Is a Disulfide-Bridged Homodimer with a Re-Entrant C-Terminal Loop

    PubMed Central

    Sasseville, Louis J.; Morin, Michael; Coady, Michael J.; Blunck, Rikard; Lapointe, Jean-Yves

    2016-01-01

    Na-coupled cotransporters are proteins that use the trans-membrane electrochemical gradient of Na to activate the transport of a second solute. The sodium-glucose cotransporter 1 (SGLT1) constitutes a well-studied prototype of this transport mechanism but essential molecular characteristics, namely its quaternary structure and the exact arrangement of the C-terminal transmembrane segments, are still debated. After expression in Xenopus oocytes, human SGLT1 molecules (hSGLT1) were labelled on an externally accessible cysteine residue with a thiol-reactive fluorophore (tetramethylrhodamine-C5-maleimide, TMR). Addition of dipicrylamine (DPA, a negatively-charged amphiphatic fluorescence “quencher”) to the fluorescently-labelled oocytes is used to quench the fluorescence originating from hSGLT1 in a voltage-dependent manner. Using this arrangement with a cysteine residue introduced at position 624 in the loop between transmembrane segments 12 and 13, the voltage-dependent fluorescence signal clearly indicated that this portion of the 12–13 loop is located on the external side of the membrane. As the 12–13 loop begins on the intracellular side of the membrane, this suggests that the 12–13 loop is re-entrant. Using fluorescence resonance energy transfer (FRET), we observed that different hSGLT1 molecules are within molecular distances from each other suggesting a multimeric complex arrangement. In agreement with this conclusion, a western blot analysis showed that hSGLT1 migrates as either a monomer or a dimer in reducing and non-reducing conditions, respectively. A systematic mutational study of endogenous cysteine residues in hSGLT1 showed that a disulfide bridge is formed between the C355 residues of two neighbouring hSGLT1 molecules. It is concluded that, 1) hSGLT1 is expressed as a disulfide bridged homodimer via C355 and that 2) a portion of the intracellular 12–13 loop is re-entrant and readily accessible from the extracellular milieu. PMID:27137918

  10. The Human Sodium-Glucose Cotransporter (hSGLT1) Is a Disulfide-Bridged Homodimer with a Re-Entrant C-Terminal Loop.

    PubMed

    Sasseville, Louis J; Morin, Michael; Coady, Michael J; Blunck, Rikard; Lapointe, Jean-Yves

    2016-01-01

    Na-coupled cotransporters are proteins that use the trans-membrane electrochemical gradient of Na to activate the transport of a second solute. The sodium-glucose cotransporter 1 (SGLT1) constitutes a well-studied prototype of this transport mechanism but essential molecular characteristics, namely its quaternary structure and the exact arrangement of the C-terminal transmembrane segments, are still debated. After expression in Xenopus oocytes, human SGLT1 molecules (hSGLT1) were labelled on an externally accessible cysteine residue with a thiol-reactive fluorophore (tetramethylrhodamine-C5-maleimide, TMR). Addition of dipicrylamine (DPA, a negatively-charged amphiphatic fluorescence "quencher") to the fluorescently-labelled oocytes is used to quench the fluorescence originating from hSGLT1 in a voltage-dependent manner. Using this arrangement with a cysteine residue introduced at position 624 in the loop between transmembrane segments 12 and 13, the voltage-dependent fluorescence signal clearly indicated that this portion of the 12-13 loop is located on the external side of the membrane. As the 12-13 loop begins on the intracellular side of the membrane, this suggests that the 12-13 loop is re-entrant. Using fluorescence resonance energy transfer (FRET), we observed that different hSGLT1 molecules are within molecular distances from each other suggesting a multimeric complex arrangement. In agreement with this conclusion, a western blot analysis showed that hSGLT1 migrates as either a monomer or a dimer in reducing and non-reducing conditions, respectively. A systematic mutational study of endogenous cysteine residues in hSGLT1 showed that a disulfide bridge is formed between the C355 residues of two neighbouring hSGLT1 molecules. It is concluded that, 1) hSGLT1 is expressed as a disulfide bridged homodimer via C355 and that 2) a portion of the intracellular 12-13 loop is re-entrant and readily accessible from the extracellular milieu.

  11. Low concentrations of the non-ionic detergent Nonidet P-40 interfere with sterol biogenesis and viability of the yeast Saccharomyces cerevisiae.

    PubMed

    Hronská, Lucia; Mrózová, Zuzana; Valachovic, Martin; Hapala, Ivan

    2004-09-01

    Mild non-ionic detergents are used for solubilization of hydrophobic substrates in yeast growth media at concentrations 0.1-1%. Our data show that low concentrations of Nonidet P-40 may significantly affect lipid biogenesis in the yeast Saccharomyces cerevisiae. The uptake and esterification of external [4-14C]-cholesterol is strongly reduced in hem1 mutants treated with low concentrations of Nonidet P-40. Significant inhibitory effect of NP-40 on sterol uptake and esterification was evident both in non-growing and growing cells supplemented with external cholesterol. Increased levels of sterol precursors (squalene, lanosterol) in hem1 cells grown in complex medium with cholesterol indicated general interference of NP-40 with sterol biosynthesis. NP-40 in the growth medium affected also cell viability estimated as the colony forming ability. More attention should be therefore paid to possible effects of mild detergents at low concentrations generally considered to be harmless, especially in cells with disturbed lipid biogenesis.

  12. Differential expression of the inflammation marker IL12p40 in the at-risk mental state for psychosis: a predictor of transition to psychotic disorder?

    PubMed

    Föcking, Melanie; Dicker, Patrick; Lopez, Lorna M; Cannon, Mary; Schäfer, Miriam R; McGorry, Patrick D; Smesny, Stefan; Cotter, David R; Amminger, G Paul

    2016-09-20

    The identification of biomarkers of transition from the at-risk mental state (ARMS) to psychotic disorder is important because early treatment of psychosis is associated with improved outcome. Increasing evidence points to an inflammatory contribution to psychosis. We questioned whether raised levels of plasma inflammatory markers predict transition from ARMS to psychotic disorder and whether any such predictors could be reduced by omega-3 (ω-3) polyunsaturated fatty acids (PUFAs). We measured the levels of 40 neuroinflammation biomarkers using a commercially available immunoassay kit. Firstly, we compared inflammatory markers in subjects in the ARMS who transitioned to psychotic disorder (n = 11) compared to subjects who did not (n = 28). Then we compared inflammatory markers in all subjects before and after ω-3 PUFA treatment (n = 40). Our data provides preliminary evidence that elevations in the baseline plasma levels of the inflammatory marker IL12/IL23p40 are associated with transition from ARMS to psychotic disorder. IL12/IL23p40 levels did not change following 12 weeks administration of ω-3 PUFAs. These findings provide evidence that elevated plasma IL12/IL23p40 is a potential biomarker of increased risk for transition to psychotic disorder. Further studies are required to confirm and extend this finding. Our results do not provide support for the possibility that administration of ω-3 PUFAs act to reduced transition to psychotic disorder by reducing blood levels of IL12/IL23p40. ClinicalTrials.gov, a service of the U.S. National Institutes of Health, Identifier: NCT00396643 , last updated December 20, 2007. Retrospectively registered.

  13. Increased Production of IL-4 and IL-12p40 from Bronchoalveolar Lavage Cells Are Biomarkers of Mycobacterium tuberculosis in the Sputum

    PubMed Central

    Nolan, Anna; Fajardo, Elaine; Huie, Maryann L.; Condos, Rany; Pooran, Anil; Dawson, Rodney; Dheda, Keertan; Bateman, Eric; Rom, William N.; Weiden, Michael D.

    2013-01-01

    Background Tuberculosis (TB) causes 1.45 million deaths annually world wide, the majority of which occur in the developing world. Active TB disease represents immune failure to control latent infection from airborne spread. Acid-fast bacillus (AFB) seen on sputum smear is a biomarker for contagiousness. Methods We enrolled 73 tuberculosis patients with extensive infiltrates into a research study using bronchoalveolar lavage (BAL) to sample lung immune cells and assay BAL cell cytokine production. All patients had sputum culture demonstrating Mycobacterium tuberculosis and 59/73 (81%) had AFB identified by microscopy of the sputum. Compared with smear negative patients, smear positive patients at presentation had a higher proportion with smoking history, a higher proportion with temperature >38.50 C, higher BAL cells/ml, lower percent lymphocytes in BAL, higher IL-4 and IL-12p40 in BAL cell supernatants. There was no correlation between AFB smear and other BAL or serum cytokines. Increasing IL-4 was associated with BAL PMN and negatively associated with BAL lymphocytes. Each 10-fold increase in BAL IL-4 and IL-12p40 increased the odds of AFB smear positivity by 7.4 and 2.2-fold, respectively, in a multi-variable logistic model. Conclusion Increasing IL-4 and IL-12p40 production by BAL cells are biomarkers for AFB in sputum of patients who present with radiographically advanced TB. They likely reflect less effective immune control of pathways for controlling TB, leading to patients with increased infectiousness. PMID:23527200

  14. Lamin A and lamin C form homodimers and coexist in higher complex forms both in the nucleoplasmic fraction and in the lamina of cultured human cells.

    PubMed

    Kolb, Thorsten; Maass, Kendra; Hergt, Michaela; Aebi, Ueli; Herrmann, Harald

    2011-01-01

    We have investigated and quantified the nuclear A-type lamin pool from human HeLa S3 suspension cells with respect to their distribution to detergent soluble and insoluble fractions. We devised a sequential extraction protocol and found that maximally 10% of A-type lamins are recovered in the soluble fraction. Notably, lamin C is enriched in low detergent fractions and only with 0.5% Nonidet P-40 lamin A and C are recovered in ratios nearly equivalent to those found in whole cell extracts and in the lamina fraction. Authentic nucleoplasmic proteins such as LAP2a, pRB and p53 are co-extracted to a large part together with the A-type lamins in these fractions. By sucrose density centrifugation we revealed that the majority of lamins co-sedimented with human IgG indicating they form rather small complexes in the range of dimers and slightly larger complexes. Some lamin A - but not lamin C - is obtained in addition in a much faster sedimenting fraction. Authentic nuclear proteins such as PCNA, p53 and LAP2a were found both in the light and the heavy sucrose fractions together with lamin A. Last but not least, immunoprecipitation experiments from both soluble fractions and from RIPA lysates of whole cells revealed that lamin A and lamin C do not form heterodimers but segregate practically completely. Correspondingly, immunofluorescence microscopy of formaldehyde-fixed cells clearly demonstrated that lamin A and C are localized at least in part to distinct patches within the lamina. Hence, the structural segregation of lamin A and C is indeed retained in the nuclear envelope to some extent too.

  15. Activation of endogenous c-fos proto-oncogene expression by human T-cell leukemia virus type I-encoded p40 sup tax protein in the human T-cell line, Jurkat

    SciTech Connect

    Nagata, Kinya; Ohtani, Kiyoshi; Nakamura, Masataka; Sugamura, Kazuo )

    1989-08-01

    The authors examined the ability of the trans-acting factor p40{sup tax} of human T-cell leukemia virus type I (HTLV-I), which is thought to be a crucial molecule in T-cell transformation by HTLV-I, to activate expression of a set of endogenous cellular genes related to T-cell proliferation. For this purpose, they established a subclone (JPX-9) of Jurkat cells that was stably transfected with an expression plasmid containing the p40{sup tax} gene, whose expression is definitively dependent on heavy-metal ions. Expression of the interleukin-2 receptor {alpha} chain in JPX-9 cells was induced in response to the induction of p40{sup tax} expression, as has been demonstrated by others in transient transfection experiments with Jurkat cells. In addition, they found that significant enhancement of expression of the nuclear proto-oncogene c-fos was closely associated with expression of p40{sup tax}. Continuous enhancement in the level of c-fos mRNA was observed in the presence of p40{sup tax}. These results suggest that (i) in addition to the interleukin-2-interleukin-2 receptor system, cellular genes such as c-fos, which regulate normal T-cell growth, are also activated directly or indirectly by p40{sup tax} and (ii) p40{sup tax}-induced modulation of gene expression plays a crucial role in T-cell transformation by HTLV-I.

  16. The laminin binding protein p40 is involved in inducing limb abnormality of mouse fetuses as the effects of methoxyacetic acid treatment.

    PubMed

    Ruyani, Aceng; Sudarwati, Sri; Sutasurya, Lien A; Sumarsono, Sony H; Gloe, Torsten

    2003-09-01

    This study is intended to characterize a protein that is linked with mouse limb teratogenicity as the effects of methoxyacetic acid (MAA) treatment. A single dose of MAA (10 mmol/kg body weight) was given by gavage on gestation day (GD) 11, whereas the control group were administered vehicle only. The pregnant mice were killed at 4 h after MAA treatment, and forelimb buds were isolated from both the control and treated group embryos. Proteins from forelimb buds GD 11 + 4 h, which were precipitated out using 40-60% ammonium sulfate, then were analyzed by two-dimensional sodium dodecyl sulfate-polyacrylamide gel electrophoresis (2-D SDS-PAGE) technique. The 2-D gels reveal one protein with 41.6 kDa and pI 6.4, which expression was downregulated after MAA treatment. Tentative protein identification via peptide mass database search and definitive protein identification via a primary sequence database search indicate that the protein matches exactly to 34/67 kDa laminin binding protein (LBP; P14206, SwissProt), which is encoded by p40 gene (MGI:105381). The identity was further verified by Western blotting with an antibody against the 67 kDa LBP. The results suggest that MAA treatment to pregnant mice downregulates the LBP-p40 in the forelimb buds.

  17. Myeloid-Restricted AMPKα1 Promotes Host Immunity and Protects against IL-12/23p40-Dependent Lung Injury during Hookworm Infection.

    PubMed

    Nieves, Wildaliz; Hung, Li-Yin; Oniskey, Taylor K; Boon, Louis; Foretz, Marc; Viollet, Benoit; Herbert, De'Broski R

    2016-06-01

    How the metabolic demand of parasitism affects immune-mediated resistance is poorly understood. Immunity against parasitic helminths requires M2 cells and IL-13, secreted by CD4(+) Th2 and group 2 innate lymphoid cells (ILC2), but whether certain metabolic enzymes control disease outcome has not been addressed. This study demonstrates that AMP-activated protein kinase (AMPK), a key driver of cellular energy, regulates type 2 immunity and restricts lung injury following hookworm infection. Mice with a selective deficiency in the AMPK catalytic α1 subunit in alveolar macrophages and conventional dendritic cells produced less IL-13 and CCL17 and had impaired expansion of ILC2 in damaged lung tissue compared with wild-type controls. Defective type 2 responses were marked by increased intestinal worm burdens, exacerbated lung injury, and increased production of IL-12/23p40, which, when neutralized, restored IL-13 production and improved lung recovery. Taken together, these data indicate that defective AMPK activity in myeloid cells negatively impacts type 2 responses through increased IL-12/23p40 production. These data support an emerging concept that myeloid cells and ILC2 can coordinately regulate tissue damage at mucosal sites through mechanisms dependent on metabolic enzyme function.

  18. Elevated IL-3 and IL-12p40 levels in the lower airway of infants with RSV-induced bronchiolitis correlate with recurrent wheezing.

    PubMed

    Bertrand, Pablo; Lay, Margarita K; Piedimonte, Giovanni; Brockmann, Pablo E; Palavecino, Christian E; Hernández, Jury; León, Miguel A; Kalergis, Alexis M; Bueno, Susan M

    2015-12-01

    Respiratory Syncytial Virus (RSV) is the first cause of hospitalization due to bronchiolitis in infants. RSV bronchiolitis has been linked to asthma and recurrent wheezing, however the mechanisms behind this association have not been elucidated. Here, we evaluated the cytokine and chemokine profiles in the airways in infants with RSV bronchiolitis. Nasopharyngeal Aspirates (NPA) and Bronchoalveolar Lavage Fluids (BALF) from infants hospitalized due to RSV bronchiolitis and healthy controls were analyzed for cytokine and chemokine production. We observed elevated levels of Th2 cytokines (IL-3, IL-4, IL-10 and IL-13), pro-inflammatory cytokines and chemokines (IL-1β, IL-6, TNF-β, MCP-1/CCL2, MIP-1α/CCL3 and IL-8/CXCL8) in BALF from infants with RSV bronchiolitis, as compared to controls. We found a direct correlation of IL-3 and IL-12p40 levels with the development of recurrent wheezing later in life. These results suggest that IL-3 and IL-12p40 could be considered as molecular predictors for recurrent wheezing due to RSV infection. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Dual TNF-α/IL-12p40 Interference as a Strategy to Protect Against Colitis Based on miR-16 Precursors With Macrophage Targeting Vectors.

    PubMed

    Huang, Zhen; Ma, Junting; Chen, Mengjie; Jiang, Haoyang; Fu, Yong; Gan, Jingjing; Dong, Lei; Zhang, Junfeng; Chen, Jiangning

    2015-10-01

    Cytokines are central components of the mucosal inflammatory responses that take place during the development of Crohn's disease. Cell-specific combination therapies against cytokines may lead to increased efficacy and even reduced side effects. Therefore, a colonic macrophage-specific therapy using miR-16 precursors that can target both TNF-α and IL-12p40 was tested for its efficacy in experimental colitic mice. Galactosylated low molecular weight chitosan (G-LMWC) associated with miR-16 precursors were intracolonically injected into mice. The cellular localization of miR-16 precursors was determined. The therapeutic effects and possible mechanism were further studied in 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitic mice. The results show that specific upregulation of miR-16 level in colonic macrophages significantly reduces TNF-α and IL-12p40 expression, which could suppress the associated mucosal inflammation and ultimately result in the relief of colitic symptoms. This strategy, based on the dual silencing of colonic macrophage-specific cytokines, represents a potential therapeutic approach that may be valuable for colitis therapy.

  20. The human parasite Leishmania amazonensis downregulates iNOS expression via NF-κB p50/p50 homodimer: role of the PI3K/Akt pathway

    PubMed Central

    Calegari-Silva, Teresa C.; Vivarini, Áislan C.; Miqueline, Marina; Dos Santos, Guilherme R. R. M.; Teixeira, Karina Luiza; Saliba, Alessandra Mattos; Nunes de Carvalho, Simone; de Carvalho, Laís; Lopes, Ulisses G.

    2015-01-01

    Leishmania amazonensis activates the NF-κB transcriptional repressor homodimer (p50/p50) and promotes nitric oxide synthase (iNOS) downregulation. We investigated the role of PI3K/Akt in p50/p50 NF-κB activation and the effect on iNOS expression in L. amazonensis infection. The increased occupancy of p50/p50 on the iNOS promoter of infected macrophages was observed and we demonstrated that both p50/p50 NF-κB induction and iNOS downregulation in infected macrophages depended on PI3K/Akt activation. Importantly, the intracellular growth of the parasite was also impaired during PI3K/Akt signalling inhibition and in macrophages knocked-down for Akt 1 expression. It was also observed that the increased nuclear levels of p50/p50 in L. amazonensis-infected macrophages were associated with reduced phosphorylation of 907 Ser p105, the precursor of p50. Corroborating these data, we demonstrated the increased levels of phospho-9 Ser GSK3β in infected macrophages, which is associated with GSK3β inhibition and, consequently, its inability to phosphorylate p105. Remarkably, we found that the levels of pPTEN 370 Ser, a negative regulator of PI3K, increased due to L. amazonensis infection. Our data support the notion that PI3K/Akt activity is sustained during the parasite infection, leading to NF-κB 105 phosphorylation and further processing to originate p50/p50 homodimers and the consequent downregulation of iNOS expression. PMID:26400473

  1. Unveiling the non-covalent interactions of molecular homodimers by dispersion-corrected DFT calculations and collision-induced broadening of ro-vibrational transitions: application to (CH2F2)2 and (SO2)2.

    PubMed

    Tasinato, Nicola; Grimme, Stefan

    2015-02-28

    Thermodynamic and spectroscopic properties of molecular complexes featuring non-covalent interactions, such as van der Waals forces and hydrogen bonds, are of fundamental interest in many fields, ranging from chemistry and biology to nanotechnology. In the present work the homodimers of difluoromethane (CH2F2) and sulfur dioxide (SO2) are investigated theoretically using dispersion-corrected density functional theory (DFT-D3) and experimentally by tunable diode laser (TDL) infrared (IR) spectroscopy. The dissociation energies of (CH2F2)2 and (SO2)2 are determined experimentally from the broadening of the ro-vibrational transitions of the corresponding monomers collisionally perturbed by a range of damping gases. The resulting dissociation energies are 2.79 ± 0.32 and 2.62 ± 0.16 kcal mol(-1) for the CH2F2 and SO2 dimers, respectively. Six to nine different stationary points on the PES of the two complexes are investigated theoretically at the DFT-D3 level, retrieving the corresponding dissociation energies, structures and rotational constants. Computations are carried out by employing six different density functionals (BLYP, TPSS, B3LYP, PBE0, TPSSh, and PW6B95) in conjunction with def2-TZVP and in a few cases def2-QZVP basis sets. DFT-D3 dissociation energies are benchmarked against reference values from CCSD(T)/CBS computations, and furthermore compared to experimental ones. A very good agreement between theory and experiment is attained, showing that DFT-D3 provides a significant improvement over standard DFT. This work shows that dissociation energies of homodimers can be consistently derived from collisional broadening cross sections and that interaction energies at various DFT-D3 levels (nearly) reach the accuracy of highly correlated wavefunction methods.

  2. In silico analysis of the three-dimensional structures of the homodimer of uridine phosphorylase from Yersinia Pseudotuberculosis in the ligand-free state and in a complex with 5-fluorouracil

    SciTech Connect

    Lashkov, A. A. Sotnichenko, S. E.; Mikhailov, A. M.

    2013-03-15

    Pseudotuberculosis is an acute infectious disease characterized by a lesion of the gastrointestinal tract. A positive therapeutic effect can be achieved by selectively suppressing the activity of uridine phosphorylase from the causative agent of the disease Yersinia pseudotuberculosis. The synergistic effect of a combination of the chemotherapeutic agent 5-fluorouracil and antimicrobial drugs, which block the synthesis of pyrimidine bases, on the cells of pathogenic protozoa and bacteria is described in the literature. The three-dimensional structures of uridine phosphorylase from Yersinia pseudotuberculosis (YptUPh) both in the ligand-free state and in complexes with pharmacological agents are unknown, which hinders the search for and design of selective inhibitors of YptUPh. The three-dimensional structure of the ligand-free homodimer of YptUPh was determined by homology-based molecular modeling. The three-dimensional structure of the subunit of the YptUPh molecule belongs to {alpha}/{beta} proteins, and its topology is a three-layer {alpha}/{beta}/{alpha} sandwich. The subunit monomer of the YptUPh molecule consists of 38% helices and 24% {beta} strands. A model of the homodimer structure of YptUPh in a complex with 5-FU was obtained by the molecular docking. The position of 5-FU in the active site of the molecule is very consistent with the known data on the X-ray diffraction structures of other bacterial uridine phosphorylases (the complex of uridine phosphorylase from Salmonella typhimurium (StUPh) with 5-FU, ID PDB: 4E1V and the complex of uridine phosphorylase from Escherichia coli (EcUPh) with 5-FU and ribose 1-phosphate, ID PDB: 1RXC).

  3. 2,3,7,8-Tetrachlorodibenzo-p-dioxin suppresses tumor necrosis factor-alpha and anti-CD40-induced activation of NF-kappaB/Rel in dendritic cells: p50 homodimer activation is not affected.

    PubMed

    Ruby, Carl E; Leid, Mark; Kerkvliet, Nancy I

    2002-09-01

    2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) suppresses many immune responses, both innate and adaptive. Suppression is mediated by the aryl hydrocarbon receptor (AhR), a ligand-activated transcription factor. The AhR mediates TCDD toxicity presumably through the alteration of transcriptional events, either by promoting gene expression or potentially by physically interacting with other transcription factors. Another transcription factor, NF-kappaB/Rel, is involved in several signaling pathways in immune cells and is crucial for generating effective immune responses. Dendritic cells (DCs), considered to be the "pacemakers" of the immune system, were recently recognized as targets of TCDD and are also dependent on NF-kappaB/Rel for activation and survival. In these studies, we investigated whether TCDD would alter the activation of NF-kappaB/Rel in DCs. The dendritic cell line DC2.4 was exposed to TCDD before treatment with tumor necrosis factor alpha (TNF-alpha) or anti-CD40, and NF-kappaB/Rel activation was measured by electrophoretic mobility shift assay and immunoblotting. TCDD suppressed the binding of NF-kappaB/Rel to its cognate response element in TNF-alpha- and anti-CD40-treated cells and blocked translocation to the nucleus. The AhR was shown to associate with RelA, after coimmunoprecipitation, and seemed to block its binding to DNA. It is noteworthy that p50 homodimers freely bound to DNA. These results suggest that TCDD may alter the balance between NF-kappaB/Rel heterodimers and transcriptional inhibitory p50 homodimers in DCs, leading to defects in the DCs and suppression of the immune response.

  4. In silico analysis of the three-dimensional structures of the homodimer of uridine phosphorylase from Yersinia Pseudotuberculosis in the ligand-free state and in a complex with 5-fluorouracil

    NASA Astrophysics Data System (ADS)

    Lashkov, A. A.; Sotnichenko, S. E.; Mikhailov, A. M.

    2013-03-01

    Pseudotuberculosis is an acute infectious disease characterized by a lesion of the gastrointestinal tract. A positive therapeutic effect can be achieved by selectively suppressing the activity of uridine phosphorylase from the causative agent of the disease Yersinia pseudotuberculosis. The synergistic effect of a combination of the chemotherapeutic agent 5-fluorouracil and antimicrobial drugs, which block the synthesis of pyrimidine bases, on the cells of pathogenic protozoa and bacteria is described in the literature. The three-dimensional structures of uridine phosphorylase from Yersinia pseudotuberculosis ( YptUPh) both in the ligand-free state and in complexes with pharmacological agents are unknown, which hinders the search for and design of selective inhibitors of YptUPh. The three-dimensional structure of the ligand-free homodimer of YptUPh was determined by homology-based molecular modeling. The three-dimensional structure of the subunit of the YptUPh molecule belongs to α/β proteins, and its topology is a three-layer α/β/α sandwich. The subunit monomer of the YptUPh molecule consists of 38% helices and 24% β strands. A model of the homodimer structure of YptUPh in a complex with 5-FU was obtained by the molecular docking. The position of 5-FU in the active site of the molecule is very consistent with the known data on the X-ray diffraction structures of other bacterial uridine phosphorylases (the complex of uridine phosphorylase from Salmonella typhimurium ( StUPh) with 5-FU, ID PDB: 4E1V and the complex of uridine phosphorylase from Escherichia coli ( EcUPh) with 5-FU and ribose 1-phosphate, ID PDB: 1RXC).

  5. T cell receptor complexes containing Fc epsilon RI gamma homodimers in lieu of CD3 zeta and CD3 eta components: a novel isoform expressed on large granular lymphocytes

    PubMed Central

    1992-01-01

    CD3 zeta and CD3 eta form disulfide-linked homo- or heterodimers important in targeting partially assembled Ti alpha-beta/CD3 gamma delta epsilon T cell receptor (TCR) complexes to the cell surface and transducing stimulatory signals after antigen recognition. Here we identify a new TCR isoform expressed on splenic CD2+, CD3/Ti alpha- beta+, CD4-, CD8-, CD16+, NK1.1+ mouse large granular lymphocytes (LGL), which are devoid of CD3 zeta and CD3 eta proteins. The TCRs of this subset contain homodimers of the gamma subunit of the high affinity receptor for IgE (Fc epsilon RI gamma) in lieu of CD3 zeta and/or CD3 eta proteins. The LGL display natural killer-like activity and are cytotoxic for B cell hybridomas producing anti-CD3 epsilon and anti-CD16 monoclonal antibodies, demonstrating the signaling capacity of both TCR and CD16 in this cell type. These findings provide evidence for an additional level of complexity of TCR signal transduction isoforms in naturally occurring T cell subsets. PMID:1530959

  6. Analytical Validation of a Highly Quantitative, Sensitive, Accurate, and Reproducible Assay (HERmark®) for the Measurement of HER2 Total Protein and HER2 Homodimers in FFPE Breast Cancer Tumor Specimens

    PubMed Central

    Larson, Jeffrey S.; Goodman, Laurie J.; Tan, Yuping; Defazio-Eli, Lisa; Paquet, Agnes C.; Cook, Jennifer W.; Rivera, Amber; Frankson, Kristi; Bose, Jolly; Chen, Lili; Cheung, Judy; Shi, Yining; Irwin, Sarah; Kiss, Linda D. B.; Huang, Weidong; Utter, Shannon; Sherwood, Thomas; Bates, Michael; Weidler, Jodi; Parry, Gordon; Winslow, John; Petropoulos, Christos J.; Whitcomb, Jeannette M.

    2010-01-01

    We report here the results of the analytical validation of assays that measure HER2 total protein (H2T) and HER2 homodimer (H2D) expression in Formalin Fixed Paraffin Embedded (FFPE) breast cancer tumors as well as cell line controls. The assays are based on the VeraTag technology platform and are commercially available through a central CAP-accredited clinical reference laboratory. The accuracy of H2T measurements spans a broad dynamic range (2-3 logs) as evaluated by comparison with cross-validating technologies. The measurement of H2T expression demonstrates a sensitivity that is approximately 7–10 times greater than conventional immunohistochemistry (IHC) (HercepTest). The HERmark assay is a quantitative assay that sensitively and reproducibly measures continuous H2T and H2D protein expression levels and therefore may have the potential to stratify patients more accurately with respect to response to HER2-targeted therapies than current methods which rely on semiquantitative protein measurements (IHC) or on indirect assessments of gene amplification (FISH). PMID:21151530

  7. An Investigation of the 40Ar(n,p)40Cl Reaction Cross-Section below 50MeV at Crocker Nuclear Laboratory

    NASA Astrophysics Data System (ADS)

    Walsh, Nicholas Ian

    Large underground liquid argon detectors are poised to detect neutrinos from the next galactic supernova. Liquid argon detectors are uniquely sensitive to the electron neutrino, thus giving them the capability to detect neutronization neutrinos for the first time. One background that may mimic the signal of this low-energy neutrino interaction in argon is the beta-decay of Cl-40 which is produced in argon by a fast neutron reaction. Previous measurements of this 40Ar+n->40Cl+p reaction cross section exist only below 15 MeV and the measurements differ by a factor of two. Using the U.C. Davis Crocker Nuclear Laboratory neutron beam this cross-section is determined by fitting to a parametrized model for neutron energies up to 50 MeV. Neutrons at this facility are generated from mono-energetic protons impinging on a thick beryllium target. Then, the neutrons that pass through the collimator are measured by time-of-flight and a fast-neutron activation technique. Using the neutron fluxes generated from five different proton energies, including 50 MeV protons, the 40Ar(n,p)40Cl reaction cross section is measured by irradiating liquid argon in each beam and counting the subsequent gammas from the Cl-40 decay in a high-purity germanium detector.

  8. Demonstration of non-infectious hemagglutinating particles of rabies virus and isolation of the hemagglutinin by disruption of the virion with Nonidet P-40.

    PubMed

    Arai, Y T; Kondo, A; Suzuki, K

    1976-01-01

    Non-infectious hemagglutinating particles of rabies virus accumulated in the fluid phase of chick embryo cell cultures at 6 days post-infection, though they were undetectable at 4 days. They were characterized as looped filaments resembling viral envelope as revealed by electron microscopy. Another form of hemagglutinin (HAnin) was obtained by solubilization of partially purified virions with Nonidet P-40 (NP-40) followed by successive high speed and CsCl density gradient centrifugations. The density of the isolated HAnin averaged 1.28 g/cm3. SDS-polyacrylamide gel electrophoresis of the HAnin demonstrated that it was mainly composed of a glycoprotein (G) with a molecular weight of 83,000. Electron microscopically, it differed from the above non-infectious hemagglutinating particles, being much smaller in size and showing a star- or rosette-like appearance with a diameter of about 25 nm, composed of a central particle surrounded by particles resembling envelope-spikes. Virus-neutralizing (VN) and hemagglutination inhibiting (HI) antibodies were produced in rabbits immunized with the HAnin isolated from virions.

  9. Combination of Epstein-Barr virus scaffold (BdRF1/VCA-p40) and small capsid protein (BFRF3/VCA-p18) into a single molecule for improved serodiagnosis of acute and malignant EBV-driven disease.

    PubMed

    Fachiroh, Jajah; Stevens, Servi J C; Haryana, Sofia M; Middeldorp, Jaap M

    2010-10-01

    Current single Epstein-Barr virus (EBV) markers fail to reach 100% sensitivity for serodiagnosis of acute and malignant diseases associated with EBV infection. Previous study had identified immunodominant epitopes of VCA-p40 and VCA-p18, and indicated that these two VCA antigens may have diagnostic value for EBV-related diseases. A recombinant protein of the full-length BdRF1 fused to the immunodominant domain of BFRF3 as 6-his tagged protein in Escherichia coli was developed. The recombinant protein was extracted in 8M urea solution and purified by metal-affinity chromatography yielding a 55 kDa product (VCA-p40+18). VCA-p40+18 blot-strips examined for IgM reactivity in infectious mononucleosis samples yielded 100% sensitivity and specificity, with improved reactivity compared with IgM/VCA-p18-ELISAs. A recent study described a synthetic peptide-based IgA/[EBNA1+VCA-p18]-ELISA (IgA/EBV-ELISA), with a sensitivity of 90% for diagnosing nasopharyngeal carcinoma. Immunoblot analysis of biopsy-confirmed nasopharyngeal carcinoma cases with low or negative IgA/EBV-ELISA showed 100% IgG reactivity to VCA-p40 and VCA-p18 proteins. Evaluation of VCA-p40+18 as an additional marker for screening and diagnosis of nasopharyngeal carcinoma was carried out. The data showed positive IgA/VCA-p40+18 reactivity by ELISA for 63.6% (14 of 22) nasopharyngeal carcinoma samples that were missed by peptide-based IgA/EBV-ELISA, suggested VCA-p40+18 as an improved marker for nasopharyngeal carcinoma serodiagnosis. The VCA-p40+18 may be combined with an EBNA1 synthetic peptide as an antigen mixture in one or separate IgA ELISA for improved nasopharyngeal carcinoma serodiagnosis. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  10. [Expression profiling and immunofluorescence localization of the major egg antigen p40 of Schistosoma japonicum in the liver of infected New Zealand white rabbits].

    PubMed

    Xia, Dan; Deng, Ganming; Teng, Pingying; Xie, Yu; Li, Yaomin; Wang, Chunmei; Chen, Shujie; Chen, Minfang; Mai, Rongjia; Liao, Haiyan; Shi, Lingyu; Ou, Liyan; Chen, Qiwei; Chen, Xiaoguang; Zhou, Xiaohong

    2015-06-01

    To examine the expression profile and immunofluorescence localization of the major egg antigen p40 of Schistosoma japonicum (Sjp40) during granuloma formation in the liver of infected New Zealand white rabbits. New Zealand white rabbits were infected with S. japonicum cercariae, and the livers were harvested at 29 and 45 days post-infection (dpi). The total RNA of the liver tissues was extracted for expression profiling of Sjp40 by quantitative reverse transcription-PCR (qRT-PCR) with GAPDH of S. japonicum as the endogenous reference gene. The expression of Sjp40 in the liver were detected by Western blotting using anti-Sjp40 monoclonal antibody (mAb) 9G7 or anti-Toxoplasma gondii tSAG1 mAb Y3A8 (control) as the primary antibody. Paraffin sections of the liver were prepared for observing egg granuloma formation using HE staining and for indirect immunofluorescence assay of Sjp40 location in the trapped eggs and egg granulomas. The level of Sjp40 mRNA in the eggs trapped in rabbit livers was significantly higher at 45 dpi than that at 29 dpi (P<0.05), and Western blotting confirmed the presence of Sjp40 protein in the rabbit livers at both 29 and 45 dpi. Immunofluorescence assay demonstrated localized expression of Sjp40 in the immature eggs in the rabbit liver at 29 dpi, but at 45 dpi fluorescence was detected in clusters of mature eggs containing miracidium and in the surrounding egg granulomas. The transcriptional levels of Sjp40 significantly increased with the maturation of eggs trapped in the rabbit livers. Sjp40 protein spread from the eggs to the surrounding egg granuloma at 45 dpi when acute liver granulomatous lesions occur, suggesting that Sjp40 plays a key role in egg granulomas formation in the livers of infected New Zealand white rabbits.

  11. Infection Rate and Tissue Localization of Murine IL-12p40-Producing Monocyte-Derived CD103+ Lung Dendritic Cells during Pulmonary Tuberculosis

    PubMed Central

    Leepiyasakulchai, Chaniya; Taher, Chato; Chuquimia, Olga D.; Mazurek, Jolanta; Söderberg-Naucler, Cecilia; Fernández, Carmen; Sköld, Markus

    2013-01-01

    Non-hematopoietic cells, including lung epithelial cells, influence host immune responses. By co-culturing primary alveolar epithelial cells and monocytes from naïve donor mice, we show that alveolar epithelial cells support monocyte survival and differentiation in vitro, suggesting a role for non-hematopoietic cells in monocyte differentiation during the steady state in vivo. CD103+ dendritic cells (αE-DC) are present at mucosal surfaces. Using a murine primary monocyte adoptive transfer model, we demonstrate that αE-DC in the lungs and pulmonary lymph nodes are monocyte-derived during pulmonary tuberculosis. The tissue localization may influence the functional potential of αE-DC that accumulate in Mycobacterium tuberculosis-infected lungs. Here, we confirm the localization of αE-DC in uninfected mice beneath the bronchial epithelial cell layer and near the vascular wall, and show that αE-DC have a similar distribution in the lungs during pulmonary tuberculosis and are detected in the bronchoalveolar lavage fluid from infected mice. Lung DC can be targeted by M. tuberculosis in vivo and play a role in bacterial dissemination to the draining lymph node. In contrast to other DC subsets, only a fraction of lung αE-DC are infected with the bacterium. We also show that virulent M. tuberculosis does not significantly alter cell surface expression levels of MHC class II on infected cells in vivo and that αE-DC contain the highest frequency of IL-12p40+ cells among the myeloid cell subsets in infected lungs. Our results support a model in which inflammatory monocytes are recruited into the M. tuberculosis-infected lung tissue and, depending on which non-hematopoietic cells they interact with, differentiate along different paths to give rise to multiple monocyte-derived cells, including DC with a distinctive αE-DC phenotype. PMID:23861965

  12. The tumor suppressor phosphatase and tensin homolog protein (PTEN) is negatively regulated by NF-κb p50 homodimers and involves histone 3 methylation/deacetylation in UROtsa cells chronically exposed to monomethylarsonous acid.

    PubMed

    Oliva-González, C; Uresti-Rivera, E E; Galicia-Cruz, O G; Jasso-Robles, F I; Gandolfi, A J; Escudero-Lourdes, C

    2017-10-05

    UROtsa cells have been accepted as a model to study carcinogenicity mechanisms of arsenic-associated human bladder cancer. In vitro continuous exposure to monomethylarsonous acid (MMA(III)), leads UROtsa cells to commit to malignant transformation. In this process, NF-κβ-associated inflammatory response seems to play an important role since this transcription factor activates some minutes after cells are exposed in vitro to MMA(III) and keeps activated during the cellular malignant transformation. It is known that a slight decrease in the protein phosphatase and tensin homologue (PTEN) gene expression is enough for some cells to become malignantly transformed. Interestingly, this tumor suppressor has been proven to be negatively regulated by NF-κβ through binding to its gene promoter. Based on these observations we propose that NF-κβ may be involved in arsenic associated carcinogenesis through the negative regulation of PTEN gene expression. Changes in PTEN expression and the binding of p50 NF-κβ subunit to PTEN promoter were evaluated in UROtsa cells exposed for 4, 12, 20, or 24 wk to 50nM MMA(III). Results showed that MMA(III) induced a significant decrease in PTEN expression around 20 wk exposure to MMA(III),which correlated with increased binding of p50 subunit to the PTEN promoter. Consistent with these results, ChIP assays also showed a significant decrease in H3 acetylation (H3ac) but an increase in the repression marks H3k9me3 and H327me3 in PTEN promoter when compared with not treated cells. These results suggest that the activation of NF-κβ by MMA(III) may participate in UROtsa cells malignant transformation through the negative regulation of PTEN expression involving p50 homodimers-mediated chromatin remodeling around the PTEN promoter. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Covalent homodimers of murine secretory component induced by epitope substitution unravel the capacity of the polymeric Ig receptor to dimerize noncovalently in the absence of IgA ligand.

    PubMed

    Crottet, P; Peitsch, M C; Servis, C; Corthésy, B

    1999-10-29

    Recombinant secretory immunoglobulin A containing a bacterial epitope in domain I of the secretory component (SC) moiety can serve as a mucosal delivery vehicle triggering both mucosal and systemic responses (Corthésy, B., Kaufmann, M., Phalipon, A., Peitsch, M., Neutra, M. R., and Kraehenbuhl, J.-P. (1996) J. Biol. Chem. 271, 33670-33677). To load recombinant secretory IgA with multiple B and T epitopes and extend its biological functions, we selected, based on molecular modeling, five surface-exposed sites in domains II and III of murine SC. Loops predicted to be exposed at the surface of SC domains were replaced with the DYKDDDDK octapeptide (FLAG). Another two mutants were obtained with the FLAG inserted in between domains II and III or at the carboxyl terminus of SC. As shown by mass spectrometry, internal substitution of the FLAG into four of the mutants induced the formation of disulfide-linked homodimers. Three of the dimers and two of the monomers from SC mutants could be affinity-purified using an antibody to the FLAG, mapping them as candidates for insertion. FLAG-induced dimerization also occurred with the polymeric immunoglobulin receptor (pIgR) and might reflect the so-far nondemonstrated capacity of the receptor to oligomerize. By co-expressing in COS-7 cells and epithelial Caco-2 cells two pIgR constructs tagged at the carboxyl terminus with hexahistidine or FLAG, we provide the strongest evidence reported to date that the pIgR dimerizes noncovalently in the plasma membrane in the absence of polymeric IgA ligand. The implication of this finding is discussed in terms of IgA transport and specific antibody response at mucosal surfaces.

  14. Osteoblastic Differentiation of Human and Equine Adult Bone Marrow-Derived Mesenchymal Stem Cells when BMP-2 or BMP-7 homodimer genetic modification is compared to BMP-2/7 heterodimer genetic modification in the Presence and Absence of Dexamethasone

    PubMed Central

    Carpenter, RS; Goodrich, LR; Frisbie, DD; Kisiday, JD; Carbone, B; McIlwraith, CW; Centeno, CJ; Hidaka, C

    2010-01-01

    Bone marrow-derived mesenchymal stem cells (BMDMSCs) have been targeted for use in enhancement of bone healing; and their osteogenic potential may be further augmented by genes encoding bone morphogenetic proteins (BMP’s). The purpose of this study was to compare the effect of genetic modification of human and equine BMDMSCs with BMP-2 or 7 or BMP-2 and 7 on their osteoblastogenic differentiation in the presence or absence of dexamethasone. The BMDMSCs were harvested from the iliac crest of 3 human donors and tuber coxae of 3 equine donors. Monolayer cells were genetically modified using adenovirus vectors encoding BMP-2, -7 or both and cultured in the presence or absence of dexamethasone. Expression of BMPs was confirmed by enzyme linked immunosorbent assay. To evaluate osteoblastic differentiation, cellular morphology was assessed every other day and expression and secretion of alkaline phosphatase (ALP), as well as expression levels of osteonectin, osteocalcin, and Runx2 were measured for up to 14 days. Human and equine BMDMSCs showed a capacity for osteogenic differentiation regardless of genetic modification or dexamethasone supplementation. Dexamethasone supplementation was more important for osteoblastogenic differentiation of equine BMDMSCs than human BMDMSCs. Genetic modification of BMDMSCs increased ALP secretion with AdBMP-2 homodimer having the greatest effect in both human and equine cells compared to AdBMP 7 or AdBMP 2/7. BMP protein elution rates reached their maximal concentration between day 4 and 8 and remained relatively stable thereafter, suggesting that genetically modified BMDMSCs could be useful for cell-based delivery of BMPs to a site of bone formation. PMID:20309952

  15. IL-12p40 gene-deficient BALB/c mice exhibit lower weight loss, reduced lung pathology and decreased sensitization to allergen in response to infection with pneumonia virus of mice.

    PubMed

    Shrivastava, Pratima; Sarkar, Indranil; Atanley, Ethel; Gomis, Susantha; van Drunen Littel-van den Hurk, Sylvia

    2016-10-01

    Respiratory syncytial virus (RSV) is a major cause of bronchiolitis and pneumonia in infants and pneumonia virus of mice (PVM) causes similar disease. BALB/c mice are highly susceptible, while C57BL/6 mice are more resistant to PVM. IL-12 was significantly more up-regulated in response to PVM infection in BALB/c than in C57BL/6 mice. IL-12p40-deficient neonatal and adult BALB/c mice showed significantly less weight loss than wild-type mice after PVM challenge. The percentage of regulatory T cells, as well as IFN-β and IL-18 expression, was higher in the lungs of both neonatal and adult IL-12p40-/- mice. Adult IL-12p40-/- mice also showed enhanced TGF-β and IL-10 expression and reduced inflammatory responses. Furthermore, IL-12p40-/- mice showed decreased sensitization to inhaled cockroach antigen after PVM infection when compared to wild-type mice. In conclusion, these data suggest that a depressed regulatory capacity in BALB/c mice to PVM infection results in enhanced immunopathology and sensitization to allergen. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Various Antibody Clones of Napsin A, Thyroid Transcription Factor 1, and p40 and Comparisons With Cytokeratin 5 and p63 in Histopathologic Diagnostics of Non-Small Cell Lung Carcinoma.

    PubMed

    Tran, Lena; Mattsson, Johanna S M; Nodin, Björn; Jönsson, Per; Planck, Maria; Jirström, Karin; Botling, Johan; Micke, Patrick; Brunnström, Hans

    2016-10-01

    Histopathologic classification of cancer in the lung is important for choice of treatment. Cytokeratin 5 (CK5), p63, and p40 are commonly used immunohistochemical markers for squamous cell carcinoma, and napsin A (NAPA) and thyroid transcription factor 1 (TTF-1) are markers for adenocarcinoma of the lung. The aim of the present study was to evaluate these 5 markers and to compare different commercially available antibody clones in lung cancer. Tissue microarrays including 557 cases of surgically treated primary tumors and 73 matched metastases of non-small cell lung carcinoma were stained with CK5, p63, p40 (monoclonal and polyclonal), NAPA (5 different clones/protocols), and TTF-1 (2 different clones). The sensitivity and specificity to separate squamous cell carcinomas from non-small cell carcinomas of nonsquamous type were 95% and 97%, respectively, for CK5, 95% and 87% for p63, 94% and 96% for p40, 75% to 79% and 96% to 98% for the NAPA clones/protocols and 80% to 85% and 95% to 97% for the TTF-1 clones. A combination of NAPA and TTF-1 resulted in a higher sensitivity (85% to 88%), whereas combining CK5 and p40 did not increase the diagnostic performance. The sensitivity was generally lower in evaluation of lung cancer metastases. The κ-values for comparison of staining results between monoclonal and polyclonal p40 and between the 5 NAPA clones/protocols were 0.97 to 1.0, whereas the corresponding figure for the 2 TTF-1 clones was 0.91 to 0.93. Conclusively, CK5 and p40 are good diagnostic markers for squamous cell carcinoma and superior to p63. In addition, it may be useful to combine NAPA and TTF-1 for increased sensitivity in lung cancer diagnostics. There is no substantial difference between monoclonal and polyclonal p40 and between different NAPA clones, whereas there is a difference between the TTF-1 clones 8G7G3/1 and SPT24.

  17. A Regulatory Element Near the 3′ End of the Adeno-Associated Virus rep Gene Inhibits Adenovirus Replication in cis by Means of p40 Promoter-Associated Short Transcripts

    PubMed Central

    Hammer, Eva; Gonsior, Melanie; Stutika, Catrin; Heilbronn, Regine

    2016-01-01

    ABSTRACT Adeno-associated virus (AAV) has long been known to inhibit helper adenovirus (Ad) replication independently of AAV Rep protein expression. More recently, replication of Ad serotype 5 (Ad5)/AAV serotype 2 (AAV-2) hybrid vectors was shown to be inhibited in cis by a sequence near the 3′ end of AAV rep, termed the Rep inhibition sequence for adenoviral replication (RIS-Ad). RIS-Ad functions independently of Rep protein expression. Here we demonstrate that inhibition of adenoviral replication by RIS-Ad requires an active AAV p40 promoter and the 5′ half of the intron. In addition, Ad inhibition is critically dependent on the integrity of the p40 transcription start site (TSS) leading to short p40-associated transcripts. These do not give rise to effector molecules capable of inhibiting adenoviral replication in trans, like small polypeptides or microRNAs. Our data point to an inhibitory mechanism in which RNA polymerase II (Pol II) pauses directly downstream of the p40 promoter, leading to interference of the stalled Pol II transcription complex with the adenoviral replication machinery. Whereas inhibition by RIS-Ad is mediated exclusively in cis, it can be overcome by providing a replication-competent adenoviral genome in trans. Moreover, the inhibitory effect of RIS-Ad is not limited to AAV-2 but could also be shown for the corresponding regions of other AAV serotypes, including AAV-5. These findings have important implications for the future generation of Ad5/AAV hybrid vectors. IMPORTANCE Insertion of sequences from the 3′ part of the rep gene of adeno-associated virus (AAV) into the genome of its helper adenovirus strongly reduces adenoviral genome replication. We could show that this inhibition is mediated exclusively in cis without the involvement of trans-acting regulatory RNAs or polypeptides but nevertheless requires an active AAV-2 p40 promoter and p40-associated short transcripts. Our results suggest a novel inhibitory mechanism that has so

  18. A novel binding protein for a member of CyP40-type Cyclophilins: N.crassa CyPBP37, a growth and thiamine regulated protein homolog to yeast Thi4p.

    PubMed

    Faou, Pierre; Tropschug, Maximilian

    2003-10-31

    Cyclophilins belong to the family of peptidyl-prolyl cis/trans isomerases (PPIases), which are ubiquitous and highly conserved enzymes capable of cis/trans isomerizing Xaa-Pro peptide bonds. Members of the CyP40-type cyclophilins have originally been described as components of hormone receptor complexes. Here, we describe NcCyP41, a CyP40 ortholog from Neurospora crassa, its expression in Escherichia coli and subsequent purification. Characterization of NcCyP41 reveals that it is a heat shock protein, which is active as a cyclosporin A-sensitive PPIase. Affinity chromatography using immobilized recombinant NcCyP41 yielded two major NcCyP41-binding proteins: Hsp80 (a Hsp90 ortholog from N.crassa) and CyPBP37. CyPBP37 has not been described. In addition, this is the first record describing an interaction between a member of Cyp40-type cyclophilins and of CyPBP37-type proteins, respectively. CyPBP37 expression is repressed by thiamine and in the stationary phase in N.crassa. CyPBP37 is present in different isoforms. The expression of a CyPBP37 ortholog in yeast, Thi4p, is diminished in a mutant lacking one of the two CyP40 orthologs (Cpr7p). In addition, the DeltaCpr7p deletion mutant shows a thiamine-dependent growth defect. We conclude that, in yeast, Cpr7p and Thi4p interact functionally.

  19. Improved transport of horseradish peroxidase after injection with a non-ionic detergent (Nonidet P-40) into mouse cortex and observations on the relationship between spread at the injection site and amount of transported label.

    PubMed

    Lipp, H P; Schwegler, H

    1980-10-20

    Addition of the non-ionic detergent Nonidet P-40 (NP-40) to horseradish peroxidase (HRP) injected in small quantities into barrelfields of mouse somatosensory cortex results in a significant increase of labeled neurons in the contralateral barrelfield cortex as compared to normal HRP. Comparisons with lysolethicin as an additive to HRP show that with NP-40 neurons are labeled more reliably and spread of label is less extensive at the injection site. Using NP-40, the region of dense label spread at the injection site as revealed by the diaminobenzidine/cobalt procedure coincides rather precisely with the contralateral cortical region containing labeled neurons as visualized by tetramethylbenzidine.

  20. Biological and biochemical properties of Nonidet P40-solubilized and partially purified tumor-specific antigens of the transplantation type from plasma membranes of a methylcholanthrene-induced sarcoma.

    PubMed

    Natori, T; Law, L W; Appella, E

    1977-09-01

    Tumor-specific transplantation antigen (TSTA) was solubilized from cell membranes of sarcoma Meth-A with non-ionic detergent Nonidet P40. Soluble TSTA was partially characterized by chromatographic separation and electrophoresis. The antigen responsible for tumor rejection activity had a molecular weight of approximately 70,000 daltons in the presence of detergent and an electrophoretic mobility of alpha-globulin. TSTA was well separated from mouse histocompatibility antigen H-2 by a sequence of procedures, including gel filtration, lectin affinity chromatography, column electrophoresis, and rechromatography on agarose, showed only three major bands on polyacrylamide gel electrophoresis. TSTA was specific for sarcoma Meth-A.

  1. Interleukin-12 bypasses common gamma-chain signalling in emergency natural killer cell lymphopoiesis

    PubMed Central

    Ohs, Isabel; van den Broek, Maries; Nussbaum, Kathrin; Münz, Christian; Arnold, Sebastian J.; Quezada, Sergio A.; Tugues, Sonia; Becher, Burkhard

    2016-01-01

    Differentiation and homeostasis of natural killer (NK) cells relies on common gamma-chain (γc)-dependent cytokines, in particular IL-15. Consequently, NK cells do not develop in mice with targeted γc deletion. Herein we identify an alternative pathway of NK-cell development driven by the proinflammatory cytokine IL-12, which can occur independently of γc-signalling. In response to viral infection or upon exogenous administration, IL-12 is sufficient to elicit the emergence of a population of CD122+CD49b+ cells by targeting NK-cell precursors (NKPs) in the bone marrow (BM). We confirm the NK-cell identity of these cells by transcriptome-wide analyses and their ability to eliminate tumour cells. Rather than using the conventional pathway of NK-cell development, IL-12-driven CD122+CD49b+ cells remain confined to a NK1.1lowNKp46low stage, but differentiate into NK1.1+NKp46+ cells in the presence of γc-cytokines. Our data reveal an IL-12-driven hard-wired pathway of emergency NK-cell lymphopoiesis bypassing steady-state γc-signalling. PMID:27982126

  2. Periodontitis aggravated pancreatic β-cell dysfunction in diabetic mice through interleukin-12 regulation on Klotho.

    PubMed

    Liu, Yihua; Zhang, Qiuli

    2016-05-01

    Recent studies have shown that periodontitis can contribute to adipose tissue inflammation and subsequent systemic insulin resistance in the obese rat model. However, the related inflammatory mechanism is not yet clear. The present study aims to investigate the effects of periodontitis on the function of pancreatic β-cells with pro-inflammatory cytokines-related immune mechanism in a mouse model. C57BL/6-db/db and inbred C57BL/6 mice were chosen here to establish a mouse model with periodontitis, which was induced by ligatures for 8 weeks. Glucose-stimulated insulin secretion was introduced to evaluate the function of pancreatic islets and β-cells. Serum levels of pro-inflammatory cytokines and Klotho were also measured, and the correlation between immunostimulation and Klotho level was deeply investigated in vitro. Pancreatic β-cell failure, with insulin resistance, was observed in db/db mice, while periodontitis could aggravate β-cell dysfunction-related features. Serum levels of interleukin (IL)-12 and Klotho showed a negatively synergistic change, whereas the expression of Klotho was also inhibited under IL-12 treatment in MIN6 β-cells or isolated islets. Furthermore, IL-12-induced immune stimulation and also decreased insulin secretion were proven to be reversed by Klotho overexpression. Periodontitis aggravated pancreatic β-cell failure in diabetic mice. Further in vitro studies showed IL-12 regulation on Klotho, while Klotho also acted as an inhibitor on IL-12, indicating the potential of Klotho for preserving pancreatic β-cell function in diabetes.

  3. Interferon-gamma differentially regulates interleukin-12 and interleukin-10 production in leprosy.

    PubMed

    Libraty, D H; Airan, L E; Uyemura, K; Jullien, D; Spellberg, B; Rea, T H; Modlin, R L

    1997-01-15

    The ability of monocytes to influence the nature of the T cell response to microbial pathogens is mediated in part by the release of cytokines. Of particular importance is the release of IL-12 and IL-10 by cells of the monocyte/macrophage lineage upon encountering the infectious agent. IL-12 promotes cell mediated immunity (CMI) to intracellular pathogens by augmenting T-helper type 1 responses, whereas IL-10 downregulates these responses. The ability of IFN-gamma to modulate the balance between IL-12 and IL-10 production was examined by studying leprosy as a model. In response to Mycobacterium leprae stimulation, IFN-gamma differentially regulated IL-12 and IL-10 production resulting in upregulation of IL-12 release and downregulation of IL-10 release. Furthermore, we determined that the mechanism by which IFN-gamma downregulates IL-10 was through the induction of IL-12. The data suggest a model of lymphocyte-monocyte interaction whereby the relative presence or absence of IFN-gamma in the local microenvironment is a key determinant of the type of monocyte cytokine response, and hence the degree of CMI in the host response to infection.

  4. Role of chitosan co-formulation in enhancing interleukin-12 delivery and antitumor activity

    PubMed Central

    Yang, Lirong; Zaharoff, David A.

    2013-01-01

    Local delivery systems that provide sustained, high concentrations of antitumor cytokines in the tumor microenvironment while minimizing systemic dissemination are needed to realize the potential of cytokine-based immunotherapies. Recently, co-formulations of cytokines with chitosan solutions have been shown to increase local cytokine retention and bioactivity. In particular, intratumoral (i.t.) injections of chitosan/IL-12 can eliminate established tumors and generate tumor-specific immune responses. In the present study, we explored the mechanisms by which chitosan potentiated IL-12’s antitumor activity. The location of chitosan/IL-12 injection was found to be critical for optimal cytokine delivery. I.t. injections eliminated 9 of 10 MC38 adenocarcinomas while contralateral and peritumoral injections delayed tumor growth but could not eliminate tumors. Microdosing studies demonstrated that IL-12 depots, simulated through daily i.t. injections with IL-12 alone, were not as effective as weekly i.t. chitosan/IL-12. 50–75% of mice receiving daily IL-12 microdoses and 87.5% of mice receiving weekly chitosan/IL-12 were cured of MC38 tumors. Chitosan was found to increase IL-12-mediated leukocytic expansion in tumors and tumor-draining lymph nodes (TDLNs) by 40% and 100%, respectively. Immunophenotyping studies demonstrated that chitosan co-formulation amplified IL-12-induced increases in important effector populations, such as CD8+IFN-γ+ and NKT cells, in tumors and dendritic cell populations in TDLNs. Remarkable increases in Gr-1+CD11b+ tumor infiltrates were also observed in mice receiving chitosan or chitosan/IL-12. This population does not appear be suppressive and may facilitate the local antitumor response. Presented data suggest that chitosan-mediated depot formation and enhanced local cytokine retention is significantly, but not entirely, responsible for increased cytokine bioactivity. PMID:23453060

  5. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice

    PubMed Central

    1995-01-01

    Allergic asthma is characterized by airway hyperresponsiveness and pulmonary eosinophilia, and may be mediated by T helper (Th) lymphocytes expressing a Th2 cytokine pattern. Interleukin (IL) 12 suppresses the expression of Th2 cytokines and their associated responses, including eosinophilia, serum immunoglobulin E, and mucosal mastocytosis. We have previously shown in a murine model that antigen- induced increases in airway hyperresponsiveness and pulmonary eosinophilia are CD4+ T cell dependent. We used this model to determine the ability of IL-12 to prevent antigen-induced increases in airway hyperresponsiveness, bronchoalveolar lavage (BAL) eosinophils, and lung Th2 cytokine expression. Sensitized A/J mice developed airway hyperresponsiveness and increased numbers of BAL eosinophils and other inflammatory cells after single or repeated intratracheal challenges with sheep red blood cell antigen. Pulmonary mRNA and protein levels of the Th2 cytokines IL-4 and IL-5 were increased after antigen challenge. Administration of IL-12 (1 microgram/d x 5 d) at the time of a single antigen challenge abolished the airway hyperresponsiveness and pulmonary eosinophilia and promoted an increase in interferon (IFN) gamma and decreases in IL-4 and IL-5 expression. The effects of IL-12 were partially dependent on IFN-gamma, because concurrent treatment with IL-12 and anti-IFN-gamma monoclonal antibody partially reversed the inhibition of airway hyperresponsiveness and eosinophilia by IL-12. Treatment of mice with IL-12 at the time of a second antigen challenge also prevented airway hyperresponsiveness and significantly reduced numbers of BAL inflammatory cells, reflecting the ability of IL-12 to inhibit responses associated with ongoing antigen-induced pulmonary inflammation. These data show that antigen-induced airway hyperresponsiveness and inflammation can be blocked by IL-12, which suppresses Th2 cytokine expression. Local administration of IL-12 may provide a novel immunotherapy for the treatment of pulmonary allergic disorders such as atopic asthma. PMID:7595222

  6. Differential regulation of interleukin-12- and interleukin-15-induced natural killer cell activation by interleukin-4.

    PubMed

    Salvucci, O; Mami-Chouaib, F; Moreau, J L; Thèze, J; Chehimi, J; Chouaib, S

    1996-11-01

    The regulation of human natural killer (NK) cell activation is under the control of a network of regulatory signals provided by cytokines. In the present study, we investigated the functional interaction between interleukin (IL)-4 and two monocyte/macrophage-derived cytokines, IL-12 and IL-15, during the process of NK stimulation. Using freshly isolated human NK cells, we have demonstrated that IL-4 negatively regulates lymphokine-activated killer (LAK) activity induced by IL-15 against the NK-resistant Daudi target cells. In contrast, IL-4 had no effect on IL-12-stimulated LAK generation. The differential effect of IL-4 on NK cell activation by IL-12 and IL-15 correlates with its ability to increase or to down-regulate the level of tumor necrosis factor-alpha and interferon-gamma release by NK cells, respectively. In contrast, endogenous transforming growth factor-beta 1 does not appear to be involved in the IL-4 regulatory pathway. Furthermore, while IL-4 was found to decrease the basal expression of the IL-2 receptor beta subunit utilized by IL-15, it had no effect on the expression of the beta 1 chain of the IL-12 receptor compared to untreated cells. Northern blot analysis indicated that the IL-4 regulatory effect on NK lytic function was associated with its capacity to down-regulate granzyme B and perforin gene transcription in response to IL-15 and its failure to affect the expression of both gene's in response to IL-12. Together, these data suggest the existence of a distinct cross-talk between IL-4 and IL-15 or IL-12 signaling pathways during the regulation of human non-major histocompatibility complex-restricted cytotoxicity.

  7. Phase I Trial of Interleukin-12 Plasmid Electroporation in Patients With Metastatic Melanoma

    PubMed Central

    Daud, Adil I.; DeConti, Ronald C.; Andrews, Stephanie; Urbas, Patricia; Riker, Adam I.; Sondak, Vernon K.; Munster, Pamela N.; Sullivan, Daniel M.; Ugen, Kenneth E.; Messina, Jane L.; Heller, Richard

    2008-01-01

    Purpose Gene-based immunotherapy for cancer is limited by the lack of safe, efficient, reproducible, and titratable delivery methods. Direct injection of DNA into tissue, although safer than viral vectors, suffers from low gene transfer efficiency. In vivo electroporation, in preclinical models, significantly enhances gene transfer efficiency while retaining the safety advantages of plasmid DNA. Patients and Methods A phase I dose escalation trial of plasmid interleukin (IL)-12 electroporation was carried out in patients with metastatic melanoma. Patients received electroporation on days 1, 5, and 8 during a single 39-day cycle, into metastatic melanoma lesions with six 100-μs pulses at a 1,300-V/cm electric field through a penetrating six-electrode array immediately after DNA injection. Pre- and post-treatment biopsies were obtained at defined time points for detailed histologic evaluation and determination of IL-12 protein levels. Results Twenty-four patients were treated at seven dose levels, with minimal systemic toxicity. Transient pain after electroporation was the major adverse effect. Post-treatment biopsies showed plasmid dose proportional increases in IL-12 protein levels as well as marked tumor necrosis and lymphocytic infiltrate. Two (10%) of 19 patients with nonelectroporated distant lesions and no other systemic therapy showed complete regression of all metastases, whereas eight additional patients (42%) showed disease stabilization or partial response. Conclusion This report describes the first human trial, to our knowledge, of gene transfer utilizing in vivo DNA electroporation. The results indicated this modality to be safe, effective, reproducible, and titratable. PMID:19029422

  8. Role of interleukin-12 family cytokines in the cellular response to mycobacterial disease.

    PubMed

    Méndez-Samperio, Patricia

    2010-05-01

    Interleukin (IL)-12 is a multifunctional cytokine acting as a key regulator of cell-mediated immune responses through the differentiation of naïve CD4+ T cells into type 1 helper T cells (Th1) producing interferon-gamma. As our knowledge of IL-12 family members is rapidly growing, it will be important to specify their involvement in the regulation of mycobacterial infection. This article is a review of the current knowledge regarding the functions of the IL-12 family cytokines in the immune host defense system against mycobacteria. Specifically, this review aims to describe recent scientific evidence concerning the protective role of some members of the IL-12 family cytokines for the control of mycobacterial infection, as well as to summarize knowledge of the potential use of the IL-12 family members as potent adjuvants in the prevention and treatment of mycobacterial infectious diseases. In addition, recent data supporting the importance of the IL-12 family members in mycobacterial diseases in relation to Th17 function are discussed. This examination will help to improve our understanding of the immune response to mycobacterial infection and also improve vaccine design and immunotherapeutic intervention against tuberculosis.

  9. Interleukin-12 and interleukin-18 synergistically induce murine tumor regression which involves inhibition of angiogenesis.

    PubMed Central

    Coughlin, C M; Salhany, K E; Wysocka, M; Aruga, E; Kurzawa, H; Chang, A E; Hunter, C A; Fox, J C; Trinchieri, G; Lee, W M

    1998-01-01

    The antitumor effect and mechanisms activated by murine IL-12 and IL-18, cytokines that induce IFN-gamma production, were studied using engineered SCK murine mammary carcinoma cells. In syngeneic A/J mice, SCK cells expressing mIL-12 or mIL-18 were less tumorigenic and formed tumors more slowly than control cells. Neither SCK.12 nor SCK.18 cells protected significantly against tumorigenesis by distant SCK cells. However, inoculation of the two cell types together synergistically protected 70% of mice from concurrently injected distant SCK cells and 30% of mice from SCK cells established 3 d earlier. Antibody neutralization studies revealed that the antitumor effects of secreted mIL-12 and mIL-18 required IFN-gamma. Interestingly, half the survivors of SCK.12 and/or SCK.18 cells developed protective immunity suggesting that anti-SCK immunity is unlikely to be responsible for protection. Instead, angiogenesis inhibition, assayed by Matrigel implants, appeared to be a property of both SCK.12 and SCK.18 cells and the two cell types together produced significantly greater systemic inhibition of angiogenesis. This suggests that inhibition of tumor angiogenesis is an important part of the systemic antitumor effect produced by mIL-12 and mIL-18. PMID:9502787

  10. Interleukin-12 and Interleukin-2 in Treating Patients With Mycosis Fungoides

    ClinicalTrials.gov

    2013-01-15

    Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Stage I Cutaneous T-cell Non-Hodgkin Lymphoma; Stage I Mycosis Fungoides/Sezary Syndrome; Stage II Cutaneous T-cell Non-Hodgkin Lymphoma; Stage II Mycosis Fungoides/Sezary Syndrome; Stage III Cutaneous T-cell Non-Hodgkin Lymphoma; Stage III Mycosis Fungoides/Sezary Syndrome; Stage IV Cutaneous T-cell Non-Hodgkin Lymphoma; Stage IV Mycosis Fungoides/Sezary Syndrome

  11. Interleukin-12 in Treating Patients With Previously Treated Non-Hodgkin's Lymphoma or Hodgkin's Disease

    ClinicalTrials.gov

    2015-04-14

    Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Nodal Marginal Zone B-cell Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Cutaneous T-cell Non-Hodgkin Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Marginal Zone Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent Small Lymphocytic Lymphoma; Splenic Marginal Zone Lymphoma; Waldenström Macroglobulinemia

  12. Interleukin-12 in Treating Patients With Hematologic Cancers or Solid Tumors

    ClinicalTrials.gov

    2014-09-09

    Breast Cancer; Chronic Myeloproliferative Disorders; Gestational Trophoblastic Tumor; Kidney Cancer; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Neuroblastoma; Ovarian Cancer; Testicular Germ Cell Tumor

  13. Interleukin-12, Paclitaxel, and Trastuzumab in Treating Patients With Solid Tumors

    ClinicalTrials.gov

    2013-06-03

    Male Breast Cancer; Recurrent Breast Cancer; Recurrent Endometrial Carcinoma; Recurrent Gastric Cancer; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Small Cell Lung Cancer

  14. Rituximab and Interleukin-12 in Treating Patients With B-Cell Non-Hodgkin's Lymphoma

    ClinicalTrials.gov

    2013-08-23

    Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Nodal Marginal Zone B-cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Small Lymphocytic Lymphoma; Splenic Marginal Zone Lymphoma

  15. Interleukin-12 Followed by Interferon Alfa in Treating Patients With Advanced Cancer

    ClinicalTrials.gov

    2013-01-31

    Chronic Myeloproliferative Disorders; Leukemia; Lymphoma; Multiple Myeloma and Plasma Cell Neoplasm; Myelodysplastic Syndromes; Precancerous Condition; Unspecified Adult Solid Tumor, Protocol Specific

  16. Interleukins 12 and 13 levels among beta-thalassaemia major patients.

    PubMed

    Hashad, R A; Hamed, N A; El Gharabawy, M M; El Metwally, H A; Morsi, M G

    2013-02-01

    The role of inflammatory cytokines in the pathophysiology of beta-thalassaemia is still unclear. In this study production levels of interleukins (IL)-12 and IL-13 were measured by commercial ELISA in culture supernatants of mitogen-stimulated peripheral blood mononuclear cells-from 30 non-splenectomized beta-thalassaemia cases with iron overload and 20 age- and sex-matched healthy individuals. IL-12 levels were significantly lower among cases compared with controls (91.4 pg/mL versus 154.6 pg/mL), while IL-13 levels were significantly higher (42.5 pg/mL versus 5.7 pg/mL). There was a significant negative correlation between IL-12 and lL-13 levels among beta-thalassaemia cases (r= -0.42). Patients with beta-thalassaemia alone had higher IL-12 levels than beta-thalassaemia patients who were seropositive for chronic hepatitis B or C virus infection (140 pg/mL versus 50 pg/mL); IL-13 levels were slightly lower (65 pg/mL versus 67 pg/mL). An imbalance in the IL-12/IL-13 axis may be relevant to the pathophysiology of beta-thalassaemia.

  17. Cyclooxygenase 2-mediated suppression of macrophage interleukin-12 production after thermal injury.

    PubMed

    Schwacha, Martin G; Chung, Chun-Shiang; Ayala, Alfred; Bland, Kirby I; Chaudry, Irshad H

    2002-02-01

    Macrophage (Mphi) prostaglandin (PG)E(2) production has been implicated in immunosuppression and increased susceptibility to sepsis after thermal injury. Deficient interleukin (IL)-12 production has also been implicated in these postburn complications. The present study examined the relationship between Mphi cyclooxygenase (COX)-2 activity and IL-12 production after thermal injury. C57BL/6 female mice were subjected to a 25% total body surface area full-thickness burn. Mphi were isolated 7 days later, or the mice were subjected to sepsis by cecal ligation and puncture (CLP). IL-12 production by Mphi from injured mice was suppressed by >50%, whereas COX-2 expression and PGE(2) production were increased twofold. The COX-2 inhibitor NS-398 suppressed PGE(2) production and normalized IL-12 production in the injury group, whereas it had no effect on IL-10 production. Injured mice subjected to CLP had lower IL-12 plasma levels compared with sham-treated mice subjected to CLP. NS-398 treatment prevented the suppression in plasma IL-12 levels in the injury group. Thus elevated Mphi COX-2 activity, independent of IL-10, suppresses Mphi IL-12 production after thermal injury and may play an important role in the observed immunosuppression under such conditions.

  18. The low-virulent African swine fever virus (ASFV/NH/P68) induces enhanced expression and production of relevant regulatory cytokines (IFNalpha, TNFalpha and IL12p40) on porcine macrophages in comparison to the highly virulent ASFV/L60.

    PubMed

    Gil, S; Sepúlveda, N; Albina, E; Leitão, A; Martins, C

    2008-01-01

    The impact of infection by the low-virulent ASFV/NH/P68 (NHV) and the highly virulent ASFV/L60 (L60) isolates on porcine macrophages was assessed through the quantification of IFNalpha, TNFalpha, IL12p40, TGFbeta and ASFV genes by real-time PCR at 2, 4 and 6 h post-infection. Increased IFNalpha, TNFalpha and IL12p40 expression was found in infection with NHV, in which expression of TGFbeta was lower than in infection with L60. Principal component analysis showed a positive interaction of cytokines involved in cellular immune mechanisms, namely IFNalpha and IL12p40 in the NHV infection. Quantification by ELISA confirmed higher production of IFNalpha, TNFalpha and IL12p40 in the NHV-infected macrophages. Overall, our studies reinforce and clarify the effect of the NHV infection by targeting cellular and cellular-based immune responses relevant for pig survival against ASFV infection.

  19. Mapping early somatosensory evoked potentials in selective attention: critical evaluation of control conditions used for titrating by difference the cognitive P30, P40, P100 and N140.

    PubMed

    Desmedt, J E; Tomberg, C

    1989-01-01

    Detailed procedures are described for the study of somatosensory event-related potentials (ERPs) to electric stimulation of fingers. Control responses to homogeneous (100%) series of identical stimuli (thus eliminating input mismatch) while the subject reads a novel (thus providing a distinct attention-capturing activity and maintaining vigilance level) are validated as reflecting the exogenous obligatory profiles required for assessing cognitive component in ERPs to target relevant stimuli. With these 'neutral' conditions, the control responses have a similar profile even at larger ISIs such as those separating the infrequent targets in Attention runs. Conversely, series of stimuli identical to those in control runs can elicit cognitive components in a 'Lie' experiment when the subject is induced to treat the stimuli like targets even though there is no discrimination involved. On this basis, the somatosensory P30, P40, P100 and N140 components appearing in the target profiles are considered genuine cognitive components. They have been analyzed with scatter displays, electronic subtraction, bit-mapped displays and with calculation of Z and dilation factors. The cognitive P30 and P40 reflect selective attention-related enhancements of the neural generators in receiving somatosensory cortex. The early parietal positivity P27 can thus be modulated separately from the frontal N30 component and is thought to be generated by a radial dipole in area 1. The later cognitive P100 and N140 reflect the invocation of distinct processors in conjunction with the behavioral use of the sensory input. The evolving topographical patterns of the P100 and N140 electrogeneses, revealed by bit-mapped data, suggest complex interactions between posterior parietal and prefrontal cortex whereby the sensory information is placed into spatial coordinate systems and matched with representations of relevant objects or relationships in space for target processing in the sequential tasks.

  20. A novel human truncated IL12rβ1-Fc fusion protein ameliorates experimental autoimmune encephalomyelitis via specific binding of p40 to inhibit Th1 and Th17 cell differentiation

    PubMed Central

    Wang, Xin; Luo, Cheng; Yu, Dongmei; Wang, Yuheng; Chen, Yucong; Lei, Wen; Gao, Xiangdong; Yao, Wenbing

    2015-01-01

    Interleukin (IL)-12 and IL-23 respectively driving polarization of T helper (Th) 1 and Th17 cells has been strongly implicated in the pathogenesis of both multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE). In this study, we first constructed, expressed and purified a novel human truncated IL12rβ1-Fc fusion protein (tIL12rβ1/Fc) binding multiple forms of the p40 subunit of human IL-12 and IL-23. tIL12rβ1/Fc was found to effectively ameliorate MOG35–55-induced EAE through reducing the production of Th1- and Th17-polarized pro-inflammatory cytokines and suppressing inflammation and demyelination in the focused parts. Moreover, tIL12rβ1/Fc suppressed Th1 (IFN-γ+ alone) and IFN-γ+ IL-17+ as well as the population of classic Th17 (IL-17+ alone) cells in vivo. Furthermore, tIL12rβ1/Fc ameliorated EAE at the peak of disease via the inhibition of STAT pathway, thereby causing a prominent reduction of RORγt (Th17) and T-bet (Th1) expression. Notably, tIL12rβ1/Fc could increase the relative number of CD4+ Foxp3+ regulatory T cells. These findings indicates that tIL12rβ1/Fc is a novel fusion protein for specific binding multiple forms of p40 subunit to exert potent anti-inflammatory effects and provides a valuable approach for the treatment of MS and other autoimmune diseases. PMID:26384304

  1. Molecules altering the intracellular thiol content modulate NF-kB and STAT-1/IRF-1 signalling pathways and IL-12 p40 and IL-27 p28 production in murine macrophages.

    PubMed

    Fraternale, Alessandra; Crinelli, Rita; Casabianca, Anna; Paoletti, Maria Filomena; Orlandi, Chiara; Carloni, Elisa; Smietana, Michaël; Palamara, Anna Teresa; Magnani, Mauro

    2013-01-01

    The aim of this study was to investigate the molecular mechanisms involved in the production of Th1 cytokines, namely IL-12 and IL-27, when the intra-macrophage redox state was altered by different chemical entities such as GSH-C4, which is reduced glutathione carrying an aliphatic chain, or I-152, a pro-drug of N-acetyl-cysteine (NAC) and beta-mercaptoethylamine. We had already demonstrated that GSH-C4 and I-152 could shift the immune response towards Th1 in Ovalbumin-immunized mice as well as enhance Th1 response in HIV-1 Tat-immunized mice. By a new high performance liquid chromatography method, we found that 20 mM GSH-C4 provided a number of thiol species in the form of GSH, while 20 mM I-152 decreased GSH and increased the thiols in the form of NAC and I-152. Under these experimental conditions, GSH-C4 and I-152 enhanced and suppressed respectively the mRNA expression levels of IL-12 p40 induced by LPS/IFN-γ as assessed by Real-Time PCR. The protein production of IL-12 p40 was increased by GSH-C4 and decreased by I-152 as determined by Enzyme-linked immunosorbent assay. Western immunoblot and electrophoretic mobility shift assays revealed that Nuclear Factor -kB (NF-kB) activation was inhibited by I-152 and prolonged by GSH-C4. Twenty mM I-152 stimulated IL-27 p28 gene expression and sustained Signal Transducer and Activator of Transcription (STAT)-mediated interferon regulator factor 1 (IRF-1) de novo synthesis. By contrast, 20 mM GSH-C4 did not exert any effect on IL-27 p28 gene expression. an increase in the intra-macrophage redox state by GSH-C4 and I-152 enhances Th1 cytokine production although the chemical structure and the intra-cellular metabolism influence differently signalling pathways involved in IL-27 or IL-12 production. GSH-C4 and I-152 may be used as Th1 immunomodulators in some pathologies and in ageing where GSH depletion may contribute to the Th1/Th2 imbalance, and in new immunization strategies.

  2. A unique enhancer element for the trans activator (p40 sup tax ) of human T-cell leukemia virus type I that is distinct from cyclic AMP- and 12-O-tetradecanoylphobol-13-acetate-responsive elements

    SciTech Connect

    Fujisawa, Junichi; Toita, Masami; Yoshida, Mitsuaki )

    1989-08-01

    The trans activator (p40{sup tax}) of human T-cell leukemia virus type I (HTLV-I) is a transcriptional factor that activates the long terminal repeat (LTR) of HTLV-I and interleukin-2 receptor {alpha}. The authors examined the HTLV-I enhancer responsible for tax-mediated trans activation and identified (A/T)(G/C)(G/C)CNNTGACG(T/A) as a plausible tax-responsive element (TRE). The putative TRE in the LTR was found to be different from the elements required for activation by cyclic AMP and 12-O-tetradecanoylphorbol-13-acetate, although these elements overlapped each other. The TRE was also different from a binding site of N-{kappa}B-like factor that was identified was identified in the interleukin-2 receptor {alpha} promoter and human immunodeficiency virus LTR as a TRE. The latter result was further demonstrated by the failure of the NF-{kappa}B sequence to compete with the TRE of the LTR in a protein-binding assay. These findings indicate that tax function and its cascade can modulate activities of various enhancer sequences, which are probably regulated by distinct DNA-binding factors.

  3. A comparative evaluation of the in vitro penetration performance of the improved Crest complete toothbrush versus the Current Crest complete toothbrush, the Colgate Precision toothbrush and the Oral-B P40 toothbrush.

    PubMed

    Volpenhein, D W; Handel, S E; Hughes, T J; Wild, J

    1996-01-01

    Removal of plaque and debris from interproximal surfaces during toothbrushing has generally been difficult to achieve, in large part because traditional flat-bristled toothbrushes do not offer good interproximal penetration. As a result, a number of varying bristle designs have been developed, with the rippled-design brush shown to be particularly effective at removing interproximal plaque. Recently, an existing brush, the original Crest Complete, was modified to offer a more deeply rippled version. This study evaluated the interproximal penetration of four bristle designs: rippled pattern (original Crest Complete), deeper rippled pattern (improved Crest Complete), multi-level (Colgate Precision), and flat-tufted (Oral-B P40). The study used a previously reported in vitro model for determining interproximal penetration of manual toothbrushes (J Clin Dent 5:27-33, 1994). In order to effectively mimic the in-use characteristics of toothbrushing, this model is based on analysis of videotaped consumer brushing habits, tooth morphology, and in vivo plaque tenacity characteristics and uses the three most predominantly used brushing techniques (circular, up-and-down, and back-and-forth, with the brush held at both 45 and 90 degrees to the tooth surface). In addition, the model's brush stroke length, brush force, and brush speed are likewise based on analysis of consumer brushing patterns. The results of the study indicate that the new Crest Complete with deeper rippled bristles provided significantly superior (p < or = 0.05) interproximal penetration than the Colgate Precision and Oral-B brushes overall and for three of the four brush strokes tested. In addition, the new Crest Complete was found to provide significantly superior interproximal penetration to the original Crest Complete overall and in circular and up-and-down strokes, and the original Crest Complete provided superior overall interproximal penetration to the Colgate and Oral-B brushes.

  4. Dendritic Cell-Based Genetic Immunotherapy for Ovarian Cancer

    DTIC Science & Technology

    2007-12-01

    a gamma-counter. Maximum and spontaneous release of 51 Cr was obtained from the supernatants of the target cells in 1% Nonidet P-40 and in...16: 1045-9. 7. Piazzolla, G., C. Tortorella, G. Fiore, M. Fanelli, A. Pisconti, and S. Antonaci, Interleukin-12 p40 /p70 ratio and in vivo

  5. Treatment of platelets with riboflavin and ultraviolet light mediates complement activation and suppresses monocyte interleukin-12 production in whole blood.

    PubMed

    Loh, Y S; Dean, M M; Johnson, L; Marks, D C

    2015-11-01

    Pathogen inactivation (PI) and storage may alter the immunomodulatory capacity of platelets (PLTs). The aim of this study was to examine the effect of PI (Riboflavin and ultraviolet light treatment) and storage on the capacity of PLTs to induce cytokine responses in recipient inflammatory cells. A pool and split design was used to prepare untreated and PI-treated buffy coat-derived platelet concentrates (PCs). Samples were taken on days 2 and 7 postcollection and incubated with ABO/RhD-matched fresh whole blood for 6 h with or without lipopolysaccharide (LPS). The intracellular production of IP-10, MCP-1, MIP-1α, IL-8, IL-6, IL-10, IL-12, TNF-α and MIP-1β in monocytes and neutrophils was assessed using flow cytometry. Complement proteins in PLT supernatants were measured using a cytometric bead array. PLTs and PLT supernatant (both untreated and PI-treated) resulted in modulation of intracellular MIP-1β and IL-12 production in monocytes. Compared to untreated PLTs, PI-treated PLTs resulted in significantly lower LPS-induced monocyte IL-12 production (day 7). The concentration of C3a and C5a (and their desArg forms) was significantly increased in PLT supernatants following PI. PI results in decreased LPS-induced monocyte IL-12 production and increased complement activation. The association between platelet-induced complement activation and IL-12 production warrants further investigation. © 2015 International Society of Blood Transfusion.

  6. [The serum concentration of transforming growth factor beta1, interleukin 12 and interleukin 5 in children with chronic hepatitis B].

    PubMed

    Lebensztejn, Dariusz Marek; Skiba, Elzbieta; Kaczmarski, Maciej; Werpachowska, Irena; Sobaniec-Łotowska, Maria

    2003-07-01

    The aim of the study was to evaluate the serum TGF-beta 1, IL-12 and IL-5 concentration in children with chronic hepatitis (ChH) B. The study included 62 children with histopathologically diagnosed chh B. The stage of fibrosis and inflammation grade were assessed according to Batts and Ludwig and Ishak et al. The control group consisted of 9 children without clinical signs of infectious and chronic diseases. Serum TGF-beta 1 concentration was significantly elevated in patients with chronic hepatitis B (p = 0.0077) as compared to controls; there were no significant differences in serum concentrations of IL-12 and IL-5 between the examined groups of children. There was also no correlation between serum concentration of the studied cytokines and the degree of fibrosis, inflammation, activity of GPT, GOT, ALP, GGTP and concentrations of bilirubin, proteins or immunoglobulins (G, A, M).

  7. The value of serum neopterin, interferon-gamma levels and interleukin-12B polymorphisms in predicting acute renal allograft rejection

    PubMed Central

    Chin, G K; Adams, C L; Carey, B S; Shaw, S; Tse, W-Y; Kaminski, E R

    2008-01-01

    Acute rejection remains a poor predictor of graft outcome. In this study, we measured serum levels of interferon (IFN)-γ and neopterin by enzyme-linked immunosorbent assay and a single nucleotide polymorphism (SNP) within the 3′ untranslated region of the interleukin (IL)-12 B gene (1188 A/C) to determine whether either of these factors could predict acute rejection in renal transplantation. Significantly higher early post-transplant neopterin levels (days 5–7; 35·7 versus 19·9 nmol/l) were observed in recipients who subsequently rejected their grafts. Post-transplant neopterin levels showed a strong positive correlation with 1-month creatinine levels (Spearman's correlation 0·62, P < 0·001), suggesting macrophage activation early after transplantation. Pretransplant neopterin and IFN-γ levels and the IL-12B gene SNP did not predict acute rejection in this small retrospective study. The ability to predict acute rejection non-invasively early after transplantation could lead to individual tailoring of immunosuppressive regimens and perhaps lead eventually to longer graft survival. PMID:18341612

  8. Recombinant bacille Calmette-Guerin coexpressing Ag85b, CFP10, and interleukin-12 elicits effective protection against Mycobacterium tuberculosis.

    PubMed

    Chen, Yih-Yuan; Lin, Chih-Wei; Huang, Wei-Feng; Chang, Jia-Ru; Su, Ih-Jen; Hsu, Chih-Hao; Cheng, Han-Yin; Hsu, Shu-Ching; Dou, Horng-Yunn

    2017-02-01

    The tuberculosis (TB) pandemic remains a leading cause of human morbidity and mortality, despite widespread use of the only licensed anti-TB vaccine, bacille Calmette-Guerin (BCG). The protective efficacy of BCG in preventing pulmonary TB is highly variable; therefore, an effective new vaccine is urgently required. In the present study, we assessed the ability of novel recombinant BCG vaccine (rBCG) against Mycobacterium tuberculosis by using modern immunological methods. Enzyme-linked immunospot assays demonstrated that the rBCG vaccine, which coexpresses two mycobacterial antigens (Ag85B and CFP10) and human interleukin (IL)-12 (rBCG2) elicits greater interferon-γ (IFN-γ) release in the mouse lung and spleen, compared to the parental BCG. In addition, rBCG2 triggers a Th1-polarized response. Our results also showed that rBCG2 vaccination significantly limits M. tuberculosis H37Rv multiplication in macrophages. The rBCG2 vaccine surprisingly induces significantly higher tumor necrosis factor-α (TNF-α) production by peripheral blood mononuclear cells that were exposed to a nonmycobacterial stimulus, compared to the parental BCG. In this study, we demonstrated that the novel rBCG2 vaccine may be a promising candidate vaccine against M. tuberculosis infection. Copyright © 2014. Published by Elsevier B.V.

  9. Effect of acute heat stress on adrenocorticotropic hormone, cortisol, interleukin-2, interleukin-12 and apoptosis gene expression in rats

    PubMed Central

    WANG, LI; LIU, FADONG; LUO, YAN; ZHU, LINGQIN; LI, GUANGHUA

    2015-01-01

    The aim of the present study was to investigate the effect of acute heat stress on the neuroendocrine and immunological function in rats. Male Sprague-Dawley rats were randomly divided into two groups and respectively exposed to heat (32°C) or to room temperature (24°C). After 7 days of heat exposure, the heat-stress rat model was established. The organ coefficients of the pituitary and adrenal glands were determined. The body temperature was measured by telemetry. The average contents of adrenocorticotropic hormone (ACTH), cortisol (Cor), interleukin-2 (IL-2) and IL-12 in serum were detected. The expression of apoptotic genes in the spleen was measured. The results showed that acute heat stress did not evidently affect the body temperature and body weight (P>0.05), but the exposure increased the organ coefficients of the pituitary and adrenal glands (P<0.05). Heat exposure significantly elevated the level of ACTH, Cor, IL-2 and IL-12 (P<0.05). The expression of caspase-3 and Bax were not changed significantly (P>0.05), while Bcl2 was reduced (P<0.05). PMID:26137249

  10. Transgenic tomato expressing interleukin-12 has a therapeutic effect in a murine model of progressive pulmonary tuberculosis

    PubMed Central

    Elías-López, A L; Marquina, B; Gutiérrez-Ortega, A; Aguilar, D; Gomez-Lim, M; Hernández-Pando, R

    2008-01-01

    Host control of mycobacterial infection, in both human and mouse models, has been shown to be associated with the production of interferon (IFN)-γ by CD4+ T cells. Interleukin (IL)-12 is known to be a crucial cytokine in the differentiation of IFN-γ-producing T helper 1 (Th1) cells. To determine whether continuous administration of IL-12 expressed in transgenic tomato (TT–IL-12) has therapeutic efficacy in a murine model of pulmonary tuberculosis, BALB/c mice were infected with either Mycobacterium tuberculosis H37Rv strain or a multi-drug-resistant clinical isolate (MDR) and treated with a daily oral dose of TT-IL12 crude fruit extracts. For the early H37Rv infection, TT–IL-12 administration was started 1 day before infection and continued for 60 days. In the H37Rv or MDR late infection, treatment was started 60 days after infection and continued for another 60 days. In both phases of infection, TT–IL-12 administration resulted in a reduction of bacterial loads and tissue damage compared with wild-type tomato (non-TT). The Th1 response was increased and the Th2 response was reduced. In the late infection, a long-term treatment with TT–IL-12 was necessary. We demonstrate that TT–IL-12 increases resistance to infection and reduces lung tissue damage during early and late drug-sensitive and drug-resistant mycobacterial infection. PMID:18727633

  11. Effects of interleukin 12 on immune responses and host protection in mice infected with intestinal nematode parasites

    PubMed Central

    1994-01-01

    The cytokine interleukin (IL) 12 stimulates T cell and natural killer cell production of interferon (IFN) gamma and inhibits T cell production of IL-4. We investigated the effects of IL-12 on cytokine gene expression, immunoglobulin (Ig)E, mucosal mast cell, and eosinophil responses, and the course of infection in mice inoculated with the nematode parasite Nippostrongylus brasiliensis, as well as the IFN-gamma dependence of these effects. IL-12 stimulated IFN-gamma and IL-10 gene expression during primary and secondary N. brasiliensis infections and inhibited IL-3, IL-4, IL-5, and IL-9 gene expression during primary infections but had little inhibitory effect during secondary infections. IL-12 inhibited IgE, mucosal mast cell, and blood and tissue eosinophil responses during primary infections, but only eosinophil responses during secondary infections. IL-12 enhanced adult worm survival and egg production during primary, but not secondary infections. IL-12 needed to be administered by day 4 of a primary infection to inhibit IgE and mucosal mast cell responses, and by day 6 to strongly inhibit eosinophil responses and to enhance worm survival and fecundity. Anti-IFN-gamma mAb inhibited the effects of IL-12 on IgE secretion, intestinal mucosal mastocytosis, and parasite survival and fecundity, but did not affect IL-12 inhibition of eosinophilia. These observations indicate that IL-12, if administered during the initiation of eosinophilia. These observations indicate that IL-12, if administered during the initiation of an immune response, can change the response from one that is characterized by the production of T helper (Th)2-associated cytokines to one characterized by the production of Th-1 associated cytokines. However, IL-12 treatment has less of an effect once the production of Th2-associated cytokines has become established. In addition, our results provide evidence that Th2- associated responses protect against, and/or Th1-associated responses exacerbate, nematode infections. PMID:7909327

  12. Defining the functional binding sites of interleukin 12 receptor β1 and interleukin 23 receptor to Janus kinases

    PubMed Central

    Floss, Doreen M.; Klöcker, Tobias; Schröder, Jutta; Lamertz, Larissa; Mrotzek, Simone; Strobl, Birgit; Hermanns, Heike; Scheller, Jürgen

    2016-01-01

    The interleukin (IL)-12–type cytokines IL-12 and IL-23 are involved in T-helper (Th) 1 and Th17 immunity, respectively. They share the IL-12 receptor β1 (IL-12Rβ1) as one component of their receptor signaling complexes, with IL-12Rβ2 as second receptor for IL-12 and IL-23R for IL-23 signal transduction. Stimulation with IL-12 and IL-23 results in activation of receptor-associated Janus kinases (Jak) and phosphorylation of STAT proteins in target cells. The Janus kinase tyrosine kinase (Tyk) 2 associates with IL-12Rβ1, whereas Jak2 binds to IL-23R and also to IL-12Rβ2. Receptor association of Jak2 is mediated by Box1 and Box2 motifs located within the intracellular domain of the receptor chains. Here we define the Box1 and Box2 motifs in IL-12Rβ1 and an unusual Jak2-binding site in IL-23R by the use of deletion and site-directed mutagenesis. Our data show that nonfunctional box motifs abolish IL-12– and IL-23–induced STAT3 phosphorylation and cytokine-dependent proliferation of Ba/F3 cells. Coimmunoprecipitation of Tyk2 by IL-12Rβ1 and Jak2 by IL‑23R supported these findings. In addition, our data demonstrate that association of Jak2 with IL-23R is mandatory for IL-12 and/or IL-23 signaling, whereas Tyk2 seems to be dispensable. PMID:27193299

  13. Defining the functional binding sites of interleukin 12 receptor β1 and interleukin 23 receptor to Janus kinases.

    PubMed

    Floss, Doreen M; Klöcker, Tobias; Schröder, Jutta; Lamertz, Larissa; Mrotzek, Simone; Strobl, Birgit; Hermanns, Heike; Scheller, Jürgen

    2016-07-15

    The interleukin (IL)-12-type cytokines IL-12 and IL-23 are involved in T-helper (Th) 1 and Th17 immunity, respectively. They share the IL-12 receptor β1 (IL-12Rβ1) as one component of their receptor signaling complexes, with IL-12Rβ2 as second receptor for IL-12 and IL-23R for IL-23 signal transduction. Stimulation with IL-12 and IL-23 results in activation of receptor-associated Janus kinases (Jak) and phosphorylation of STAT proteins in target cells. The Janus kinase tyrosine kinase (Tyk) 2 associates with IL-12Rβ1, whereas Jak2 binds to IL-23R and also to IL-12Rβ2. Receptor association of Jak2 is mediated by Box1 and Box2 motifs located within the intracellular domain of the receptor chains. Here we define the Box1 and Box2 motifs in IL-12Rβ1 and an unusual Jak2-binding site in IL-23R by the use of deletion and site-directed mutagenesis. Our data show that nonfunctional box motifs abolish IL-12- and IL-23-induced STAT3 phosphorylation and cytokine-dependent proliferation of Ba/F3 cells. Coimmunoprecipitation of Tyk2 by IL-12Rβ1 and Jak2 by IL‑23R supported these findings. In addition, our data demonstrate that association of Jak2 with IL-23R is mandatory for IL-12 and/or IL-23 signaling, whereas Tyk2 seems to be dispensable. © 2016 Floss, Klöcker, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  14. Adjuvant activity of chicken interleukin-12 co-administered with infectious bursal disease virus recombinant VP2 antigen in chickens.

    PubMed

    Su, Bor Sheu; Chiu, Hua Hsien; Lin, Cheng Chung; Shien, Jui Hung; Yin, Hsien Sheng; Lee, Long Huw

    2011-02-15

    A recombinant fowlpox virus (rFPV/VP2) expressing infectious bursal diseases virus (IBDV) VP2 gene has been constructed. After purification and identification of rFPV/VP2, the adjuvant activity of the recombinant chicken IL-12 (rchIL-12), synthesized by our previous construct of rFPV/chIL-12, in rFPV/VP2-expressed rVP2 antigen was assessed in one-week-old specific-pathogen free chickens. The results indicated that rchIL-12 alone or rchIL-12 plus mineral oil (MO) co-administered with rVP2 antigen significantly enhanced the production of serum neutralization (SN) antibody against IBDV, compared to those with MO alone. The SN titers in groups receiving rVP2 antigen with MO alone were more inconsistent after vaccination. On the other hand, rchIL-12 significantly stimulated IFN-γ production in serum and in splenocyte cultured supernatant, suggesting that rchIL-12 alone or plus MO significantly induced a cell-mediated immune response. Finally, bursal lesion protection from very virulent IBDV (vvIBDV) challenge in chickens receiving rVP2 antigen with rchIL-12 alone or plus MO was much more effective than that with MO alone at two weeks after boosting. Taken together, rchIL-12 alone augmented in vivo the induction of a primary and also a secondary SN antibody production and a cell-mediated immunity against IBDV rVP2 antigen, which conferred the enhancement of bursal lesion protective efficacy from vvIBDV challenge. These data indicated that a potential for chIL-12 as immunoadjuvant for chicken vaccine development such as IBDV rVP2 antigen.

  15. Sirtuin 1 is a key regulator of the interleukin-12 p70/interleukin-23 balance in human dendritic cells.

    PubMed

    Alvarez, Yolanda; Rodríguez, Mario; Municio, Cristina; Hugo, Etzel; Alonso, Sara; Ibarrola, Nieves; Fernández, Nieves; Crespo, Mariano Sánchez

    2012-10-12

    Stimulation of human dendritic cells with the fungal surrogate zymosan produces IL-23 and a low amount of IL-12 p70. Trans-repression of il12a transcription, which encodes IL-12 p35 chain, by proteins of the Notch family and lysine deacetylation reactions have been reported as the underlying mechanisms, but a number of questions remain to be addressed. Zymosan produced the location of sirtuin 1 (SIRT1) to the nucleus, enhanced its association with the il12a promoter, increased the nuclear concentration of the SIRT1 co-substrate NAD(+), and decreased chromatin accessibility in the nucleosome-1 of il12a, which contains a κB-site. The involvement of deacetylation reactions in the inhibition of il12a transcription was supported by the absence of Ac-Lys-14-histone H3 in dendritic cells treated with zymosan upon coimmunoprecipitation of transducin-like enhancer of split. In contrast, we did not obtain evidence of a possible effect of SIRT1 through the deacetylation of c-Rel, the central element of the NF-κB family involved in il12a regulation. These data indicate that an enhancement of SIRT1 activity in response to phagocytic stimuli may reduce the accessibility of c-Rel to the il12a promoter and its transcriptional activation, thus regulating the IL-12 p70/IL-23 balance and modulating the ongoing immune response.

  16. Sirtuin 1 Is a Key Regulator of the Interleukin-12 p70/Interleukin-23 Balance in Human Dendritic Cells*

    PubMed Central

    Alvarez, Yolanda; Rodríguez, Mario; Municio, Cristina; Hugo, Etzel; Alonso, Sara; Ibarrola, Nieves; Fernández, Nieves; Crespo, Mariano Sánchez

    2012-01-01

    Stimulation of human dendritic cells with the fungal surrogate zymosan produces IL-23 and a low amount of IL-12 p70. Trans-repression of il12a transcription, which encodes IL-12 p35 chain, by proteins of the Notch family and lysine deacetylation reactions have been reported as the underlying mechanisms, but a number of questions remain to be addressed. Zymosan produced the location of sirtuin 1 (SIRT1) to the nucleus, enhanced its association with the il12a promoter, increased the nuclear concentration of the SIRT1 co-substrate NAD+, and decreased chromatin accessibility in the nucleosome-1 of il12a, which contains a κB-site. The involvement of deacetylation reactions in the inhibition of il12a transcription was supported by the absence of Ac-Lys-14-histone H3 in dendritic cells treated with zymosan upon coimmunoprecipitation of transducin-like enhancer of split. In contrast, we did not obtain evidence of a possible effect of SIRT1 through the deacetylation of c-Rel, the central element of the NF-κB family involved in il12a regulation. These data indicate that an enhancement of SIRT1 activity in response to phagocytic stimuli may reduce the accessibility of c-Rel to the il12a promoter and its transcriptional activation, thus regulating the IL-12 p70/IL-23 balance and modulating the ongoing immune response. PMID:22893703

  17. Combined Allogeneic Tumor Cell Vaccination and Systemic Interleukin 12 Prevents Mammary Carcinogenesis in HER-2/neu Transgenic Mice

    PubMed Central

    Nanni, Patrizia; Nicoletti, Giordano; De Giovanni, Carla; Landuzzi, Lorena; Di Carlo, Emma; Cavallo, Federica; Pupa, Serenella M.; Rossi, Ilaria; Colombo, Mario P.; Ricci, Cinzia; Astolfi, Annalisa; Musiani, Piero; Forni, Guido; Lollini, Pier-Luigi

    2001-01-01

    Transgenic Balb/c mice expressing the transforming rat HER-2/neu oncogene develop early and multifocal mammary carcinomas. Within the first 5 months of life the tissue-specific expression of HER-2/neu causes a progression in all their 10 mammary glands from atypical hyperplasia to invasive carcinoma. It was previously observed that chronic administration of interleukin (IL)-12 increased tumor latency, but every mouse eventually succumbed to multiple carcinomas. A significant improvement in tumor prevention was sought by administering allogeneic mammary carcinoma cells expressing HER-2/neu combined with systemic IL-12. This treatment reduced tumor incidence by 90% and more than doubled mouse lifetime. For the maximum prevention p185neu antigen must be expressed by allogeneic cells. IL-12 treatment strongly increased the cell vaccine efficacy. The mammary glands of mice receiving the combined treatment displayed a markedly reduced epithelial cell proliferation, angiogenesis, and HER-2/neu expression, while the few hyperplastic foci were heavily infiltrated by granulocytes, macrophages, and CD8+ lymphocytes. Specific anti–HER-2/neu antibodies were produced and a nonpolarized activation of CD4+ and CD8+ cells secreting IL-4 and interferon (IFN)-γ were evident. A central role for IFN-γ in the preventive effect was proven by the lack of efficacy of vaccination in IFN-γ gene knockout HER-2/neu transgenic Balb/c mice. A possible requirement for IFN-γ is related to its effect on antibody production, in particular on IgG2a and IgG2b subclasses, that were not induced in IFN-γ knockout HER-2/neu mice. In conclusion, our data show that an allogeneic HER-2/neu–expressing cell vaccine combined with IL-12 systemic treatment can prevent the onset of genetically determined tumors. PMID:11696586

  18. Sequential immunogene therapy with interleukin-12- and interleukin-15-engineered neuroblastoma cells cures metastatic disease in syngeneic mice.

    PubMed

    Croce, Michela; Meazza, Raffaella; Orengo, Anna Maria; Radić, Luana; De Giovanni, Barbara; Gambini, Claudio; Carlini, Barbara; Pistoia, Vito; Mortara, Lorenzo; Accolla, Roberto S; Corrias, Maria Valeria; Ferrini, Silvano

    2005-01-15

    To investigate the potential synergistic effects of Neuro2a neuroblastoma cells engineered with IL-12 and/or IL-15 genes in improving survival of syngeneic mice bearing neuroblastoma metastatic disease. Neuro2a cells engineered with interleukin (IL)-12 (Neuro2a/IL-12), IL-15 (Neuro2a/IL-15), or both cytokines (Neuro2a/IL-12/IL-15) were injected s.c. in syngeneic A/J mice challenged i.v. with Neuro2a parental cells (Neuro2apc) using different schedules of administration in either preventive or therapeutic settings. A single injection of Neuro2a/IL-12 or Neuro2a/IL-15 cells induced resistance to a subsequent i.v. Neuro2apc challenge in 45% and 28% of mice, respectively. Neuro2a/IL-12/IL-15 cells protected 28% of mice, showing no synergistic effect. However, sequential vaccination with Neuro2a/IL-12 (day -30) followed by Neuro2a/IL-15 (day -15) protected 71% of mice from subsequent challenge with Neuro2apc. A single dose of Neuro2a/IL-12 prolonged the mean survival time of mice bearing established metastatic neuroblastoma from 21 +/- 3 to 46 +/- 27 days but failed to cure mice, whereas Neuro2a/IL-15 or Neuro2a/IL-12/IL-15 were ineffective. However, sequential vaccination with Neuro2a/IL-12 (day +3) followed by Neuro2a/IL-15 (day +13) cured 43% of mice as assessed by histologic analysis of different organs from long-term surviving mice. CTL activity against Neuro2apc cells was observed in splenocytes from treated mice, and CD8(+) T-cell depletion abrogated the therapeutic effect of vaccination. Sequential vaccination with IL-12- and IL-15-engineered neuroblastoma cells induced optimal preventive and therapeutic effects, which may be related to the Th1 priming effect of IL-12 followed by the enhancement of CD8(+) T-cell responses and their maintenance mediated by IL-15.

  19. Clinical improvement in feline herpesvirus 1 infected cats by oral low dose of interleukin-12 plus interferon-gamma.

    PubMed

    Fiorito, Filomena; Cantiello, Antonietta; Granato, Giovanna Elvira; Navas, Luigi; Diffidenti, Carmine; De Martino, Luisa; Maharajan, Veeramani; Olivieri, Fabio; Pagnini, Ugo; Iovane, Giuseppe

    2016-10-01

    Feline herpesvirus 1 (FHV-1) is a widespread cat pathogen inducing rhinitis, conjunctivitis and corneal ulcers. To alleviate acute FHV-1-induced disease, antiviral agents are used often with antibiotics. But sometimes, these treatments, as well as conventional doses of cytokines have moderate efficacy and/or collateral effects. Herein we have investigated the effects of low dose interleukin (IL)-12 plus interferon (IFN)-gamma, prepared by Sequential Kinetic Activated (SKA), on the treatment of FHV-1 infection. Twenty-five, unvaccinated FHV-1-positive cats were recruited into a prospective, randomized, placebo-controlled, double-blinded clinical trial. Fifteen cats were treated for 6 months with oral low doses of SKA IL-12 plus IFN-gamma and 10 cats were treated with placebo. At 1, 6 and 12 months (follow-up) after the beginning of treatment, clinical assessment, PCR assay and blood count were carried out. At follow-up, in treated group, we observed significant (p<0.05) improvements in clinical signs and PCR became negative in 12/15 cats (80%). In placebo, 10/10 cats were PCR-positive, with improvements (30%) or worsening (70%) in clinical signs. Blood values were normal in both groups. Our results show that the low dose therapy, based on activated solutions of IL-12 plus IFN-gamma, represents a novel approach to treat FHV-1 infection in cats.

  20. Induction of interleukin-8 and interleukin-12 in neonatal ovine lung following experimental inoculation of bovine respiratory syncytial virus.

    PubMed

    Redondo, E; Gázquez, A; Vadillo, S; García, A; Franco, A; Masot, A J

    2014-05-01

    This study aimed to determine the immunohistochemical expression of interleukin (IL)-1β, tumour necrosis factor alpha (TNF)-α, interferon (IFN)-γ, IL-4, IL-6, IL-8, IL-10 and IL-12 and to measure the concentrations of these cytokines in lung tissue from lambs infected experimentally with bovine respiratory syncytial virus (BRSV). Lambs (n = 15) were inoculated at 2 days of age with 20 ml of viral inoculum (1.26 × 10(6) TCID50 per ml) or sterile medium (n = 15). Rectal temperature, pulse and respiratory rates were monitored daily in control and infected lambs. Lambs were killed and subject to necropsy examination at 1, 3, 5, 7 and 15 days post inoculation (dpi). There was a temporal association between pulmonary expression of these cytokines and lung pathology in BRSV-infected lambs. The cytokines IL-4 and IL-10 were not elevated, but there was a significant increase in IL-1β, TNF-α, IFN-γ and IL-6 proteins and labelled cells, suggesting that these cytokines may play a role in the biological response to BRSV infection and contribute to the development of lung lesions. There was also a significant increase in the cytokine concentration and number of immunolabelled cells expressing IL-8 and IL-12 in infected lungs, suggesting that these cytokines might be used as therapeutic targets in the management of BRSV, in conjunction with measures to combat the causative pathogen and prophylactic methods aimed at preventing infection.

  1. Human dendritic cells induce the differentiation of interleukin-21-producing T follicular helper-like cells through interleukin-12.

    PubMed

    Schmitt, Nathalie; Morita, Rimpei; Bourdery, Laure; Bentebibel, Salah Eddine; Zurawski, Sandra M; Banchereau, Jacques; Ueno, Hideki

    2009-07-17

    T follicular helper (Tfh) cells help development of antibody responses via interleukin-21 (IL-21). Here we show that activated human dendritic cells (DCs) induced naive CD4(+) T cells to become IL-21-producing Tfh-like cells through IL-12. CD4(+) T cells primed with IL-12 induced B cells to produce immunoglobulins in a fashion dependent on IL-21 and inducible costimulator (ICOS), thus sharing fundamental characteristics with Tfh cells. The induction of Tfh-like cells by activated DCs was inhibited by neutralizing IL-12. IL-12 induced two different IL-21-producers: IL-21(+)IFN-gamma(+)T-bet(+) Th1 cells and IL-21(+)IFN-gamma(-)T-bet(-) non-Th1 cells, in a manner dependent on signal transducer and activator of transcription 4 (STAT4). IL-12 also regulated IL-21 secretion by memory CD4(+) T cells. Thus, IL-12 produced by activated DCs regulates antibody responses via developing IL-21-producing Tfh-like cells and inducing IL-21 secretion from memory CD4(+) T cells. These data suggest that the developmental pathway of Tfh cells differs between mice and humans, which have considerable implications for vaccine development.

  2. Therapeutic Efficacy of Interleukin 12/Interleukin 23 Blockade in Generalized Pustular Psoriasis Regardless of IL36RN Mutation Status.

    PubMed

    Arakawa, Akiko; Ruzicka, Thomas; Prinz, Jörg C

    2016-07-01

    Generalized pustular psoriasis von Zumbusch type (GPP) is the most severe manifestation of psoriasis. The etiology of GPP is only partially understood, and GPP lacks approved treatments. Loss-of-function mutations in the interleukin 36 (IL-36) receptor antagonist (IL36RN), an inhibitor of innate immune activation in the skin, and therapeutic efficacy of IL-1 blockade in a subset of patients with GPP are viewed as evidence for an autoinflammatory pathogenesis. A pathogenic role of T cells has not been considered. To test whether ustekinumab, a monoclonal antibody blocking IL-12 and IL-23, is an effective treatment modality for patients in whom GPP treatment with conventional psoriasis drugs or antagonists of tumor necrosis factor (TNF) has not been sufficiently effective, is contraindicated, or has lost efficacy. We treated a series of 4 patients with GPP with ustekinumab, which was applied on an outpatient basis according to the dosing regimen approved for psoriasis vulgaris. In 3 patients it was combined with low doses of the retinoid acitretin. IL36RN mutations were determined in all 4 patients by means of targeted sequencing of genomic DNA. The response to therapy was assessed by clinical examination. The 4 patients were female. Sequencing of IL36RN identified a homozygous mutation in case 1 (Pro76Leu). The other 3 patients carried no rare IL36RN variants. Overall GPP duration ranged from 50 to 146 months. Ustekinumab treatment is currently ongoing in all 4 patients without loss of efficacy, currently reaching treatment durations of 17 (case 1) to 44 months (case 3). Ustekinumab treatment induced sustained remissions in all 4 GPP patients. This response was independent of IL36RN mutations and consolidated by combination with low doses of the retinoid acitretin. Ustekinumab-induced remissions suggest that T cells play a crucial role in GPP pathogenesis based on the documented role that IL-12 and IL-23 play in autoimmune diseases through differentiating helper T cell 1 (TH1) and maintaining TH17 responses. Acitretin treatment may support ustekinumab efficacy, possibly by suppressing TH17 responses through the retinoid-related orphan receptors, RORγt and RORα. Combining IL-12/IL-23 blockade and acitretin may constitute an efficient treatment modality interfering with GPP pathomechanisms.

  3. Interleukin-27 and interleukin-12 augment activation of distinct cord blood natural killer cells responses via STAT3 pathways.

    PubMed

    Chen, Juei-Chang; Huang, Ai-Ju; Chen, Shih-Chang; Wu, Jia-Long; Wu, Wen-Mein; Chiang, Han-Sun; Chan, Chia-Hao; Lin, Chih-Ming; Huang, Yu-Tzu

    2012-05-01

    Umbilical cord blood is rich in primitive natural killer (NK) cells, which are activated by interleukin (IL)-12. It was previously reported that a novel IL-12 family cytokine, IL-27 comprised of EBI3 and p28, was elevated in maternal serum during normal pregnancy. Thus, we compared the immune regulatory functions of IL-27 and IL-12 on mononuclear cells derived from cord blood and adult peripheral blood. After stimulation with IL-27, IL-12, and IL-27 combined with IL-12, the cytotoxicity against BJAB lymphoma cells by blood mononuclear cells was performed. Then immunofluorescence staining, reverse transcriptase-polymerase chain reaction and Western blotting were used to detect the effects of IL-27 and IL-12 in isolated NK cells. IL-27, IL-12, and IL-27 combined with IL-12 enhanced the cytotoxicity of adult peripheral blood cells and cord blood cells, but the proliferation of distinct subpopulations of cells was not evident. Similar results were also obtained with purified cord blood NK cells. Interestingly, distinct from IL-12, IL-27 could induce aggregation and morphological changes of umbilical cord blood cells. Finally, IL-27 combined with IL-12 could stimulate increased IL-27 receptor (gp130 and WSX-1) transcripts in purified cord blood NK cells. However, the activation of signal transducer and activator of transcription 3 (STAT3) in NK cells was only detected in the presence of IL-27, but not IL-12 alone. From previous results, we summarize our current understanding of the augmentation of distinct regulation of NK cells by IL-27 and IL-12. Copyright © 2012. Published by Elsevier B.V.

  4. [Expression of interleukin-12 and interleukin-27 proteins and immune status in serum of patients with oral lichen planus].

    PubMed

    Huang, Yunying; Zhou, Sn; Cai, Yang

    2016-04-01

    This study aimed to conduct a preliminary study on the possible role and significance of interleukin (IL)-12 and IL-27 in the pathogeneses of oral lichen planus (OLP). Thirty cases of patients with OLP (fifteen cases of reticular OLP and fifteen cases of erosive OLP) were enrolled in this study, and twenty cases of healthy people served as controls. Lymphocyte subsets CD3+, CD4+, CD8+, CD19+, and CD16+56 [natural killer cell (NK)] were tested using flow cytometry, and humoral immunity [immunoglobulin (Ig)G, IgA, IgM, C3, C4] were examined using nephelometry assays. IL-12 and IL-27 contents in serum of patients with OLP and normal controls were detected through enzyme linked immunosorbent assay. The correlations between the levels of IL-12, IL-27, immune status, and clinical characteristics of patients with OLP were analyzed, respectively. CD3+, CD4+, and CD8+in patients with OLP were markedly lower than the normal value, whereas CD 19+ of OLP in patients was significantly higher than the normal value (P<0.05). IgM inpatients with OLP was increased, whereas C4 was declined (P<0.05). IL-12 and IL-27 levels showed significant upregulation or ULF patients compared with control groups (P<0.05). Meanwhile, positive correlations existed between IL-12 andIL-27 levels in the serum of patients with OLP (r=0.912, P<0.01). No significant correlations of IL-12 and IL-27 epressions with clinical characteristics of OLP were found (P>0.05). Negative correlations of IL-12 and IL-27 levels with CD16+56(NK) cells were observed (r1 = -0.416, P1 = 0.022; r2 = -0.392, P2=0.032, respectively), whereas a positive correlation existed for IgG (r1=0.445, P1=0.014; n=0.549, P2=0.002, respectively). A cellular immune dysfunction mainly dominate in patients with OLP, accompanied by some degree of humoral-immunity-function disorder. The abnormally high expressions of IL-12 and IL-27 are possibly synergized and promoted inflammation development in OLP. Its promotion takes place through the negatie feedback regulation of humoral immune responses, which are involved in the regulation of immune mechanisms of OLP.

  5. Interleukin-12 and Trastuzumab in Treating Patients With Cancer That Has High Levels of HER2/Neu

    ClinicalTrials.gov

    2013-02-27

    Advanced Adult Primary Liver Cancer; Anaplastic Thyroid Cancer; Bone Metastases; Carcinoma of the Appendix; Distal Urethral Cancer; Fallopian Tube Cancer; Gastrinoma; Glucagonoma; Inflammatory Breast Cancer; Insulinoma; Liver Metastases; Localized Unresectable Adult Primary Liver Cancer; Lung Metastases; Male Breast Cancer; Malignant Pericardial Effusion; Malignant Pleural Effusion; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Parathyroid Cancer; Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Newly Diagnosed Carcinoma of Unknown Primary; Occult Non-small Cell Lung Cancer; Pancreatic Polypeptide Tumor; Primary Peritoneal Cavity Cancer; Proximal Urethral Cancer; Pulmonary Carcinoid Tumor; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Adrenocortical Carcinoma; Recurrent Adult Primary Liver Cancer; Recurrent Anal Cancer; Recurrent Bladder Cancer; Recurrent Breast Cancer; Recurrent Carcinoma of Unknown Primary; Recurrent Cervical Cancer; Recurrent Colon Cancer; Recurrent Endometrial Carcinoma; Recurrent Esophageal Cancer; Recurrent Extrahepatic Bile Duct Cancer; Recurrent Gallbladder Cancer; Recurrent Gastric Cancer; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Malignant Testicular Germ Cell Tumor; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Pancreatic Cancer; Recurrent Parathyroid Cancer; Recurrent Prostate Cancer; Recurrent Rectal Cancer; Recurrent Renal Cell Cancer; Recurrent Salivary Gland Cancer; Recurrent Small Intestine Cancer; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Thyroid Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Recurrent Vaginal Cancer; Recurrent Vulvar Cancer; Skin Metastases; Small Intestine Adenocarcinoma; Somatostatinoma; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Adrenocortical Carcinoma; Stage III Bladder Cancer; Stage III Cervical Cancer; Stage III Colon Cancer; Stage III Endometrial Carcinoma; Stage III Esophageal Cancer; Stage III Follicular Thyroid Cancer; Stage III Gastric Cancer; Stage III Malignant Testicular Germ Cell Tumor; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Ovarian Epithelial Cancer; Stage III Pancreatic Cancer; Stage III Papillary Thyroid Cancer; Stage III Prostate Cancer; Stage III Rectal Cancer; Stage III Renal Cell Cancer; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Vaginal Cancer; Stage III Vulvar Cancer; Stage IIIA Anal Cancer; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Anal Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Adenoid Cystic Carcinoma of the Oral Cavity; Stage IV Adrenocortical Carcinoma; Stage IV Anal Cancer; Stage IV Bladder Cancer; Stage IV Breast Cancer; Stage IV Colon Cancer; Stage IV Endometrial Carcinoma; Stage IV Esophageal Cancer; Stage IV Follicular Thyroid Cancer; Stage IV Gastric Cancer; Stage IV Mucoepidermoid Carcinoma of the Oral Cavity; Stage IV Non-small Cell Lung Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Pancreatic Cancer; Stage IV Papillary Thyroid Cancer; Stage IV Prostate Cancer; Stage IV Rectal Cancer; Stage IV Renal Cell Cancer; Stage IV Salivary Gland Cancer; Stage IV Squamous Cell Carcinoma of the Larynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Oropharynx; Stage IVA Cervical Cancer; Stage IVA Vaginal Cancer; Stage IVB Cervical Cancer; Stage IVB Vaginal Cancer; Stage IVB Vulvar Cancer; Thyroid Gland Medullary Carcinoma; Unresectable Extrahepatic Bile Duct Cancer; Unresectable Gallbladder Cancer; Urethral Cancer Associated With Invasive Bladder Cancer; WDHA Syndrome

  6. Transgenic tomato expressing interleukin-12 has a therapeutic effect in a murine model of progressive pulmonary tuberculosis.

    PubMed

    Elías-López, A L; Marquina, B; Gutiérrez-Ortega, A; Aguilar, D; Gomez-Lim, M; Hernández-Pando, R

    2008-10-01

    Host control of mycobacterial infection, in both human and mouse models, has been shown to be associated with the production of interferon (IFN)-gamma by CD4(+) T cells. Interleukin (IL)-12 is known to be a crucial cytokine in the differentiation of IFN-gamma-producing T helper 1 (Th1) cells. To determine whether continuous administration of IL-12 expressed in transgenic tomato (TT-IL-12) has therapeutic efficacy in a murine model of pulmonary tuberculosis, BALB/c mice were infected with either Mycobacterium tuberculosis H37Rv strain or a multi-drug-resistant clinical isolate (MDR) and treated with a daily oral dose of TT-IL12 crude fruit extracts. For the early H37Rv infection, TT-IL-12 administration was started 1 day before infection and continued for 60 days. In the H37Rv or MDR late infection, treatment was started 60 days after infection and continued for another 60 days. In both phases of infection, TT-IL-12 administration resulted in a reduction of bacterial loads and tissue damage compared with wild-type tomato (non-TT). The Th1 response was increased and the Th2 response was reduced. In the late infection, a long-term treatment with TT-IL-12 was necessary. We demonstrate that TT-IL-12 increases resistance to infection and reduces lung tissue damage during early and late drug-sensitive and drug-resistant mycobacterial infection.

  7. Effects of interleukin-12 in the long-term protection conferred by a Mycobacterium avium subunit vaccine.

    PubMed

    Silva, R A; Pais, T F; Appelberg, R

    2000-12-01

    The effects of the addition of recombinant interleukin (IL)-12 to a mycobacterial subunit vaccine were analyzed in terms of the longevity of the protective immunity generated. BALB/c mice were immunized with culture filtrate proteins from Mycobacterium avium with dimethyl-dioctadecilammonium bromide (DDA) as an adjuvant. This subunit vaccine induced protection against a challenge by M. avium which lasted for at least 6 months while waning with time until 1 year postvaccination. Whereas the addition of IL-12 enhanced the initial protective efficacy of this subunit vaccine during the first 6 months, it accelerated the loss of protective efficacy observed at 1 year postvaccination. These data confirm the adjuvant properties of IL-12 in vaccines against mycobacteria and raise the possibility of late counter-protective untoward effects.

  8. Efficacy and safety of the anti-IL-12/23 p40 monoclonal antibody, ustekinumab, in patients with active psoriatic arthritis despite conventional non-biological and biological anti-tumour necrosis factor therapy: 6-month and 1-year results of the phase 3, multicentre, double-blind, placebo-controlled, randomised PSUMMIT 2 trial.

    PubMed

    Ritchlin, Christopher; Rahman, Proton; Kavanaugh, Arthur; McInnes, Iain B; Puig, Lluis; Li, Shu; Wang, Yuhua; Shen, Yaung-Kaung; Doyle, Mittie K; Mendelsohn, Alan M; Gottlieb, Alice B

    2014-06-01

    Assess ustekinumab efficacy (week 24/week 52) and safety (week 16/week 24/week 60) in patients with active psoriatic arthritis (PsA) despite treatment with conventional and/or biological anti-tumour necrosis factor (TNF) agents. In this phase 3, multicentre, placebo-controlled trial, 312 adults with active PsA were randomised (stratified by site, weight (≤100 kg/>100 kg), methotrexate use) to ustekinumab 45 mg or 90 mg at week 0, week 4, q12 weeks or placebo at week 0, week 4, week 16 and crossover to ustekinumab 45 mg at week 24, week 28 and week 40. At week 16, patients with <5% improvement in tender/swollen joint counts entered blinded early escape (placebo→45 mg, 45 mg→90 mg, 90 mg→90 mg). The primary endpoint was ≥20% improvement in American College of Rheumatology (ACR20) criteria at week 24. Secondary endpoints included week 24 Health Assessment Questionnaire-Disability Index (HAQ-DI) improvement, ACR50, ACR70 and ≥75% improvement in Psoriasis Area and Severity Index (PASI75). Efficacy was assessed in all patients, anti-TNF-naïve (n=132) patients and anti-TNF-experienced (n=180) patients. More ustekinumab-treated (43.8% combined) than placebo-treated (20.2%) patients achieved ACR20 at week 24 (p<0.001). Significant treatment differences were observed for week 24 HAQ-DI improvement (p<0.001), ACR50 (p≤0.05) and PASI75 (p<0.001); all benefits were sustained through week 52. Among patients previously treated with ≥1 TNF inhibitor, sustained ustekinumab efficacy was also observed (week 24 combined vs placebo: ACR20 35.6% vs 14.5%, PASI75 47.1% vs 2.0%, median HAQ-DI change -0.13 vs 0.0; week 52 ustekinumab-treated: ACR20 38.9%, PASI75 43.4%, median HAQ-DI change -0.13). No unexpected adverse events were observed through week 60. The interleukin-12/23 inhibitor ustekinumab (45/90 mg q12 weeks) yielded significant and sustained improvements in PsA signs/symptoms in a diverse population of patients with active PsA, including anti-TNF-experienced Ps

  9. Non-heat pipe receiver/p-40 Stirling engine

    NASA Technical Reports Server (NTRS)

    Haglund, R. A.

    1981-01-01

    The technology for a full-up hybrid dish-Stirling Solar Thermal Power system is discussed. Overall solar-to-electric efficiency for the dish-Stirling system demonstration is approximately 30%. Hybrid operation is provided by fossil fuel combustion augmentation, which enables the Stirling engine to operate continuously at constant speed and power, regardless of insolation level, thus providing the capability to operate on cloudy days and at night.

  10. Cytokine mRNA expression in leprosy: a possible role for interferon-gamma and interleukin-12 in reactions (RR and ENL).

    PubMed

    Moraes, M O; Sarno, E N; Almeida, A S; Saraiva, B C; Nery, J A; Martins, R C; Sampaio, E P

    1999-11-01

    Leprosy patients during the natural course of the disease may develop reactional episodes, namely reversal reaction (RR) and erythema nodosum leprosum (ENL). Immunological events described as occurring during RR indicate up-regulation of the immune response, whereas in ENL the events are not fully understood. The aim of this study was to analyse the in vivo pattern of cytokine gene expression in the reactional states of leprosy. Peripheral blood mononuclear cells (PBMC, n = 14) and tissue samples (n = 17) obtained from patients with ENL and RR were obtained and assayed by RT-PCR. PBMC obtained from unreactional patients (n = 15) and normal individuals (n = 5) were also assessed. Expression of interferon (IFN)gamma, granulocyte-macrophage colony stimulating factor (GM-CSF), interleukin (IL)-2Rp55, perforin and IL-1beta mRNA in PBMC were detected mostly in ENL/RR patients, but not in unreactional patients. Likewise, cytokines such as IL-6, IL-8, tumour necrosis factor (TNF)alpha and TNFbeta were also present in reactional and tuberculoid patients as opposed to lepromatous leprosy (BL/LL). Interestingly, the majority of ENL/RR patients showed messages for IL-6, IL-10, IL-12 and TNFalpha in the skin. IFNgamma was detected in 84.6% (ENL) and 100% (RR) of the patients, whereas IL-4 was detected only in few individuals (38.5 and 25%, respectively). Although mRNA expression and protein levels may be different, the data reported in this study suggest a cytokine mRNA profile that seems to be indistinguishable for RR and ENL. In addition, it shows up-regulation of immuno-inflammatory cytokines in the blood and tissue of the same patient examined before and during reaction. Furthermore, it is suggested that this pattern of response results from an immunological reactivation that might lead to an acute inflammatory response in both reactional episodes.

  11. Interleukin 12 acts directly on CD4+ T cells to enhance priming for interferon gamma production and diminishes interleukin 4 inhibition of such priming.

    PubMed Central

    Seder, R A; Gazzinelli, R; Sher, A; Paul, W E

    1993-01-01

    Naive CD4+ T cells produce interleukin 2 (IL-2) but little IL-4 or interferon gamma (IFN-gamma). In vitro, they develop into IL-4 or IFN-gamma producers depending on the conditions of the priming culture. Using T-cell receptor transgenic CD4+ T cells, the role of IL-12 and IL-4 in antigen-specific priming was examined. IL-12 substantially enhanced the ability of naive CD4+ T cells to develop into cells that produced IFN-gamma upon restimulation. However, it was not essential since anti-IL-12 antibodies failed to block the priming for IFN-gamma observed in the absence of exogenous IL-12. When both IL-12 and IL-4 were present in the priming culture, IL-12 did not inhibit priming for IL-4 production. In contrast, IL-4 diminished but did not abolish priming for IFN-gamma production. In an accessory cell-independent priming system, IL-12 strikingly augmented priming for IFN-gamma production, indicating that it acts directly on T cells. IFN-gamma itself did not enhance priming for IFN-gamma production in either accessory cell-dependent or independent systems. In an accessory cell-dependent system, the IL-12-mediated enhancement was not blocked by adding neutralizing anti-IFN-gamma monoclonal antibody. However, in an accessory cell-independent system, anti-IFN-gamma antibody did inhibit priming for IFN-gamma production leaving open a role for IFN-gamma in the priming process. These data indicate that IL-12 has a major effect on the inductive phase of T-cell priming by enhancing commitment to IFN-gamma production and thus can profoundly influence the state of immunity that develops. Images Fig. 4 PMID:7901851

  12. The Wnt5a-Ror2 axis promotes the signaling circuit between interleukin-12 and interferon-γ in colitis

    PubMed Central

    Sato, Akira; Kayama, Hisako; Shojima, Kensaku; Matsumoto, Shinji; Koyama, Hirofumi; Minami, Yasuhiro; Nojima, Satoshi; Morii, Eiichi; Honda, Hiroaki; Takeda, Kiyoshi; Kikuchi, Akira

    2015-01-01

    Wnt5a, which regulates various cellular functions in Wnt signaling, is involved in inflammatory responses, however the mechanism is not well understood. We examined the role of Wnt5a signaling in intestinal immunity using conditional knockout mice for Wnt5a and its receptor Ror2. Removing Wnt5a or Ror2 in adult mice suppressed dextran sodium sulfate (DSS)-induced colitis. It also attenuated the DSS-dependent increase in inflammatory cytokine production and decreased interferon-γ (IFN-γ)-producing CD4+ Th1 cell numbers in the colon. Wnt5a was highly expressed in stromal fibroblasts in ulcerative lesions in the DSS-treated mice and inflammatory bowel disease patients. Dendritic cells (DCs) isolated from the colon of Wnt5a and Ror2 deficient mice reduced the ability to differentiate naïve CD4+ T cells to IFN-γ-producing CD4+ Th1 cells. In vitro experiments demonstrated that the Wnt5a-Ror2 signaling axis augmented the DCs priming effect of IFN-γ, leading to enhanced lipopolysaccharide (LPS)-induced interleukin (IL)-12 expression. Taken together, these results suggest that Wnt5a promotes IFN-γ signaling, leading to IL-12 expression in DCs, and thereby inducing Th1 differentiation in colitis. PMID:26030277

  13. The effect of interleukin-10 and of interleukin-12 on the in vitro production of anti-double-stranded DNA antibodies from patients with systemic lupus erythematosus

    PubMed Central

    Tyrrell-Price, J; Lydyard, P M; Isenberg, D A

    2001-01-01

    IL-10 and IL-12 are cytokines which are important in regulating immune responses. Plasma levels of IL-10 and autoantibodies against double-stranded DNA (dsDNA) often mirror disease activity in patients with SLE. IL-12 secretion from SLE patients' blood mononuclear cells also correlates with disease activity, but has an inverse relationship. The aim of this study was to measure the effect of IL-10 and of IL-12 on the production of IgG autoantibodies from patients with SLE, both cross-sectionally and longitudinally. Peripheral blood mononuclear cells (PBMC) were cultured with IL-10 (at 20 ng/ml or 2 ng/ml) or IL-12 (at 2 ng/ml or 0·2 ng/ml) or without cytokine and the supernatanants tested for the production of double-stranded DNA antibodies (dsDNA abs), single-stranded DNA antibodies (ssDNA abs) and total IgG antibodies (IgG abs) by ELISA. The BILAG disease activity index was recorded at each patient visit (a global score of six or more is regarded as active disease). In general, treatment with IL-10 caused PBMCs from patients with inactive disease to increase their antissDNA and dsDNA ab production (by upto 354% and 186%, respectively) while patients with active disease decreased their antibody production (by upto 91% and 97%, respectively). Overall there was a correlation between disease activity and change in antissDNA and dsDNA ab production (r = − 0·51; P = 0·03 and r = − 0·48; P = 0·042, respectively). Treatment with IL-12 at 0·2 ng/ml inhibited antissDNA and dsDNA antibody production, having the greatest effect on patients with active disease (decreasing antissDNA and dsDNA antibody production by upto 75% and 73%, respectively). This resulted in a significant correlation between disease activity and change in antissDNA antibody production (r = − 0·76; P = 0·03), but significance was not reached with antidsDNA antibody production (P = 0·06). Together these data suggest that the effect of these cytokines on antibody production by SLE PBMCs involves several factors; one of which is disease activity. PMID:11359450

  14. Immunological, anti-angiogenic and clinical effects of intratumoral interleukin 12 electrogene therapy combined with metronomic cyclophosphamide in dogs with spontaneous cancer: A pilot study.

    PubMed

    Cicchelero, Laetitia; Denies, Sofie; Vanderperren, Katrien; Stock, Emmelie; Van Brantegem, Leen; de Rooster, Hilde; Sanders, Niek N

    2017-08-01

    The immunological, anti-angiogenic and clinical effects of metronomic cyclophosphamide and 3 consecutive intratumoral interleukin (IL)-12 gene therapy (electrogene therapy (EGT)) treatments were evaluated in 6 dogs with spontaneous cancer. In all dogs, a decrease in peripheral leukocytes 2 days after IL-12 EGT coincided with erythema and swelling of the tumor. In the tumor, a transient increase in IL-12 levels was measured, whereas a continuous increase in interferon γ (IFNγ) and thrombospondin 1 (TSP-1) were determined in contrast to a continuous decrease in vascular endothelial growth factor (VEGF). In the serum, a transient increase in IL-12 and IL-10 levels were noted in contrast to a transient decrease in VEGF and TSP-1. The treatment resulted in a significant anti-angiogenic effect. Although all primary tumors continued to progress in time, this progression was slower than before treatment according to the contrast-enhanced ultrasound data. Besides the encouraging immunostimulatory and anti-angiogenic effects observed in all dogs we also noticed in 4 out of 6 dogs clinically relevant improvements in quality of life and weight. These results hold great promise for combinatorial strategies of IL-12 EGT and metronomic chemotherapy with conventional antitumor (immuno)therapies. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Rapid downregulation of innate immune cells, interleukin-12 and interleukin-23 in generalized pustular psoriasis with infliximab in combination with acitretin.

    PubMed

    Tang, M M; Spanou, Z; Tang, H; Schibler, F; Pelivani, N; Yawalkar, N

    2012-01-01

    Generalized pustular psoriasis (GPP) is a severe inflammatory disease characterized by recurrent eruptions of sterile pustules on erythematous skin. Although tumor necrosis factor (TNF) antagonists may lead to a rapid resolution of GPP, the mechanism of action of these agents remains to be investigated. Here, we sought to evaluate markers of immune response in the skin of a patient who experienced a rapid amelioration of GPP after treatment with infliximab and acitretin. A skin biopsy was obtained before and 72 h after initiation of treatment. Immunohistochemical stainings were performed to characterize alterations of the infiltrates, the apoptosis marker caspase 3 and key cytokines like TNFα, interleukin (IL)-12, IL-23 and the chemokine CXCL8/IL-8. Parallel with clinical improvement, a striking decline of neutrophils, myeloid and plasmacytoid dendritic cells, M1 macrophages and partly of CD4+ T cells was observed. There was no evidence of increased apoptosis mediated through the caspase-3 pathway. A marked reduction particularly of IL-12 and IL-23 and, to a lesser degree, of TNFα and CXCL8/IL-8 was observed. A swift clinical improvement of GPP by infliximab and acitretin is associated with a marked reduction particularly of innate and partially of the acquired immune cells as well as IL-12 and IL-23. Copyright © 2013 S. Karger AG, Basel.

  16. Association of the interleukin-12 polymorphic variants with the development of antibodies to surface antigen of hepatitis B virus in hemodialysis patients in response to vaccination or infection.

    PubMed

    Grzegorzewska, Alicja E; Wobszal, Piotr M; Sowińska, Anna; Mostowska, Adrianna; Jagodziński, Paweł P

    2013-12-01

    Cytokines, involved in the T-helper 1 system, play a role in the regulation of hepatitis B virus (HBV) clearance and the immune response to HBV antigens during natural infection or planned vaccination. Our aim was to examine whether the polymorphic variants of IL-12 are equally associated with development of antibodies to HBV surface antigen (anti-HBs) in hemodialysis (HD) patients in the case of HBV vaccination or HBV infection. The IL-12A rs568408 and IL-12B rs3212227 polymorphisms were analyzed in relation to anti-HBs development in 602 HD patients with negative antibodies to HBV core antigen (anti-HBc) who were hepatitis B vaccinated (group I) as well as in 237 anti-HBc positive HD patients who were infected with HBV in the past (group II). In group I, 199 patients did not develop an anti-HBs titre >10 IU/L (subgroup Ia), whereas in group II, 55 patients did not develop an anti-HBs titre >10 IU/L (subgroup IIa). Patients of groups I and II that developed an anti-HBs >10 IU/L were included into subgroups Ib and IIb, respectively. In hepatitis B vaccinated HD patients, development of a protective anti-HBs titre was positively associated with vintage of renal replacement therapy (RRT), chronic glomerulonephritis as a cause of RRT, and GA rs 568408 IL-12A (OR 1.6, 95 % CI 1.0-2.5, P = 0.035), but a frequency distribution of this genotype between responders and non-responders was not significant when the Bonferroni correction was applied. In HBV infected HD patients, anti-HBs development was positively associated with AC rs3212227 IL-12B (OR 8.0, 95 % CI 2.6-24.9, P < 0.001), whereas HBsAg positivity, AA rs3212227 IL-12B (OR 0.3, 95 % CI 0.1-0.7, P = 0.007), and CC rs3212227 IL-12B (OR 0.1, 95 % CI 0.03-0.6, P = 0.011) were negative predictors of positive anti-HBs phenotype. When the Bonferroni correction was applied, if appropriate, these associations remained significant. In HD patients, the studied IL-12 polymorphic variants seem to be associated with the anti-HBs phenotype (a) with borderline significance for IL-12A in hepatitis B vaccinated patients, and (b) significantly for IL-12B in patients who underwent natural HBV infection.

  17. Wrestlers’ immune cells produce higher interleukin-6 and lower interleukin-12 and interleukin-13 in response to in vitro mitogen activation

    PubMed Central

    Zamani, Alireza; Omidi, Mostafa; Hemmatfar, Ahmad; Salehi, Iraj; Bazmamoun, Hassan

    2014-01-01

    Objective(s): Although recent investigations have shown chronic inflammation and inflammation-associated diseases might be ameliorated by exercise; little is known about the relation between exercise training with anti/pro-inflammatory cytokines. Materials and Methods: This cross sectional study was conducted to compare interleukin-4 (IL-4), IL-6, IL-10, IL-12, IL-13, interferon gamma (IFN-γ ) levels in serum, and their in vitro production by whole blood (WB) cells and by peripheral blood mononuclear cells (PBMCs) in response to mitogens lipopolysaccharide and phytohemagglutinin. Twelve elite wrestlers with history of three times per week exercise training for about 9.5 years, and thirteen healthy silent controls were recruited. To analysis the cytokines by enzyme linked immunosorbent assay (ELISA), the blood samples were taken 24 hr after the last training session from the wrestlers. Results: Serum analysis for IL-4, IL-6, IL-10, IL-12, IL-13 and IFN-γ indicated no statistical difference between the two groups. Meanwhile, 48 hr in vitro activation of WB and PBMCs by the mitogens revealed that IL-6 production was elevated in both WB and PBMCs. Whereas, IL-12 and IL-13 were decreased in supernatant of PBMCs and WB cells cultures, respectively. Conclusion: It seems that wrestling cause immune system cells to produce anti-inflammatory myokine IL-6 and decrease production of pro-inflammatory cytokine IL-12 and IL-13. PMID:25691935

  18. Augmentation by interleukin-18 of MHC-nonrestricted killer activity of human peripheral blood mononuclear cells in response to interleukin-12.

    PubMed

    Singh, S M; Yanagawa, H; Hanibuchi, M; Miki, T; Okamura, H; Sone, S

    2000-01-01

    Interleukin (IL)-18 is a novel cytokine with pleiotropic functions. In the present study, we examined the induction of the killer activity of peripheral blood mononuclear cells (MNC) against lung cancer cell lines upon treatment with IL-18 in combination with IL-12. Cytotoxic activity was measured by standard (51)Cr release assay. IL-18 (100 ng/ml) was found to significantly augment IL-12-induced killer activity in a MHC-nonrestricted manner against allogeneic NK-resistant Daudi cells and lung cancer cell lines: SBC-3, RERF-LC-AI and A549. IL-18 could augment IL-12-induced killer activity both at the optimal as well as suboptimal doses of the latter. However, IL-18 was found to have little effect on the killer activity of MNC induced by optimal or suboptimal dose of IL-2 or IL-15. Treatment of MNC with IL-18 in combination with IL-12 for a period of more than 4 days was observed to optimally induce the killer activity. As for induction of IFN-gamma production by MNC, IL-18 augmented that induced by IL-2 and IL-15, as well as that induced by IL-12. These results show the potential of IL-18 in combination with IL-12 for clinical application in treatment of cancer.

  19. Effect of preoperative topical diclofenac on intraocular interleukin-12 concentration and macular edema after cataract surgery in patients with diabetic retinopathy: a randomized controlled trial

    PubMed Central

    Medić, Aleksej; Jukić, Tomislav; Matas, Anita; Vukojević, Katarina; Sapunar, Ada; Znaor, Ljubo

    2017-01-01

    Aim To determine if preoperative treatment with a topical non-steroidal anti-inflammatory drug (NSAID) lowers the concentration of intraocular interleukin (IL)-12 and the incidence of postoperative macular edema in patients with non-proliferative diabetic retinopathy undergoing cataract surgery. Methods A total of 55 patients were randomized to diclofenac (n = 27) or placebo (n = 28). Patients receiving diclofenac started preoperative treatment with 0.1% topical diclofenac four times a day 7 days before cataract surgery and the therapy was discontinued 30 days after surgery. Patients in the control group were administered placebo 7 days preoperatively and a standard postoperative therapy with 0.1% topical dexamethasone four times a day for 30 days after surgery. All patients received postoperative antibiotic prophylaxis with tobramycin eye drops four times daily for 30 days. Seven days before the cataract surgery, on the day of surgery, and 1, 7, 30, and 90 days after surgery, central foveal thickness (CFT) was measured with optical coherence tomography (OCT) and the aqueous humor was sampled at the beginning of cataract surgery for the analysis of IL-12 concentration. Due to loss to follow-up and insufficient aqueous humor samples, the data of 3 patients treated with diclofenac and 8 patients receiving placebo were not analyzed. Results The aqueous humor IL-12 concentration was significantly lower in the diclofenac group than in the placebo group (t=−2.85, P = 0.007). The diclofenac group had a significantly smaller increase in CFT after phacoemulsification (F = 13.57, p<0.001). Conclusion Patients preoperatively treated with diclofenac had significantly lower intraocular levels of IL-12 and a lower increase in CFT, which indicates that a combination of preoperative and postoperative treatment with a topical NSAID may lower the incidence of postoperative macular edema in patients with diabetic retinopathy. ClinicalTrials.gov trial registration number MZJ-2106 PMID:28252875

  20. Insufficient interleukin-12 signalling favours differentiation of human CD4+ and CD8+ T cells into GATA-3+ and GATA-3+ T-bet+ subsets in humanized mice

    PubMed Central

    Billerbeck, Eva; Labitt, Rachael N; Vega, Kevin; Frias-Staheli, Natalia; Dorner, Marcus; Xiao, Jing W; Rice, Charles M; Ploss, Alexander

    2014-01-01

    Differentiation of CD4+ T cells into type 1 or type 2 subsets is mediated by the expression of the opposing lineage defining transcription factors T-bet and GATA-3. However, the existence of GATA-3+ T-bet+ CD4+ T cells in mice suggests functional plasticity of these subsets. Little is known about type 1 and type 2 plasticity of human T-cell subsets in vivo. Here, we show that in the xenogeneic environment of humanized mice, which lacks a functional immune-regulatory network, human CD4+ and, notably, CD8+ T cells preferentially differentiate into interleukin (IL)-4+ GATA-3+ and IL-4+ interferon-γ+ GATA-3+ T-bet+ subsets. Treatment with recombinant human IL-12 or expansion of IL-12-producing human dendritic cells in vivo reverted this phenotype and led to the down-regulation of GATA-3 expression. These changes also correlated with improved antiviral immune responses in humanized mice. In conclusion, our study shows the capacity of human CD4+ and CD8+ T cells for stable co-expression of GATA-3 and T-bet in humanized mice and reveals a critical role for IL-12 in regulating this phenotype. PMID:24766459

  1. Interleukin 12 exerts a differential effect on the maturation of neonatal and adult human CD45R0- CD4 T cells.

    PubMed Central

    Shu, U; Demeure, C E; Byun, D G; Podlaski, F; Stern, A S; Delespesse, G

    1994-01-01

    It is now recognized that IL-12 plays a predominant role in protective immunity against intracellular pathogens by promoting the development of T helper type 1 (Th1) responses. We here report the unexpected observations that IL-12 exerts differential effects on the maturation of "native" human CD4 T cells isolated from umbilical cord blood or from the blood of healthy adults. After priming in the presence of IL-12, naive cells of adult donors, defined as CD45R0- CD4+ T cells, acquire a Th1 phenotype whereas neonatal cells develop into effector cells producing high levels of IL-4 in addition to IFN-gamma. This effect of IL-12 on neonatal T cells is direct inasmuch as it is observed on highly purified CD4 T cells, however, it is not inhibited by CD8 T cells and natural killer cells. Unstimulated neonatal T cells which have been preincubated with IL-12 before the priming behave like adult T cells and acquire a Th1 phenotype after stimulation in the presence of IL-12. Given that IL-4 is a potent antagonist of Th1 responses, the finding that IL-12 promotes the maturation of neonatal T cells into IL-4 producers may explain the increased susceptibility of neonates to intracellular pathogens and should be taken into account for the development of vaccines to be used in the perinatal period. Images PMID:7929809

  2. Dendritic Cell Activation and Cytokine Production Induced by Group B Neisseria meningitidis: Interleukin-12 Production Depends on Lipopolysaccharide Expression in Intact Bacteria

    PubMed Central

    Dixon, Garth L. J.; Newton, Phillippa J.; Chain, Benjamin M.; Katz, David; Andersen, Svein Rune; Wong, Simon; van der Ley, Peter; Klein, Nigel; Callard, Robin E.

    2001-01-01

    Interactions between dendritic cells (DCs) and microbial pathogens are fundamental to the generation of innate and adaptive immune responses. Upon stimulation with bacteria or bacterial components such as lipopolysaccharide (LPS), immature DCs undergo a maturation process that involves expression of costimulatory molecules, HLA molecules, and cytokines and chemokines, thus providing critical signals for lymphocyte development and differentiation. In this study, we investigated the response of in vitro-generated human DCs to a serogroup B strain of Neisseria meningitidis compared to an isogenic mutant lpxA strain totally deficient in LPS and purified LPS from the same strain. We show that the parent strain, lpxA mutant, and meningococcal LPS all induce DC maturation as measured by increased surface expression of costimulatory molecules and HLA class I and II molecules. Both the parent and lpxA strains induced production of tumor necrosis factor alpha (TNF-α), interleukin-1α (IL-1α), and IL-6 in DCs, although the parent was the more potent stimulus. In contrast, high-level IL-12 production was only seen with the parent strain. Compared to intact bacteria, purified LPS was a very poor inducer of IL-1α, IL-6, and TNF-α production and induced no detectable IL-12. Addition of exogenous LPS to the lpxA strain only partially restored cytokine production and did not restore IL-12 production. These data show that non-LPS components of N. meningitidis induce DC maturation, but that LPS in the context of the intact bacterium is required for high-level cytokine production, especially that of IL-12. These findings may be useful in assessing components of N. meningitidis as potential vaccine candidates. PMID:11401973

  3. Dendritic cell activation and cytokine production induced by group B Neisseria meningitidis: interleukin-12 production depends on lipopolysaccharide expression in intact bacteria.

    PubMed

    Dixon, G L; Newton, P J; Chain, B M; Katz, D; Andersen, S R; Wong, S; van der Ley, P; Klein, N; Callard, R E

    2001-07-01

    Interactions between dendritic cells (DCs) and microbial pathogens are fundamental to the generation of innate and adaptive immune responses. Upon stimulation with bacteria or bacterial components such as lipopolysaccharide (LPS), immature DCs undergo a maturation process that involves expression of costimulatory molecules, HLA molecules, and cytokines and chemokines, thus providing critical signals for lymphocyte development and differentiation. In this study, we investigated the response of in vitro-generated human DCs to a serogroup B strain of Neisseria meningitidis compared to an isogenic mutant lpxA strain totally deficient in LPS and purified LPS from the same strain. We show that the parent strain, lpxA mutant, and meningococcal LPS all induce DC maturation as measured by increased surface expression of costimulatory molecules and HLA class I and II molecules. Both the parent and lpxA strains induced production of tumor necrosis factor alpha (TNF-alpha), interleukin-1alpha (IL-1alpha), and IL-6 in DCs, although the parent was the more potent stimulus. In contrast, high-level IL-12 production was only seen with the parent strain. Compared to intact bacteria, purified LPS was a very poor inducer of IL-1alpha, IL-6, and TNF-alpha production and induced no detectable IL-12. Addition of exogenous LPS to the lpxA strain only partially restored cytokine production and did not restore IL-12 production. These data show that non-LPS components of N. meningitidis induce DC maturation, but that LPS in the context of the intact bacterium is required for high-level cytokine production, especially that of IL-12. These findings may be useful in assessing components of N. meningitidis as potential vaccine candidates.

  4. Differential effects of tumour necrosis factor-α and interleukin-12 on isopentenyl pyrophosphate-stimulated interferon-γ production by cord blood Vγ9 T cells

    PubMed Central

    Alberto, Eduardo Jose Campos; Shimojo, Naoki; Aoyagi, Masahiko; Kohno, Yoichi

    2009-01-01

    Lower numbers of Vγ9Vδ2 T cells in cord blood (CB) than in adult peripheral blood (PB), as well as their impaired ability to produce interferon-γ (IFN-γ) in response to stimulation, are associated with functional deficiency in the immune system in newborns. In this study, we stimulated CB Vγ9 T cells with their T-cell receptor-specific ligand, isopentenyl pyrophosphate (IPP), plus exogenous costimulatory cytokines such as interleukin-2 (IL-2), IL-12 and tumour necrosis factor-α (TNF-α), which are known to play important roles in the activation of PB γδ T cells. Our data show that CB Vγ9 T cells are able to produce IFN-γ at levels comparable to PB Vγ9 T cells by the addition of TNF-α in the presence of IPP and IL-2; however, under the same culture conditions, IL-12 does not efficiently activate CB Vγ9 T cells to produce IFN-γ. The frequency of TNF-α receptor II-positive Vγ9T cells and the expression levels of TNF-α receptor II are similar in CB and PB; in contrast, the frequency of IL-12 receptor βI (IL-12RβI)-positive Vγ9T cells and expression levels of IL-12RβI are significantly lower in CB than PB. TNF-α but not IL-12 increases the expression of IL-2Rβ on CB Vγ9 T cells. These results provide new insights into the role of TNF-α in the activation of CB Vγ9 T cells. PMID:19019091

  5. Early coupled up-regulation of interleukin-12 receptor beta-1 in CD8+ central memory and effector T cells for better clinical outcomes in liver transplant recipients.

    PubMed

    Uemoto, S; Ozawa, K; Kaido, T; Mori, A; Fujimoto, Y; Ogawa, K

    2015-08-01

    This study aimed to investigate the role of initial priming of interleukin (IL)-12 receptor beta-1 in CD8(+) central memory T cells (initial IL-12RTCM priming) and CCR7-negative subsets (CNS) in effector cell expansion and clinical outcome after living donor liver transplantation (LDLT). One hundred and six patients who underwent LDLT were classified into the following three groups according to hierarchical clustering of CD8(+) CD45 isoforms before LDLT: I, naive-dominant; II, effector memory-dominant; and III, effector-dominant. The pre-existing CD8(+) effector cells (TE ) and activated immune status increased progressively from group I to group II to group III. Groups I, II and III received tacrolimus (Tac)/glucocorticoid (GC) regimens. Eighteen group III recipients received Tac/mycophenolate mofetil (MMF) and were defined as group IV. Initial IL-12RTCM priming was slightly, moderately and markedly decreased in droups I, II, and III, respectively. Initial priming of IL-12Rβ1 in CNS was decreased markedly in the three groups with marked decreases of TE , perforin and interferon (IFN)-γ; all parameters were restored by up-regulation of IL-12Rβ1(+) TCM through the self-renewal of TCM . The lag time required until coupled up-regulation of IL-12Rβ1 of TCM and CNS to above baseline was 12, 20 and 32 days in groups I, II and III, respectively. Inferior clinical outcomes were associated with increasing lag time. In contrast, the initial priming of IL-12Rβ1 in TCM and CNS remained above baseline in group IV due to MMF-mediated increase of IL-12Rβ1. Early coupled up-regulation of TCM and CNS leads to efficient TE differentiation and optimal clinical outcomes.

  6. Therapeutic Administration of KM+ Lectin Protects Mice Against Paracoccidioides brasiliensis Infection via Interleukin-12 Production in a Toll-Like Receptor 2-Dependent Mechanism

    PubMed Central

    Coltri, Kely C.; Oliveira, Leandro L.; Pinzan, Camila F.; Vendruscolo, Patrícia E.; Martinez, Roberto; Goldman, Maria Helena; Panunto-Castelo, Ademilson; Roque-Barreira, Maria-Cristina

    2008-01-01

    KM+ is a mannose-binding lectin from Artocarpus integrifolia that induces interleukin (IL)-12 production by macrophages and protective T helper 1 immune response against Leishmania major infection. In this study, we performed experiments to evaluate the therapeutic activity of jackfruit KM+ (jfKM+) and its recombinant counterpart (rKM+) in experimental paracoccidioidomycosis. To this end, jfKM+ or rKM+ was administered to BALB/c mice 10 days after infection with Paracoccidiodes brasiliensis. Thirty days postinfection, lungs from the KM+-treated mice contained significantly fewer colony-forming units and little to no organized granulomas compared to the controls. In addition, lung homogenates from the KM+-treated mice presented higher levels of nitric oxide, IL-12, interferon-γ, and tumor necrosis factor-α, whereas higher levels of IL-4 and IL-10 were detected in the control group. With mice deficient in IL-12, Toll-like receptor (TLR) 2, TLR4, or TLR adaptor molecule MyD88, we demonstrated that KM+ led to protection against P. brasiliensis infection through IL-12 production, which was dependent on TLR2. These results demonstrated a beneficial effect of KM+ on the severity of P. brasiliensis infection and may expand its potential use as a novel immunotherapeutic molecule. PMID:18599609

  7. Effect of inhibition of interleukin-12/23 by ustekinumab on the expression of leptin and leptin receptor in human THP-1 macrophages.

    PubMed

    Voloshyna, I; Mounessa, J; Carsons, S E; Reiss, A B

    2016-04-01

    Leptin, an adipocyte-derived circulating cytokine that signals nutritional status, may play a role in the development of psoriasis and its associated systemic diseases. Patients with psoriasis have significantly decreased serum leptin levels compared with controls. To investigate the effect of two commonly used anti-psoriatic biologic drugs, adalimumab and ustekinumab, on leptin and leptin receptor expression in human macrophages. THP-1 differentiated macrophages were cultured under the following conditions: (i) untreated control, (ii) adalimumab 5 μg/mL, (iii) ustekinumab 1 μg/mL and (iv) ustekinumab 5 μg/mL. Expression of leptin and leptin receptors were measured using real-time quantitative PCR and immunoblotting techniques. The presence of either adalimumab or ustekinumab in growth medium significantly upregulated expression of leptin receptor in THP-1 human macrophages to 1.98 ± 0.47 and 2.09 ± 0.24, respectively (n = 3, P < 0.01) vs. 1.12 ± 0.19 for untreated control cells. However, only ustekinumab at a concentration of 5 μg/mL augmented expression of leptin to 1.99 ± 0.56 (n = 3, P < 0.01) vs. control untreated cells. Enhanced leptin and leptin receptor expression in macrophages exposed to therapeutic levels of ustekinumab suggest a novel immunomodulatory mechanism for this biologic drug. Further mechanistic studies may yield targeted treatment using the leptin pathway, which could reduce the common obesity-related complications of psoriasis while alleviating symptoms and improving prognosis. © 2015 British Association of Dermatologists.

  8. [Effect of interleukin 21 and/or interleukin 12 on the antitumor activity of peripheral blood mononuclear cells in patients with endometrial cancer].

    PubMed

    Tian, Yong-ju; Cui, Bao-xia; Ma, Dao-xin; Zhang, Yan; Hou, Fei; Zhang, Wen-jing

    2011-06-01

    To observe the role of interleukin (IL) 21 alone, IL12 alone, and IL21 plus IL12 for inducing the antitumor activity of peripheral blood mononuclear cells (PBMCs) in patients with endometrial cancer. PBMCs were isolated from peripheral blood in patients with endometrial cancer in vitro, and kept the culture with low-level IL2. IL2-stimulated PBMCs were cocultured under different conditions (with anti-IL21 antibody, IL21 alone, IL12 alone, or IL21 plus IL12) for 72 h. The cytotoxicity of PBMCs was then examined by lactate dehydrogenase(LDH) released assay. CD4(+) CD25(+) FOXP3(+) regulatory (Treg) cell and CD4(+) IL17A(+) T-helper (Th17) cell proportion were determined with flow cytometry. Cell proliferation and apoptosis were measured by cell counting kit-8(CCK-8)assay and flow cytometry, respectively. In comparison to control group, both IL21 and IL12 significantly enhanced the cytotoxicity of PBMCs. The IL21 plus IL12 group had superior effect to IL21 alone and IL12 alone. IL21 and IL12 significantly decreased the percentages of Treg cells and the rate of PBMCs apoptosis. IL21 or IL12 had no significant effect on the differentiation of Th17 cells and the proliferation of PBMCs. IL21 and IL12 can enhance the cytotoxicity of PBMCs in patients with endometrial cancer, which can be further strengthened with treatment of IL21 plus IL12. Such effects may be achieved by inhibiting the differentiation of Treg cells and the apoptosis of PBMCs, but not by the differentiation of Th17 cell.

  9. CXCL-10, interleukin-12 and interleukin-21 are not immunological predictors of HBeAg seroconversion in HIV-1-HBV coinfection following HBV-active antiretroviral therapy.

    PubMed

    Giarda, Paola; Avihingsanon, Anchalee; Sasadeusz, Joe; Audsley, Jennifer; Marks, Pip; Matthews, Gail; Ruxrungtham, Kiat; Lewin, Sharon R; Crane, Megan

    2014-01-01

    Interferon stimulated chemokine CXCL-10, interleukin (IL)-12 (p70) and IL-21 have been associated with HBsAg and HBeAg loss following treatment of HBV monoinfection. The aim of this study was to determine whether these factors were also associated with HBsAg and HBeAg loss in HIV-HBV-coinfected patients following HBV-active combination antiretroviral therapy (cART). HIV-HBV-coinfected patients with HBeAg seroconversion (n=12; seroconverters [SC]) were compared to patients who did not seroconvert (n=13; non-seroconverters [NSC]). CXCL-10, IL-12 and IL-21 (Luminex Bead Array, Life Technologies, Grand Island, NY, USA) were measured in plasma prior to initiation of HBV-active cART (baseline), at the time of seroconversion (T0) and at the closest time point before (T-1) and after (T+1) seroconversion. Levels of CXCL-10 declined significantly in all patients following HBV-active cART (P<0.05 for both SC and NSC; Kruskall-Wallis, Dunn's post-test). There was no difference between SC and NSC in the level of CXCL-10, IL-12 and IL-21 at any time point. We found no evidence that CXCL-10, IL-12 or IL-21 were associated with HBeAg seroconversion following HBV-active cART. Other immunological determinants should be explored in this setting.

  10. Effect of preoperative topical diclofenac on intraocular interleukin-12 concentration and macular edema after cataract surgery in patients with diabetic retinopathy: a randomized controlled trial.

    PubMed

    Medić, Aleksej; Jukić, Tomislav; Matas, Anita; Vukojević, Katarina; Sapunar, Ada; Znaor, Ljubo

    2017-02-28

    To determine if preoperative treatment with a topical non-steroidal anti-inflammatory drug (NSAID) lowers the concentration of intraocular interleukin (IL)-12 and the incidence of postoperative macular edema in patients with non-proliferative diabetic retinopathy undergoing cataract surgery. A total of 55 patients were randomized to diclofenac (n=27) or placebo (n=28). Patients receiving diclofenac started preoperative treatment with 0.1% topical diclofenac four times a day 7 days before cataract surgery and the therapy was discontinued 30 days after surgery. Patients in the control group were administered placebo 7 days preoperatively and a standard postoperative therapy with 0.1% topical dexamethasone four times a day for 30 days after surgery. All patients received postoperative antibiotic prophylaxis with tobramycin eye drops four times daily for 30 days. Seven days before the cataract surgery, on the day of surgery, and 1, 7, 30, and 90 days after surgery, central foveal thickness (CFT) was measured with optical coherence tomography (OCT) and the aqueous humor was sampled at the beginning of cataract surgery for the analysis of IL-12 concentration. Due to loss to follow-up and insufficient aqueous humor samples, the data of 3 patients treated with diclofenac and 8 patients receiving placebo were not analyzed. The aqueous humor IL-12 concentration was significantly lower in the diclofenac group than in the placebo group (t=-2.85, p=0.007). The diclofenac group had a significantly smaller increase in CFT after phacoemulsification (F=13.57, p<0.001). Patients preoperatively treated with diclofenac had significantly lower intraocular levels of IL-12 and a lower increase in CFT, which indicates that a combination of preoperative and postoperative treatment with a topical NSAID may lower the incidence of postoperative macular edema in patients with diabetic retinopathy.

  11. The X-ray Structure of a BAK Homodimer Reveals an Inhibitory Zinc Binding Site

    SciTech Connect

    Modoveanu,T.; Liu, Q.; Tocilj, A.; Watson, M.; Shore, G.; Gehring, K.

    2006-01-01

    BAK/BAX-mediated mitochondrial outer-membrane permeabilization (MOMP) drives cell death during development and tissue homeostasis from zebrafish to humans. In most cancers, this pathway is inhibited by BCL-2 family antiapoptotic members, which bind and block the action of proapoptotic BCL proteins. We report the 1.5 {angstrom} crystal structure of calpain-proteolysed BAK, cBAK, to reveal a zinc binding site that regulates its activity via homodimerization. cBAK contains an occluded BH3 peptide binding pocket that binds a BID BH3 peptide only weakly . Nonetheless, cBAK requires activation by truncated BID to induce cytochrome c release in mitochondria isolated from bak/bax double-knockout mouse embryonic fibroblasts. The BAK-mediated MOMP is inhibited by low micromolar zinc levels. This inhibition is alleviated by mutation of the zinc-coordination site in BAK. Our results link directly the antiapoptotic effects of zinc to BAK.

  12. Synthesis and Evaluation of Chloramphenicol Homodimers: Molecular Target, Antimicrobial Activity, and Toxicity against Human Cells

    PubMed Central

    Kostopoulou, Ourania N.; Magoulas, George E.; Papadopoulos, Georgios E.; Mouzaki, Athanasia; Dinos, George P.; Papaioannou, Dionissios; Kalpaxis, Dimitrios L.

    2015-01-01

    As fight against antibiotic resistance must be strengthened, improving old drugs that have fallen in reduced clinical use because of toxic side effects and/or frequently reported resistance, like chloramphenicol (CAM), is of special interest. Chloramphenicol (CAM), a prototypical wide-spectrum antibiotic has been shown to obstruct protein synthesis via binding to the bacterial ribosome. In this study we sought to identify features intensifying the bacteriostatic action of CAM. Accordingly, we synthesized a series of CAM-dimers with various linker lengths and functionalities and compared their efficiency in inhibiting peptide-bond formation in an Escherichia coli cell-free system. Several CAM-dimers exhibited higher activity, when compared to CAM. The most potent of them, compound 5, containing two CAM bases conjugated via a dicarboxyl aromatic linker of six successive carbon-bonds, was found to simultaneously bind both the ribosomal catalytic center and the exit-tunnel, thus revealing a second, kinetically cryptic binding site for CAM. Compared to CAM, compound 5 exhibited comparable antibacterial activity against MRSA or wild-type strains of Staphylococcus aureus, Enterococcus faecium and E. coli, but intriguingly superior activity against some CAM-resistant E. coli and Pseudomonas aeruginosa strains. Furthermore, it was almost twice as active in inhibiting the growth of T-leukemic cells, without affecting the viability of normal human lymphocytes. The observed effects were rationalized by footprinting tests, crosslinking analysis, and MD-simulations. PMID:26267355

  13. Activated d16HER2 homodimers and SRC kinase mediate optimal efficacy for trastuzumab.

    PubMed

    Castagnoli, Lorenzo; Iezzi, Manuela; Ghedini, Gaia C; Ciravolo, Valentina; Marzano, Giulia; Lamolinara, Alessia; Zappasodi, Roberta; Gasparini, Patrizia; Campiglio, Manuela; Amici, Augusto; Chiodoni, Claudia; Palladini, Arianna; Lollini, Pier Luigi; Triulzi, Tiziana; Menard, Sylvie; Nanni, Patrizia; Tagliabue, Elda; Pupa, Serenella M

    2014-11-01

    A splice isoform of the HER2 receptor that lacks exon 16 (d16HER2) is expressed in many HER2-positive breast tumors, where it has been linked with resistance to the HER2-targeting antibody trastuzumab, but the impact of d16HER2 on tumor pathobiology and therapeutic response remains uncertain. Here, we provide genetic evidence in transgenic mice that expression of d16HER2 is sufficient to accelerate mammary tumorigenesis and improve the response to trastuzumab. A comparative analysis of effector signaling pathways activated by d16HER2 and wild-type HER2 revealed that d16HER2 was optimally functional through a link to SRC activation (pSRC). Clinically, HER2-positive breast cancers from patients who received trastuzumab exhibited a positive correlation in d16HER2 and pSRC abundance, consistent with the mouse genetic results. Moreover, patients expressing high pSRC or an activated "d16HER2 metagene" were found to derive the greatest benefit from trastuzumab treatment. Overall, our results establish the d16HER2 signaling axis as a signature for decreased risk of relapse after trastuzumab treatment.

  14. Asymmetric configurations in a reengineered homodimer reveal multiple subunit communication pathways in protein allostery

    PubMed Central

    Lanfranco, Maria Fe; Gárate, Fernanda; Engdahl, Ashton J.; Maillard, Rodrigo A.

    2017-01-01

    Many allosteric proteins form homo-oligomeric complexes to regulate a biological function. In homo-oligomers, subunits establish communication pathways that are modulated by external stimuli like ligand binding. A challenge for dissecting the communication mechanisms in homo-oligomers is identifying intermediate liganded states, which are typically transiently populated. However, their identities provide the most mechanistic information on how ligand-induced signals propagate from bound to empty subunits. Here, we dissected the directionality and magnitude of subunit communication in a reengineered single-chain version of the homodimeric transcription factor cAMP receptor protein. By combining wild-type and mutant subunits in various asymmetric configurations, we revealed a linear relationship between the magnitude of cooperative effects and the number of mutant subunits. We found that a single mutation is sufficient to change the global allosteric behavior of the dimer even when one subunit was wild type. Dimers harboring two mutations with opposite cooperative effects had different allosteric properties depending on the arrangement of the mutations. When the two mutations were placed in the same subunit, the resulting cooperativity was neutral. In contrast, when placed in different subunits, the observed cooperativity was dominated by the mutation with strongest effects over cAMP affinity relative to wild type. These results highlight the distinct roles of intrasubunit interactions and intersubunit communication in allostery. Finally, dimers bound to either one or two cAMP molecules had similar DNA affinities, indicating that both asymmetric and symmetric liganded states activate DNA interactions. These studies have revealed the multiple communication pathways that homo-oligomers employ to transduce signals. PMID:28188293

  15. Enhanced immunomodulatory activity and stability in simulated digestive juices of Lactobacillus plantarum L-137 by heat treatment.

    PubMed

    Fujiki, Takashi; Hirose, Yoshitaka; Yamamoto, Yoshihiro; Murosaki, Shinji

    2012-01-01

    This study reports the effect of heat treating Lactobacillus plantarum L-137 on its in vitro cytokine-inducing activity, on the stability of this activity in simulated digestive juices, and on its in vivo immunomodulatory properties. L-137 cells were harvested at the stationary phase with or without the subsequent heat treatment and then lyophilized. Heat-killed L-137 cells stimulated mouse spleen cells to produce more interleukin-12p40 than unheated L-137. The interleukin-12p40-inducing activity of unheated L-137 was significantly lower when incubated with simulated intestinal juice, but the activity of heat-killed L-137 cells was maintained. Furthermore, heat-killed L-137 was more protective than unheated L-137 in a mouse model of dextran sulfate sodium-induced colitis. A heat treatment may therefore be effective for enhancing the immunomodulatory activity of L-137 cells.

  16. Neospora caninum surface antigen (p40) is a potential diagnostic marker for cattle neosporosis

    USDA-ARS?s Scientific Manuscript database

    Neospora caninum is an intracellular protozoan that infects domestic and wild canids as well as many warm-blooded animals as shown by the isolation of viable parasites. The effectiveness of diagnostic tests for detecting specific antibodies against N. caninum is hampered by potential cross-reaction ...

  17. Pre-treatment serum levels of interleukin-10, interleukin-12 and their ratio predict response to therapy and probability of event-free and overall survival in childhood soft tissue sarcomas, Hodgkin's lymphomas and acute lymphoblastic leukemias.

    PubMed

    Bien, Ewa; Balcerska, Anna; Adamkiewicz-Drozynska, Elzbieta; Rapala, Malgorzata; Krawczyk, Malgorzata; Stepinski, Jan

    2009-07-01

    Deregulated serum IL-10, IL-12 and their reciprocal balance have been stated in malignancies of adults. In children with cancer the issue has not been investigated so far. To determine the diagnostic and prognostic roles of pre-treatment serum levels of IL-10 (Th2 cytokine), IL-12 (Th1) and their ratios (measured by the IL-10 and IL-12p70 ELISA kits; Endogen) in 91 children with soft tissue sarcomas (STS), Hodgkin's lymphomas (HL) and acute lymphoblastic leukemias (ALL). Median IL-10 and IL-12 levels were significantly higher in cancer patients than in healthy controls. Increased IL-10 indicated presence of general symptoms in HL and high risk group in ALL. Elevated IL-10 and IL-10/IL-12 ratios and decreased IL-12 correlated with poor-risk histology in STS, poor response to therapy, relapse and death from cancer. Multivariate analysis identified IL-10/IL-12 ratio>0.14 and IL-12<40 pg/mL as significant predictors for shorter EFS and OS, respectively. Pre-treatment serum levels of IL-10, IL-12 and IL-10/IL-12 balance in children with STS, HL and ALL may be of value as additional prognostic tools to predict the response to therapy and probability of EFS and OS.

  18. Regulation of signal transducer and activator of transcription and suppressor of cytokine-signaling gene expression in the brain of mice with astrocyte-targeted production of interleukin-12 or experimental autoimmune encephalomyelitis.

    PubMed

    Maier, Joachim; Kincaid, Carrie; Pagenstecher, Axel; Campbell, Iain L

    2002-01-01

    Interleukin (IL)-12 and interferon (IFN)-gamma are implicated in the pathogenesis of immune disorders of the central nervous system (CNS). To define the basis for the actions of these cytokines in the CNS, we examined the temporal and spatial regulation of key signal transducers and activators of transcription (STATs) and suppressors of cytokine signaling (SOCS) in the brain of transgenic mice with astrocyte production of IL-12 or in mice with experimental autoimmune encephalomyelitis (EAE). In healthy mice, with the exception of STAT4 and STAT6, the expression of a number of STAT and SOCS genes was detectable. However, in symptomatic transgenic mice and in EAE significant up-regulation of STAT1, STAT2, STAT3, STAT4, IRF9, and SOCS1 and SOCS3 RNA transcripts was observed. Although the increased expression of STAT1 RNA was widely distributed and included neurons, astrocytes, and microglia, STAT4 and STAT3 and SOCS1 and SOCS3 RNA was primarily restricted to the infiltrating mononuclear cell population. The level and location of the STAT1, STAT3, and STAT4 proteins overlapped with their corresponding RNA and additionally showed nuclear localization indicative of activation of these molecules. Thus, in both the glial fibrillary acidic protein-IL-12 mice and in EAE the CNS expression of key STAT and SOCS genes that regulate IL-12 (STAT4) and IFN-gamma (STAT1, SOCS1, and SOCS3) receptor signaling is highly regulated and compartmentalized. We conclude the interaction between these positive and negative signaling circuits and their distinct cellular locations likely play a defining role in coordinating the actions of IL-12 and IFN-gamma during the pathogenesis of type 1 immune responses in the CNS.

  19. Regulation of Signal Transducer and Activator of Transcription and Suppressor of Cytokine-Signaling Gene Expression in the Brain of Mice with Astrocyte-Targeted Production of Interleukin-12 or Experimental Autoimmune Encephalomyelitis

    PubMed Central

    Maier, Joachim; Kincaid, Carrie; Pagenstecher, Axel; Campbell, Iain L.

    2002-01-01

    Interleukin (IL)-12 and interferon (IFN)-γ are implicated in the pathogenesis of immune disorders of the central nervous system (CNS). To define the basis for the actions of these cytokines in the CNS, we examined the temporal and spatial regulation of key signal transducers and activators of transcription (STATs) and suppressors of cytokine signaling (SOCS) in the brain of transgenic mice with astrocyte production of IL-12 or in mice with experimental autoimmune encephalomyelitis (EAE). In healthy mice, with the exception of STAT4 and STAT6, the expression of a number of STAT and SOCS genes was detectable. However, in symptomatic transgenic mice and in EAE significant up-regulation of STAT1, STAT2, STAT3, STAT4, IRF9, and SOCS1 and SOCS3 RNA transcripts was observed. Although the increased expression of STAT1 RNA was widely distributed and included neurons, astrocytes, and microglia, STAT4 and STAT3 and SOCS1 and SOCS3 RNA was primarily restricted to the infiltrating mononuclear cell population. The level and location of the STAT1, STAT3, and STAT4 proteins overlapped with their corresponding RNA and additionally showed nuclear localization indicative of activation of these molecules. Thus, in both the glial fibrillary acidic protein-IL-12 mice and in EAE the CNS expression of key STAT and SOCS genes that regulate IL-12 (STAT4) and IFN-γ (STAT1, SOCS1, and SOCS3) receptor signaling is highly regulated and compartmentalized. We conclude the interaction between these positive and negative signaling circuits and their distinct cellular locations likely play a defining role in coordinating the actions of IL-12 and IFN-γ during the pathogenesis of type 1 immune responses in the CNS. PMID:11786421

  20. Neonatal levels of adiponectin, interleukin-10 and interleukin-12 are associated with the risk of developing type 1 diabetes in childhood and adolescence: A nationwide Danish case-control study.

    PubMed

    Thorsen, Steffen U; Pipper, Christian B; Eising, Stefanie; Skogstrand, Kristin; Hougaard, David M; Svensson, Jannet; Pociot, Flemming

    2017-01-01

    An in-depth understanding of the early phase of type 1 diabetes (T1D) pathogenesis is important for targeting primary prevention. We examined if 14 preselected mediators of immune responses differed in neonates that later developed T1D compared to control neonates. The study is a case-control study with a 1:2 matching. The individuals were born between 1981 through 2002. Cases were validated using the National Patient Register and the Danish Childhood Diabetes Register. Interleukin(IL)-1β, IL-4, IL-6, IL-8, IL-10, IL-12p70, interferon gamma, tumor necrosis factor alpha, transforming growth factor beta 1 (active form), leptin, adiponectin, c-reactive protein, mannose-binding lectin and soluble triggering receptor expressed on myeloid cells-1 were measured by using a flowmetric Luminex xMAP® technology. We tested two models both including a number of possible confounders. In the first model (model 1) we also adjusted for HLA-DQB1 genotype. A total of 1930 groups of assay-matched cases and controls (4746 individuals) were included in the statistical analyses. Adiponectin was negatively associated with later risk of T1D in both models (relative change (RC), model 1: 0.95, P=0.046 and model 2: 0.95, P=0.006). IL-10 and IL-12 were both positively associated with T1D risk in the model 2 (RC, 1.19, P=0.006 and 1.07, P=0.02, respectively)-these results were borderline significant in model 1, but showed the same direction as the results from model 2. Our results indicate that specific immunological signatures are already present at time of birth in children developing T1D before the age of 18years. Copyright © 2016 Elsevier Inc. All rights reserved.

  1. Adoptive transfer of experimental allergic encephalomyelitis after in vitro treatment with recombinant murine interleukin-12. Preferential expansion of interferon-gamma-producing cells and increased expression of macrophage-associated inducible nitric oxide synthase as immunomodulatory mechanisms.

    PubMed Central

    Waldburger, K. E.; Hastings, R. C.; Schaub, R. G.; Goldman, S. J.; Leonard, J. P.

    1996-01-01

    In an adoptive transfer model of experimental allergic encephalomyelitis, stimulation of lymph node cells with proteolipid protein and recombinant murine interleukin (rmIL)-12 before cell transfer accelerated the onset and exacerbates clinical disease. In vitro stimulation with proteolipid protein in the presence of rmIL-12 was associated with an increase in interferon-gamma-producing cells and a decrease in IL-4-producing cells, indicating a preferential expansion of Th1 effector cells. This was supported by the finding that severe disease with rapid onset could be transferred with as few as 10 x 10(6) rmIL-12-stimulated lymph node cells. Immunohistochemical analysis confirmed that the accelerated onset of disease after in vitro stimulation with rmIL-12 coincided with an acute inflammatory response in the central nervous system. At peak disease, both control and rmIL-12 treatment groups exhibited extensive cellular infiltration with characteristic perivascular cuffing. No notable differences in either the cellular composition or cytokine expression within the lesions were seen between groups. However, the frequency of macrophages that stained positively for inducible nitric oxide synthase was increased in animals challenged with rmIL-12-treated lymph node cells. The results suggest that, in addition to promoting the preferential expansion of interferon-gamma-producing cells by rmIL-12 in vitro, secondary in vivo effects leading to macrophage activation and inducible nitric oxide synthase expression may contribute to the severe and protracted course of central nervous system inflammation in this model. Images Figure 2 PMID:8579100

  2. Mis-translation of a computationally designed protein yields an exceptionally stable homodimer: implications for protein engineering and evolution.

    PubMed

    Dantas, Gautam; Watters, Alexander L; Lunde, Bradley M; Eletr, Ziad M; Isern, Nancy G; Roseman, Toby; Lipfert, Jan; Doniach, Sebastian; Tompa, Martin; Kuhlman, Brian; Stoddard, Barry L; Varani, Gabriele; Baker, David

    2006-10-06

    We recently used computational protein design to create an extremely stable, globular protein, Top7, with a sequence and fold not observed previously in nature. Since Top7 was created in the absence of genetic selection, it provides a rare opportunity to investigate aspects of the cellular protein production and surveillance machinery that are subject to natural selection. Here we show that a portion of the Top7 protein corresponding to the final 49 C-terminal residues is efficiently mis-translated and accumulates at high levels in Escherichia coli. We used circular dichroism, size-exclusion chromatography, small-angle X-ray scattering, analytical ultra-centrifugation, and NMR spectroscopy to show that the resulting C-terminal fragment (CFr) protein adopts a compact, extremely stable, homo-dimeric structure. Based on the solution structure, we engineered an even more stable variant of CFr by disulfide-induced covalent circularisation that should be an excellent platform for design of novel functions. The accumulation of high levels of CFr exposes the high error rate of the protein translation machinery. The rarity of correspondingly stable fragments in natural proteins coupled with the observation that high quality ribosome binding sites are found to occur within E. coli protein-coding regions significantly less often than expected by random chance implies a stringent evolutionary pressure against protein sub-fragments that can independently fold into stable structures. The symmetric self-association between two identical mis-translated CFr sub-domains to generate an extremely stable structure parallels a mechanism for natural protein-fold evolution by modular recombination of protein sub-structures.

  3. N15 Cro and lambda Cro: orthologous DNA-binding domains with completely different but equally effective homodimer interfaces.

    PubMed

    Dubrava, Matthew S; Ingram, Wendy M; Roberts, Sue A; Weichsel, Andrzej; Montfort, William R; Cordes, Matthew H J

    2008-05-01

    Bacteriophage Cro proteins bind to target DNA as dimers but do not all dimerize with equal strength, and differ in fold in the region of the dimer interface. We report the structure of the Cro protein from Enterobacteria phage N15 at 1.05 A resolution. The subunit fold contains five alpha-helices and is closely similar to the structure of P22 Cro (1.3 A backbone room mean square difference over 52 residues), but quite different from that of lambda Cro, a structurally diverged member of this family with a mixed alpha-helix/beta-sheet fold. N15 Cro crystallizes as a biological dimer with an extensive interface (1303 A(2) change in accessible surface area per dimer) and also dimerizes in solution with a K(d) of 5.1 +/- 1.5 microM. Its dimerization is much stronger than that of its structural homolog P22 Cro, which does not self-associate detectably in solution. Instead, the level of self-association and interfacial area for N15 Cro is similar to that of lambda Cro, even though these two orthologs do not share the same fold and have dimer interfaces that are qualitatively different in structure. The common Cro ancestor is thought to be an all-helical monomer similar to P22 Cro. We propose that two Cro descendants independently developed stronger dimerization by entirely different mechanisms.

  4. N15 Cro and λ Cro: Orthologous DNA-binding domains with completely different but equally effective homodimer interfaces

    PubMed Central

    Dubrava, Matthew S.; Ingram, Wendy M.; Roberts, Sue A.; Weichsel, Andrzej; Montfort, William R.; Cordes, Matthew H.J.

    2008-01-01

    Bacteriophage Cro proteins bind to target DNA as dimers but do not all dimerize with equal strength, and differ in fold in the region of the dimer interface. We report the structure of the Cro protein from Enterobacteria phage N15 at 1.05 Å resolution. The subunit fold contains five α-helices and is closely similar to the structure of P22 Cro (1.3 Å backbone room mean square difference over 52 residues), but quite different from that of λ Cro, a structurally diverged member of this family with a mixed α-helix/β-sheet fold. N15 Cro crystallizes as a biological dimer with an extensive interface (1303 Å2 change in accessible surface area per dimer) and also dimerizes in solution with a Kd of 5.1 ± 1.5 μM. Its dimerization is much stronger than that of its structural homolog P22 Cro, which does not self-associate detectably in solution. Instead, the level of self-association and interfacial area for N15 Cro is similar to that of λ Cro, even though these two orthologs do not share the same fold and have dimer interfaces that are qualitatively different in structure. The common Cro ancestor is thought to be an all-helical monomer similar to P22 Cro. We propose that two Cro descendants independently developed stronger dimerization by entirely different mechanisms. PMID:18369196

  5. N15 Cro And Gamma Cro Orthologous DNA-Binding Domains With Completely Different But Equally Effective Homodimer Interfaces

    SciTech Connect

    Dubrava, M.S.; Ingram, W.M.; Roberts, S.A.; Weichsel, A.; Montfort, W.R.; Cordes, M.H.J.

    2009-05-18

    Bacteriophage Cro proteins bind to target DNA as dimers but do not all dimerize with equal strength, and differ in fold in the region of the dimer interface. We report the structure of the Cro protein from Enterobacteria phage N15 at 1.05 {angstrom} resolution. The subunit fold contains five alpha-helices and is closely similar to the structure of P22 Cro (1.3 {angstrom} backbone room mean square difference over 52 residues), but quite different from that of lambda Cro, a structurally diverged member of this family with a mixed alpha-helix/beta-sheet fold. N15 Cro crystallizes as a biological dimer with an extensive interface (1303 {angstrom}{sub 2} change in accessible surface area per dimer) and also dimerizes in solution with a K(d) of 5.1 {+-} 1.5 {micro}M. Its dimerization is much stronger than that of its structural homolog P22 Cro, which does not self-associate detectably in solution. Instead, the level of self-association and interfacial area for N15 Cro is similar to that of lambda Cro, even though these two orthologs do not share the same fold and have dimer interfaces that are qualitatively different in structure. The common Cro ancestor is thought to be an all-helical monomer similar to P22 Cro. We propose that two Cro descendants independently developed stronger dimerization by entirely different mechanisms.

  6. Binding of nitrogen-containing bisphosphonates (N-BPs) to the Trypanosoma cruzi farnesyl diphosphate synthase homodimer

    SciTech Connect

    Huang, Chuan-Hsiang; Gabelli, Sandra B.; Oldfield, Eric; Amzel, L. Mario

    2010-11-15

    Bisphosphonates (BPs) are a class of compounds that have been used extensively in the treatment of osteoporosis and malignancy-related hypercalcemia. Some of these compounds act through inhibition of farnesyl diphosphate synthase (FPPS), a key enzyme in the synthesis of isoprenoids. Recently, nitrogen-containing bisphosphonates (N-BPs) used in bone resorption therapy have been shown to be active against Trypanosoma cruzi, the parasite that causes American trypanosomiasis (Chagas disease), suggesting that they may be used as anti-trypanosomal agents. The crystal structures of TcFPPS in complex with substrate (isopentenyl diphosphate, IPP) and five N-BP inhibitors show that the C-1 hydroxyl and the nitrogen-containing groups of the inhibitors alter the binding of IPP and the conformation of two TcFPPS residues, Tyr94 and Gln167. Isothermal titration calorimetry experiments suggest that binding of the first N-BPs to the homodimeric TcFPPS changes the binding properties of the second site. This mechanism of binding of N-BPs to TcFPPS is different to that reported for the binding of the same compounds to human FPPS.

  7. The Vesicle Priming Factor CAPS Functions as a Homodimer via C2 Domain Interactions to Promote Regulated Vesicle Exocytosis*

    PubMed Central

    Petrie, Matt; Esquibel, Joseph; Maciuba, Stephanie; Takahashi, Hirohide

    2016-01-01

    Neurotransmitters and peptide hormones are secreted by regulated vesicle exocytosis. CAPS (also known as CADPS) is a 145-kDa cytosolic and peripheral membrane protein required for vesicle docking and priming steps that precede Ca2+-triggered vesicle exocytosis. CAPS binds phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) and SNARE proteins and is proposed to promote SNARE protein complex assembly for vesicle docking and priming. We characterized purified soluble CAPS as mainly monomer in equilibrium with small amounts of dimer. However, the active form of CAPS bound to PC12 cell membranes or to liposomes containing PI(4,5)P2 and Q-SNARE proteins was mainly dimer. CAPS dimer formation required its C2 domain based on mutation or deletion studies. Moreover, C2 domain mutations or deletions resulted in a loss of CAPS function in regulated vesicle exocytosis, indicating that dimerization is essential for CAPS function. Comparison of the CAPS C2 domain to a structurally defined Munc13-1 C2A domain dimer revealed conserved residues involved in CAPS dimerization. We conclude that CAPS functions as a C2 domain-mediated dimer in regulated vesicle exocytosis. The unique tandem C2-PH domain of CAPS may serve as a PI(4,5)P2-triggered switch for dimerization. CAPS dimerization may be coupled to oligomeric SNARE complex assembly for vesicle docking and priming. PMID:27528604

  8. Regulation of the PI3K pathway through a p85α monomer–homodimer equilibrium | Office of Cancer Genomics

    Cancer.gov

    The canonical action of the p85α regulatory subunit of phosphatidylinositol 3-kinase (PI3K) is to associate with the p110α catalytic subunit to allow stimuli-dependent activation of the PI3K pathway. We elucidate a p110α-independent role of homodimerized p85α in the positive regulation of PTEN stability and activity.

  9. Histone deacetylase inhibitors decrease Toll-like receptor-mediated activation of proinflammatory gene expression by impairing transcription factor recruitment

    PubMed Central

    Bode, Konrad A; Schroder, Kate; Hume, David A; Ravasi, Timothy; Heeg, Klaus; Sweet, Matthew J; Dalpke, Alexander H

    2007-01-01

    Post-translational modifications of histone proteins are major mechanisms that modify chromatin structure and regulate gene expression in eukaryotes. Activation of histone acetyltransferases or inhibition of histone deacetylases (HDACs) is generally believed to allow chromatin to assume a more open state, permitting transcriptional activity. We report here the surprising observation that treatment of murine dendritic cells with the HDAC inhibitors trichostatin A (TSA) or suberoylanilide hydroxamic acid (SAHA) in non-apoptotic concentrations strongly inhibited induction of both interleukin-12 protein p40 (IL-12p40) mRNA and protein upon stimulation of Toll-like receptors (TLRs). Moreover, TLR-mediated up-regulation of costimulatory molecules was also inhibited. Up-regulation of tumour necrosis factor-α mRNA and protein in response to TLR agonists was only affected upon prolonged exposure to HDAC inhibitors and regulation of IL-1β was not affected. Similar effects were apparent in murine and human macrophages. Regarding the mode of action, HDAC inhibition increased the acetylation status at the IL-12p40 locus. Nevertheless, IL-12p40 chromatin remodelling, binding of Rel-A and IRF1 to the IL-12p40 promoter and transcriptional activation were abrogated. In contrast, HDAC inhibitors had no effects on upstream nuclear factor-κB and mitogen-activated protein kinase activation. Thus HDACs positively regulate the expression of a subset of cytokine genes by enabling transcription factor recruitment. PMID:17635610

  10. SU-E-P-40: Dosimetric Characteristics of Field Aperture Margin Design in Stereotactic Body Radiation Therapy (SBRT)

    SciTech Connect

    Zhu, J

    2015-06-15

    Purpose: To characterize the dosimetric effects of field aperture margin design in Stereotactic Body Radiation Therapy (SBRT). Methods: Three artificial spherical PTVs, with diameter of 10mm, 20mm and 30mm, were created on CT images of a human body thoracic phantom. Seven non-coplanar isocentric fields were used for treatment planning. For each PTV, treatment plans with margins 0mm, 1mm, 2mm and 3mm were planned. Dosimetric comparison among plans was done considering the following parameters: prescribed isodose line for target coverage, maximum dose, mean dose as well as dose spillages of V80, V50, and V20. Results: Corresponding to aperture margins of 0mm, 1mm,2m and 3mm used in the treatment planning, the percentage of isodose line chosen for dose prescription increases from 65% to 93% for 10mm PTV, 70% to 92% for 20mm PTV, and 75% to 92% for 30mm PTV. The maximum dose decrease accordingly from 155.7% to 109.5% for 10mm PTV, 145% to 111.6% for 20mm PTV, 137% to 112.2% for 30mm PTV. The mean dose decrease from 138.% to 104.4% for 10mm PTV, 122.8% to 106.1% for 20mm PTV, 121.3% to 106% for 30mm PTV. Dose spillages (mm3) increase (V80−2.6 to 4.02, V50−4.55 to 9.3, V20–87.86 to 101.71) for 10 mm PTV, (V80−6.78 to 9.89, V50–13.46 to 20.4, V20-119.16 to 219.1) for 20 mm PTV, (V80–22.01 to 28.59, V50–41.56 to 52.66, V20-532.71 to 551.84) for 30 mm PTV. Conclusion: In SBRT treatment planning, tight field aperture margin requires prescribing dose to lower isodose line that leading to higher dose inhomogeneity and higher mean dose to PTV. Loose margin allows prescribing dose to higher isodose line, therefore improves the dose homogeneity. However, it increases dose spillages. Clinician could try different margins according to the PTV size and location of surrounding critical organs to optimize the dose delivered to the patient.

  11. Recombinant p35 from bacteria can form Interleukin (IL-)12, but Not IL-35.

    PubMed

    Aparicio-Siegmund, Samadhi; Moll, Jens M; Lokau, Juliane; Grusdat, Melanie; Schröder, Jutta; Plöhn, Svenja; Rose-John, Stefan; Grötzinger, Joachim; Lang, Philipp A; Scheller, Jürgen; Garbers, Christoph

    2014-01-01

    The Interleukin (IL)-12 family contains several heterodimeric composite cytokines which share subunits among each other. IL-12 consists of the subunits p40 (shared with IL-23) and p35. p35 is shared with the composite cytokine IL-35 which comprises of the p35/EBI3 heterodimer (EBI3 shared with IL-27). IL-35 signals via homo- or heterodimers of IL-12Rβ2, gp130 and WSX-1, which are shared with IL-12 and IL-27 receptor complexes, respectively. p35 was efficiently secreted in complex with p40 as IL-12 but not with EBI3 as IL-35 in several transfected cell lines tested which complicates the analysis of IL-35 signal transduction. p35 and p40 but not p35 and EBI3 form an inter-chain disulfide bridge. Mutation of the responsible cysteine residue (p40C197A) reduced IL-12 formation and activity only slightly. Importantly, the p40C197A mutation prevented the formation of antagonistic p40 homodimers which enabled the in vitro reconstitution of biologically active IL-12 with p35 produced in bacteria (p35bac). Reconstitution of IL-35 with p35bac and EBI3 did, however, fail to induce signal transduction in Ba/F3 cells expressing IL-12Rβ2 and gp130. In summary, we describe the in vitro reconstitution of IL-12, but fail to produce recombinant IL-35 by this novel approach.

  12. The Yersinia enterocolitica phage shock proteins B and C can form homodimers and heterodimers in vivo with the possibility of close association between multiple domains.

    PubMed

    Gueguen, Erwan; Flores-Kim, Josué; Darwin, Andrew J

    2011-10-01

    The Yersinia enterocolitica phage shock protein (Psp) stress response is essential for virulence and for survival during the mislocalization of outer membrane secretin proteins. The cytoplasmic membrane proteins PspB and PspC are critical components involved in regulating psp gene expression and in facilitating tolerance to secretin-induced stress. Interactions between PspB and PspC monomers might be important for their functions and for PspC stability. However, little is known about these interactions and there are conflicting reports about the ability of PspC to dimerize. To address this, we have used a combination of independent approaches to systematically analyze the ability of PspB and PspC to form dimers in vivo. Formaldehyde cross-linking of the endogenous chromosomally encoded proteins in Y. enterocolitica revealed discrete complexes corresponding in size to PspB-PspB, PspC-PspC, and PspB-PspC. Bacterial two-hybrid analysis corroborated these protein associations, but an important limitation of the two-hybrid approach was uncovered for PspB. A series of PspB and PspC proteins with unique cysteine substitutions at various positions was constructed. In vivo disulfide cross-linking experiments with these proteins further supported close association between PspB and PspC monomers. Detailed cysteine substitution analysis of predicted leucine zipper-like amphipathic helices in both PspB and PspC suggested that their hydrophobic faces could form homodimerization interfaces.

  13. Arginine mutations within a transmembrane domain of Tar, an Escherichia coli aspartate receptor, can drive homodimer dissociation and heterodimer association in vivo

    PubMed Central

    2004-01-01

    The interactions between the TM (transmembrane) domains of many membrane proteins are important for their proper functioning. Mutations of residues into positively charged ones within TM domains were reported to be involved in many genetic diseases, possibly because these mutations affect the self- and/or hetero-assembly of the corresponding proteins. To our knowledge, despite significant progress in understanding the role of various amino acids in TM–TM interactions in vivo, the direct effect of positively charged residues on these interactions has not been studied. To address this issue, we employed the N-terminal TM domain of the aspartate receptor (Tar-1) as a dimerization model system. We expressed within the ToxR TM assembly system several Tar-1 constructs that dimerize via polar- or non-polar amino acid motifs, and mutated these by replacement with a single arginine residue. Our results have revealed that a mutation in each of the motifs significantly reduced the ability of the TMs to dimerize. Furthermore, a Tar-1 construct that contained two arginine residues was unable to correctly integrate itself into the membrane. Nevertheless, an exogenous synthetic Tar-1 peptide containing these two arginine residues was able to inhibit in vivo the marked dimerization of a mutant Tar-1 construct that contained two glutamate residues at similar positions. This indicates that hetero-assembly of TM domains can be mediated by the interaction of two oppositely charged residues, probably by formation of ion pairs. This study broadens our knowledge regarding the effect of positively charged residues on TM–TM interactions in vivo, and provides a potential therapeutic approach to inhibit uncontrolled dimerization of TM domains caused by mutations of polar amino acids. PMID:15330757

  14. CDK-activating kinase (Ee;CDKF;1) of leafy spurge (Euphorbia esula) forms both homo-dimers and homo-trimers in its native state

    USDA-ARS?s Scientific Manuscript database

    Leafy spurge is a deep rooted perennial weed that propagates both by seeds and underground adventitious buds located on the crown and roots (crown and root buds). As buds develop during the normal growing season, they are maintained in a quiescent state through correlative inhibition. To enhance our...

  15. KBF1 (p50 NF-kappa B homodimer) acts as a repressor of H-2Kb gene expression in metastatic tumor cells

    PubMed Central

    1993-01-01

    Downregulation of major histocompatibility complex class I expression is causally related to high malignancy and low immunogenicity of certain murine tumors. In this study, we have analyzed the roles of the nuclear factors KBF1/p50 and p65 in regulation of class I expression in high and low metastatic tumor cells. Low class I-expressing cells show at higher levels of KBF1/p50 and NF-kappa B (p50/p65) binding activity than high class I-expressing cells. However, an excess of KBF1 over NF- kappa B is observed in low expressing cells, while an excess of NF- kappa B over KBF1 is observed in high expressing cells. Stable transfection of a p65 expression vector into low class I-expressing cells activated H-2 transcription and cell surface expression, while stable transfection of p50 expression vector into high expressing cells suppressed H-2Kb transcription and cell surface expression. Our studies suggest that KBF1 has the potential of downregulating class I gene expression, whereas dimers containing the p65 subunit are activators of class I gene expression. PMID:8496683

  16. The Yersinia enterocolitica Phage Shock Proteins B and C Can Form Homodimers and Heterodimers In Vivo with the Possibility of Close Association between Multiple Domains▿ †

    PubMed Central

    Gueguen, Erwan; Flores-Kim, Josué; Darwin, Andrew J.

    2011-01-01

    The Yersinia enterocolitica phage shock protein (Psp) stress response is essential for virulence and for survival during the mislocalization of outer membrane secretin proteins. The cytoplasmic membrane proteins PspB and PspC are critical components involved in regulating psp gene expression and in facilitating tolerance to secretin-induced stress. Interactions between PspB and PspC monomers might be important for their functions and for PspC stability. However, little is known about these interactions and there are conflicting reports about the ability of PspC to dimerize. To address this, we have used a combination of independent approaches to systematically analyze the ability of PspB and PspC to form dimers in vivo. Formaldehyde cross-linking of the endogenous chromosomally encoded proteins in Y. enterocolitica revealed discrete complexes corresponding in size to PspB-PspB, PspC-PspC, and PspB-PspC. Bacterial two-hybrid analysis corroborated these protein associations, but an important limitation of the two-hybrid approach was uncovered for PspB. A series of PspB and PspC proteins with unique cysteine substitutions at various positions was constructed. In vivo disulfide cross-linking experiments with these proteins further supported close association between PspB and PspC monomers. Detailed cysteine substitution analysis of predicted leucine zipper-like amphipathic helices in both PspB and PspC suggested that their hydrophobic faces could form homodimerization interfaces. PMID:21856846

  17. Definition of a natural killer NKR-P1A+/CD56-/CD16- functionally immature human NK cell subset that differentiates in vitro in the presence of interleukin 12 [published erratum appears in J Exp Med 1997 Mar 17;185(6):1150-1

    PubMed Central

    1996-01-01

    Human natural killer (NK) cell differentiation from immature lineage negative (Lin-) umbilical cord blood cells was examined in vitro. Cells expressing differentiation antigens of mature NK cells (CD56, CD16, CD2, CD8, NKR-P1A) were generated from Lin- cells cultured with interleukin (IL)-2 and a murine bone marrow stromal cell line expressing the human membrane-bound form of stem cell factor. Two subsets of NK cells were identified in these cultures: one expressed both NKR-P1A and CD56 and, in variable proportions, all other NK cell differentiation antigens; the second subset expressed only NKR-P1A and, unlike the former, was not cytotoxic. Neither subset expressed interferon (IFN)-gamma mRNA even after stimulation with phorbol di- ester and Ca2+ ionophore, but both expressed tumor necrosis factor alpha mRNA and the cytotoxic granule-associated proteins TIA-1, perforin, and serine esterase-1. After 10-d culture with IL-2, IL-12, and irradiated B lymphoblastoid cells, approximately 45% of the NKR- P1A+/ CD56- cells became CD56+, and the same cultures contained cells capable of cytotoxicity and of IFN-gamma production. These results indicate that NKR-P1A expression in the absence of other NK cell markers defines an intermediate, functionally immature stage of NK cell differentiation, and that effector functions develop in these cells, concomitantly with CD56 expression, in the presence of IL-12. These cells likely represent the counterpart of a CD3-/NKR-P1A+/ CD56-/CD16- cell subset that, as shown here, is present both in adult and neonatal circulating lymphocytes. PMID:8920872

  18. Infectious Dose Dictates the Host Response during Staphylococcus aureus Orthopedic-Implant Biofilm Infection

    PubMed Central

    Vidlak, Debbie

    2016-01-01

    Staphylococcus aureus is a leading cause of prosthetic joint infections (PJIs) that are typified by biofilm formation. Given the diversity of S. aureus strains and their propensity to cause community- or hospital-acquired infections, we investigated whether the immune response and biofilm growth during PJI were conserved among distinct S. aureus clinical isolates. Three S. aureus strains representing USA200 (UAMS-1), USA300 (LAC), and USA400 (MW2) lineages were equally effective at biofilm formation in a mouse model of PJI and elicited similar leukocyte infiltrates and cytokine/chemokine profiles. Another factor that may influence the course of PJI is infectious dose. In particular, higher bacterial inocula could accelerate biofilm formation and alter the immune response, making it difficult to discern underlying pathophysiological mechanisms. To address this issue, we compared the effects of two bacterial doses (103 or 105 CFU) on inflammatory responses in interleukin-12p40 (IL-12p40) knockout mice that were previously shown to have reduced myeloid-derived suppressor cell recruitment concomitant with bacterial clearance after low-dose challenge (103 CFU). Increasing the infectious dose of LAC to 105 CFU negated these differences in IL-12p40 knockout animals, demonstrating the importance of bacterial inoculum on infection outcome. Collectively, these observations highlight the importance of considering infectious dose when assessing immune responsiveness, whereas biofilm formation during PJI is conserved among clinical isolates commonly used in mouse S. aureus infection models. PMID:27091926

  19. Expression of bioactive single-chain murine IL-12 in transgenic plants.

    PubMed

    Liu, Jianyun; Dolan, Maureen C; Reidy, Michael; Cramer, Carole L

    2008-06-01

    Interleukin-12 (IL-12), an important immunomodulator for cell-mediated immunity, shows significant potential as a vaccine adjuvant and anticancer therapeutic. However, its clinical application is limited in part by lack of an effective bioproduction system for this complex heterodimeric glycoprotein. Transgenic plants show promise as scalable bioproduction platforms for challenging biopharmaceutical proteins. To test the potential of plants to effectively produce bioactive IL-12, we developed transgenic tobacco plant lines and derived root cultures yielding high levels of mouse IL-12 (MuIL-12). Functional IL-12 is a heterodimer consisting of two disulfide-linked subunits, p35 and p40. To ensure the stoichiometric expression and assembly of p35 and p40, we expressed a single-chain version of