Sample records for internal electron transfer

  1. Allosteric control of internal electron transfer in cytochrome cd1 nitrite reductase

    PubMed Central

    Farver, Ole; Kroneck, Peter M. H.; Zumft, Walter G.; Pecht, Israel

    2003-01-01

    Cytochrome cd1 nitrite reductase is a bifunctional multiheme enzyme catalyzing the one-electron reduction of nitrite to nitric oxide and the four-electron reduction of dioxygen to water. Kinetics and thermodynamics of the internal electron transfer process in the Pseudomonas stutzeri enzyme have been studied and found to be dominated by pronounced interactions between the c and the d1 hemes. The interactions are expressed both in dramatic changes in the internal electron-transfer rates between these sites and in marked cooperativity in their electron affinity. The results constitute a prime example of intraprotein control of the electron-transfer rates by allosteric interactions. PMID:12802018

  2. 76 FR 708 - Electronic Funds Transfer of Depository Taxes; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-06

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 1, 31, 40, and 301 [TD 9507] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue Service... Electronic Funds Transfer (EFT). The temporary and final regulations provide rules under which depositors...

  3. 76 FR 709 - Electronic Funds Transfer of Depository Taxes; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-01-06

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 40 and 301 [TD 9507] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue Service (IRS...) providing guidance relating to Federal tax deposits (FTDs) by Electronic Funds Transfer (EFT). The temporary...

  4. 75 FR 52485 - Electronic Funds Transfer of Depository Taxes; Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-08-26

    ... DEPARTMENT OF THE TREASURY Internal Revenue Service 26 CFR Parts 1, 31, 40, and 301 [REG-153340-09] RIN 1545-BJ13 Electronic Funds Transfer of Depository Taxes; Correction AGENCY: Internal Revenue... to Federal tax deposits (FTDs) by Electronic Funds Transfer (EFT). FOR FURTHER INFORMATION CONTACT...

  5. Thermal Enhancement of Silicon Carbide (SiC) Power Electronics and Laser Bars: Statistical Design Optimization of a Liquid-Cooled Power Electronic Heat Sink

    DTIC Science & Technology

    2015-08-01

    Forced Convective Heat Transfer Across a Pin Fin Micro Heat Sink”, International Journal of Heat and Mass Transfer 48 (2005) 3615-3627. 3. Cao...from Pin Fins Situated in an Oncoming Longitudinal Flow Which Turns to Crossflow”, International Journal of Heat and Mass Transfer, Vol. 25 No. 5...Flow Forced Convection”, International Journal of Heat and Mass Transfer, Vol. 39, No. 2, pp. 311-317, 1996. 11. Khan, W., Culham, J., and Yovanovich

  6. Internal electron transfer between hemes and Cu(II) bound at cysteine beta93 promotes methemoglobin reduction by carbon monoxide.

    PubMed

    Bonaventura, C; Godette, G; Tesh, S; Holm, D E; Bonaventura, J; Crumbliss, A L; Pearce, L L; Peterson, J

    1999-02-26

    Previous studies showed that CO/H2O oxidation provides electrons to drive the reduction of oxidized hemoglobin (metHb). We report here that Cu(II) addition accelerates the rate of metHb beta chain reduction by CO by a factor of about 1000. A mechanism whereby electron transfer occurs via an internal pathway coupling CO/H2O oxidation to Fe(III) and Cu(II) reduction is suggested by the observation that the copper-induced rate enhancement is inhibited by blocking Cys-beta93 with N-ethylmaleimide. Furthermore, this internal electron-transfer pathway is more readily established at low Cu(II) concentrations in Hb Deer Lodge (beta2His --> Arg) and other species lacking His-beta2 than in Hb A0. This difference is consistent with preferential binding of Cu(II) in Hb A0 to a high affinity site involving His-beta2, which is ineffective in promoting electron exchange between Cu(II) and the beta heme iron. Effective electron transfer is thus affected by Hb type but is not governed by the R left arrow over right arrow T conformational equilibrium. The beta hemes in Cu(II)-metHb are reduced under CO at rates close to those observed for cytochrome c oxidase, where heme and copper are present together in the oxygen-binding site and where internal electron transfer also occurs.

  7. 48 CFR 252.232-7011 - Payments in Support of Emergencies and Contingency Operations.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    .... Internal Revenue Code. (ix) Electronic funds transfer banking information. (A) The Contractor shall include electronic funds transfer banking information on the invoice only if required elsewhere in this contract. (B) If electronic funds transfer banking information is not required to be on the invoice, in order for...

  8. ULTRAFAST CHEMISTRY: Using Time-Resolved Vibrational Spectroscopy for Interrogation of Structural Dynamics

    NASA Astrophysics Data System (ADS)

    Nibbering, Erik T. J.; Fidder, Henk; Pines, Ehud

    2005-05-01

    Time-resolved infrared (IR) and Raman spectroscopy elucidates molecular structure evolution during ultrafast chemical reactions. Following vibrational marker modes in real time provides direct insight into the structural dynamics, as is evidenced in studies on intramolecular hydrogen transfer, bimolecular proton transfer, electron transfer, hydrogen bonding during solvation dynamics, bond fission in organometallic compounds and heme proteins, cis-trans isomerization in retinal proteins, and transformations in photochromic switch pairs. Femtosecond IR spectroscopy monitors the site-specific interactions in hydrogen bonds. Conversion between excited electronic states can be followed for intramolecular electron transfer by inspection of the fingerprint IR- or Raman-active vibrations in conjunction with quantum chemical calculations. Excess internal vibrational energy, generated either by optical excitation or by internal conversion from the electronic excited state to the ground state, is observable through transient frequency shifts of IR-active vibrations and through nonequilibrium populations as deduced by Raman resonances.

  9. Coherent Electron Transfer at the Ag / Graphite Heterojunction Interface

    NASA Astrophysics Data System (ADS)

    Tan, Shijing; Dai, Yanan; Zhang, Shengmin; Liu, Liming; Zhao, Jin; Petek, Hrvoje

    2018-03-01

    Charge transfer in transduction of light to electrical or chemical energy at heterojunctions of metals with semiconductors or semimetals is believed to occur by photogenerated hot electrons in metal undergoing incoherent internal photoemission through the heterojunction interface. Charge transfer, however, can also occur coherently by dipole coupling of electronic bands at the heterojunction interface. Microscopic physical insights into how transfer occurs can be elucidated by following the coherent polarization of the donor and acceptor states on the time scale of electronic dephasing. By time-resolved multiphoton photoemission spectroscopy (MPP), we investigate the coherent electron transfer from an interface state that forms upon chemisorption of Ag nanoclusters onto graphite to a σ symmetry interlayer band of graphite. Multidimensional MPP spectroscopy reveals a resonant two-photon transition, which dephases within 10 fs completing the coherent transfer.

  10. 76 FR 77584 - U.S. Department of State Advisory Committee on Private International Law (ACPIL): Public Meeting...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-12-13

    ... validate the identity of individuals who enter Department facilities. The data will be entered into the... electronic transferable records. Working Group IV (international electronic commerce) of the United Nations... http://www.uncitral.org/uncitral/en/commission/working_groups/4Electronic_Commerce.html . The ACPIL...

  11. Formation of a cytochrome c-nitrous oxide reductase complex is obligatory for N2O reduction by Paracoccus pantotrophus.

    PubMed

    Rasmussen, Tim; Brittain, Thomas; Berks, Ben C; Watmough, Nicholas J; Thomson, Andrew J

    2005-11-07

    Nitrous oxide reductase (N2OR) catalyses the final step of bacterial denitrification, the two-electron reduction of nitrous oxide (N2O) to dinitrogen (N2). N2OR contains two metal centers; a binuclear copper center, CuA, that serves to receive electrons from soluble donors, and a tetranuclear copper-sulfide center, CuZ, at the active site. Stopped flow experiments at low ionic strengths reveal rapid electron transfer (kobs=150 s-1) between reduced horse heart (HH) cytochrome c and the CuA center in fully oxidized N2OR. When fully reduced N2OR was mixed with oxidized cytochrome c, a similar rate of electron transfer was recorded for the reverse reaction, followed by a much slower internal electron transfer from CuZ to CuA(kobs=0.1-0.4 s-1). The internal electron transfer process is likely to represent the rate-determining step in the catalytic cycle. Remarkably, in the absence of cytochrome c, fully reduced N2OR is inert towards its substrate, even though sufficient electrons are stored to initiate a single turnover. However, in the presence of reduced cytochrome c and N2O, a single turnover occurs after a lag-phase. We propose that a conformational change in N2OR is induced by its specific interaction with cytochrome c that in turn either permits electron transfer between CuA and CuZ or controls the rate of N2O decomposition at the active site.

  12. Electrochemical capacitance modulation in an interacting mesoscopic capacitor induced by internal charge transfer

    NASA Astrophysics Data System (ADS)

    Liu, Wei; He, Jianhong; Guo, Huazhong; Gao, Jie

    2018-04-01

    We report experiments on the dynamic response of an interacting mesoscopic capacitor consisting of a quantum dot with two confined spin-split levels of the lowest Landau level. In high magnetic fields, states inside the dot are regulated by a mixture of Coulomb interaction and Landau-level quantization, and electrons distribute on two spatially separated regions. Quantum point contact voltage and magnetic field are employed to manipulate the number and distribution of electrons inside the quantum dot. We find that the periodicity of the electrochemical capacitance oscillations is dominated by the charging energy, and their amplitudes, due to internal charge transfer and strong internal capacitive coupling, show rich variations of modulations. Magnetocapacitance displays a sawtoothlike manner and may differ in tooth directions for different voltages, which, we demonstrate, result from a sawtoothlike electrochemical potential change induced by internal charge transfer and field-sensitive electrostatic potential. We further build a charge stability diagram, which, together with all other capacitance properties, is consistently interpreted in terms of a double-dot model. The demonstrated technique is of interest as a tool for fast and sensitive charge state readout of a double-quantum-dot qubit in the gigahertz frequency quantum electronics.

  13. Improvement of Charge Transportation in Si Quantum Dot-Sensitized Solar Cells Using Vanadium Doped TiO2.

    PubMed

    Seo, Hyunwoong; Ichida, Daiki; Hashimoto, Shinji; Itagaki, Naho; Koga, Kazunori; Shiratani, Masaharu; Nam, Sang-Hun; Boo, Jin-Hyo

    2016-05-01

    The multiple exciton generation characteristics of quantum dots have been expected to enhance the performance of photochemical solar cells. In previous work, we first introduced Si quantum dot for sensitized solar cells. The Si quantum dots were fabricated by multi-hollow discharge plasma chemical vapor deposition, and were characterized optically and morphologically. The Si quantum dot-sensitized solar cells had poor performance due to significant electron loss by charge recombination. Although the large Si particle size resulted in the exposure of a large TiO2 surface area, there was a limit to ho much the particle size could be decreased due to the reduced absorbance of small particles. Therefore, this work focused on decreasing the internal impedance to improve charge transfer. TiO2 was electronically modified by doping with vanadium, which can improve electron transfer in the TiO2 network, and which is stable in the redox electrolyte. Photogenerated electrons can more easily arrive at the conductive electrode due to the decreased internal impedance. The dark photovoltaic properties confirmed the reduction of charge recombination, and the photon-to-current conversion efficiency reflected the improved electron transfer. Impedance analysis confirmed a decrease in internal impedance and an increased electron lifetime. Consequently, these improvements by vanadium doping enhanced the overall performance of Si quantum dot-sensitized solar cells.

  14. What Hinders Electron Transfer Dissociation (ETD) of DNA Cations?

    NASA Astrophysics Data System (ADS)

    Hari, Yvonne; Leumann, Christian J.; Schürch, Stefan

    2017-12-01

    Radical activation methods, such as electron transfer dissociation (ETD), produce structural information complementary to collision-induced dissociation. Herein, electron transfer dissociation of 3-fold protonated DNA hexamers was studied to gain insight into the fragmentation mechanism. The fragmentation patterns of a large set of DNA hexamers confirm cytosine as the primary target of electron transfer. The reported data reveal backbone cleavage by internal electron transfer from the nucleobase to the phosphate linker leading either to a•/ w or d/ z• ion pairs. This reaction pathway contrasts with previous findings on the dissociation processes after electron capture by DNA cations, suggesting multiple, parallel dissociation channels. However, all these channels merely result in partial fragmentation of the precursor ion because the charge-reduced DNA radical cations are quite stable. Two hypotheses are put forward to explain the low dissociation yield of DNA radical cations: it is either attributed to non-covalent interactions between complementary fragments or to the stabilization of the unpaired electron in stacked nucleobases. MS3 experiments suggest that the charge-reduced species is the intact oligonucleotide. Moreover, introducing abasic sites significantly increases the dissociation yield of DNA cations. Consequently, the stabilization of the unpaired electron by π-π-stacking provides an appropriate rationale for the high intensity of DNA radical cations after electron transfer. [Figure not available: see fulltext.

  15. Unusual Internal Electron Transfer in Conjugated Radical Polymers.

    PubMed

    Li, Fei; Gore, Danielle N; Wang, Shaoyang; Lutkenhaus, Jodie L

    2017-08-07

    Nitroxide-containing organic radical polymers (ORPs) have captured attention for their high power and fast redox kinetics. Yet a major challenge is the polymer's aliphatic backbone, resulting in a low electronic conductivity. Recent attempts that replace the aliphatic backbone with a conjugated one have not met with success. The reason for this is not understood until now. We examine a family of polythiophenes bearing nitroxide radical groups, showing that while both species are electrochemically active, there exists an internal electron transfer mechanism that interferes with stabilization of the polymer's fully oxidized form. This finding directs the future design of conjugated radical polymers in energy storage and electronics, where careful attention to the redox potential of the backbone relative to the organic radical species is needed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Molecular dynamics simulations give insight into the conformational change, complex formation, and electron transfer pathway for cytochrome P450 reductase

    PubMed Central

    Sündermann, Axel; Oostenbrink, Chris

    2013-01-01

    Cytochrome P450 reductase (CYPOR) undergoes a large conformational change to allow for an electron transfer to a redox partner to take place. After an internal electron transfer over its cofactors, it opens up to facilitate the interaction and electron transfer with a cytochrome P450. The open conformation appears difficult to crystallize. Therefore, a model of a human CYPOR in the open conformation was constructed to be able to investigate the stability and conformational change of this protein by means of molecular dynamics simulations. Since the role of the protein is to provide electrons to a redox partner, the interactions with cytochrome P450 2D6 (2D6) were investigated and a possible complex structure is suggested. Additionally, electron pathway calculations with a newly written program were performed to investigate which amino acids relay the electrons from the FMN cofactor of CYPOR to the HEME of 2D6. Several possible interacting amino acids in the complex, as well as a possible electron transfer pathway were identified and open the way for further investigation by site directed mutagenesis studies. PMID:23832577

  17. Femtosecond excited state studies of the two-center three-electron bond driven twisted internal charge transfer dynamics in 1,8-bis(dimethylamino)naphthalene.

    PubMed

    Balkowski, Grzegorz; Szemik-Hojniak, Anna; van Stokkum, Ivo H M; Zhang, Hong; Buma, Wybren J

    2005-04-28

    Femtosecond fluorescence upconversion and transient absorption experiments have been performed to monitor the photoinduced electronic, geometry, and solvent relaxation dynamics of 1,8-bis(dimethylamino)naphthalene dissolved in methylcyclohexane or n-hexane, n-dodecane, dichloromethane, and acetonitrile. The data have been analyzed by using a sequential global analysis method that gives rise to species associated difference spectra. The spectral features in these spectra and their dynamic behavior enable us to associate them with specific processes occurring in the molecule. The experiments show that the internal charge-transfer lpi* state is populated after internal conversion from the 1La state. In the lpi state the molecule is concluded to be subject to a large-amplitude motion, thereby confirming our previous predictions that internal charge transfer in this state is accompanied by the formation of a two-center three-electron bond between the two nitrogen atoms. Solvent relaxation and vibrational cooling in the lpi* state cannot be separated in polar solvents, but in apolar solvents a distinct vibrational cooling process in the lpi* state is discerned. The spectral and dynamic characteristics of the final species created in the experiments are shown to correspond well with what has been determined before for the relaxed emissive lpi state.

  18. Photocatalytic Conversion of Nitrobenzene to Aniline through Sequential Proton-Coupled One-Electron Transfers from a Cadmium Sulfide Quantum Dot

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Stephen C.; Bettis Homan, Stephanie; Weiss, Emily A.

    2016-01-28

    This paper describes the use of cadmium sulfide quantum dots (CdS QDs) as visible-light photocatalysts for the reduction of nitrobenzene to aniline through six sequential photoinduced, proton-coupled electron transfers. At pH 3.6–4.3, the internal quantum yield of photons-to-reducing electrons is 37.1% over 54 h of illumination, with no apparent decrease in catalyst activity. Monitoring of the QD exciton by transient absorption reveals that, for each step in the catalytic cycle, the sacrificial reductant, 3-mercaptopropionic acid, scavenges the excitonic hole in ~5 ps to form QD•–; electron transfer to nitrobenzene or the intermediates nitrosobenzene and phenylhydroxylamine then occurs on the nanosecondmore » time scale. The rate constants for the single-electron transfer reactions are correlated with the driving forces for the corresponding proton-coupled electron transfers. This result suggests, but does not prove, that electron transfer, not proton transfer, is rate-limiting for these reactions. Nuclear magnetic resonance analysis of the QD–molecule systems shows that the photoproduct aniline, left unprotonated, serves as a poison for the QD catalyst by adsorbing to its surface. Performing the reaction at an acidic pH not only encourages aniline to desorb but also increases the probability of protonated intermediates; the latter effect probably ensures that recruitment of protons is not rate-limiting.« less

  19. Photoinduced electron transfer and solvation in iodide-doped acetonitrile clusters.

    PubMed

    Ehrler, Oli T; Griffin, Graham B; Young, Ryan M; Neumark, Daniel M

    2009-04-02

    We have used ultrafast time-resolved photoelectron imaging to measure charge transfer dynamics in iodide-doped acetonitrile clusters I(-)(CH(3)CN)(n) with n = 5-10. Strong modulations of vertical detachment energies were observed following charge transfer from the halide, allowing interpretation of the ongoing dynamics. We observe a sharp drop in the vertical detachment energy (VDE) within 300-400 fs, followed by a biexponential increase that is complete by approximately 10 ps. Comparison to theory suggests that the iodide is internally solvated and that photodetachment results in formation of a diffuse electron cloud in a confined cavity. We interpret the initial drop in VDE as a combination of expansion of the cavity and localization of the excess electron on one or two solvent molecules. The subsequent increase in VDE is attributed to a combination of the I atom leaving the cavity and rearrangement of the acetonitrile molecules to solvate the electron. The n = 5-8 clusters then show a drop in VDE of around 50 meV on a much longer time scale. The long-time VDEs are consistent with those of (CH(3)CN)(n)(-) clusters with internally solvated electrons. Although the excited-state created by the pump pulse decays by emission of a slow electron, no such decay is seen by 200 ps.

  20. Heterogeneous Electron-Transfer Dynamics through Dipole-Bridge Groups.

    PubMed

    Nieto-Pescador, Jesus; Abraham, Baxter; Li, Jingjing; Batarseh, Alberto; Bartynski, Robert A; Galoppini, Elena; Gundlach, Lars

    2016-01-14

    Heterogeneous electron transfer (HET) between photoexcited molecules and colloidal TiO 2 has been investigated for a set of Zn-porphyrin chromophores attached to the semiconductor via linkers that allow to change level alignment by 200 meV by reorientation of the dipole moment. These unique dye molecules have been studied by femtosecond transient absorption spectroscopy in solution and adsorbed on the TiO 2 colloidal film in vacuum. In solution energy transfer from the excited chromophore to the dipole group has been identified as a slow relaxation pathway competing with S 2 -S 1 internal conversion. On the film heterogeneous electron transfer occurred in 80 fs, much faster compared to all intramolecular pathways. Despite a difference of 200 meV in level alignment of the excited state with respect to the semiconductor conduction band, identical electron transfer times were measured for different linkers. The measurements are compared to a quantum-mechanical model that accounts for electronic-vibronic coupling and finite band width for the acceptor states. We conclude that HET occurs into a distribution of transition states that differs from regular surface states or bridge mediated states.

  1. Definition and determination of the triplet-triplet energy transfer reaction coordinate.

    PubMed

    Zapata, Felipe; Marazzi, Marco; Castaño, Obis; Acuña, A Ulises; Frutos, Luis Manuel

    2014-01-21

    A definition of the triplet-triplet energy transfer reaction coordinate within the very weak electronic coupling limit is proposed, and a novel theoretical formalism is developed for its quantitative determination in terms of internal coordinates The present formalism permits (i) the separation of donor and acceptor contributions to the reaction coordinate, (ii) the identification of the intrinsic role of donor and acceptor in the triplet energy transfer process, and (iii) the quantification of the effect of every internal coordinate on the transfer process. This formalism is general and can be applied to classical as well as to nonvertical triplet energy transfer processes. The utility of the novel formalism is demonstrated here by its application to the paradigm of nonvertical triplet-triplet energy transfer involving cis-stilbene as acceptor molecule. In this way the effect of each internal molecular coordinate in promoting the transfer rate, from triplet donors in the low and high-energy limit, could be analyzed in detail.

  2. Ru–protein–Co biohybrids designed for solar hydrogen production: understanding electron transfer pathways related to photocatalytic function† †Electronic supplementary information (ESI) available: Time traces of photocatalysis, additional EPR spectra and parameters, UV-visible spectroscopy data, and kinetic fits of TA traces. See DOI: 10.1039/c6sc03121h Click here for additional data file.

    PubMed Central

    Soltau, Sarah R.; Dahlberg, Peter D.; Niklas, Jens; Poluektov, Oleg G.; Mulfort, Karen L.

    2016-01-01

    A series of Ru–protein–Co biohybrids have been prepared using the electron transfer proteins ferredoxin (Fd) and flavodoxin (Fld) as scaffolds for photocatalytic hydrogen production. The light-generated charge separation within these hybrids has been monitored by transient optical and electron paramagnetic resonance spectroscopies. Two distinct electron transfer pathways are observed. The Ru–Fd–Co biohybrid produces up to 650 turnovers of H2 utilizing an oxidative quenching mechanism for Ru(ii)* and a sequential electron transfer pathway via the native [2Fe–2S] cluster to generate a Ru(iii)–Fd–Co(i) charge separated state that lasts for ∼6 ms. In contrast, a direct electron transfer pathway occurs for the Ru–ApoFld–Co biohybrid, which lacks an internal electron relay, generating Ru(i)–ApoFld–Co(i) charge separated state that persists for ∼800 μs and produces 85 turnovers of H2 by a reductive quenching mechanism for Ru(ii)*. This work demonstrates the utility of protein architectures for linking donor and catalytic function via direct or sequential electron transfer pathways to enable stabilized charge separation which facilitates photocatalysis for solar fuel production. PMID:28451142

  3. Observation of Internal Photoinduced Electron and Hole Separation in Hybrid Two-Dimentional Perovskite Films.

    PubMed

    Liu, Junxue; Leng, Jing; Wu, Kaifeng; Zhang, Jun; Jin, Shengye

    2017-02-01

    Two-dimensional (2D) organolead halide perovskites are promising for various optoelectronic applications. Here we report a unique spontaneous charge (electron/hole) separation property in multilayered (BA) 2 (MA) n-1 Pb n I 3n+1 (BA = CH 3 (CH 2 ) 3 NH 3 + , MA = CH 3 NH 3 + ) 2D perovskite films by studying the charge carrier dynamics using ultrafast transient absorption and photoluminescence spectroscopy. Surprisingly, the 2D perovskite films, although nominally prepared as "n = 4", are found to be mixture of multiple perovskite phases, with n = 2, 3, 4 and ≈ ∞, that naturally align in the order of n along the direction perpendicular to the substrate. Driven by the band alignment between 2D perovskites phases, we observe consecutive photoinduced electron transfer from small-n to large-n phases and hole transfer in the opposite direction on hundreds of picoseconds inside the 2D film of ∼358 nm thickness. This internal charge transfer efficiently separates electrons and holes to the upper and bottom surfaces of the films, which is a unique property beneficial for applications in photovoltaics and other optoelectronics devices.

  4. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized 2H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M. Ferro-Luzzi; M. Bouwhuis; E. Passchier

    1996-09-23

    We report an absolute measurement of the tensor analyzing powers T20 and T22 in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup -1}. The novel approach of this measurement is the use of a tensor polarized 2H target internal to an electron storage ring, with in situ measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering.

  5. Definition and determination of the triplet-triplet energy transfer reaction coordinate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zapata, Felipe; Marazzi, Marco; Castaño, Obis

    2014-01-21

    A definition of the triplet-triplet energy transfer reaction coordinate within the very weak electronic coupling limit is proposed, and a novel theoretical formalism is developed for its quantitative determination in terms of internal coordinates The present formalism permits (i) the separation of donor and acceptor contributions to the reaction coordinate, (ii) the identification of the intrinsic role of donor and acceptor in the triplet energy transfer process, and (iii) the quantification of the effect of every internal coordinate on the transfer process. This formalism is general and can be applied to classical as well as to nonvertical triplet energy transfermore » processes. The utility of the novel formalism is demonstrated here by its application to the paradigm of nonvertical triplet-triplet energy transfer involving cis-stilbene as acceptor molecule. In this way the effect of each internal molecular coordinate in promoting the transfer rate, from triplet donors in the low and high-energy limit, could be analyzed in detail.« less

  6. 27 CFR 40.11 - Meaning of terms.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... Regulations. Chewing tobacco. Any leaf tobacco that is not intended to be smoked. Cigar. Any roll of tobacco... number of cigarette papers to a set before January 1, 2000 or sale price of large cigars), that... district director of internal revenue. Electronic fund transfer or EFT. Any transfer of funds effected by a...

  7. Electron transfer function versus oxygen delivery: a comparative study for several hexacoordinated globins across the animal kingdom.

    PubMed

    Kiger, Laurent; Tilleman, Lesley; Geuens, Eva; Hoogewijs, David; Lechauve, Christophe; Moens, Luc; Dewilde, Sylvia; Marden, Michael C

    2011-01-01

    Caenorhabditis elegans globin GLB-26 (expressed from gene T22C1.2) has been studied in comparison with human neuroglobin (Ngb) and cytoglobin (Cygb) for its electron transfer properties. GLB-26 exhibits no reversible binding for O(2) and a relatively low CO affinity compared to myoglobin-like globins. These differences arise from its mechanism of gaseous ligand binding since the heme iron of GLB-26 is strongly hexacoordinated in the absence of external ligands; the replacement of this internal ligand, probably the E7 distal histidine, is required before binding of CO or O(2) as for Ngb and Cygb. Interestingly the ferrous bis-histidyl GLB-26 and Ngb, another strongly hexacoordinated globin, can transfer an electron to cytochrome c (Cyt-c) at a high bimolecular rate, comparable to those of inter-protein electron transfer in mitochondria. In addition, GLB-26 displays an unexpectedly rapid oxidation of the ferrous His-Fe-His complex without O(2) actually binding to the iron atom, since the heme is oxidized by O(2) faster than the time for distal histidine dissociation. These efficient mechanisms for electron transfer could indicate a family of hexacoordinated globin which are functionally different from that of pentacoordinated globins.

  8. Cyclopropyl conjugation and ketyl anions: when do things begin to fall apart?

    PubMed

    Tanko, J M; Li, Xiangzhong; Chahma, M'hamed; Jackson, Woodward F; Spencer, Jared N

    2007-04-11

    Results pertaining to the electrochemical reduction of 1,2-diacetylcyclopropane (5), 1-acetyl-2-phenylcyclopropane (6), 1-acetyl-2-benzoylcyclopropane (7), and 1,2-dibenzoylcyclopropane (8) are reported. While 6*- exists as a discrete species, the barrier to ring opening is very small (<1 kcal/mol) and the rate constant for ring opening is >10(7) s(-1). For 7 and 8, the additional resonance stabilization afforded by the benzoyl moieties results in significantly lower rate constants for ring opening, on the order of 10(5)-10(6) s(-1). Electron transfer to 8 serves to initiate an unexpected vinylcyclopropane --> cyclopentene type rearrangement, which occurs via a radical ion chain mechanism. The results for reduction of 5 are less clear-cut: The experimental results suggest that the reduction is unexceptional, with a symmetry coefficient alpha

  9. Proton-coupled electron transfer and the role of water molecules in proton pumping by cytochrome c oxidase

    PubMed Central

    Sharma, Vivek; Enkavi, Giray; Vattulainen, Ilpo; Róg, Tomasz; Wikström, Mårten

    2015-01-01

    Molecular oxygen acts as the terminal electron sink in the respiratory chains of aerobic organisms. Cytochrome c oxidase in the inner membrane of mitochondria and the plasma membrane of bacteria catalyzes the reduction of oxygen to water, and couples the free energy of the reaction to proton pumping across the membrane. The proton-pumping activity contributes to the proton electrochemical gradient, which drives the synthesis of ATP. Based on kinetic experiments on the O–O bond splitting transition of the catalytic cycle (A → PR), it has been proposed that the electron transfer to the binuclear iron–copper center of O2 reduction initiates the proton pump mechanism. This key electron transfer event is coupled to an internal proton transfer from a conserved glutamic acid to the proton-loading site of the pump. However, the proton may instead be transferred to the binuclear center to complete the oxygen reduction chemistry, which would constitute a short-circuit. Based on atomistic molecular dynamics simulations of cytochrome c oxidase in an explicit membrane–solvent environment, complemented by related free-energy calculations, we propose that this short-circuit is effectively prevented by a redox-state–dependent organization of water molecules within the protein structure that gates the proton transfer pathway. PMID:25646428

  10. Current status of the CALET mission

    NASA Astrophysics Data System (ADS)

    Mori, Masaki

    2017-01-01

    The CALorimeteric Electron Telescope (CALET) is a Japanese-led international mission being developed as part of the utilization plan for the International Space Station (ISS). CALET was launched by an H-II B rocket utilizing the Japanese developed HTV (H-II Transfer Vehicle) in August 2015, and has been measuring high-energy electrons, cosmic rays as well as gamma rays above 10 GeV to about 10 TeV with high accuracy. In this paper we describe the current status of the CALET mission focused on gamma-ray observations.

  11. Comparison of GLONASS and GPS Time Transfers Between Two West European Time Laboratories and VNIIFTRI

    DTIC Science & Technology

    1991-12-01

    COMPARISON OF GLONASS AND GPS TIME TRANSFERS BETWEEN TWO WEST EUROPEAN TIME LABORATORIES AND VNIIFTRI P. Daly Department of Electronic and...Radiotechnical Measurements - VNIIFTRI Mendeleevo, Moscow region, 141570, USSR and W. Lewandowski, G. Petit, C. Thomas Bureau International des Poids et...00-1991 to 00-00-1991 4. TITLE AND SUBTITLE Comparison of GLONASS and GPS Time Transfers Between Two West European Time Laboratories and VNIIFTRI

  12. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized {sup 2}H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferro-Luzzi, M.; Bouwhuis, M.; Passchier, E.

    1996-09-01

    We report an absolute measurement of the tensor analyzing powers {ital T}{sub 20} and {ital T}{sub 22} in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup {minus}1}. The novel approach of this measurement is the use of a tensor polarized {sup 2}H target internal to an electron storage ring, with {ital in} {ital situ} measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering. {copyright} {ital 1996 The American Physical Society.}

  13. Quantum electron tunneling in respiratory complex I.

    PubMed

    Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

    2011-05-12

    We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. While the one-electron tunneling approximation is found to hold in electron tunneling between the antiferromagnetic binuclear and tetranuclear Fe/S clusters without major orbital or spin rearrangement of the core electrons, induced polarization of the core electrons contributes significantly to decrease the electron transfer rates to 19-56 %. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of the electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A signature of the wave properties of electrons is observed as distinct quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included is in good agreement with a reported phenomenological relation.

  14. A bioinspired redox relay that mimics radical interactions of the Tyr-His pairs of photosystem II

    NASA Astrophysics Data System (ADS)

    Megiatto, Jackson D., Jr.; Méndez-Hernández, Dalvin D.; Tejeda-Ferrari, Marely E.; Teillout, Anne-Lucie; Llansola-Portolés, Manuel J.; Kodis, Gerdenis; Poluektov, Oleg G.; Rajh, Tijana; Mujica, Vladimiro; Groy, Thomas L.; Gust, Devens; Moore, Thomas A.; Moore, Ana L.

    2014-05-01

    In water-oxidizing photosynthetic organisms, light absorption generates a powerfully oxidizing chlorophyll complex (P680•+) in the photosystem II reaction centre. This is reduced via an electron transfer pathway from the manganese-containing water-oxidizing catalyst, which includes an electron transfer relay comprising a tyrosine (Tyr)-histidine (His) pair that features a hydrogen bond between a phenol group and an imidazole group. By rapidly reducing P680•+, the relay is thought to mitigate recombination reactions, thereby ensuring a high quantum yield of water oxidation. Here, we show that an artificial reaction centre that features a benzimidazole-phenol model of the Tyr-His pair mimics both the short-internal hydrogen bond in photosystem II and, using electron paramagnetic resonance spectroscopy, the thermal relaxation that accompanies proton-coupled electron transfer. Although this artificial system is much less complex than the natural one, theory suggests that it captures the essential features that are important in the function of the relay.

  15. Network Basics.

    ERIC Educational Resources Information Center

    Tennant, Roy

    1992-01-01

    Explains how users can find and access information resources available on the Internet. Highlights include network information centers (NICs); lists, both formal and informal; computer networking protocols, including international standards; electronic mail; remote log-in; and file transfer. (LRW)

  16. Economics of electron beam and electrical discharge processing for post-combustion NO(x) control in internal combustion engines

    NASA Astrophysics Data System (ADS)

    Penetrante, B. M.

    1993-08-01

    The physics and chemistry of non-thermal plasma processing for post-combustion NO(x) control in internal combustion engines are discussed. A comparison of electron beam and electrical discharge processing is made regarding their power consumption, radical production, NO(x) removal mechanisms, and by-product formation. Pollution control applications present a good opportunity for transferring pulsed power techniques to the commercial sector. However, unless advances are made to drastically reduce the price and power consumption of electron beam sources and pulsed power systems, these plasma techniques will not become commercially competitive with conventional thermal or surface-catalytic methods.

  17. On the Theory of Oxidation-Reduction Reactions Involving Electron Transfer. V. Comparison and Properties of Electrochemical and Chemical Rate Constants

    DOE R&D Accomplishments Database

    Marcus, R. A.

    1962-01-01

    Using a theory of electron transfers which takes cognizance of reorganization of the medium outside the inner coordination shell and of changes of bond lengths inside it, relations between electrochemical and related chemical rate constants are deduced and compared with the experimental data. A correlation is found, without the use of arbitrary parameters. Effects of weak complexes with added electrolytes are included under specified conditions. The deductions offer a way of coordinating a variety of data in the two fields, internally as well as with each those in another. For example, the rate of oxidation or reduction of a series of related reactants by one reagent is correlated with that of another and with that of the corresponding electrochemical oxidation-reduction reaction, under certain specified conditions. These correlations may also provide a test for distinguishing an electron from an atom transfer mechanism. (auth)

  18. Imaging the motion of electrons in 2D semiconductor heterostructures

    NASA Astrophysics Data System (ADS)

    Dani, Keshav

    Technological progress since the late 20th century has centered on semiconductor devices, such as transistors, diodes, and solar cells. At the heart of these devices, is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. In this talk, we combine femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy to image the motion of photoexcited electrons from high-energy to low-energy states in a 2D InSe/GaAs heterostructure exhibiting a type-II band alignment. At the instant of photoexcitation, energy-resolved photoelectron images reveal a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observe the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we make a movie lasting a few tens of picoseconds of the electron transfer process in the photoexcited type-II heterostructure - a fundamental phenomenon in semiconductor devices like solar cells. Quantitative analysis and theoretical modeling of spatial variations in the video provide insight into future solar cells, electron dynamics in 2D materials, and other semiconductor devices.

  19. Improving the efficiency of water splitting in dye-sensitized solar cells by using a biomimetic electron transfer mediator

    PubMed Central

    Zhao, Yixin; Swierk, John R.; Megiatto, Jackson D.; Sherman, Benjamin; Youngblood, W. Justin; Qin, Dongdong; Lentz, Deanna M.; Moore, Ana L.; Moore, Thomas A.; Gust, Devens; Mallouk, Thomas E.

    2012-01-01

    Photoelectrochemical water splitting directly converts solar energy to chemical energy stored in hydrogen, a high energy density fuel. Although water splitting using semiconductor photoelectrodes has been studied for more than 40 years, it has only recently been demonstrated using dye-sensitized electrodes. The quantum yield for water splitting in these dye-based systems has, so far, been very low because the charge recombination reaction is faster than the catalytic four-electron oxidation of water to oxygen. We show here that the quantum yield is more than doubled by incorporating an electron transfer mediator that is mimetic of the tyrosine-histidine mediator in Photosystem II. The mediator molecule is covalently bound to the water oxidation catalyst, a colloidal iridium oxide particle, and is coadsorbed onto a porous titanium dioxide electrode with a Ruthenium polypyridyl sensitizer. As in the natural photosynthetic system, this molecule mediates electron transfer between a relatively slow metal oxide catalyst that oxidizes water on the millisecond timescale and a dye molecule that is oxidized in a fast light-induced electron transfer reaction. The presence of the mediator molecule in the system results in photoelectrochemical water splitting with an internal quantum efficiency of approximately 2.3% using blue light. PMID:22547794

  20. Trust Management - Building Trust for International Cross Disciplinary Collaboration on Climate Change

    NASA Astrophysics Data System (ADS)

    Oakley, K. V.; Gurney, R. J.

    2014-12-01

    Successful communication and collaboration entails mutual understanding, and transfer, of information. The risk of misunderstanding and/or miscommunication between collaborating groups is tackled in different ways around the globe; some are well documented whereas others may be unknown outside particular groups, whether defined geographically or by specialism. For example; in some countries legally binding contracts define the terms of collaboration. Some regions place greater emphasis on developing trust relationships, and sometimes an official agreement is implied, such as many electronic data transfers on the web. International collaboration on climate change increasingly involves electronic data exchange (e.g. open access publications, shared documents, data repositories etc.) and with this increased reliance on electronic data a need has arisen for scientists to collaborate both internationally and cross-disciplinarily particularly with information technology and data management specialists. Trust of data and metadata on the internet (e.g. privacy, legitimacy etc.) varies, possibly due to a lack of internationally agreed standards for data governance and management, leaving many national, regional and institutional practices tailored to the needs of that group only. It is proposed that building trust relationships between cross-disciplinary and international groups could help facilitate further communication, understanding and benefits from the relationship, while still maintaining independence as separate groups. Complex international cross-disciplinary group relationship dynamics are not easily mapped and producing a set of trust building rules that can be applied to any current and future collaboration with equal validity may be unfeasible. An alternative to such a set of rules may be found in a Trust Manager, whose role is to improve mutually beneficial knowledge exchange between groups, build trust and increase future collaborative potential. This presentation will report on the potential of trust management to improve international cross disciplinary climate change collaboration.

  1. Imaging the motion of electrons across semiconductor heterojunctions.

    PubMed

    Man, Michael K L; Margiolakis, Athanasios; Deckoff-Jones, Skylar; Harada, Takaaki; Wong, E Laine; Krishna, M Bala Murali; Madéo, Julien; Winchester, Andrew; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel M; Dani, Keshav M

    2017-01-01

    Technological progress since the late twentieth century has centred on semiconductor devices, such as transistors, diodes and solar cells. At the heart of these devices is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. Here, by combining femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy, we imaged the motion of photoexcited electrons from high-energy to low-energy states in a type-II 2D InSe/GaAs heterostructure. At the instant of photoexcitation, energy-resolved photoelectron images revealed a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observed the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we produced a movie lasting a few trillionths of a second of the electron-transfer process in the photoexcited type-II heterostructure-a fundamental phenomenon in semiconductor devices such as solar cells. Quantitative analysis and theoretical modelling of spatial variations in the movie provide insight into future solar cells, 2D materials and other semiconductor devices.

  2. Imaging the motion of electrons across semiconductor heterojunctions

    NASA Astrophysics Data System (ADS)

    Man, Michael K. L.; Margiolakis, Athanasios; Deckoff-Jones, Skylar; Harada, Takaaki; Wong, E. Laine; Krishna, M. Bala Murali; Madéo, Julien; Winchester, Andrew; Lei, Sidong; Vajtai, Robert; Ajayan, Pulickel M.; Dani, Keshav M.

    2017-01-01

    Technological progress since the late twentieth century has centred on semiconductor devices, such as transistors, diodes and solar cells. At the heart of these devices is the internal motion of electrons through semiconductor materials due to applied electric fields or by the excitation of photocarriers. Imaging the motion of these electrons would provide unprecedented insight into this important phenomenon, but requires high spatial and temporal resolution. Current studies of electron dynamics in semiconductors are generally limited by the spatial resolution of optical probes, or by the temporal resolution of electronic probes. Here, by combining femtosecond pump-probe techniques with spectroscopic photoemission electron microscopy, we imaged the motion of photoexcited electrons from high-energy to low-energy states in a type-II 2D InSe/GaAs heterostructure. At the instant of photoexcitation, energy-resolved photoelectron images revealed a highly non-equilibrium distribution of photocarriers in space and energy. Thereafter, in response to the out-of-equilibrium photocarriers, we observed the spatial redistribution of charges, thus forming internal electric fields, bending the semiconductor bands, and finally impeding further charge transfer. By assembling images taken at different time-delays, we produced a movie lasting a few trillionths of a second of the electron-transfer process in the photoexcited type-II heterostructure—a fundamental phenomenon in semiconductor devices such as solar cells. Quantitative analysis and theoretical modelling of spatial variations in the movie provide insight into future solar cells, 2D materials and other semiconductor devices.

  3. Crystallochromy of perylene pigments: Interference between Frenkel excitons and charge-transfer states

    NASA Astrophysics Data System (ADS)

    Gisslén, Linus; Scholz, Reinhard

    2009-09-01

    The optical properties of perylene-based pigments are arising from the interplay between neutral molecular excitations and charge transfer between adjacent molecules. In the crystalline phase, these excitations are coupled via electron and hole transfer, two quantities relating directly to the width of the conduction and valence band in the crystalline phase. Based on the crystal structure determined by x-ray diffraction, density-functional theory (DFT) and Hartree-Fock are used for the calculation of the electronic states of a dimer of stacked molecules. The resulting transfer parameters for electron and hole are used in an exciton model for the coupling between Frenkel excitons and charge-transfer states. The deformation of the positively or negatively charged molecular ions with respect to the neutral ground state is calculated with DFT and the geometry in the optically excited state is deduced from time-dependent DFT and constrained DFT. All of these deformations are interpreted in terms of the elongation of an effective internal vibration which is used subsequently in the exciton model for the crystalline phase. A comparison between the calculated dielectric function and the observed optical spectra allows to deduce the relative energetic position of Frenkel excitons and the charge-transfer state involving stack neighbors, a key parameter for various electronic and optoelectronic device applications. For five out of six perylene pigments studied in the present work, this exciton model results in excellent agreement between calculated and observed optical properties.

  4. The behavior of exciplex decay processes and interplay of radiationless transition and preliminary reorganization mechanisms of electron transfer in loose and tight pairs of reactants.

    PubMed

    Kuzmin, Michael G; Soboleva, Irina V; Dolotova, Elena V

    2007-01-18

    Exciplex emission spectra and rate constants of their decay via internal conversion and intersystem crossing are studied and discussed in terms of conventional radiationless transition approach. Exciplexes of 9-cyanophenanthrene with 1,2,3-trimethoxybenzene and 1,3,5-trimethoxybenzene were studied in heptane, toluene, butyl acetate, dichloromethane, butyronitrile, and acetonitrile. A better description of spectra and rate constants is obtained using 0-0 transition energy and Gauss broadening of vibrational bands rather than the free energy of electron transfer and reorganization energy. The coincidence of parameters describing exciplex emission spectra and dependence of exciplex decay rate constants on energy gap gives the evidence of radiationless quantum transition mechanism rather than thermally activated medium reorganization mechanism of charge recombination in exciplexes and excited charge transfer complexes (contact radical ion pairs) as well as in solvent separated radical ion pairs. Radiationless quantum transition mechanism is shown to provide an appropriate description also for the main features of exergonic excited-state charge separation reactions if fast mutual transformations of loose and tight pairs of reactants are considered. In particular, very fast electron transfer (ET) in tight pairs of reactants with strong electronic coupling of locally excited and charge transfer states can prevent the observation of an inverted region in bimolecular excited-state charge separation even for highly exergonic reactions.

  5. Inverted battery design as ion generator for interfacing with biosystems

    DOE PAGES

    Wang, Chengwei; Fu, Kun; Dai, Jiaqi; ...

    2017-07-24

    In a lithium-ion battery, electrons are released from the anode and go through an external electronic circuit to power devices, while ions simultaneously transfer through internal ionic media to meet with electrons at the cathode. Inspired by the fundamental electrochemistry of the lithium-ion battery, we envision a cell that can generate a current of ions instead of electrons, so that ions can be used for potential applications in biosystems. Based on this concept, we report an ‘electron battery’ configuration in which ions travel through an external circuit to interact with the intended biosystem whereas electrons are transported internally. As amore » proof-of-concept, we demonstrate the application of the electron battery by stimulating a monolayer of cultured cells, which fluoresces a calcium ion wave at a controlled ionic current. Electron batteries with the capability to generate a tunable ionic current could pave the way towards precise ion-system control in a broad range of biological applications« less

  6. Inverted battery design as ion generator for interfacing with biosystems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Chengwei; Fu, Kun; Dai, Jiaqi

    In a lithium-ion battery, electrons are released from the anode and go through an external electronic circuit to power devices, while ions simultaneously transfer through internal ionic media to meet with electrons at the cathode. Inspired by the fundamental electrochemistry of the lithium-ion battery, we envision a cell that can generate a current of ions instead of electrons, so that ions can be used for potential applications in biosystems. Based on this concept, we report an ‘electron battery’ configuration in which ions travel through an external circuit to interact with the intended biosystem whereas electrons are transported internally. As amore » proof-of-concept, we demonstrate the application of the electron battery by stimulating a monolayer of cultured cells, which fluoresces a calcium ion wave at a controlled ionic current. Electron batteries with the capability to generate a tunable ionic current could pave the way towards precise ion-system control in a broad range of biological applications« less

  7. Inverted battery design as ion generator for interfacing with biosystems

    PubMed Central

    Wang, Chengwei; Fu, Kun (Kelvin); Dai, Jiaqi; Lacey, Steven D.; Yao, Yonggang; Pastel, Glenn; Xu, Lisha; Zhang, Jianhua; Hu, Liangbing

    2017-01-01

    In a lithium-ion battery, electrons are released from the anode and go through an external electronic circuit to power devices, while ions simultaneously transfer through internal ionic media to meet with electrons at the cathode. Inspired by the fundamental electrochemistry of the lithium-ion battery, we envision a cell that can generate a current of ions instead of electrons, so that ions can be used for potential applications in biosystems. Based on this concept, we report an ‘electron battery’ configuration in which ions travel through an external circuit to interact with the intended biosystem whereas electrons are transported internally. As a proof-of-concept, we demonstrate the application of the electron battery by stimulating a monolayer of cultured cells, which fluoresces a calcium ion wave at a controlled ionic current. Electron batteries with the capability to generate a tunable ionic current could pave the way towards precise ion-system control in a broad range of biological applications. PMID:28737174

  8. Designed Proteins as Optimized Oxygen Carriers for Artificial Blood

    DTIC Science & Technology

    2013-02-01

    to the lower energy for electron transfer when coupled to a proton transfer from water (3). Thus we set out to compare the rate of solvent...binding affinities and reduction potentials are the sole result of differences in internal electric fields in these proteins wrought by the surface...serving as the source of potential energy for the hexa- to penta-coordinate conformational change, and one in which the b-position glutamates from

  9. Innovating the Standard Procurement System Utilizing Intelligent Agent Technologies

    DTIC Science & Technology

    1999-12-01

    36 C. STANDARD PROCUREMENT SYSTEM 36 1. OVERVIEW 36 2. SPS FUNCTIONS , 37 3. SPS ADVANTAGES 39 4. SPS DISADVANTAGES 40 5. SPS SUMMARY 41 D...PROCUREMENT PROCESS INNOVATION RESULTS ’. 52 E. INTELLIGENT AGENT (IA) TECHNOLOGY 53 1. OVERVIEW 54 viii 2. ADVANTAGES 58 3. DISADVANTAGES 58 F...Electronic Mall (EMALL), GSA Advantage , etc. • Web invoicing Electronic Funds Transfer (EFT) • • International Merchant Purchase Authorization Card (IMPAC

  10. International Space Station Alpha's bearing, motor, and roll ring module developmental testing and results

    NASA Technical Reports Server (NTRS)

    Obrien, David L.

    1994-01-01

    This paper presents the design and developmental testing associated with the bearing, motor, and roll ring module (BMRRM) used for the beta rotation axis on International Space Station Alpha (ISSA). The BMRRM with its controllers located in the electronic control unit (ECU), provides for the solar array pointing and tracking functions as well as power and signal transfer across a rotating interface.

  11. Quantum Electron Tunneling in Respiratory Complex I1

    PubMed Central

    Hayashi, Tomoyuki; Stuchebrukhov, Alexei A.

    2014-01-01

    We have simulated the atomistic details of electronic wiring of all Fe/S clusters in complex I, a key enzyme in the respiratory electron transport chain. The tunneling current theory of many-electron systems is applied to the broken-symmetry (BS) states of the protein at the ZINDO level. One-electron tunneling approximation is found to hold in electron tunneling between the anti-ferromagnetic binuclear and tetranuclear Fe/S clusters with moderate induced polarization of the core electrons. Calculated tunneling energy is about 3 eV higher than Fermi level in the band gap of the protein, which supports that the mechanism of electron transfer is quantum mechanical tunneling, as in the rest of electron transport chain. Resulting electron tunneling pathways consist of up to three key contributing protein residues between neighboring Fe/S clusters. A distinct signature of the wave properties of electrons is observed as quantum interferences when multiple tunneling pathways exist. In N6a-N6b, electron tunnels along different pathways depending on the involved BS states, suggesting possible fluctuations of the tunneling pathways driven by the local protein environment. The calculated distance dependence of the electron transfer rates with internal water molecules included are in good agreement with a reported phenomenological relation. PMID:21495666

  12. Electron transfer in silicon-bridged adjacent chromophores: the source for blue-green emission.

    PubMed

    Bayda, Malgorzata; Angulo, Gonzalo; Hug, Gordon L; Ludwiczak, Monika; Karolczak, Jerzy; Koput, Jacek; Dobkowski, Jacek; Marciniak, Bronislaw

    2017-05-10

    Si-Bridged chromophores have been proposed as sources for blue-green emission in several technological applications. The origin of this dual emission is to be found in an internal charge transfer reaction. The current work is an attempt to describe the details of these processes in these kinds of substances, and to design a molecular architecture to improve their performance. Nuclear motions essential for intramolecular charge transfer (ICT) can involve processes from twisted internal moieties to dielectric relaxation of the solvent. To address these issues, we studied ICT between adjacent chromophores in a molecular compound containing N-isopropylcarbazole (CBL) and 1,4-divinylbenzene (DVB) linked by a dimethylsilylene bridge. In nonpolar solvents emission arises from the local excited state (LE) of carbazole whereas in solvents of higher polarity dual emission was detected (LE + ICT). The CT character of the additional emission band was concluded from the linear dependence of the fluorescence maxima on solvent polarity. Electron transfer from CBL to DVB resulted in a large excited-state dipole moment (37.3 D) as determined from a solvatochromic plot and DFT calculations. Steady-state and picosecond time-resolved fluorescence experiments in butyronitrile (293-173 K) showed that the ICT excited state arises from the LE state of carbazole. These results were analyzed and found to be in accordance with an adiabatic version of Marcus theory including solvent relaxation.

  13. Hydrodynamic and thermal modeling of two-dimensional microdroplet arrays for digitized heat transfer

    NASA Astrophysics Data System (ADS)

    Baird, Eric S.

    This document describes hydrodynamic and thermal modeling of two-dimensional microdroplet arrays for use in digitized heat transfer (DHT), a novel active thermal management technique for high power density electronics and integrated microsystems. In DHT, thermal energy is transported by a discrete array of electrostatically activated microdroplets of liquid metals, alloys or aqueous solutions with the potential of supporting significantly higher heat transfer rates than classical air-cooled heat sinks. Actuation methods for dispensing and transporting individual fluid slugs with a high degree of precision and programmability are described, with simple approximate formulae for net forces for steady state and transient velocities in terms of known parameters. A modified cavity flow solver is developed to provide details on the internal flow properties of a translating microdroplet and used to detail the effects of droplet curvature, internal mixing, Peclet number and other parameters on the heat transfer capabilities of a discretized liquid flow. The concept of Nusselt number is generalized to an individual fluid slug and shown to oscillate with a period equal to the droplet's mixing rate. In whole, DHT is demonstrated to be a viable new alternative for achieving the most important objectives of electronic cooling (i.e., minimization of the maximum substrate temperature, reduction of the substrate temperature gradient and removal of substrate hot spots) and a sound fundamental description of the method's electro-, hydro- and thermodynamics is provided.

  14. Proton-Coupled Electron Transfer in Artificial Photosynthetic Systems.

    PubMed

    Mora, S Jimena; Odella, Emmanuel; Moore, Gary F; Gust, Devens; Moore, Thomas A; Moore, Ana L

    2018-02-20

    Artificial photosynthetic constructs can in principle operate more efficiently than natural photosynthesis because they can be rationally designed to optimize solar energy conversion for meeting human demands rather than the multiple needs of an organism competing for growth and reproduction in a complex ecosystem. The artificial photosynthetic constructs described in this Account consist primarily of covalently linked synthetic chromophores, electron donors and acceptors, and proton donors and acceptors that carry out the light absorption, electron transfer, and proton-coupled electron transfer (PCET) processes characteristic of photosynthetic cells. PCET is the movement of an electron from one site to another accompanied by proton transfer. PCET and the transport of protons over tens of angstroms are important in all living cells because they are a fundamental link between redox processes and the establishment of transmembrane gradients of proton electrochemical potential, known as proton-motive force (PMF), which is the unifying concept in bioenergetics. We have chosen a benzimidazole phenol (BIP) system as a platform for the study of PCET because with appropriate substitutions it is possible to design assemblies in which one or multiple proton transfers can accompany oxidation of the phenol. In BIP, oxidation of the phenol increases its acidity by more than ten pK a units; thus, electrochemical oxidation of the phenol is associated with a proton transfer to the imidazole. This is an example of a PCET process involving transfer of one electron and one proton, known as electron-proton transfer (EPT). When the benzimidazole moiety of BIP is substituted at the 4-position with good proton acceptor groups such as aliphatic amines, experimental and theoretical results indicate that two proton transfers occur upon one-electron oxidation of the phenol. This phenomenon is described as a one-electron-two-proton transfer (E2PT) process and results in translocation of protons over ∼7 Å via a Grotthuss-type mechanism, where the protons traverse a network of internally H-bonded sites. In the case of the E2TP process involving BIP analogues with amino group substituents, the thermodynamic price paid in redox potential to move a proton to the final proton acceptor is ∼300 mV. In this example, the decrease in redox potential limits the oxidizing power of the resulting phenoxyl radical. Thus, unlike the biological counterpart, the artificial construct is thermodynamically incapable of effectively advancing the redox state of a water oxidation catalyst. The design of systems where multiple proton transfer events are coupled to an oxidation reaction while a relatively high redox potential is maintained remains an outstanding challenge. The ability to control proton transfer and activity at defined distances and times is key to achieving proton management in the vicinity of catalysts operating at low overpotential in myriad biochemically important processes. Artificial photosynthetic constructs with well-defined structures, such as the ones described in this Account, can provide the means for discovering design principles upon which efficient redox catalysts for electrolysis and fuel cells can be based.

  15. Light and colour as analytical detection tools: a journey into the periodic table using polyamines to bio-inspired systems as chemosensors.

    PubMed

    Lodeiro, Carlos; Capelo, José Luis; Mejuto, Juan Carlos; Oliveira, Elisabete; Santos, Hugo M; Pedras, Bruno; Nuñez, Cristina

    2010-08-01

    This critical review describes some developments on the chemistry of fluorescent and colorimetric molecular probes or chemosensors, based on polyamines and associated compounds having oxygen and/or sulfur as donor atoms. The reported systems are essentially based on some selected published work in this field in the last five years, and in the work developed by the authors from 2000 onwards. Some interesting properties beyond sensing molecules, ions or/and cations by fluorescence, colorimetry as well as by MALDI-TOF MS spectrometry can arise from these systems. A short brief on different examples activated by PET (photoinduced electron transfer), ICT (internal charge transfer) and EET (electronic energy transfer) phenomena will be provided. Finally the introduction of bio-inspired compounds derived from emissive amino acid or short peptide systems and nanoparticle devices to detect metal ions will be reviewed (202 references).

  16. Tensor Analyzing Powers for Quasi-Elastic Electron Scattering from Deuterium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Z.-L. Zhou; M. Bouwhuis; M. Ferro-Luzzi

    1999-01-01

    We report on a first measurement of tensor analyzing powers in quasi-elastic electron-deuteron scattering at an average three-momentum transfer of 1.7 fm{sup -1}. Data sensitive to the spin-dependent nucleon density in the deuteron were obtained for missing momenta up to 150 MeV/c with a tensor polarized {sup 2}H target internal to an electron storage ring. The data are well described by a calculation that includes the effects of final-state interaction, meson-exchange and isobar currents, and leading-order relativistic contributions.

  17. Thermal-Diode Sandwich Panel

    NASA Technical Reports Server (NTRS)

    Basiulis, A.

    1986-01-01

    Thermal diode sandwich panel transfers heat in one direction, but when heat load reversed, switches off and acts as thermal insulator. Proposed to control temperature in spacecraft and in supersonic missiles to protect internal electronics. In combination with conventional heat pipes, used in solar panels and other heat-sensitive systems.

  18. Approaches to eliminating chlorofluorocarbon use in manufacturing.

    PubMed Central

    Boyhan, W S

    1992-01-01

    Until quite recently, chlorofluorocarbons (CFCs) had been considered the safest and most benign of industrial chemicals. Their physical and chemical properties made them an integral part of manufacturing processes for electronics products. The recognition that CFCs destroy the stratospheric ozone layer, with consequent enormous consequences to all forms of life on earth, has led to international agreements which will end virtually all possibly before. This impending phaseout of CFCs has caused electronics manufacturers to examine alternative chemicals and processing methods. This manuscript documents the steps AT&T has taken to reach its goal of 100% phaseout of CFCs by years-end 1994. These actions include top-down management support with combined bottom-up thrusts, an internal information gathering and dissemination center, internal technology transfer, and external corporate activism. Images PMID:11607258

  19. Carbon fiber enhanced bioelectricity generation in soil microbial fuel cells.

    PubMed

    Li, Xiaojing; Wang, Xin; Zhao, Qian; Wan, Lili; Li, Yongtao; Zhou, Qixing

    2016-11-15

    The soil microbial fuel cell (MFC) is a promising biotechnology for the bioelectricity recovery as well as the remediation of organics contaminated soil. However, the electricity production and the remediation efficiency of soil MFC are seriously limited by the tremendous internal resistance of soil. Conductive carbon fiber was mixed with petroleum hydrocarbons contaminated soil and significantly enhanced the performance of soil MFC. The maximum current density, the maximum power density and the accumulated charge output of MFC mixed carbon fiber (MC) were 10, 22 and 16 times as high as those of closed circuit control due to the carbon fiber productively assisted the anode to collect the electron. The internal resistance of MC reduced by 58%, 83% of which owed to the charge transfer resistance, resulting in a high efficiency of electron transfer from soil to anode. The degradation rates of total petroleum hydrocarbons enhanced by 100% and 329% compared to closed and opened circuit controls without the carbon fiber respectively. The effective range of remediation and the bioelectricity recovery was extended from 6 to 20cm with the same area of air-cathode. The mixed carbon fiber apparently enhanced the bioelectricity generation and the remediation efficiency of soil MFC by means of promoting the electron transfer rate from soil to anode. The use of conductively functional materials (e.g. carbon fiber) is very meaningful for the remediation and bioelectricity recovery in the bioelectrochemical remediation. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Non-Transition-Metal Catalytic System for N 2 Reduction to NH 3: A Density Functional Theory Study of Al-Doped Graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tian, Yong-Hui; Hu, Shuangli; Sheng, Xiaolan

    The prevalent catalysts for natural and artificial N 2 fixation are known to hinge upon transition-metal (TM) elements. In this paper, we demonstrate by density functional theory that Al-doped graphene is a potential non-TM catalyst to convert N 2 to NH 3 in the presence of relatively mild proton/electron sources. In the integrated structure of the catalyst, the Al atom serves as a binding site and catalytic center while the graphene framework serves as an electron buffer during the successive proton/electron additions to N 2 and its various downstream N xH y intermediates. The initial hydrogenation of N 2 canmore » readily take place via an internal H-transfer process with the assistance of a Li + ion as an additive. Finally, in view of the recurrence of H transfer in the first step of N 2 reduction observed in biological nitrogenases and other synthetic catalysts, this finding highlights the significance of heteroatom-assisted H transfer in the design of synthetic catalysts for N 2 fixation.« less

  1. MD studies of electron transfer at ambient and elevated pressures

    NASA Astrophysics Data System (ADS)

    Giles, Alex; Spooner, Jacob; Weinberg, Noham

    2013-06-01

    The effect of pressure on the rate constants of outer-sphere electron transfer reactions has often been described using the Marcus-Hush theory. This theory agrees well with experiment when internal reorganization of the ionic system is negligible, however it does not offer a recipe for calculation of the effects that result from significant solute restructuring. We have recently developed a molecular dynamics technique that accurately describes structural dependence of molecular volumes in non-polar and weakly polar systems. We are now extending this approach to the case of highly polar ionic systems where both solvent and solute restructuring components are important. For this purpose we construct pressure-dependent two-dimensional surfaces for electron transfer reactions in coordinate system composed of interionic distance and Marcus-type solvent polarization coordinate, and use these surfaces to describe pressure effects on reaction kinetics. R.A. Marcus. J. Chem. Phys. 24, 966 (1956); 24, 979 (1956); 26, 867 (1957). Discuss. Faraday Soc. 29, 21 (1960). Faraday Discuss. Chem. Soc. 74, 7 (1982); N.S. Hush. Trans. Faraday Soc. 57, 557 (1961).

  2. Non-Transition-Metal Catalytic System for N 2 Reduction to NH 3: A Density Functional Theory Study of Al-Doped Graphene

    DOE PAGES

    Tian, Yong-Hui; Hu, Shuangli; Sheng, Xiaolan; ...

    2018-01-16

    The prevalent catalysts for natural and artificial N 2 fixation are known to hinge upon transition-metal (TM) elements. In this paper, we demonstrate by density functional theory that Al-doped graphene is a potential non-TM catalyst to convert N 2 to NH 3 in the presence of relatively mild proton/electron sources. In the integrated structure of the catalyst, the Al atom serves as a binding site and catalytic center while the graphene framework serves as an electron buffer during the successive proton/electron additions to N 2 and its various downstream N xH y intermediates. The initial hydrogenation of N 2 canmore » readily take place via an internal H-transfer process with the assistance of a Li + ion as an additive. Finally, in view of the recurrence of H transfer in the first step of N 2 reduction observed in biological nitrogenases and other synthetic catalysts, this finding highlights the significance of heteroatom-assisted H transfer in the design of synthetic catalysts for N 2 fixation.« less

  3. Charge-transfer-to-solvent reactions from I{sup −} to water, methanol, and ethanol studied by time-resolved photoelectron spectroscopy of liquids

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okuyama, Haruki; Karashima, Shutaro; Suzuki, Toshinori, E-mail: suzuki@kuchem.kyoto-u.ac.jp

    The charge-transfer-to-solvent (CTTS) reactions from iodide (I{sup −}) to H{sub 2}O, D{sub 2}O, methanol, and ethanol were studied by time-resolved photoelectron spectroscopy of liquid microjets using a magnetic bottle time-of-flight spectrometer with variable pass energy. Photoexcited iodide dissociates into a weak complex (a contact pair) of a solvated electron and an iodine atom in similar reaction times, 0.3 ps in H{sub 2}O and D{sub 2}O and 0.5 ps in methanol and ethanol, which are much shorter than their dielectric relaxation times. The results indicate that solvated electrons are formed with minimal solvent reorganization in the long-range solvent polarization field createdmore » for I{sup −}. The photoelectron spectra for CTTS in H{sub 2}O and D{sub 2}O—measured with higher accuracy than in our previous study [Y. I. Suzuki et al., Chem. Sci. 2, 1094 (2011)]—indicate that internal conversion yields from the photoexcited I{sup −*} (CTTS) state are less than 10%, while alcohols provide 2–3 times greater yields of internal conversion from I{sup −*}. The overall geminate recombination yields are found to be in the order of H{sub 2}O > D{sub 2}O > methanol > ethanol, which is opposite to the order of the mutual diffusion rates of an iodine atom and a solvated electron. This result is consistent with the transition state theory for an adiabatic outer-sphere electron transfer process, which predicts that the recombination reaction rate has a pre-exponential factor inversely proportional to a longitudinal solvent relaxation time.« less

  4. Studying electron-PAG interactions using electron-induced fluorescence

    NASA Astrophysics Data System (ADS)

    Narasimhan, Amrit; Grzeskowiak, Steven; Ostrander, Jonathan; Schad, Jonathon; Rebeyev, Eliran; Neisser, Mark; Ocola, Leonidas E.; Denbeaux, Gregory; Brainard, Robert L.

    2016-03-01

    In extreme ultraviolet (EUV) lithography, 92 eV photons are used to expose photoresists. Typical EUV resists are organic-based and chemically amplified using photoacid generators (PAGs). Upon exposure, PAGs produce acids which catalyze reactions that result in changes in solubility. In EUV lithography, photo- and secondary electrons (energies of 10- 80 eV) play a large role in PAG acid-production. Several mechanisms for electron-PAG interactions (e.g. electron trapping, and hole-initiated chemistry) have been proposed. The aim of this study is to explore another mechanism - internal excitation - in which a bound PAG electron can be excited by receiving energy from another energetic electron, causing a reaction that produces acid. This paper explores the mechanism of internal excitation through the analogous process of electron-induced fluorescence, in which an electron loses energy by transferring that energy to a molecule and that molecule emits a photon rather than decomposing. We will show and quantify electron-induced fluorescence of several fluorophores in polymer films to mimic resist materials, and use this information to refine our proposed mechanism. Relationships between the molecular structure of fluorophores and fluorescent quantum yield may aid in the development of novel PAGs for EUV lithography.

  5. Barrier-free proton transfer in the valence anion of 2'-deoxyadenosine-5'-monophosphate. II. A computational study.

    PubMed

    Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy

    2008-01-28

    The propensity of four representative conformations of 2(')-deoxyadenosine-5(')-monophosphate (5(')-dAMPH) to bind an excess electron has been studied at the B3LYP6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5(')-dAMPH form adiabatically stable anions. The type of an anionic 5(')-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4(')-C5(') bond. The adiabatic electron affinity of the a_south-syn anion is 1.19 eV, while its vertical detachment energy is 1.89 eV. Our results are compared with the photoelectron spectrum (PES) of 5(')-dAMPH(-) measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.

  6. Barrier-free proton transfer in the valence anion of 2'-deoxyadenosine-5'-monophosphate. II. A computational study

    NASA Astrophysics Data System (ADS)

    Kobyłecka, Monika; Gu, Jiande; Rak, Janusz; Leszczynski, Jerzy

    2008-01-01

    The propensity of four representative conformations of 2'-deoxyadenosine-5'-monophosphate (5'-dAMPH) to bind an excess electron has been studied at the B3LYP /6-31++G(d,p) level. While isolated canonical adenine does not support stable valence anions in the gas phase, all considered neutral conformations of 5'-dAMPH form adiabatically stable anions. The type of an anionic 5'-dAMPH state, i.e., the valence, dipole bound, or mixed (valence/dipole bound), depends on the internal hydrogen bond(s) pattern exhibited by a particular tautomer. The most stable anion results from an electron attachment to the neutral syn-south conformer. The formation of this anion is associated with a barrier-free proton transfer triggered by electron attachment and the internal rotation around the C4'-C5' bond. The adiabatic electron affinity of the a&barbelow;south-syn anion is 1.19eV, while its vertical detachment energy is 1.89eV. Our results are compared with the photoelectron spectrum (PES) of 5'-dAMPH- measured recently by Stokes et al., [J. Chem. Phys. 128, 044314 (2008)]. The computational VDE obtained for the most stable anionic structure matches well with the experimental electron binding energy region of maximum intensity. A further understanding of DNA damage might require experimental and computational studies on the systems in which purine nucleotides are engaged in hydrogen bonding.

  7. International Conference on Electronic Processes in Organic Materials (6th) Held in Gurzuf, Crimea, Ukraine, on September 25-29, 2006

    DTIC Science & Technology

    2006-09-29

    MEH-PPV and blends MEH-PPV/fullerene derivative to investigate the charge transfer process . Microstructure - properties correlation of blends polymer...liquid crystals 4. Nonlinear properties of organic structures and composites 5. Electronic processes within polymer composites 6. Nanostructures. Polymer...P.A.Kondratenko, Yu.M.Lopatkin, TN.Sakun. SPECTROSCOPIC PROPERTIES AND PROCESSES OF PHOTODISSOCIATION OF DYES ....... 32 D.-Q. Feng, D. Wisbey, Y. Ta4 Ya. B

  8. Organic sensitizers from D-π-A to D-A-π-A: effect of the internal electron-withdrawing units on molecular absorption, energy levels and photovoltaic performances.

    PubMed

    Wu, Yongzhen; Zhu, Weihong

    2013-03-07

    The high performance and low cost of dye-sensitized solar cells (DSSCs) have drawn great interest from both academic and industrial circles. The research on exploring novel efficient sensitizers, especially on inexpensive metal-free pure organic dyes, has never been suspended. The donor-π bridge-acceptor (D-π-A) configuration is mainstream in the design of organic sensitizers due to its convenient modulation of the intramolecular charge-transfer nature. Recently, it has been found that incorporation of additional electron-withdrawing units (such as benzothiadiazole, benzotriazole, quinoxaline, phthalimide, diketopyrrolopyrrole, thienopyrazine, thiazole, triazine, cyanovinyl, cyano- and fluoro-substituted phenyl) into the π bridge as internal acceptors, termed the D-A-π-A configuration, displays several advantages such as tuning of the molecular energy levels, red-shift of the charge-transfer absorption band, and distinct improvement of photovoltaic performance and stability. We apply the D-A-π-A concept broadly to the organic sensitizers containing additional electron-withdrawing units between electron donors and acceptors. This review is projected to summarize the category of pure organic sensitizers on the basis of the D-A-π-A feature. By comparing the structure-property relationship of typical photovoltaic D-A-π-A dyes, the important guidelines in the design of such materials are highlighted.

  9. Direct Observation of Pressure-Driven Valence Electron Transfer in Ba 3 BiRu 2 O 9 , Ba 3 BiIr 2 O 9 , and Ba 4 BiIr 3 O 12

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blanchard, Peter E. R.; Chapman, Karena W.; Heald, Steve M.

    The hexagonal perovskites Ba3BiIr2O9, Ba3BiRu2O9 and Ba4BiIr3O12 all undergo pressure-induced 1% volume collapses above 5 GPa. These first-order transitions have been ascribed to internal transfer of valence electrons between bismuth and iridium/ruthenium, which is driven by external applied pressure because the reduction in volume achieved by emptying the 6s shell of bismuth upon oxidation to Bi5+ is greater in magnitude than the increase in volume by reducing iridium or ruthenium. Here, we report direct observation of these valence transfers for the first time, using high-pressure X-ray absorption near-edge spectroscopy (XANES) measurements. Our data also support the highly unusual “4+” nominalmore » oxidation state of bismuth in these compounds, although the possibility of local disproportionation into Bi3+/Bi5+ cannot be definitively ruled out. Ab initio calculations reproduce the transition, support its interpretation as a valence electron transfer from Bi to Ir/Ru, and suggest that the high-pressure phase may show metallic behavior (in contrast to the insulating ambient-pressure phase).« less

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Inhester, Ludger; Oostenrijk, Bart; Patanen, Minna

    In many cases fragmentation of molecules upon inner-shell ionization is very unspecific with respect to the initially localized ionization site. Often this finding is interpreted in terms of an equilibration of internal energy into vibrational degrees of freedom after Auger decay. In this paper, we investigate the X-ray photofragmentation of ethyl trifluoroacetate upon core electron ionization at environmentally distinct carbon sites using photoelectron–photoion–photoion coincidence measurements and ab initio electronic structure calculations. For all four carbon ionization sites, the Auger decay weakens the same bonds and transfers the two charges to opposite ends of the molecule, which leads to a rapidmore » dissociation into three fragments, followed by further fragmentation steps. Finally, the lack of site specificity is attributed to the character of the dicationic electronic states after Auger decay instead of a fast equilibration of internal energy.« less

  11. The central active site arginine in sulfite oxidizing enzymes alters kinetic properties by controlling electron transfer and redox interactions.

    PubMed

    Hsiao, Ju-Chun; McGrath, Aaron P; Kielmann, Linda; Kalimuthu, Palraj; Darain, Farzana; Bernhardt, Paul V; Harmer, Jeffrey; Lee, Mihwa; Meyers, Kimberley; Maher, Megan J; Kappler, Ulrike

    2018-01-01

    A central conserved arginine, first identified as a clinical mutation leading to sulfite oxidase deficiency, is essential for catalytic competency of sulfite oxidizing molybdoenzymes, but the molecular basis for its effects on turnover and substrate affinity have not been fully elucidated. We have used a bacterial sulfite dehydrogenase, SorT, which lacks an internal heme group, but transfers electrons to an external, electron accepting cytochrome, SorU, to investigate the molecular functions of this arginine residue (Arg78). Assay of the SorT Mo centre catalytic competency in the absence of SorU showed that substitutions in the central arginine (R78Q, R78K and R78M mutations) only moderately altered SorT catalytic properties, except for R78M which caused significant reduction in SorT activity. The substitutions also altered the Mo-centre redox potentials (Mo VI/V potential lowered by ca. 60-80mV). However, all Arg78 mutations significantly impaired the ability of SorT to transfer electrons to SorU, where activities were reduced 17 to 46-fold compared to SorT WT , precluding determination of kinetic parameters. This was accompanied by the observation of conformational changes in both the introduced Gln and Lys residues in the crystal structure of the enzymes. Taking into account data collected by others on related SOE mutations we propose that the formation and maintenance of an electron transfer complex between the Mo centre and electron accepting heme groups is the main function of the central arginine, and that the reduced turnover and increases in K Msulfite are caused by the inefficient operation of the oxidative half reaction of the catalytic cycle in enzymes carrying these mutations. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Electron Raman scattering in a strained ZnO/MgZnO double quantum well

    NASA Astrophysics Data System (ADS)

    Mojab-abpardeh, M.; Karimi, M. J.

    2018-02-01

    In this work, the electron Raman scattering in a strained ZnO / MgZnO double quantum wells is studied. The energy eigenvalues and the wave functions are obtained using the transfer matrix method. The effects of Mg composition, well width and barrier width on the internal electric field in well and barrier layers are investigated. Then, the influences of these parameters on the differential cross-section of electron Raman scattering are studied. Results indicate that the position, magnitude and the number of the peaks depend on the Mg composition, well width and barrier width.

  13. PROPOSED ASTM METHOD FOR THE DETERMINATION OF ASBESTOS IN AIR BY TEM AND INFORMATION ON INTERFERING FIBERS

    EPA Science Inventory

    The draft of the ASTM Test Method for air entitled: "Airborne Asbestos Concentration in Ambient and Indoor Atmospheres as Determined by Transmission Electron Microscopy Direct Transfer (TEM)" (ASTM Z7077Z) is an adaptation of the International Standard, ISO 10312. It is currently...

  14. A Study of Trends in the Demand for Information Transfer. Final Report.

    ERIC Educational Resources Information Center

    Hough, R. W.; And Others

    The scope of the research reported here is summarized as follows: (1) consider items of information that could conceivably be transmitted electrically or electronically, (2) concentrate on domestic U.S. rather than international traffic, (3) concentrate on point-to-point service, (4) consider data collection and broadcasting services only as they…

  15. 12 CFR 701.30 - Services for nonmembers within the field of membership.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 6 2011-01-01 2011-01-01 false Services for nonmembers within the field of membership. 701.30 Section 701.30 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS... international and domestic electronic fund transfers); and (b) Cashing checks and money orders and receiving...

  16. 12 CFR 701.30 - Services for nonmembers within the field of membership.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Services for nonmembers within the field of membership. 701.30 Section 701.30 Banks and Banking NATIONAL CREDIT UNION ADMINISTRATION REGULATIONS... international and domestic electronic fund transfers); and (b) Cashing checks and money orders and receiving...

  17. Theoretical Characterization of Charge Transport in Chromia (α-Cr2O3)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Iordanova, Nellie I.; Dupuis, Michel; Rosso, Kevin M.

    2005-08-15

    Transport of conduction electrons and holes through the lattice of ?-Cr2O3 (chromia) is modeled as a valence alternation of chromium cations using ab initio electronic structure calculations and electron transfer theory. In the context of the small polaron model, a cluster approach was used to compute quantities controlling the mobility of localized electrons and holes, i.e. the reorganization energy and the electronic coupling matrix element that enter Marcus? theory. The calculation of the electronic coupling followed the Generalized Mulliken-Hush approach and the quasi-diabatic method using the complete active space self-consistent field (CASSCF) method. Our findings indicate that hole mobility ismore » more than three orders of magnitude larger than electron mobility in both (001) and [001] lattice directions. The difference arises mainly from the larger internal reorganization energy calculated for electron transport relative to hole transport processes while electronic couplings have similar magnitudes. The much larger hole mobility vs electron mobility in ?-Cr2O3 is in contrast to similar hole and electron mobility in hematite ?-Fe2O3 previously calculated. Our calculations also indicate that the electronic coupling for all charge transfer processes of interest is smaller than for the corresponding processes in hematite. This variation is attributed to weaker interaction between the metal 3d states and the O(2p) states in chromia than in hematite, leading to smaller overlap between the charge transfer donor and acceptor wavefunctions and smaller super-exchange coupling in chromia. Nevertheless, the weaker coupling in chromia is still sufficiently large to suggest that charge transport processes in chromia are adiabatic in nature. The electronic coupling is found to depend on both the superexchange interaction through the bridging oxygen atoms and the d-shell electron spin coupling within the Cr-Cr donor-acceptor pair, while the reorganization energy is essentially independent of the electron spin coupling.« less

  18. Theoretical characterization of charge transport in chromia (α-Cr2O3)

    NASA Astrophysics Data System (ADS)

    Iordanova, N.; Dupuis, M.; Rosso, K. M.

    2005-08-01

    Transport of conduction electrons and holes through the lattice of α-Cr2O3 (chromia) is modeled as a valence alternation of chromium cations using ab initio electronic structure calculations and electron-transfer theory. In the context of the small polaron model, a cluster approach was used to compute quantities controlling the mobility of localized electrons and holes, i.e., the reorganization energy and the electronic coupling matrix element that enter Marcus' theory. The calculation of the electronic coupling followed the generalized Mulliken-Hush approach using the complete active space self-consistent-field (CASSCF) method and the quasidiabatic method. Our findings indicate that hole mobility is more than three orders of magnitude larger than electron mobility in both (001) and [001] lattice directions. The difference arises mainly from the larger internal reorganization energy calculated for electron-transport relative to hole-transport processes while electronic couplings have similar magnitudes. The much larger hole mobility versus electron mobility in α-Cr2O3 is in contrast to similar hole and electron mobilities in hematite α-Fe2O3 previously calculated. Our calculations also indicate that the electronic coupling for all charge-transfer processes of interest is smaller than for the corresponding processes in hematite. This variation is attributed to the weaker interaction between the metal 3d states and the O(2p ) states in chromia than in hematite, leading to a smaller overlap between the charge-transfer donor and acceptor wave functions and smaller superexchange coupling in chromia. Nevertheless, the weaker coupling in chromia is still sufficiently large to suggest that charge-transport processes in chromia are adiabatic in nature. The electronic coupling is found to depend on both the superexchange interaction through the bridging oxygen atoms and the d-shell electron-spin coupling within the Cr-Cr donor-acceptor pair, while the reorganization energy is essentially independent of the electron-spin coupling.

  19. Multicomponent patterned ultrathin carbon nanomembranes by laser ablation

    NASA Astrophysics Data System (ADS)

    Frese, Natalie; Scherr, Julian; Beyer, André; Terfort, Andreas; Gölzhäuser, Armin; Hampp, Norbert; Rhinow, Daniel

    2018-01-01

    Carbon nanomembranes (CNMs) are a class of two-dimensional materials, which are obtained by electron beam-induced crosslinking of aromatic self-assembled monolayers (SAMs) on solid substrates. CNMs made from a single type of precursor molecule are uniform with homogeneous chemical and physical properties. We have developed a method for the fabrication of internally patterned CNMs resembling a key feature of biological membranes. Direct laser patterning is used to obtain multicomponent patterned SAMs on gold, which are subsequently crosslinked by electron irradiation. We demonstrate that the structure of internally patterned CNMs is preserved upon transfer to different substrates. The method enables rapid fabrication of patterned 2D materials with local variations in chemical and physical properties on the micrometer to centimeter scale.

  20. Chemical Understanding of the Limited Site-Specificity in Molecular Inner-Shell Photofragmentation

    DOE PAGES

    Inhester, Ludger; Oostenrijk, Bart; Patanen, Minna; ...

    2018-02-14

    In many cases fragmentation of molecules upon inner-shell ionization is very unspecific with respect to the initially localized ionization site. Often this finding is interpreted in terms of an equilibration of internal energy into vibrational degrees of freedom after Auger decay. In this paper, we investigate the X-ray photofragmentation of ethyl trifluoroacetate upon core electron ionization at environmentally distinct carbon sites using photoelectron–photoion–photoion coincidence measurements and ab initio electronic structure calculations. For all four carbon ionization sites, the Auger decay weakens the same bonds and transfers the two charges to opposite ends of the molecule, which leads to a rapidmore » dissociation into three fragments, followed by further fragmentation steps. Finally, the lack of site specificity is attributed to the character of the dicationic electronic states after Auger decay instead of a fast equilibration of internal energy.« less

  1. Stimulated Raman adiabatic passage preparation of a coherent superposition of ThO H3Δ1 states for an improved electron electric-dipole-moment measurement

    NASA Astrophysics Data System (ADS)

    Panda, C. D.; O'Leary, B. R.; West, A. D.; Baron, J.; Hess, P. W.; Hoffman, C.; Kirilov, E.; Overstreet, C. B.; West, E. P.; DeMille, D.; Doyle, J. M.; Gabrielse, G.

    2016-05-01

    Experimental searches for the electron electric-dipole moment (EDM) probe new physics beyond the standard model. The current best EDM limit was set by the ACME Collaboration [Science 343, 269 (2014), 10.1126/science.1248213], constraining time-reversal symmetry (T ) violating physics at the TeV energy scale. ACME used optical pumping to prepare a coherent superposition of ThO H3Δ1 states that have aligned electron spins. Spin precession due to the molecule's internal electric field was measured to extract the EDM. We report here on an improved method for preparing this spin-aligned state of the electron by using stimulated Raman adiabatic passage (STIRAP). We demonstrate a transfer efficiency of 75 %±5 % , representing a significant gain in signal for a next-generation EDM experiment. We discuss the particularities of implementing STIRAP in systems such as ours, where molecular ensembles with large phase-space distributions are transferred via weak molecular transitions with limited laser power and limited optical access.

  2. Cation Recombination Energy/Coulomb Repulsion Effects in ETD/ECD as Revealed by Variation of Charge per Residue at Fixed Total Charge

    PubMed Central

    Mentinova, Marija; Crizer, David M.; Baba, Takashi; McGee, William M.; Glish, Gary L.; McLuckey, Scott A.

    2013-01-01

    Electron capture dissociation (ECD) and electron transfer dissociation (ETD) experiments in electrodynamic ion traps operated in the presence of a bath gas in the 1–10 mTorr range have been conducted on a common set of doubly protonated model peptides of the form X(AG)nX (X = lysine, arginine, or histidine, n=1, 2, or 4). The partitioning of reaction products was measured using thermal electrons, anions of azobenzene, and anions of 1,3-dinitrobenzene as reagents. Variation of n alters the charge per residue of the peptide cation, which affects recombination energy. The ECD experiments showed that H-atom loss is greatest for the n=1 peptides and decreases as n increases. Proton transfer in ETD, on the other hand, is expected to increase as charge per residue decreases (i.e., as n increases). These opposing tendencies were apparent in the data for the K(AG)nK peptides. H-atom loss appeared to be more prevalent in ECD than in ETD and is rationalized on the basis of either internal energy differences, differences in angular momentum transfer associated with the electron capture versus electron transfer processes, or a combination of the two. The histidine peptides showed the greatest extent of charge reduction without dissociation, the arginine peptides showed the greatest extent of side-chain cleavages, and the lysine peptides generally showed the greatest extent of partitioning into the c/z•-product ion channels. The fragmentation patterns for the complementary c- and z•-ions for ETD and ECD were found to be remarkably similar, particularly for the peptides with X = lysine. PMID:23568028

  3. High-resolution neutron and X-ray diffraction room-temperature studies of an H-FABP-oleic acid complex: study of the internal water cluster and ligand binding by a transferred multipolar electron-density distribution.

    PubMed

    Howard, E I; Guillot, B; Blakeley, M P; Haertlein, M; Moulin, M; Mitschler, A; Cousido-Siah, A; Fadel, F; Valsecchi, W M; Tomizaki, Takashi; Petrova, T; Claudot, J; Podjarny, A

    2016-03-01

    Crystal diffraction data of heart fatty acid binding protein (H-FABP) in complex with oleic acid were measured at room temperature with high-resolution X-ray and neutron protein crystallography (0.98 and 1.90 Å resolution, respectively). These data provided very detailed information about the cluster of water molecules and the bound oleic acid in the H-FABP large internal cavity. The jointly refined X-ray/neutron structure of H-FABP was complemented by a transferred multipolar electron-density distribution using the parameters of the ELMAMII library. The resulting electron density allowed a precise determination of the electrostatic potential in the fatty acid (FA) binding pocket. Bader's quantum theory of atoms in molecules was then used to study interactions involving the internal water molecules, the FA and the protein. This approach showed H⋯H contacts of the FA with highly conserved hydrophobic residues known to play a role in the stabilization of long-chain FAs in the binding cavity. The determination of water hydrogen (deuterium) positions allowed the analysis of the orientation and electrostatic properties of the water molecules in the very ordered cluster. As a result, a significant alignment of the permanent dipoles of the water molecules with the protein electrostatic field was observed. This can be related to the dielectric properties of hydration layers around proteins, where the shielding of electrostatic interactions depends directly on the rotational degrees of freedom of the water molecules in the interface.

  4. Model-based confirmation of alternative substrates of mitochondrial electron transport chain.

    PubMed

    Kleessen, Sabrina; Araújo, Wagner L; Fernie, Alisdair R; Nikoloski, Zoran

    2012-03-30

    Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data.

  5. Balancing cellular redox metabolism in microbial electrosynthesis and electro fermentation - A chance for metabolic engineering.

    PubMed

    Kracke, Frauke; Lai, Bin; Yu, Shiqin; Krömer, Jens O

    2018-01-01

    More and more microbes are discovered that are capable of extracellular electron transfer, a process in which they use external electrodes as electron donors or acceptors for metabolic reactions. This feature can be used to overcome cellular redox limitations and thus optimizing microbial production. The technologies, termed microbial electrosynthesis and electro-fermentation, have the potential to open novel bio-electro production platforms from sustainable energy and carbon sources. However, the performance of reported systems is currently limited by low electron transport rates between microbes and electrodes and our limited ability for targeted engineering of these systems due to remaining knowledge gaps about the underlying fundamental processes. Metabolic engineering offers many opportunities to optimize these processes, for instance by genetic engineering of pathways for electron transfer on the one hand and target product synthesis on the other hand. With this review, we summarize the status quo of knowledge and engineering attempts around chemical production in bio-electrochemical systems from a microbe perspective. Challenges associated with the introduction or enhancement of extracellular electron transfer capabilities into production hosts versus the engineering of target compound synthesis pathways in natural exoelectrogens are discussed. Recent advances of the research community in both directions are examined critically. Further, systems biology approaches, for instance using metabolic modelling, are examined for their potential to provide insight into fundamental processes and to identify targets for metabolic engineering. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  6. Study of metal transfer in CO2 laser+GMAW-P hybrid welding using argon-helium mixtures

    NASA Astrophysics Data System (ADS)

    Zhang, Wang; Hua, Xueming; Liao, Wei; Li, Fang; Wang, Min

    2014-03-01

    The metal transfer in CO2 Laser+GMAW-P hybrid welding by using argon-helium mixtures was investigated and the effect of the laser on the mental transfer is discussed. A 650 nm laser, in conjunction with the shadow graph technique, is used to observe the metal transfer process. In order to analyze the heat input to the droplet and the droplet internal current line distribution. An optical emission spectroscopy system was employed to estimate default parameter and optimized plasma temperature, electron number densities distribution. The results indicate that the CO2 plasma plume have a significant impact to the electrode melting, droplet formation, detachment, impingement onto the workpiece and weld morphology. Since the current distribution direction flow changes to the keyhole, to obtain a metal transfer mode of one droplet per pulse, the welding parameters should be adjusted to a higher pulse time (TP) and a lower voltage.

  7. UV excitation of single DNA and RNA strands produces high yields of exciplex states between two stacked bases

    PubMed Central

    Takaya, Tomohisa; Su, Charlene; de La Harpe, Kimberly; Crespo-Hernández, Carlos E.; Kohler, Bern

    2008-01-01

    Excited electronic states created by UV excitation of the diribonucleoside monophosphates ApA, ApG, ApC, ApU, and CpG were studied by the femtosecond transient-absorption technique. Bleach recovery signals recorded at 252 nm show that long-lived excited states are formed in all five dinucleosides. The lifetimes of these states exceed those measured in equimolar mixtures of the constituent mononucleotides by one to two orders of magnitude, indicating that electronic coupling between proximal nucleobases dramatically slows the relaxation of excess electronic energy. The decay rates of the long-lived states decrease with increasing energy of the charge-transfer state produced by transferring an electron from one base to another. The charge-transfer character of the long-lived states revealed by this analysis supports their assignment to excimer or exciplex states. Identical bleach recovery signals were seen for ApA, (A)4, and poly(A) at delay times >10 ps after photoexcitation. This indicates that excited states localized on a stack of just two bases are the common trap states independent of the number of stacked nucleotides. The fraction of initial excitations that decay to long-lived exciplex states is approximately equal to the fraction of stacked bases determined by NMR measurements. This supports a model in which excitations associated with two stacked bases decay to exciplex states, whereas excitations in unstacked bases decay via ultrafast internal conversion. These results establish the importance of charge transfer-quenching pathways for UV-irradiated RNA and DNA in room-temperature solution. PMID:18647840

  8. UV excitation of single DNA and RNA strands produces high yields of exciplex states between two stacked bases.

    PubMed

    Takaya, Tomohisa; Su, Charlene; de La Harpe, Kimberly; Crespo-Hernández, Carlos E; Kohler, Bern

    2008-07-29

    Excited electronic states created by UV excitation of the diribonucleoside monophosphates ApA, ApG, ApC, ApU, and CpG were studied by the femtosecond transient-absorption technique. Bleach recovery signals recorded at 252 nm show that long-lived excited states are formed in all five dinucleosides. The lifetimes of these states exceed those measured in equimolar mixtures of the constituent mononucleotides by one to two orders of magnitude, indicating that electronic coupling between proximal nucleobases dramatically slows the relaxation of excess electronic energy. The decay rates of the long-lived states decrease with increasing energy of the charge-transfer state produced by transferring an electron from one base to another. The charge-transfer character of the long-lived states revealed by this analysis supports their assignment to excimer or exciplex states. Identical bleach recovery signals were seen for ApA, (A)(4), and poly(A) at delay times >10 ps after photoexcitation. This indicates that excited states localized on a stack of just two bases are the common trap states independent of the number of stacked nucleotides. The fraction of initial excitations that decay to long-lived exciplex states is approximately equal to the fraction of stacked bases determined by NMR measurements. This supports a model in which excitations associated with two stacked bases decay to exciplex states, whereas excitations in unstacked bases decay via ultrafast internal conversion. These results establish the importance of charge transfer-quenching pathways for UV-irradiated RNA and DNA in room-temperature solution.

  9. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 12 Banks and Banking 8 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that provides an...

  10. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 12 Banks and Banking 8 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

  11. 12 CFR 1005.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 12 Banks and Banking 8 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.14 Electronic fund transfer service provider not holding consumer's account. (a) Provider of electronic fund transfer service. A person that...

  12. Computer Software Configuration Item-Specific Flight Software Image Transfer Script Generator

    NASA Technical Reports Server (NTRS)

    Bolen, Kenny; Greenlaw, Ronald

    2010-01-01

    A K-shell UNIX script enables the International Space Station (ISS) Flight Control Team (FCT) operators in NASA s Mission Control Center (MCC) in Houston to transfer an entire or partial computer software configuration item (CSCI) from a flight software compact disk (CD) to the onboard Portable Computer System (PCS). The tool is designed to read the content stored on a flight software CD and generate individual CSCI transfer scripts that are capable of transferring the flight software content in a given subdirectory on the CD to the scratch directory on the PCS. The flight control team can then transfer the flight software from the PCS scratch directory to the Electronically Erasable Programmable Read Only Memory (EEPROM) of an ISS Multiplexer/ Demultiplexer (MDM) via the Indirect File Transfer capability. The individual CSCI scripts and the CSCI Specific Flight Software Image Transfer Script Generator (CFITSG), when executed a second time, will remove all components from their original execution. The tool will identify errors in the transfer process and create logs of the transferred software for the purposes of configuration management.

  13. Carotenoids as electron or excited-state energy donors in artificial photosynthesis: an ultrafast investigation of a carotenoporphyrin and a carotenofullerene dyad.

    PubMed

    Pillai, Smitha; Ravensbergen, Janneke; Antoniuk-Pablant, Antaeres; Sherman, Benjamin D; van Grondelle, Rienk; Frese, Raoul N; Moore, Thomas A; Gust, Devens; Moore, Ana L; Kennis, John T M

    2013-04-07

    Photophysical investigations of molecular donor-acceptor systems have helped elucidate many details of natural photosynthesis and revealed design principles for artificial photosynthetic systems. To obtain insights into the factors that govern the partition between excited-state energy transfer (EET) and electron transfer (ET) processes among carotenoids and tetrapyrroles and fullerenes, we have designed artificial photosynthetic dyads that are thermodynamically poised to favor ET over EET processes. The dyads were studied using transient absorption spectroscopy with ∼100 femtosecond time resolution. For dyad , a carotenoporphyrin, excitation to the carotenoid S2 state induces ultrafast ET, competing with internal conversion (IC) to the carotenoid S1 state. In addition, the carotenoid S1 state gives rise to ET. In contrast with biological photosynthesis and many artificial photosynthetic systems, no EET at all was detected for this dyad upon carotenoid S2 excitation. Recombination of the charge separated state takes place in hundreds of picoseconds and yields a triplet state, which is interpreted as a triplet delocalized between the porphyrin and carotenoid moieties. In dyad , a carotenofullerene, excitation of the carotenoid in the S2 band results in internal conversion to the S1 state, ET and probably EET to fullerene on ultrafast timescales. From the carotenoid S1 state EET to fullerene occurs. Subsequently, the excited-state fullerene gives rise to ET from the carotenoid to the fullerene. Again, the charge separated state recombines in hundreds of picoseconds. The results illustrate that for a given rate of EET, the ratio of ET to EET can be controlled by adjusting the driving force for electron transfer.

  14. Enhanced Fenton-like removal of nitrobenzene via internal microelectrolysis in nano zerovalent iron/activated carbon composite.

    PubMed

    Hu, Sihai; Wu, Yaoguo; Yao, Hairui; Lu, Cong; Zhang, Chengjun

    2016-01-01

    The efficiency of Fenton-like catalysis using nano zerovalent iron (nZVI) is limited by nZVI aggregation and activity loss due to inactive ferric oxide forming on the nZVI surface, which hinders electron transfer. A novel iron-carbon composite catalyst consisting of nZVI and granular activated carbon (GAC), which can undergo internal iron-carbon microelectrolysis spontaneously, was successfully fabricated by the adsorption-reduction method. The catalyst efficiency was evaluated in nitrobenzene (NB) removal via the Fenton-like process (H2O2-nZVI/GAC). The results showed that nZVI/GAC composite was good for dispersing nZVI on the surface of GAC, which permitted much better removal efficiency (93.0%) than nZVI (31.0%) or GAC (20.0%) alone. Moreover, iron leaching decreased from 1.28 to 0.58 mg/L after reaction of 240 min and the oxidation kinetic of the Fenton-like reaction can be described well by the second-order reaction kinetic model (R2=0.988). The composite catalyst showed sustainable catalytic ability and GAC performed as a medium for electron transfer in internal iron-carbon microelectrolysis to promote Fe2+ regeneration and Fe3+/Fe2+ cycles. Therefore, this study represents an important method to design a low cost and high efficiency Fenton-like catalyst in practical application.

  15. 1998 Conference on Precision Electromagnetic Measurements Digest. Proceedings.

    NASA Astrophysics Data System (ADS)

    Nelson, T. L.

    The following topics were dealt with: fundamental constants; caesium standards; AC-DC transfer; impedance measurement; length measurement; units; statistics; cryogenic resonators; time transfer; QED; resistance scaling and bridges; mass measurement; atomic fountains and clocks; single electron transport; Newtonian constant of gravitation; stabilised lasers and frequency measurements; cryogenic current comparators; optical frequency standards; high voltage devices and systems; international compatibility; magnetic measurement; precision power measurement; high resolution spectroscopy; DC transport standards; waveform acquisition and analysis; ion trap standards; optical metrology; quantised Hall effect; Josephson array comparisons; signal generation and measurement; Avogadro constant; microwave networks; wideband power standards; antennas, fields and EMC; quantum-based standards.

  16. Chonopeltis australis (Crustacea) male reproductive system morphology; sperm transfer and review of reproduction in Branchiura.

    PubMed

    Neethling, Lourelle Alicia Martins; Avenant-Oldewage, Annemariè

    2015-02-01

    The morphology of the male reproductive system as well as sperm transfer in Branchiura has been described for Dolops ranarum and Argulus japonicus. In this study, the reproductive system and accessory structures are described for male Chonopeltis australis using histology, light microscopy, and scanning electron microscopy. For the first time, we describe sperm transfer by means of a spermatophore in this genus. The internal and external morphology and mechanism of sperm transfer is compared with other Branchiura, where it has been described. The morphology of the reproductive system of C. australis is similar to that of D. ranarum while the accessory structures and the spermatophore produced are similar to that of A. japonicus. A revision of the definition of Branchiura with respect to reproduction is provided. © 2014 Wiley Periodicals, Inc.

  17. No Moving Parts

    NASA Technical Reports Server (NTRS)

    1998-01-01

    Under a NASA SBIR (Small Business Innovative Research), Research International developed the solid state micromachined pump used for cooling electronics in space, circulation of heat transfer fluids on spacecraft, and monitoring fire and gas hazards aboard naval warships. Incorporating Lewis Research Center's pumping technology, commercial applications for this product include both detection of toxins and pollutants in coal mines, and early warning smoke detectors for industrial applications.

  18. Enhanced Internal Quantum Efficiency in Dye-Sensitized Solar Cells: Effect of Long-Lived Charge-Separated State of Sensitizers.

    PubMed

    Sun, Haiya; Liu, Dongzhi; Wang, Tianyang; Lu, Ting; Li, Wei; Ren, Siyao; Hu, Wenping; Wang, Lichang; Zhou, Xueqin

    2017-03-22

    Effective charge separation is one of the key determinants for the photovoltaic performance of the dye-sensitized solar cells (DSSCs). Herein, two charge-separated (CS) sensitizers, MTPA-Pyc and YD-Pyc, have been synthesized and applied in DSSCs to investigate the effect of the CS states of the sensitizers on the device's efficiency. The CS states with lifetimes of 64 and 177 ns for MTPA-Pyc and YD-Pyc, respectively, are formed via the photoinduced electron transfer (PET) from the 4-styryltriphenylamine (MTPA) or 4-styrylindoline (YD) donor to the pyrimidine cyanoacrylic acid (Pyc) acceptor. DSSCs based on MTPA-Pyc and YD-Pyc exhibit high internal quantum efficiency (IQE) values of over 80% from 400 to 600 nm. In comparison, the IQEs of the charge transfer (CT) sensitizer cells are 10-30% lower in the same wavelength range. The enhanced IQE values in the devices based on the CS sensitizers are ascribed to the higher electron injection efficiencies and slower charge recombination. The results demonstrate that taking advantage of the CS states in the sensitizers can be a promising strategy to improve the IQEs and further enhance the overall efficiencies of the DSSCs.

  19. Transfer of Orbital and Spin angular momentum from non-paraxial optical vortex to atomic BEC

    NASA Astrophysics Data System (ADS)

    Bhowmik, Anal; Mondal, Pradip Kumar; Majumder, Sonjoy; Deb, Bimalendu

    2017-04-01

    Allen and co-workers first brought up the realization that optical vortex can carry well defined orbital angular momentum (OAM) associated with its spatial mode. Spin angular momentum (SAM) of the light, associated with the polarization, interacts with the internal electronic motion of the atom. The exchange of orbital angular momentum (OAM) between optical vortex and the center-of-mass (CM) motion of an atom or molecule is well known in paraxial approximation. We show that, how the total angular momentum (TAM) of non-paraxial optical vortex is shared with atom, in terms of OAM and SAM. Both the angular momenta are now possible to be transferred to the internal electronic and external CM motion of atom. Here we have studied how the Rabi frequencies of the excitations of two-photon Raman transitions with respect to focusing angles. Also, we investigate the properties of the vortex superposed state for a Bose-Einstein condensate condensate by a single non-paraxial vortex beam. The density distribution of the vortex-antivortex superposed state has a petal structure which is determined by the quantum circulations and proportion of the vortex and antivortex.

  20. Quantum tunneling resonant electron transfer process in Lorentzian plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hong, Woo-Pyo; Jung, Young-Dae, E-mail: ydjung@hanyang.ac.kr; Department of Applied Physics and Department of Bionanotechnology, Hanyang University, Ansan, Kyunggi-Do 426-791

    The quantum tunneling resonant electron transfer process between a positive ion and a neutral atom collision is investigated in nonthermal generalized Lorentzian plasmas. The result shows that the nonthermal effect enhances the resonant electron transfer cross section in Lorentzian plasmas. It is found that the nonthermal effect on the classical resonant electron transfer cross section is more significant than that on the quantum tunneling resonant charge transfer cross section. It is shown that the nonthermal effect on the resonant electron transfer cross section decreases with an increase of the Debye length. In addition, the nonthermal effect on the quantum tunnelingmore » resonant electron transfer cross section decreases with increasing collision energy. The variation of nonthermal and plasma shielding effects on the quantum tunneling resonant electron transfer process is also discussed.« less

  1. Ultrafast direct electron transfer at organic semiconductor and metal interfaces.

    PubMed

    Xiang, Bo; Li, Yingmin; Pham, C Huy; Paesani, Francesco; Xiong, Wei

    2017-11-01

    The ability to control direct electron transfer can facilitate the development of new molecular electronics, light-harvesting materials, and photocatalysis. However, control of direct electron transfer has been rarely reported, and the molecular conformation-electron dynamics relationships remain unclear. We describe direct electron transfer at buried interfaces between an organic polymer semiconductor film and a gold substrate by observing the first dynamical electric field-induced vibrational sum frequency generation (VSFG). In transient electric field-induced VSFG measurements on this system, we observe dynamical responses (<150 fs) that depend on photon energy and polarization, demonstrating that electrons are directly transferred from the Fermi level of gold to the lowest unoccupied molecular orbital of organic semiconductor. Transient spectra further reveal that, although the interfaces are prepared without deliberate alignment control, a subensemble of surface molecules can adopt conformations for direct electron transfer. Density functional theory calculations support the experimental results and ascribe the observed electron transfer to a flat-lying polymer configuration in which electronic orbitals are found to be delocalized across the interface. The present observation of direct electron transfer at complex interfaces and the insights gained into the relationship between molecular conformations and electron dynamics will have implications for implementing novel direct electron transfer in energy materials.

  2. Contribution of direct electron transfer mechanisms to overall electron transfer in microbial fuel cells utilising Shewanella oneidensis as biocatalyst.

    PubMed

    Fapetu, Segun; Keshavarz, Taj; Clements, Mark; Kyazze, Godfrey

    2016-09-01

    To investigate the contribution of direct electron transfer mechanisms to electricity production in microbial fuel cells by physically retaining Shewanella oneidensis cells close to or away from the anode electrode. A maximum power output of 114 ± 6 mWm(-2) was obtained when cells were retained close to the anode using a dialysis membrane. This was 3.5 times more than when the cells were separated away from the anode. Without the membrane the maximum power output was 129 ± 6 mWm(-2). The direct mechanisms of electron transfer contributed significantly to overall electron transfer from S. oneidensis to electrodes, a result that was corroborated by another experiment where S. oneidensis cells were entrapped in alginate gels. S. oneidensis transfers electrons primarily by direct electron transfer as opposed to mediated electron transfer.

  3. Suppression of BRCA2 by Mutant Mitochondrial DNA in Prostate Cancer

    DTIC Science & Technology

    2011-05-01

    Briefly, the electron transfer activities of complex I/III (NADH dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from NADH to...ferricytochrome c) and complex II/III (succinate dehydrogenase/cytochrome bc1 complex: catalyzes the electron transfer from succinate to ferricytochrome...The electron transfer activity of complex IV (cytochrome c oxidase: catalyzes the final step of the respiratory chain by transferring electrons from

  4. DFT investigation on two-dimensional GeS/WS2 van der Waals heterostructure for direct Z-scheme photocatalytic overall water splitting

    NASA Astrophysics Data System (ADS)

    Ju, Lin; Dai, Ying; Wei, Wei; Li, Mengmeng; Huang, Baibiao

    2018-03-01

    Recently, extensive attention has been paid to the direct Z-scheme systems for photocatalytic water splitting where carriers migrate directly between the two semiconductors without a redox mediator. In the present work, the electronic structure and related properties of two-dimensional (2D) van de Waals (vdW) GeS/WX2 (X = O, S, Se, Te) heterojunction are systematically investigated by first-principles calculations. Our results demonstrate that, the GeS/WS2 heterojunction could form a direct Z-scheme system for photocatalytic water splitting, whereas the GeS/WX2 (X = O, Se, Te) can't, because of their respective unsuitable electronic structures. For the GeS/WS2 heterojunction, the GeS and WS2 monolayers serve as photocatalysts for the hydrogen evolution reactionand oxygen evolution reaction, respectively. The internal electric field induced by the electron transfer at the interface can promote the separation of photo-generated charge carriers and formation of the interface Z-scheme electron transfer. Remarkably, the designed GeS/WS2 heterojunction not only enhances the hydrogen production activity of GeS and the oxygen production ability of WS2 but also improves the light absorption of the two monolayers by reducing the band gaps. Moreover, it is found that narrowing the interlayer distance could enhance the internal electric field, improving the photocatalytic ability of the vdW heterojunction. This work provides fundamental insights for further design and preparation of emergent metal dichalcogenide catalysts, beneficial for the development in clean energy.

  5. Electrochemical Measurement of Electron Transfer Kinetics by Shewanella oneidensis MR-1*

    PubMed Central

    Baron, Daniel; LaBelle, Edward; Coursolle, Dan; Gralnick, Jeffrey A.; Bond, Daniel R.

    2009-01-01

    Shewanella oneidensis strain MR-1 can respire using carbon electrodes and metal oxyhydroxides as electron acceptors, requiring mechanisms for transferring electrons from the cell interior to surfaces located beyond the cell. Although purified outer membrane cytochromes will reduce both electrodes and metals, S. oneidensis also secretes flavins, which accelerate electron transfer to metals and electrodes. We developed techniques for detecting direct electron transfer by intact cells, using turnover and single turnover voltammetry. Metabolically active cells attached to graphite electrodes produced thin (submonolayer) films that demonstrated both catalytic and reversible electron transfer in the presence and absence of flavins. In the absence of soluble flavins, electron transfer occurred in a broad potential window centered at ∼0 V (versus standard hydrogen electrode), and was altered in single (ΔomcA, ΔmtrC) and double deletion (ΔomcA/ΔmtrC) mutants of outer membrane cytochromes. The addition of soluble flavins at physiological concentrations significantly accelerated electron transfer and allowed catalytic electron transfer to occur at lower applied potentials (−0.2 V). Scan rate analysis indicated that rate constants for direct electron transfer were slower than those reported for pure cytochromes (∼1 s−1). These observations indicated that anodic current in the higher (>0 V) window is due to activation of a direct transfer mechanism, whereas electron transfer at lower potentials is enabled by flavins. The electrochemical dissection of these activities in living cells into two systems with characteristic midpoint potentials and kinetic behaviors explains prior observations and demonstrates the complementary nature of S. oneidensis electron transfer strategies. PMID:19661057

  6. Hydrated Electron Transfer to Nucleobases in Aqueous Solutions Revealed by Ab Initio Molecular Dynamics Simulations.

    PubMed

    Zhao, Jing; Wang, Mei; Fu, Aiyun; Yang, Hongfang; Bu, Yuxiang

    2015-08-03

    We present an ab initio molecular dynamics (AIMD) simulation study into the transfer dynamics of an excess electron from its cavity-shaped hydrated electron state to a hydrated nucleobase (NB)-bound state. In contrast to the traditional view that electron localization at NBs (G/A/C/T), which is the first step for electron-induced DNA damage, is related only to dry or prehydrated electrons, and a fully hydrated electron no longer transfers to NBs, our AIMD simulations indicate that a fully hydrated electron can still transfer to NBs. We monitored the transfer dynamics of fully hydrated electrons towards hydrated NBs in aqueous solutions by using AIMD simulations and found that due to solution-structure fluctuation and attraction of NBs, a fully hydrated electron can transfer to a NB gradually over time. Concurrently, the hydrated electron cavity gradually reorganizes, distorts, and even breaks. The transfer could be completed in about 120-200 fs in four aqueous NB solutions, depending on the electron-binding ability of hydrated NBs and the structural fluctuation of the solution. The transferring electron resides in the π*-type lowest unoccupied molecular orbital of the NB, which leads to a hydrated NB anion. Clearly, the observed transfer of hydrated electrons can be attributed to the strong electron-binding ability of hydrated NBs over the hydrated electron cavity, which is the driving force, and the transfer dynamics is structure-fluctuation controlled. This work provides new insights into the evolution dynamics of hydrated electrons and provides some helpful information for understanding the DNA-damage mechanism in solution. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Comparative Dosimetric Estimates of a 25 keV Electron Micro-beam with three Monte Carlo Codes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mainardi, Enrico; Donahue, Richard J.; Blakely, Eleanor A.

    2002-09-11

    The calculations presented compare the different performances of the three Monte Carlo codes PENELOPE-1999, MCNP-4C and PITS, for the evaluation of Dose profiles from a 25 keV electron micro-beam traversing individual cells. The overall model of a cell is a water cylinder equivalent for the three codes but with a different internal scoring geometry: hollow cylinders for PENELOPE and MCNP, whereas spheres are used for the PITS code. A cylindrical cell geometry with scoring volumes with the shape of hollow cylinders was initially selected for PENELOPE and MCNP because of its superior simulation of the actual shape and dimensions ofmore » a cell and for its improved computer-time efficiency if compared to spherical internal volumes. Some of the transfer points and energy transfer that constitute a radiation track may actually fall in the space between spheres, that would be outside the spherical scoring volume. This internal geometry, along with the PENELOPE algorithm, drastically reduced the computer time when using this code if comparing with event-by-event Monte Carlo codes like PITS. This preliminary work has been important to address dosimetric estimates at low electron energies. It demonstrates that codes like PENELOPE can be used for Dose evaluation, even with such small geometries and energies involved, which are far below the normal use for which the code was created. Further work (initiated in Summer 2002) is still needed however, to create a user-code for PENELOPE that allows uniform comparison of exact cell geometries, integral volumes and also microdosimetric scoring quantities, a field where track-structure codes like PITS, written for this purpose, are believed to be superior.« less

  8. Electron transfer and conformational change in complexes of trimethylamine dehydrogenase and electron transferring flavoprotein.

    PubMed

    Jones, Matthew; Talfournier, Francois; Bobrov, Anton; Grossmann, J Günter; Vekshin, Nikolai; Sutcliffe, Michael J; Scrutton, Nigel S

    2002-03-08

    The trimethylamine dehydrogenase-electron transferring flavoprotein (TMADH.ETF) electron transfer complex has been studied by fluorescence and absorption spectroscopies. These studies indicate that a series of conformational changes occur during the assembly of the TMADH.ETF electron transfer complex and that the kinetics of assembly observed with mutant TMADH (Y442F/L/G) or ETF (alpha R237A) complexes are much slower than are the corresponding rates of electron transfer in these complexes. This suggests that electron transfer does not occur in the thermodynamically most favorable state (which takes too long to form), but that one or more metastable states (which are formed more rapidly) are competent in transferring electrons from TMADH to ETF. Additionally, fluorescence spectroscopy studies of the TMADH.ETF complex indicate that ETF undergoes a stable conformational change (termed structural imprinting) when it interacts transiently with TMADH to form a second, distinct, structural form. The mutant complexes compromise imprinting of ETF, indicating a dependence on the native interactions present in the wild-type complex. The imprinted form of semiquinone ETF exhibits an enhanced rate of electron transfer to the artificial electron acceptor, ferricenium. Overall molecular conformations as probed by small-angle x-ray scattering studies are indistinguishable for imprinted and non-imprinted ETF, suggesting that changes in structure likely involve confined reorganizations within the vicinity of the FAD. Our results indicate a series of conformational events occur during the assembly of the TMADH.ETF electron transfer complex, and that the properties of electron transfer proteins can be affected lastingly by transient interaction with their physiological redox partners. This may have significant implications for our understanding of biological electron transfer reactions in vivo, because ETF encounters TMADH at all times in the cell. Our studies suggest that caution needs to be exercised in extrapolating the properties of in vitro interprotein electron transfer reactions to those occurring in vivo.

  9. 31 CFR 208.3 - Payment by electronic funds transfer.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 31 Money and Finance:Treasury 2 2011-07-01 2011-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

  10. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 48 Federal Acquisition Regulations System 1 2011-10-01 2011-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  11. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 48 Federal Acquisition Regulations System 1 2013-10-01 2013-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  12. 31 CFR 208.3 - Payment by electronic funds transfer.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 31 Money and Finance:Treasury 2 2012-07-01 2012-07-01 false Payment by electronic funds transfer... DISBURSEMENTS § 208.3 Payment by electronic funds transfer. Subject to § 208.4, and notwithstanding any other... electronic funds transfer. ...

  13. 48 CFR 18.123 - Electronic funds transfer.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Electronic funds transfer. 18.123 Section 18.123 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  14. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 48 Federal Acquisition Regulations System 1 2012-10-01 2012-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  15. 48 CFR 18.124 - Electronic funds transfer.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 48 Federal Acquisition Regulations System 1 2014-10-01 2014-10-01 false Electronic funds transfer. 18.124 Section 18.124 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION... Electronic funds transfer. Electronic funds transfer payments may be waived for acquisitions to support...

  16. Quantitative analysis of intramolecular exciplex and electron transfer in a double-linked zinc porphyrin-fullerene dyad.

    PubMed

    Al-Subi, Ali Hanoon; Niemi, Marja; Tkachenko, Nikolai V; Lemmetyinen, Helge

    2012-10-04

    Photoinduced charge transfer in a double-linked zinc porphyrin-fullerene dyad is studied. When the dyad is excited at the absorption band of the charge-transfer complex (780 nm), an intramolecular exciplex is formed, followed by the complete charge separated (CCS) state. By analyzing the results obtained from time-resolved transient absorption and emission decay measurements in a range of solvents with different polarities, we derived a dependence between the observable lifetimes and internal parameters controlling the reaction rate constants based on the semiquantum Marcus electron-transfer theory. The critical value of the solvent polarity was found to be ε(r) ≈ 6.5: in solvents with higher dielectric constants, the energy of the CCS state is lower than that of the exciplex and the relaxation takes place via the CCS state predominantly, whereas in solvents with lower polarities the energy of the CCS state is higher and the exciplex relaxes directly to the ground state. In solvents with moderate polarities the exciplex and the CCS state are in equilibrium and cannot be separated spectroscopically. The degree of the charge shift in the exciplex relative to that in the CCS state was estimated to be 0.55 ± 0.02. The electronic coupling matrix elements for the charge recombination process and for the direct relaxation of the exciplex to the ground state were found to be 0.012 ± 0.001 and 0.245 ± 0.022 eV, respectively.

  17. Comparison of direct and indirect methods of measuring airborne chrysotile fibre concentration.

    PubMed

    Eypert-Blaison, Celine; Veissiere, Sylvie; Rastoix, Olivier; Kauffer, Edmond

    2010-01-01

    Transmission electron microscopy observations most frequently form a basis for estimating asbestos fibre concentration in the environment and in buildings with asbestos-containing materials. Sampled fibres can be transferred to microscope grids by applying either a direct [ISO (1995) Draft International ISO/DIS 10312. Ambient air. Determination of asbestos fibres. Direct transfer transmission electron microscopy procedure. Geneva, Switzerland: International Standardization Organization] or an indirect [AFNOR (1996) Détermination de la concentration en fibres d'amiante par microscopie électronique à transmission-Méthode indirecte. Cedex, France: AFNOR, p. 42; ISO (1997) Draft International ISO/DIS 13794. Ambient air. Determination of asbestos fibres. Indirect-transfer transmission electron microscopy procedure. Geneva, Switzerland: International Standardization Organization] method. In the latter case, ISO Standard 13794 recommends filtering calcination residues either on a polycarbonate (PC) filter (PC indirect method) or on a cellulose ester (CE) membrane (CE indirect method). The PC indirect method requires that fibres deposited on a PC filter be covered by a carbon layer, whereas in the CE indirect method, the CE membrane has to be directly processed using a method described in ISO Standard 10312. The purpose of this study was to compare results obtained using, on the one hand, direct preparation methods and, on the other hand, PC indirect or CE indirect methods, for counting asbestos fibres deposited on filters as a result of liquid filtration or air sampling. In direct method-based preparation, we observed that an etching time of 6-14 min does not affect the measured densities, except for fibres <1 microm deposited by liquid filtration. Moreover, in all cases, the direct method gives higher densities than the PC indirect method because of possible fibre disappearance when using the carbon evaporator implemented in the PC indirect method. The CE membrane used for sample preparation in the CE indirect method is collapsed prior to passing it through the carbon evaporator, so the fibres are less likely to disappear at this stage. We then note that the resulting fibre densities for chrysotile-loaded filters prepared using the direct method are close to those obtained with filters prepared using the CE indirect method. Our study therefore shows that, under the implemented experimental conditions, the PC and CE indirect preparation methods described in ISO Standard 13794 are not equivalent.

  18. Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles

    PubMed Central

    Tvrdy, Kevin; Frantsuzov, Pavel A.; Kamat, Prashant V.

    2011-01-01

    Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO2, TiO2, and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO2) were not the same as those which showed the highest photocurrent (TiO2). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency. PMID:21149685

  19. Photoinduced electron transfer from semiconductor quantum dots to metal oxide nanoparticles.

    PubMed

    Tvrdy, Kevin; Frantsuzov, Pavel A; Kamat, Prashant V

    2011-01-04

    Quantum dot-metal oxide junctions are an integral part of next-generation solar cells, light emitting diodes, and nanostructured electronic arrays. Here we present a comprehensive examination of electron transfer at these junctions, using a series of CdSe quantum dot donors (sizes 2.8, 3.3, 4.0, and 4.2 nm in diameter) and metal oxide nanoparticle acceptors (SnO(2), TiO(2), and ZnO). Apparent electron transfer rate constants showed strong dependence on change in system free energy, exhibiting a sharp rise at small driving forces followed by a modest rise further away from the characteristic reorganization energy. The observed trend mimics the predicted behavior of electron transfer from a single quantum state to a continuum of electron accepting states, such as those present in the conduction band of a metal oxide nanoparticle. In contrast with dye-sensitized metal oxide electron transfer studies, our systems did not exhibit unthermalized hot-electron injection due to relatively large ratios of electron cooling rate to electron transfer rate. To investigate the implications of these findings in photovoltaic cells, quantum dot-metal oxide working electrodes were constructed in an identical fashion to the films used for the electron transfer portion of the study. Interestingly, the films which exhibited the fastest electron transfer rates (SnO(2)) were not the same as those which showed the highest photocurrent (TiO(2)). These findings suggest that, in addition to electron transfer at the quantum dot-metal oxide interface, other electron transfer reactions play key roles in the determination of overall device efficiency.

  20. Electronic structures and population dynamics of excited states of xanthione and its derivatives

    NASA Astrophysics Data System (ADS)

    Fedunov, Roman G.; Rogozina, Marina V.; Khokhlova, Svetlana S.; Ivanov, Anatoly I.; Tikhomirov, Sergei A.; Bondarev, Stanislav L.; Raichenok, Tamara F.; Buganov, Oleg V.; Olkhovik, Vyacheslav K.; Vasilevskii, Dmitrii A.

    2017-09-01

    A new compound, 1,3-dimethoxy xanthione (DXT), has been synthesized and its absorption (stationary and transient) and luminescence spectra have been measured in n-hexane and compared with xanthione (XT) spectra. The pronounced broadening of xanthione vibronic absorption band related to the electronic transition to the second singlet excited state has been observed. Distinctions between the spectra of xanthione and its methoxy derivatives are discussed. Quantum chemical calculations of these compounds in the ground and excited electronic states have been accomplished to clarify the nature of electronic spectra changes due to modification of xanthione by methoxy groups. Appearance of a new absorption band of DXT caused by symmetry changes has been discussed. Calculations of the second excited state structure of xanthione and its methoxy derivatives confirm noticeable charge transfer (about 0.1 of the charge of an electron) from the methoxy group to thiocarbonyl group. Fitting of the transient spectra of XT and DXT has been fulfilled and the time constants of internal conversion S2 →S1 and intersystem crossing S1 →T1 have been determined. A considerable difference between the time constants of internal conversion S2 →S1 in XT and DXT is uncovered.

  1. Modular electron transfer circuits for synthetic biology

    PubMed Central

    Agapakis, Christina M

    2010-01-01

    Electron transfer is central to a wide range of essential metabolic pathways, from photosynthesis to fermentation. The evolutionary diversity and conservation of proteins that transfer electrons makes these pathways a valuable platform for engineered metabolic circuits in synthetic biology. Rational engineering of electron transfer pathways containing hydrogenases has the potential to lead to industrial scale production of hydrogen as an alternative source of clean fuel and experimental assays for understanding the complex interactions of multiple electron transfer proteins in vivo. We designed and implemented a synthetic hydrogen metabolism circuit in Escherichia coli that creates an electron transfer pathway both orthogonal to and integrated within existing metabolism. The design of such modular electron transfer circuits allows for facile characterization of in vivo system parameters with applications toward further engineering for alternative energy production. PMID:21468209

  2. Investigation of the Mechanism of Electron Capture and Electron Transfer Dissociation of Peptides with a Covalently Attached Free Radical Hydrogen Atom Scavenger.

    PubMed

    Sohn, Chang Ho; Yin, Sheng; Peng, Ivory; Loo, Joseph A; Beauchamp, J L

    2015-11-15

    The mechanisms of electron capture and electron transfer dissociation (ECD and ETD) are investigated by covalently attaching a free-radical hydrogen atom scavenger to a peptide. The 2,2,6,6-tetramethylpiperidin-l-oxyl (TEMPO) radical was chosen as the scavenger due to its high hydrogen atom affinity (ca. 280 kJ/mol) and low electron affinity (ca. 0.45 ev), and was derivatized to the model peptide, FQX TEMPO EEQQQTEDELQDK. The X TEMPO residue represents a cysteinyl residue derivatized with an acetamido-TEMPO group. The acetamide group without TEMPO was also examined as a control. The gas phase proton affinity (882 kJ/mol) of TEMPO is similar to backbone amide carbonyls (889 kJ/mol), minimizing perturbation to internal solvation and sites of protonation of the derivatized peptides. Collision induced dissociation (CID) of the TEMPO tagged peptide dication generated stable odd-electron b and y type ions without indication of any TEMPO radical induced fragmentation initiated by hydrogen abstraction. The type and abundance of fragment ions observed in the CID spectra of the TEMPO and acetamide tagged peptides are very similar. However, ECD of the TEMPO labeled peptide dication yielded no backbone cleavage. We propose that a labile hydrogen atom in the charge reduced radical ions is scavenged by the TEMPO radical moiety, resulting in inhibition of N-C α backbone cleavage processes. Supplemental activation after electron attachment (ETcaD) and CID of the charge-reduced precursor ion generated by electron transfer of the TEMPO tagged peptide dication produced a series of b + H (b H ) and y + H (y H ) ions along with some c ions having suppressed intensities, consistent with stable O-H bond formation at the TEMPO group. In summary, the results indicate that ECD and ETD backbone cleavage processes are inhibited by scavenging of a labile hydrogen atom by the localized TEMPO radical moiety. This observation supports the conjecture that ECD and ETD processes involve long-lived intermediates formed by electron capture/transfer in which a labile hydrogen atom is present and plays a key role with low energy processes leading to c and z ion formation. Ab initio and density functional calculations are performed to support our conclusion, which depends most importantly on the proton affinity, electron affinity and hydrogen atom affinity of the TEMPO moiety.

  3. Electrochemical control over photoinduced electron transfer and trapping in CdSe-CdTe quantum-dot solids.

    PubMed

    Boehme, Simon C; Walvis, T Ardaan; Infante, Ivan; Grozema, Ferdinand C; Vanmaekelbergh, Daniël; Siebbeles, Laurens D A; Houtepen, Arjan J

    2014-07-22

    Understanding and controlling charge transfer between different kinds of colloidal quantum dots (QDs) is important for devices such as light-emitting diodes and solar cells and for thermoelectric applications. Here we study photoinduced electron transfer between CdTe and CdSe QDs in a QD film. We find that very efficient electron trapping in CdTe QDs obstructs electron transfer to CdSe QDs under most conditions. Only the use of thiol ligands results in somewhat slower electron trapping; in this case the competition between trapping and electron transfer results in a small fraction of electrons being transferred to CdSe. However, we demonstrate that electron trapping can be controlled and even avoided altogether by using the unique combination of electrochemistry and transient absorption spectroscopy. When the Fermi level is raised electrochemically, traps are filled with electrons and electron transfer from CdTe to CdSe QDs occurs with unity efficiency. These results show the great importance of knowing and controlling the Fermi level in QD films and open up the possibility of studying the density of trap states in QD films as well as the systematic investigation of the intrinsic electron transfer rates in donor-acceptor films.

  4. Model-based Confirmation of Alternative Substrates of Mitochondrial Electron Transport Chain

    PubMed Central

    Kleessen, Sabrina; Araújo, Wagner L.; Fernie, Alisdair R.; Nikoloski, Zoran

    2012-01-01

    Discrimination of metabolic models based on high throughput metabolomics data, reflecting various internal and external perturbations, is essential for identifying the components that contribute to the emerging behavior of metabolic processes. Here, we investigate 12 different models of the mitochondrial electron transport chain (ETC) in Arabidopsis thaliana during dark-induced senescence in order to elucidate the alternative substrates to this metabolic pathway. Our findings demonstrate that the coupling of the proposed computational approach, based on dynamic flux balance analysis, with time-resolved metabolomics data results in model-based confirmations of the hypotheses that, during dark-induced senescence in Arabidopsis, (i) under conditions where the main substrate for the ETC are not fully available, isovaleryl-CoA dehydrogenase and 2-hydroxyglutarate dehydrogenase are able to donate electrons to the ETC, (ii) phytanoyl-CoA does not act even as an indirect substrate of the electron transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase complex, and (iii) the mitochondrial γ-aminobutyric acid transporter has functional significance in maintaining mitochondrial metabolism. Our study provides a basic framework for future in silico studies of alternative pathways in mitochondrial metabolism under extended darkness whereby the role of its components can be computationally discriminated based on available molecular profile data. PMID:22334689

  5. Study of energetic particle physics with advanced ECEI system on the HL-2A tokamak

    NASA Astrophysics Data System (ADS)

    Shi, Zhongbing; Jiang, Min; Yu, Liming; Chen, Wei; Shi, Peiwan; Zhong, Wulyu; Yang, Zengchen; Zhang, Boyu; Ji, Xiaoquan; Li, Yonggao; Zhou, Yan; Song, Shaodong; Huang, Mei; Song, Xianming; Li, Jiaxuan; Yuan, Baoshan; Fu, Bingzhong; Liu, Zetian; Ding, Xuantong; Xu, Yuhong; Yang, Qingwei; Duan, Xuru

    2017-07-01

    Understanding the physics of energetic particles (EP) is crucial for the burning plasmas in next generation fusion devices such as ITER. In this work, three types of internal kink modes (a saturated internal kink mode (SK), a resonant internal kink mode (RK), and a double e-fishbone) excited by energetic particles in the low density discharges during ECRH/ECCD heating have been studied by the newly developed 24(poloidal) × 16(radial) = 384 channel ECEI system on the HL-2A tokamak. The SK and RK rotate in the electron diamagnetic direction poloidally and are destabilized by the energetic trapped electrons. The SK is destabilized in the case of qmin > 1, while the RK is destabilized in the case of qmin < 1. The double e-fishbone, which has two m/n = 1/1 modes propagating in the opposite directions poloidally, has been observed during plasma current ramp-up with counter-ECCD. Strong thermal transfer and mode coupling between the two m/n = 1/1 modes have been studied.

  6. Comprehensive report of aeropropulsion, space propulsion, space power, and space science applications of the Lewis Research Center

    NASA Technical Reports Server (NTRS)

    1988-01-01

    The research activities of the Lewis Research Center for 1988 are summarized. The projects included are within basic and applied technical disciplines essential to aeropropulsion, space propulsion, space power, and space science/applications. These disciplines are materials science and technology, structural mechanics, life prediction, internal computational fluid mechanics, heat transfer, instruments and controls, and space electronics.

  7. 26 CFR 31.6302(c)-3 - Use of Government depositaries in connection with tax under the Federal Unemployment Tax Act.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... with tax under the Federal Unemployment Tax Act. 31.6302(c)-3 Section 31.6302(c)-3 Internal Revenue...) § 31.6302(c)-3 Use of Government depositaries in connection with tax under the Federal Unemployment Tax... transfer. For the requirement to deposit tax under the Federal Unemployment Tax Act by electronic funds...

  8. Hot-electron transfer in quantum-dot heterojunction films.

    PubMed

    Grimaldi, Gianluca; Crisp, Ryan W; Ten Brinck, Stephanie; Zapata, Felipe; van Ouwendorp, Michiko; Renaud, Nicolas; Kirkwood, Nicholas; Evers, Wiel H; Kinge, Sachin; Infante, Ivan; Siebbeles, Laurens D A; Houtepen, Arjan J

    2018-06-13

    Thermalization losses limit the photon-to-power conversion of solar cells at the high-energy side of the solar spectrum, as electrons quickly lose their energy relaxing to the band edge. Hot-electron transfer could reduce these losses. Here, we demonstrate fast and efficient hot-electron transfer between lead selenide and cadmium selenide quantum dots assembled in a quantum-dot heterojunction solid. In this system, the energy structure of the absorber material and of the electron extracting material can be easily tuned via a variation of quantum-dot size, allowing us to tailor the energetics of the transfer process for device applications. The efficiency of the transfer process increases with excitation energy as a result of the more favorable competition between hot-electron transfer and electron cooling. The experimental picture is supported by time-domain density functional theory calculations, showing that electron density is transferred from lead selenide to cadmium selenide quantum dots on the sub-picosecond timescale.

  9. Electron-transfer oxidation properties of DNA bases and DNA oligomers.

    PubMed

    Fukuzumi, Shunichi; Miyao, Hiroshi; Ohkubo, Kei; Suenobu, Tomoyoshi

    2005-04-21

    Kinetics for the thermal and photoinduced electron-transfer oxidation of a series of DNA bases with various oxidants having the known one-electron reduction potentials (E(red)) in an aqueous solution at 298 K were examined, and the resulting electron-transfer rate constants (k(et)) were evaluated in light of the free energy relationship of electron transfer to determine the one-electron oxidation potentials (E(ox)) of DNA bases and the intrinsic barrier of the electron transfer. Although the E(ox) value of GMP at pH 7 is the lowest (1.07 V vs SCE) among the four DNA bases, the highest E(ox) value (CMP) is only 0.19 V higher than that of GMP. The selective oxidation of GMP in the thermal electron-transfer oxidation of GMP results from a significant decrease in the pH dependent oxidation potential due to the deprotonation of GMP*+. The one-electron reduced species of the photosensitizer produced by photoinduced electron transfer are observed as the transient absorption spectra when the free energy change of electron transfer is negative. The rate constants of electron-transfer oxidation of the guanine moieties in DNA oligomers with Fe(bpy)3(3+) and Ru(bpy)3(3+) were also determined using DNA oligomers containing different guanine (G) sequences from 1 to 10 G. The rate constants of electron-transfer oxidation of the guanine moieties in single- and double-stranded DNA oligomers with Fe(bpy)3(2+) and Ru(bpy)3(3+) are dependent on the number of sequential guanine molecules as well as on pH.

  10. 14 CFR 1274.931 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

  11. 77 FR 40459 - Electronic Fund Transfers (Regulation E); Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-10

    ... Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... published the Final Rule (77 FR 6194), which implements the Electronic Fund Transfer Act, and the official... Sec. 1005.3(a) in the interim final rule, Electronic Fund Transfers (Regulation E), published on...

  12. 14 CFR 1274.931 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS WITH COMMERCIAL FIRMS Other Provisions and Special Conditions § 1274.931 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods July 2002 Payments under this...

  13. 14 CFR § 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 14 Aeronautics and Space 5 2014-01-01 2014-01-01 false Electronic funds transfer payment methods... GRANTS AND COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made...

  14. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 14 Aeronautics and Space 5 2013-01-01 2013-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  15. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 14 Aeronautics and Space 5 2012-01-01 2012-01-01 false Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  16. 14 CFR 1260.69 - Electronic funds transfer payment methods.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 14 Aeronautics and Space 5 2011-01-01 2010-01-01 true Electronic funds transfer payment methods... COOPERATIVE AGREEMENTS General Special Conditions § 1260.69 Electronic funds transfer payment methods. Electronic Funds Transfer Payment Methods October 2000 (a) Payments under this grant will be made by the...

  17. Quantum Computational Studies of Electron Transfer in Respiratory Complex III and its Application for Designing New Mitocan Drugs

    NASA Astrophysics Data System (ADS)

    Hagras, Muhammad Ahmed

    Electron transfer occurs in many biological systems which are imperative to sustain life; oxidative phosphorylation in prokaryotes and eukaryotes, and photophosphorylation in photosynthetic and plant cells are well-balanced and complementary processes. Investigating electron transfer in those natural systems provides detailed knowledge of the atomistic events that lead eventually to production of ATP, or harvesting light energy. Ubiquinol:cytochrome c oxidoreductase complex (also known as bc 1 complex, or respiratory complex III) is a middle player in the electron transport proton pumping orchestra, located in the inner-mitochondrial membrane in eukaryotes or plasma membrane in prokaryotes, which converts the free energy of redox reactions to electrochemical proton gradient across the membrane, following the fundamental chemiosmotic principle discovered by Peter Mitchell 1. In humans, the malfunctioned bc1 complex plays a major role in many neurodegenerative diseases, stress-induced aging, and cancer development, because it produces most of the reactive oxygen species, which are also involved in cellular signaling 2. The mitochondrial bc1 complex has an intertwined dimeric structure comprised of 11 subunits in each monomer, but only three of them have catalytic function, and those are the only domains found in bacterial bc1 complex. The core subunits include: Rieske domain, which incorporates iron-sulfur cluster [2Fe-2S]; trans-membrane cytochrome b domain, incorporating low-potential heme group (heme b L) and high-potential heme group (heme b H); and cytochrome c1 domain, containing heme c1 group and two separate binding sites, Qo (or QP) site where the hydrophobic electron carrier ubihydroquinol QH2 is oxidized, and Qi (or QN) site where ubiquinone molecule Q is reduced 3. Electrons and protons in the bc1 complex flow according to the proton-motive Q-cycle proposed by Mitchell, which includes a unique electron flow bifurcation at the Qo site. At this site, one electron of a bound QH2 molecule transfers to [2Fe-2S] cluster of the Rieske domain, docked at the proximal docking site, and another electron transfers to heme b L , which subsequently passes it to heme bH , and finally to Q or SQ molecule bound at the Qi-site 4. Rieske domain undergoes a domain movement 22 A to bind at the distal docking site, where [2Fe-2S] cluster passes its electron to heme c1, which in turn passes it to heme c of the water-soluble cytochrome c carrier 3c, 5 (which shuttles it to cytochrome c oxidase, complex IV). In the current compiled work presented in the subsequent chapters, we deployed a stacking tiers hierarchy where each chapter's work presents a foundation for the next one. In chapter 1, we first present different methods to calculate tunneling currents in proteins including a new derivation method for the inter-atomic tunneling current method. In addition, we show the results of the inter-atomic tunneling current theory on models based on heme bL-heme bH redox pair system in bc1 complex. Afterwards, in chapter 2, we examine the electron tunneling pathways 6 between different intra-monomeric and inter-monomeric redox centers of bc1 complex, including its electron carriers - ubiquinol, ubiquinone, and cytochrome c molecules, using the well-studied coarse-grained interatomic method of the tunneling current theory 7. Going through the different tunneling pathways in bc1 complex, we discovered a pair of internal switches that modulate the electron transfer rate which we discuss in full details in chapter 3. Motivated by the discovery of those internal switches, we discuss in chapter 4 the discovery of a new binding pocket (designated as NonQ-site or NQ-site for short) in bc 1 complex which is located at the opposite side of the enzyme with respect to Qo site. In contrast to Qo site, however, the NQ-site penetrates deeply in the cytochrome b domain and reaches very closely the LH region. Hence the NQ-site provides a suitable binding pocket for ligands that can influence the orientation of Phe90 residue, and hence modulate the corresponding ET rate between heme b L and heme bH. Finally we present in chapter 5 our unique integrated software package (called Electron Tunneling in Proteins Program or ETP) which provides an environment with different capabilities such as tunneling current calculation, semi-empirical quantum mechanical calculation and molecular modeling simulation for calculation and analysis of electron transfer reactions in proteins.

  18. The influence of dielectric relaxation on intramolecular electron transfer

    NASA Astrophysics Data System (ADS)

    Heitele, H.; Michel-Beyerle, M. E.; Finckh, P.

    1987-07-01

    An unusually strong temperature dependence on the intramolecular electron-transfer rate has been observed for bridged donor-acceptor compounds in propylene glycol solution. In the frame of recent electron-transfer theories this effect reflects the influence of dielectric relaxation dynamics on electron transfer. With increasing dielectric relaxation time a smooth transition from non-adiabatic to solvent-controlled adiabatic behaviour is observed. The electron transfer rate in the solvent-controlled adiabatic limit is dominated by an inhomogeneous distribution of relaxation times.

  19. Effects of internal friction on contact formation dynamics of polymer chain

    NASA Astrophysics Data System (ADS)

    Bian, Yukun; Li, Peng; Zhao, Nanrong

    2018-04-01

    A theoretical framework is presented to study the contact formation dynamics of polymer chains, in accompany with an electron-transfer quenching. Based on a non-Markovian Smoluchowski equation supplemented with an exponential sink term, we derive the mean time of contact formation under Wilemski-Fixman approximation. Our particular attentions are paid to the effect of internal friction. We find out that internal friction induces a novel fractional viscosity dependence, which will become more remarkable as internal friction increases. Furthermore, we clarify that internal friction inevitably promotes a diffusion-controlled mechanism by slowing the chain relaxation. Finally, we apply our theory to rationalise the experimental investigation for contact formation of a single-stranded DNA. The theoretical results can reproduce the experimental data very well with quite reasonable estimation for the intrinsic parameters. Such good agreements clearly demonstrate the validity of our theory which has appropriately addressed the very role of internal friction to the relevant dynamics.

  20. 12 CFR 205.15 - Electronic fund transfer of government benefits.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer of government benefits. 205.15 Section 205.15 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.15 Electronic fund transfer of government...

  1. 12 CFR 1005.3 - Coverage.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...-time electronic fund transfer from a consumer's account. The consumer must authorize the transfer. (ii... one-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR... transfer. A consumer authorizes a one-time electronic fund transfer from his or her account to pay the fee...

  2. The role of electron transfer in DNA building blocks: Evaluation of strand breaks and their implications

    NASA Astrophysics Data System (ADS)

    Almeida, Diogo Alexandre Fialho de

    Radiation-induced damage to biological systems, both direct and indirect processes, has increasingly come under scrutiny by the international scientific community due to recent findings that electrons are a very effective agent in damaging DNA/RNA. Indeed, much remains to be discovered regarding the exact physico-chemical processes that occur in the nascent stages of DNA/RNA damage by incident radiation. However, it is also known that electrons do not exist freely in the physiological medium, but rather solvated and/or pre-solvated states. This leads to the need for new techniques that can better explore the damaging role of "bound" electrons to DNA/RNA. The work presented in this thesis consists on the study of electron transfer in collisions of atomic species with molecules of biological relevance. In order to study these processes, two experimental setups were used. One setup consists of a crossed beam experiment where a neutral potassium beam is created and made to collide with an effusive molecular target beam. The anionic products that stem from electron transfer in potassium atom to the molecular target collisions are then extracted and time-of-flight (TOF) mass analysed. In the second setup a beam of anionic species is formed and made to collide with a molecular target. Collisions with three different anionic beams were performed (H-, O- and OH-), as well as with different simple organic molecules, by measuring the positive and negative ion fragmentation patterns with a quadrupole mass spectrometer (QMS). A comparison between these two collisional systems can greatly help to understand the underlying mechanisms of the electron transfer processes. Finally, studies of potassium collisions with sugar surrogates D-Ribose and THF were performed. These studies show very different fragmentation patterns from DEA, although in the case of THF, it is suggested that the initially accessed states are the same as in DEA. With these studies was also possible to show for the first time collision induced site and bond selectivity breaking, where the electron is transferred into a given state of the acceptor molecule and the resulting fragmentation pathways are exclusive to the initial anionic state. Furthermore, the role of the potassium cation post collisionwas explored and indeed its presence is suggested to induce at least partial suppression of auto-detachment. The implications that ensue from this degradation are analysed in the light of the obtained fragmentation patterns.

  3. Effect of electronic excitation on high-temperature flows behind strong shock waves

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Istomin, V. A.; Kustova, E. V.

    2014-12-09

    In the present paper, a strongly non-equilibrium one-dimensional steady-state flow behind the plane shock wave is studied. We consider a high-temperature chemically reacting five-component ionized mixture of nitrogen species (N{sub 2}/N{sub 2}{sup 2}/N/N{sup +}/e{sup −}) taking into account electronic degrees of freedom in N and N{sup +} (170 and 625 electronic energy levels respectively), and electronic-rotational-vibrational modes in N{sub 2} and N{sub 2}{sup +} (5 and 7 electronic terms). Non-equilibrium reactions of ionization, dissociation, recombination and charge-transfer are included to the kinetic scheme. The system of governing equations is written under the assumption that translation and internal energy relaxation ismore » fast whereas chemical reactions and ionization proceed on the macroscopic gas-dynamics time-scale. The developed model is applied to simulate the flow behind a plane shock wave under initial conditions characteristic for the spacecraft re-entry from an interplanetary flight (Hermes and Fire II experiments). Fluid-dynamic parameters behind the shock wave as well as transport coefficients and the heat flux are calculated for the (N{sub 2}/N{sub 2}{sup +}/N/N{sup +}/e{sup −}) mixture. The effect of electronic excitation on kinetics, dynamics and heat transfer is analyzed. Whereas the contribution of electronic degrees of freedom to the flow macroparameters is negligible, their influence on the heat flux is found to be important under conditions of Hermes re-entry.« less

  4. Tuning charge transfer in the LaTiO3/RO/LaNiO3 (R = rare-earth) superlattices by the rare-earth oxides interfaces from a first-principles calculation

    NASA Astrophysics Data System (ADS)

    Yao, Fen; Zhang, Lifang; Meng, Junling; Liu, Xiaojuan; Zhang, Xiong; Zhang, Wenwen; Meng, Jian; Zhang, Hongjie

    2018-03-01

    We investigate the internal charge transfer at the isopolar interfaces in LaTiO3/RO/LaNiO3 (R = La, Ce, Pr, Nd, Sm, Gd, Tb, Dy, Ho, Er, Tm, and Lu) superlattices by means of density functional theory calculations. The charge transfer from Ti sites to Ni sites in all superlattices is induced by the electronegativity difference between the elements Ti and Ni, and the lanthanide oxides interfaces can modulate the amount of charge transfer. Comparison of the perovskite heterostructures with the different rare-earth interfaces shows that increasing the deviations of bond angles from 180.0° and the oxygen motions near the interfaces enhance charge transfer. The 4f electrons themselves of rare-earth elements have faint influences on charge transfer. In addition, the reasons why our calculated 4f states of Sm and Tm elements disagree with the experimental systems have been provided. It is hoped that all the calculated results could be used to design new functional nanoelectronic devices in perovskite oxides.

  5. 12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2010-01-01 2010-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

  6. 12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2013-01-01 2013-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

  7. 12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2014-01-01 2014-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

  8. 12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

  9. 12 CFR 205.14 - Electronic fund transfer service provider not holding consumer's account.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... consumer learns of the loss or theft; and extends the time periods for reporting unauthorized transfers or... 12 Banks and Banking 2 2012-01-01 2012-01-01 false Electronic fund transfer service provider not... GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.14 Electronic fund...

  10. Database Development for Electrical, Electronic, and Electromechanical (EEE) Parts for the International Space Station Alpha

    NASA Technical Reports Server (NTRS)

    Wassil-Grimm, Andrew D.

    1997-01-01

    More effective electronic communication processes are needed to transfer contractor and international partner data into NASA and prime contractor baseline database systems. It is estimated that the International Space Station Alpha (ISSA) parts database will contain up to one million parts each of which may require database capabilities for approximately one thousand bytes of data for each part. The resulting gigabyte database must provide easy access to users who will be preparing multiple analyses and reports in order to verify as-designed, as-built, launch, on-orbit, and return configurations for up to 45 missions associated with the construction of the ISSA. Additionally, Internet access to this data base is strongly indicated to allow multiple user access from clients located in many foreign countries. This summer's project involved familiarization and evaluation of the ISSA Electrical, Electronic, and Electromechanical (EEE) Parts data and the process of electronically managing these data. Particular attention was devoted to improving the interfaces among the many elements of the ISSA information system and its global customers and suppliers. Additionally, prototype queries were developed to facilitate the identification of data changes in the data base, verifications that the designs used only approved parts, and certifications that the flight hardware containing EEE parts was ready for flight. This project also resulted in specific recommendations to NASA for further development in the area of EEE parts database development and usage.

  11. Anomalous single-electron transfer in common-gate quadruple-dot single-electron devices with asymmetric junction capacitances

    NASA Astrophysics Data System (ADS)

    Imai, Shigeru; Ito, Masato

    2018-06-01

    In this paper, anomalous single-electron transfer in common-gate quadruple-dot turnstile devices with asymmetric junction capacitances is revealed. That is, the islands have the same total number of excess electrons at high and low gate voltages of the swing that transfers a single electron. In another situation, two electrons enter the islands from the source and two electrons leave the islands for the source and drain during a gate voltage swing cycle. First, stability diagrams of the turnstile devices are presented. Then, sequences of single-electron tunneling events by gate voltage swings are investigated, which demonstrate the above-mentioned anomalous single-electron transfer between the source and the drain. The anomalous single-electron transfer can be understood by regarding the four islands as “three virtual islands and a virtual source or drain electrode of a virtual triple-dot device”. The anomalous behaviors of the four islands are explained by the normal behavior of the virtual islands transferring a single electron and the behavior of the virtual electrode.

  12. Apparatus and method of direct water cooling several parallel circuit cards each containing several chip packages

    DOEpatents

    Cipolla, Thomas M [Katonah, NY; Colgan, Evan George [Chestnut Ridge, NY; Coteus, Paul W [Yorktown Heights, NY; Hall, Shawn Anthony [Pleasantville, NY; Tian, Shurong [Mount Kisco, NY

    2011-12-20

    A cooling apparatus, system and like method for an electronic device includes a plurality of heat producing electronic devices affixed to a wiring substrate. A plurality of heat transfer assemblies each include heat spreaders and thermally communicate with the heat producing electronic devices for transferring heat from the heat producing electronic devices to the heat transfer assemblies. The plurality of heat producing electronic devices and respective heat transfer assemblies are positioned on the wiring substrate having the regions overlapping. A heat conduit thermally communicates with the heat transfer assemblies. The heat conduit circulates thermally conductive fluid therethrough in a closed loop for transferring heat to the fluid from the heat transfer assemblies via the heat spreader. A thermally conductive support structure supports the heat conduit and thermally communicates with the heat transfer assemblies via the heat spreader transferring heat to the fluid of the heat conduit from the support structure.

  13. Acid/base-regulated reversible electron transfer disproportionation of N–N linked bicarbazole and biacridine derivatives† †Electronic supplementary information (ESI) available: Experimental information, synthesis and characterization data, NMR spectra, solid state NMR data, X-ray data, ESR spectra, UV-Vis-NIR spectra, fluorescence spectra, kinetic experiments, theoretical calculations, Tables S1–S8, Scheme S1, Fig. S1–12, References. CCDC 1025063, 1038914, 1049677 and 1040722. For ESI and crystallographic data in CIF or other electronic format see DOI: 10.1039/c5sc00946d

    PubMed Central

    Pandit, Palash; Yamamoto, Koji; Nakamura, Toshikazu; Nishimura, Katsuyuki; Kurashige, Yuki; Yanai, Takeshi; Nakamura, Go; Masaoka, Shigeyuki; Furukawa, Ko; Yakiyama, Yumi; Kawano, Masaki

    2015-01-01

    Regulation of electron transfer on organic substances by external stimuli is a fundamental issue in science and technology, which affects organic materials, chemical synthesis, and biological metabolism. Nevertheless, acid/base-responsive organic materials that exhibit reversible electron transfer have not been well studied and developed, owing to the difficulty in inventing a mechanism to associate acid/base stimuli and electron transfer. We discovered a new phenomenon in which N–N linked bicarbazole (BC) and tetramethylbiacridine (TBA) derivatives undergo electron transfer disproportionation by acid stimulus, forming their stable radical cations and reduced species. The reaction occurs through a biradical intermediate generated by the acid-triggered N–N bond cleavage reaction of BC or TBA, which acts as a two electron acceptor to undergo electron transfer reactions with two equivalents of BC or TBA. In addition, in the case of TBA the disproportionation reaction is highly reversible through neutralization with NEt3, which recovers TBA through back electron transfer and N–N bond formation reactions. This highly reversible electron transfer reaction is possible due to the association between the acid stimulus and electron transfer via the acid-regulated N–N bond cleavage/formation reactions which provide an efficient switching mechanism, the ability of the organic molecules to act as multi-electron donors and acceptors, the extraordinary stability of the radical species, the highly selective reactivity, and the balance of the redox potentials. This discovery provides new design concepts for acid/base-regulated organic electron transfer systems, chemical reagents, or organic materials. PMID:29218181

  14. Rate of Interfacial Electron Transfer through the 1,2,3-Triazole Linkage

    PubMed Central

    Devaraj, Neal K.; Decreau, Richard A.; Ebina, Wataru; Collman, James P.; Chidsey, Christopher E. D.

    2012-01-01

    The rate of electron transfer is measured to two ferrocene and one iron tetraphenylporphyrin redox species coupled through terminal acetylenes to azide-terminated thiol monolayers by the Cu(I)-catalyzed azide–alkyne cycloaddition (a Sharpless “click” reaction) to form the 1,2,3-triazole linkage. The high yield, chemoselectivity, convenience, and broad applicability of this triazole formation reaction make such a modular assembly strategy very attractive. Electron-transfer rate constants from greater than 60,000 to 1 s−1 are obtained by varying the length and conjugation of the electron-transfer bridge and by varying the surrounding diluent thiols in the monolayer. Triazole and the triazole carbonyl linkages provide similar electronic coupling for electron transfer as esters. The ability to vary the rate of electron transfer to many different redox species over many orders of magnitude by using modular coupling chemistry provides a convenient way to study and control the delivery of electrons to multielectron redox catalysts and similar interfacial systems that require controlled delivery of electrons. PMID:16898751

  15. Vibrational energy flow controls internal conversion in a transition metal complex.

    PubMed

    Hedley, Gordon J; Ruseckas, Arvydas; Samuel, Ifor D W

    2010-09-02

    Internal conversion (IC) between excited electronic states is a fundamental photophysical process that is important for understanding protection from UV radiation, energy transfer pathways and electron injection in artificial photosynthetic systems and organic solar cells. We have studied IC between three singlet MLCT states in an iridium complex using femtosecond fluorescence spectroscopy. Very fast IC with a time constant of <20 fs is observed from the highest state and a much slower relaxation to the lowest energy singlet state on a 70 fs time scale. The abrupt slowdown of the relaxation rate occurs when there is >0.6 eV of vibrational energy stored in the complex that has to be dissipated by intramolecular vibrational redistribution before further IC to the lower energy states can occur. These results show that the ability to dissipate vibrational energy can control the relaxation process in this class of materials.

  16. On the physics of electron transfer (drift) in the substance: about the reason of “abnormal” fast transfer of electrons in the plasma of tokamak and at known Bohm’s diffusion

    NASA Astrophysics Data System (ADS)

    Boriev, I. A.

    2018-03-01

    An analysis of the problem of so-called “abnormal” fast transfer of electrons in tokamak plasma, which turned out much faster than the result of accepted calculation, is given. Such transfer of hot electrons leads to unexpectedly fast destruction of the inner tokamak wall with ejection of its matter in plasma volume, what violates a condition of plasma confinement for controlled thermonuclear fusion. It is shown, taking into account real physics of electron drift in the gas (plasma) and using the conservation law for momentum of electron transfer (drift), that the drift velocity of elastically scattered electrons should be significantly greater than that of accepted calculation. The reason is that the relaxation time of the momentum of electron transfer, to which the electron drift velocity is proportional, is significantly greater (from 16 up to 4 times) than the electron free path time. Therefore, generally accepted replacement of the relaxation time, which is unknown a priori, by the electron free path time, leads to significant (16 times for thermal electrons) underestimation of electron drift velocity (mobility). This result means, that transfer of elastically (and isotropically) scattered electrons in the gas phase should be so fast, and corresponds to multiplying coefficient (16), introduced by D. Bohm to explain the observed by him “abnormal” fast diffusion of electrons.

  17. Marcus equation

    DOE R&D Accomplishments Database

    1998-09-21

    In the late 1950s to early 1960s Rudolph A. Marcus developed a theory for treating the rates of outer-sphere electron-transfer reactions. Outer-sphere reactions are reactions in which an electron is transferred from a donor to an acceptor without any chemical bonds being made or broken. (Electron-transfer reactions in which bonds are made or broken are referred to as inner-sphere reactions.) Marcus derived several very useful expressions, one of which has come to be known as the Marcus cross-relation or, more simply, as the Marcus equation. It is widely used for correlating and predicting electron-transfer rates. For his contributions to the understanding of electron-transfer reactions, Marcus received the 1992 Nobel Prize in Chemistry. This paper discusses the development and use of the Marcus equation. Topics include self-exchange reactions; net electron-transfer reactions; Marcus cross-relation; and proton, hydride, atom and group transfers.

  18. Coupled sensitizer-catalyst dyads: electron-transfer reactions in a perylene-polyoxometalate conjugate.

    PubMed

    Odobel, Fabrice; Séverac, Marjorie; Pellegrin, Yann; Blart, Errol; Fosse, Céline; Cannizzo, Caroline; Mayer, Cédric R; Elliott, Kristopher J; Harriman, Anthony

    2009-01-01

    Ultrafast discharge of a single-electron capacitor: A variety of intramolecular electron-transfer reactions are apparent for polyoxometalates functionalized with covalently attached perylene monoimide chromophores, but these are restricted to single-electron events. (et=electron transfer, cr=charge recombination, csr=charge-shift reaction, PER=perylene, POM=polyoxometalate).A new strategy is introduced that permits covalent attachment of an organic chromophore to a polyoxometalate (POM) cluster. Two examples are reported that differ according to the nature of the anchoring group and the flexibility of the linker. Both POMs are functionalized with perylene monoimide units, which function as photon collectors and form a relatively long-lived charge-transfer state under illumination. They are reduced to a stable pi-radical anion by electrolysis or to a protonated dianion under photolysis in the presence of aqueous triethanolamine. The presence of the POM opens up an intramolecular electron-transfer route by which the charge-transfer state reduces the POM. The rate of this process depends on the molecular conformation and appears to involve through-space interactions. Prior reduction of the POM leads to efficient fluorescence quenching, again due to intramolecular electron transfer. In most cases, it is difficult to resolve the electron-transfer products because of relatively fast reverse charge shift that occurs within a closed conformer. Although the POM can store multiple electrons, it has not proved possible to use these systems as molecular-scale capacitors because of efficient electron transfer from the one-electron-reduced POM to the excited singlet state of the perylene monoimide.

  19. Directing the path of light-induced electron transfer at a molecular fork using vibrational excitation

    NASA Astrophysics Data System (ADS)

    Delor, Milan; Archer, Stuart A.; Keane, Theo; Meijer, Anthony J. H. M.; Sazanovich, Igor V.; Greetham, Gregory M.; Towrie, Michael; Weinstein, Julia A.

    2017-11-01

    Ultrafast electron transfer in condensed-phase molecular systems is often strongly coupled to intramolecular vibrations that can promote, suppress and direct electronic processes. Recent experiments exploring this phenomenon proved that light-induced electron transfer can be strongly modulated by vibrational excitation, suggesting a new avenue for active control over molecular function. Here, we achieve the first example of such explicit vibrational control through judicious design of a Pt(II)-acetylide charge-transfer donor-bridge-acceptor-bridge-donor 'fork' system: asymmetric 13C isotopic labelling of one of the two -C≡C- bridges makes the two parallel and otherwise identical donor→acceptor electron-transfer pathways structurally distinct, enabling independent vibrational perturbation of either. Applying an ultrafast UVpump(excitation)-IRpump(perturbation)-IRprobe(monitoring) pulse sequence, we show that the pathway that is vibrationally perturbed during UV-induced electron transfer is dramatically slowed down compared to its unperturbed counterpart. One can thus choose the dominant electron transfer pathway. The findings deliver a new opportunity for precise perturbative control of electronic energy propagation in molecular devices.

  20. Energy cascades, excited state dynamics, and photochemistry in cob(III)alamins and ferric porphyrins.

    PubMed

    Rury, Aaron S; Wiley, Theodore E; Sension, Roseanne J

    2015-03-17

    Porphyrins and the related chlorins and corrins contain a cyclic tetrapyrrole with the ability to coordinate an active metal center and to perform a variety of functions exploiting the oxidation state, reactivity, and axial ligation of the metal center. These compounds are used in optically activated applications ranging from light harvesting and energy conversion to medical therapeutics and photodynamic therapy to molecular electronics, spintronics, optoelectronic thin films, and optomagnetics. Cobalt containing corrin rings extend the range of applications through photolytic cleavage of a unique axial carbon-cobalt bond, permitting spatiotemporal control of drug delivery. The photochemistry and photophysics of cyclic tetrapyrroles are controlled by electronic relaxation dynamics including internal conversion and intersystem crossing. Typically the electronic excitation cascades through ring centered ππ* states, ligand to metal charge transfer (LMCT) states, metal to ligand charge transfer (MLCT) states, and metal centered states. Ultrafast transient absorption spectroscopy provides a powerful tool for the investigation of the electronic state dynamics in metal containing tetrapyrroles. The UV-visible spectrum is sensitive to the oxidation state, electronic configuration, spin state, and axial ligation of the central metal atom. Ultrashort broadband white light probes spanning the range from 270 to 800 nm, combined with tunable excitation pulses, permit the detailed unravelling of the time scales involved in the electronic energy cascade. State-of-the-art theoretical calculations provide additional insight required for precise assignment of the states. In this Account, we focus on recent ultrafast transient absorption studies of ferric porphyrins and corrin containing cob(III)alamins elucidating the electronic states responsible for ultrafast energy cascades, excited state dynamics, and the resulting photoreactivity or photostability of these compounds. Iron tetraphenyl porphyrin chloride (Fe((III))TPPCl) exhibits picosecond decay to a metal centered d → d* (4)T state. This state decays on a ca. 16 ps time scale in room temperature solution but persists for much longer in a cryogenic glass. The photoreactivity of the (4)T state may lead to novel future applications for these compounds. In contrast, the nonplanar cob(III)alamins contain two axial ligands to the central cobalt atom. The upper axial ligand can be an alkyl group as in the two biologically active coenzymes or a nonalkyl ligand such as -CN in cyanocobalamin (vitamin B12) or -OH in hydroxocobalamin. The electronic structure, energy cascade, and bond cleavage of these compounds is sensitive to the details of the axial ligand. Nonalkylcobalamins exhibit ultrafast internal conversion to a low-lying state of metal to ligand or ligand to metal charge transfer character. The compounds are generally photostable with ground state recovery complete on a time scale of 2-7 ps in room temperature aqueous solution. Alkylcobalamins exhibit ultrafast internal conversion to an S1 state of d/π → π* character. Most compounds undergo bond cleavage from this state with near unit quantum yield within ∼100 ps. Recent theoretical calculations provide a potential energy surface accounting for these observations. Conformation dependent mixing of the corrin π and cobalt d orbitals plays a significant role in the observed photochemistry and photophysics.

  1. Analysis of FORTE data to extract ionospheric parameters

    NASA Astrophysics Data System (ADS)

    Roussel-Dupré, Robert A.; Jacobson, Abram R.; Triplett, Laurie A.

    2001-01-01

    The ionospheric transfer function is derived for a spherically symmetric ionosphere with an arbitrary radial electron density profile in the limit where the radio frequencies of interest ω are much larger than the plasma frequency ωpe. An expansion of the transfer function to second order in the parameter X (= ω2pe/ω2) is carried out. In this limit the dispersive properties of the ionosphere are manifested as a frequency-dependent time of arrival that includes quadratic, cubic, and quartic terms in 1/ω. The coefficients of these terms are related to the total electron content (TEC) along the slant path from transmitter to receiver, the product of TEC and the longitudinal magnetic field strength along the slant path, and refractive bending and higher-order electron density profile effects, respectively. By fitting the time of arrival versus frequency of a transionospheric signal to a polynomial in 1/ω it is possible to extract the TEC, the longitudinal magnetic field strength, the peak electron density, and an effective thickness for the ionosphere. This exercise was carried out for a number of transionospheric pulses measured in the VHF by the FORTE satellite receiver and generated by the Los Alamos Portable Pulser. The results are compared with predictions derived from the International Reference Ionosphere and the United States Geological Survey geomagnetic field model.

  2. Thermal transfer structures coupling electronics card(s) to coolant-cooled structure(s)

    DOEpatents

    David, Milnes P; Graybill, David P; Iyengar, Madhusudan K; Kamath, Vinod; Kochuparambil, Bejoy J; Parida, Pritish R; Schmidt, Roger R

    2014-12-16

    Cooling apparatuses and coolant-cooled electronic systems are provided which include thermal transfer structures configured to engage with a spring force one or more electronics cards with docking of the electronics card(s) within a respective socket(s) of the electronic system. A thermal transfer structure of the cooling apparatus includes a thermal spreader having a first thermal conduction surface, and a thermally conductive spring assembly coupled to the conduction surface of the thermal spreader and positioned and configured to reside between and physically couple a first surface of an electronics card to the first surface of the thermal spreader with docking of the electronics card within a socket of the electronic system. The thermal transfer structure is, in one embodiment, metallurgically bonded to a coolant-cooled structure and facilitates transfer of heat from the electronics card to coolant flowing through the coolant-cooled structure.

  3. Probing energy transfer events in the light harvesting complex 2 (LH2) of Rhodobacter sphaeroides with two-dimensional spectroscopy.

    PubMed

    Fidler, Andrew F; Singh, Ved P; Long, Phillip D; Dahlberg, Peter D; Engel, Gregory S

    2013-10-21

    Excitation energy transfer events in the photosynthetic light harvesting complex 2 (LH2) of Rhodobacter sphaeroides are investigated with polarization controlled two-dimensional electronic spectroscopy. A spectrally broadened pulse allows simultaneous measurement of the energy transfer within and between the two absorption bands at 800 nm and 850 nm. The phased all-parallel polarization two-dimensional spectra resolve the initial events of energy transfer by separating the intra-band and inter-band relaxation processes across the two-dimensional map. The internal dynamics of the 800 nm region of the spectra are resolved as a cross peak that grows in on an ultrafast time scale, reflecting energy transfer between higher lying excitations of the B850 chromophores into the B800 states. We utilize a polarization sequence designed to highlight the initial excited state dynamics which uncovers an ultrafast transfer component between the two bands that was not observed in the all-parallel polarization data. We attribute the ultrafast transfer component to energy transfer from higher energy exciton states to lower energy states of the strongly coupled B850 chromophores. Connecting the spectroscopic signature to the molecular structure, we reveal multiple relaxation pathways including a cyclic transfer of energy between the two rings of the complex.

  4. Ultrafast forward and backward electron transfer dynamics of coumarin 337 in hydrogen-bonded anilines as studied with femtosecond UV-pump/IR-probe spectroscopy.

    PubMed

    Ghosh, Hirendra N; Verma, Sandeep; Nibbering, Erik T J

    2011-02-10

    Femtosecond infrared spectroscopy is used to study both forward and backward electron transfer (ET) dynamics between coumarin 337 (C337) and the aromatic amine solvents aniline (AN), N-methylaniline (MAN), and N,N-dimethylaniline (DMAN), where all the aniline solvents can donate an electron but only AN and MAN can form hydrogen bonds with C337. The formation of a hydrogen bond with AN and MAN is confirmed with steady state FT-IR spectroscopy, where the C═O stretching vibration is a direct marker mode for hydrogen bond formation. Transient IR absorption measurements in all solvents show an absorption band at 2166 cm(-1), which has been attributed to the C≡N stretching vibration of the C337 radical anion formed after ET. Forward electron transfer dynamics is found to be biexponential with time constants τ(ET)(1) = 500 fs, τ(ET)(2) = 7 ps in all solvents. Despite the presence of hydrogen bonds of C337 with the solvents AN and MAN, no effect has been found on the forward electron transfer step. Because of the absence of an H/D isotope effect on the forward electron transfer reaction of C337 in AN, hydrogen bonds are understood to play a minor role in mediating electron transfer. In contrast, direct π-orbital overlap between C337 and the aromatic amine solvents causes ultrafast forward electron transfer dynamics. Backward electron transfer dynamics, in contrast, is dependent on the solvent used. Standard Marcus theory explains the observed backward electron transfer rates.

  5. A photovoltaic device structure based on internal electron emission.

    PubMed

    McFarland, Eric W; Tang, Jing

    2003-02-06

    There has been an active search for cost-effective photovoltaic devices since the development of the first solar cells in the 1950s (refs 1-3). In conventional solid-state solar cells, electron-hole pairs are created by light absorption in a semiconductor, with charge separation and collection accomplished under the influence of electric fields within the semiconductor. Here we report a multilayer photovoltaic device structure in which photon absorption instead occurs in photoreceptors deposited on the surface of an ultrathin metal-semiconductor junction Schottky diode. Photoexcited electrons are transferred to the metal and travel ballistically to--and over--the Schottky barrier, so providing the photocurrent output. Low-energy (approximately 1 eV) electrons have surprisingly long ballistic path lengths in noble metals, allowing a large fraction of the electrons to be collected. Unlike conventional cells, the semiconductor in this device serves only for majority charge transport and separation. Devices fabricated using a fluorescein photoreceptor on an Au/TiO2/Ti multilayer structure had typical open-circuit photovoltages of 600-800 mV and short-circuit photocurrents of 10-18 micro A cm(-2) under 100 mW cm(-2) visible band illumination: the internal quantum efficiency (electrons measured per photon absorbed) was 10 per cent. This alternative approach to photovoltaic energy conversion might provide the basis for durable low-cost solar cells using a variety of materials.

  6. Photo-induced electron transfer method

    DOEpatents

    Wohlgemuth, R.; Calvin, M.

    1984-01-24

    The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospholipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transferring electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.

  7. Dynamics driving function: new insights from electron transferring flavoproteins and partner complexes.

    PubMed

    Toogood, Helen S; Leys, David; Scrutton, Nigel S

    2007-11-01

    Electron transferring flavoproteins (ETFs) are soluble heterodimeric FAD-containing proteins that function primarily as soluble electron carriers between various flavoprotein dehydrogenases. ETF is positioned at a key metabolic branch point, responsible for transferring electrons from up to 10 primary dehydrogenases to the membrane-bound respiratory chain. Clinical mutations of ETF result in the often fatal disease glutaric aciduria type II. Structural and biophysical studies of ETF in complex with partner proteins have shown that ETF partitions the functions of partner binding and electron transfer between (a) a 'recognition loop', which acts as a static anchor at the ETF-partner interface, and (b) a highly mobile redox-active FAD domain. Together, this enables the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. This 'conformational sampling' enables ETF to recognize structurally distinct partners, whilst also maintaining a degree of specificity. Complex formation triggers mobility of the FAD domain, an 'induced disorder' mechanism contrasting with the more generally accepted models of protein-protein interaction by induced fit mechanisms. We discuss the implications of the highly dynamic nature of ETFs in biological interprotein electron transfer. ETF complexes point to mechanisms of electron transfer in which 'dynamics drive function', a feature that is probably widespread in biology given the modular assembly and flexible nature of biological electron transfer systems.

  8. Parallel Large-scale Semidefinite Programming for Strong Electron Correlation: Using Correlation and Entanglement in the Design of Efficient Energy-Transfer Mechanisms

    DTIC Science & Technology

    2014-09-24

    which nature uses strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an...strong electron correlation for efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm...efficient energy transfer, particularly in photosynthesis and bioluminescence, (ii) providing an innovative paradigm for energy transfer in photovoltaic

  9. Electron Tunneling in Lithium Ammonia Solutions Probed by Frequency-Dependent Electron-Spin Relaxation Studies

    PubMed Central

    Maeda, Kiminori; Lodge, Matthew T.J.; Harmer, Jeffrey; Freed, Jack H.; Edwards, Peter P.

    2012-01-01

    Electron transfer or quantum tunneling dynamics for excess or solvated electrons in dilute lithium-ammonia solutions have been studied by pulse electron paramagnetic resonance (EPR) spectroscopy at both X- (9.7 GHz) and W-band (94 GHz) frequencies. The electron spin-lattice (T1) and spin-spin (T2) relaxation data indicate an extremely fast transfer or quantum tunneling rate of the solvated electron in these solutions which serves to modulate the hyperfine (Fermi-contact) interaction with nitrogen nuclei in the solvation shells of ammonia molecules surrounding the localized, solvated electron. The donor and acceptor states of the solvated electron in these solutions are the initial and final electron solvation sites found before, and after, the transfer or tunneling process. To interpret and model our electron spin relaxation data from the two observation EPR frequencies requires a consideration of a multi-exponential correlation function. The electron transfer or tunneling process that we monitor through the correlation time of the nitrogen Fermi-contact interaction has a time scale of (1–10)×10−12 s over a temperature range 230–290K in our most dilute solution of lithium in ammonia. Two types of electron-solvent interaction mechanisms are proposed to account for our experimental findings. The dominant electron spin relaxation mechanism results from an electron tunneling process characterized by a variable donor-acceptor distance or range (consistent with such a rapidly fluctuating liquid structure) in which the solvent shell that ultimately accepts the transferring electron is formed from random, thermal fluctuations of the liquid structure in, and around, a natural hole or Bjerrum-like defect vacancy in the liquid. Following transfer and capture of the tunneling electron, further solvent-cage relaxation with a timescale of ca. 10−13 s results in a minor contribution to the electron spin relaxation times. This investigation illustrates the great potential of multi-frequency EPR measurements to interrogate the microscopic nature and dynamics of ultra fast electron transfer or quantum-tunneling processes in liquids. Our results also impact on the universal issue of the role of a host solvent (or host matrix, e.g. a semiconductor) in mediating long-range electron transfer processes and we discuss the implications of our results with a range of other materials and systems exhibiting the phenomenon of electron transfer. PMID:22568866

  10. Opto-electronic conversion logic behaviour through dynamic modulation of electron/energy transfer states at the TiO2-carbon quantum dot interface.

    PubMed

    Wang, Fang; Zhang, Yonglai; Liu, Yang; Wang, Xuefeng; Shen, Mingrong; Lee, Shuit-Tong; Kang, Zhenhui

    2013-03-07

    Here we show a bias-mediated electron/energy transfer process at the CQDs-TiO(2) interface for the dynamic modulation of opto-electronic properties. Different energy and electron transfer states have been observed in the CQDs-TNTs system due to the up-conversion photoluminescence and the electron donation/acceptance properties of the CQDs decorated on TNTs.

  11. High-level ab initio potential energy surface and dynamics of the F- + CH3I SN2 and proton-transfer reactions.

    PubMed

    Olasz, Balázs; Szabó, István; Czakó, Gábor

    2017-04-01

    Bimolecular nucleophilic substitution (S N 2) and proton transfer are fundamental processes in chemistry and F - + CH 3 I is an important prototype of these reactions. Here we develop the first full-dimensional ab initio analytical potential energy surface (PES) for the F - + CH 3 I system using a permutationally invariant fit of high-level composite energies obtained with the combination of the explicitly-correlated CCSD(T)-F12b method, the aug-cc-pVTZ basis, core electron correlation effects, and a relativistic effective core potential for iodine. The PES accurately describes the S N 2 channel producing I - + CH 3 F via Walden-inversion, front-side attack, and double-inversion pathways as well as the proton-transfer channel leading to HF + CH 2 I - . The relative energies of the stationary points on the PES agree well with the new explicitly-correlated all-electron CCSD(T)-F12b/QZ-quality benchmark values. Quasiclassical trajectory computations on the PES show that the proton transfer becomes significant at high collision energies and double-inversion as well as front-side attack trajectories can occur. The computed broad angular distributions and hot internal energy distributions indicate the dominance of indirect mechanisms at lower collision energies, which is confirmed by analyzing the integration time and leaving group velocity distributions. Comparison with available crossed-beam experiments shows usually good agreement.

  12. Integrated view of internal friction in unfolded proteins from single-molecule FRET, contact quenching, theory, and simulations

    PubMed Central

    Soranno, Andrea; Holla, Andrea; Dingfelder, Fabian; Nettels, Daniel; Makarov, Dmitrii E.; Schuler, Benjamin

    2017-01-01

    Internal friction is an important contribution to protein dynamics at all stages along the folding reaction. Even in unfolded and intrinsically disordered proteins, internal friction has a large influence, as demonstrated with several experimental techniques and in simulations. However, these methods probe different facets of internal friction and have been applied to disparate molecular systems, raising questions regarding the compatibility of the results. To obtain an integrated view, we apply here the combination of two complementary experimental techniques, simulations, and theory to the same system: unfolded protein L. We use single-molecule Förster resonance energy transfer (FRET) to measure the global reconfiguration dynamics of the chain, and photoinduced electron transfer (PET), a contact-based method, to quantify the rate of loop formation between two residues. This combination enables us to probe unfolded-state dynamics on different length scales, corresponding to different parts of the intramolecular distance distribution. Both FRET and PET measurements show that internal friction dominates unfolded-state dynamics at low denaturant concentration, and the results are in remarkable agreement with recent large-scale molecular dynamics simulations using a new water model. The simulations indicate that intrachain interactions and dihedral angle rotation correlate with the presence of internal friction, and theoretical models of polymer dynamics provide a framework for interrelating the contribution of internal friction observed in the two types of experiments and in the simulations. The combined results thus provide a coherent and quantitative picture of internal friction in unfolded proteins that could not be attained from the individual techniques. PMID:28223518

  13. Integrated view of internal friction in unfolded proteins from single-molecule FRET, contact quenching, theory, and simulations.

    PubMed

    Soranno, Andrea; Holla, Andrea; Dingfelder, Fabian; Nettels, Daniel; Makarov, Dmitrii E; Schuler, Benjamin

    2017-03-07

    Internal friction is an important contribution to protein dynamics at all stages along the folding reaction. Even in unfolded and intrinsically disordered proteins, internal friction has a large influence, as demonstrated with several experimental techniques and in simulations. However, these methods probe different facets of internal friction and have been applied to disparate molecular systems, raising questions regarding the compatibility of the results. To obtain an integrated view, we apply here the combination of two complementary experimental techniques, simulations, and theory to the same system: unfolded protein L. We use single-molecule Förster resonance energy transfer (FRET) to measure the global reconfiguration dynamics of the chain, and photoinduced electron transfer (PET), a contact-based method, to quantify the rate of loop formation between two residues. This combination enables us to probe unfolded-state dynamics on different length scales, corresponding to different parts of the intramolecular distance distribution. Both FRET and PET measurements show that internal friction dominates unfolded-state dynamics at low denaturant concentration, and the results are in remarkable agreement with recent large-scale molecular dynamics simulations using a new water model. The simulations indicate that intrachain interactions and dihedral angle rotation correlate with the presence of internal friction, and theoretical models of polymer dynamics provide a framework for interrelating the contribution of internal friction observed in the two types of experiments and in the simulations. The combined results thus provide a coherent and quantitative picture of internal friction in unfolded proteins that could not be attained from the individual techniques.

  14. Experimental insights on the electron transfer and energy transfer processes between Ce{sup 3+}-Yb{sup 3+} and Ce{sup 3+}-Tb{sup 3+} in borate glass

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sontakke, Atul D., E-mail: sontakke.atul.55a@st.kyoto-u.ac.jp; Katayama, Yumiko; Tanabe, Setsuhisa

    2015-03-30

    A facile method to describe the electron transfer and energy transfer processes among lanthanide ions is presented based on the temperature dependent donor luminescence decay kinetics. The electron transfer process in Ce{sup 3+}-Yb{sup 3+} exhibits a steady rise with temperature, whereas the Ce{sup 3+}-Tb{sup 3+} energy transfer remains nearly unaffected. This feature has been investigated using the rate equation modeling and a methodology for the quantitative estimation of interaction parameters is presented. Moreover, the overall consequences of electron transfer and energy transfer process on donor-acceptor luminescence behavior, quantum efficiency, and donor luminescence decay kinetics are discussed in borate glass host.more » The results in this study propose a straight forward approach to distinguish the electron transfer and energy transfer processes between lanthanide ions in dielectric hosts, which is highly advantageous in view of the recent developments on lanthanide doped materials for spectral conversion, persistent luminescence, and related applications.« less

  15. Ultrafast energy transfer with competing channels: Non-equilibrium Förster and Modified Redfield theories

    NASA Astrophysics Data System (ADS)

    Seibt, Joachim; Mančal, Tomáš

    2017-05-01

    We derive equations of motion for the reduced density matrix of a molecular system which undergoes energy transfer dynamics competing with fast internal conversion channels. Environmental degrees of freedom of such a system have no time to relax to quasi-equilibrium in the electronic excited state of the donor molecule, and thus the conditions of validity of Förster and Modified Redfield theories in their standard formulations do not apply. We derive non-equilibrium versions of the two well-known rate theories and apply them to the case of carotenoid-chlorophyll energy transfer. Although our reduced density matrix approach does not account for the formation of vibronic excitons, it still confirms the important role of the donor ground-state vibrational states in establishing the resonance energy transfer conditions. We show that it is essential to work with a theory valid in a strong system-bath interaction regime to obtain correct dependence of the rates on donor-acceptor energy gap.

  16. Hydrogen peroxide and dioxygen activation by dinuclear copper complexes in aqueous solution: hydroxyl radical production initiated by internal electron transfer.

    PubMed

    Zhu, Qing; Lian, Yuxiang; Thyagarajan, Sunita; Rokita, Steven E; Karlin, Kenneth D; Blough, Neil V

    2008-05-21

    Dinuclear Cu(II) complexes, CuII2Nn (n = 4 or 5), were recently found to specifically cleave DNA in the presence of a reducing thiol and O2 or in the presence of H2O2 alone. However, CuII2N3 and a closely related mononuclear Cu(II) complex exhibited no selective reaction under either condition. Spectroscopic studies indicate an intermediate is generated from CuII2Nn (n = 4 or 5) and mononuclear Cu(II) solutions in the presence of H2O2 or from CuI2Nn (n = 4 or 5) in the presence of O2. This intermediate decays to generate OH radicals and ligand degradation products at room temperature. The lack of reactivity of the intermediate with a series of added electron donors suggests the intermediate discharges through a rate-limiting intramolecular electron transfer from the ligand to the metal peroxo center to produce an OH radical and a ligand-based radical. These results imply that DNA cleavage does not result from direct reaction with a metal-peroxo intermediate but instead arises from reaction with either OH radicals or ligand-based radicals.

  17. Verification of the electron/proton coupled mechanism for phenolic H-atom transfer using a triplet π,π ∗ carbonyl

    NASA Astrophysics Data System (ADS)

    Yamaji, Minoru; Oshima, Juro; Hidaka, Motohiko

    2009-06-01

    Evidence for the coupled electron/proton transfer mechanism of the phenolic H-atom transfer between triplet π,π ∗ 3,3'-carbonylbis(7-diethylaminocoumarin) and phenol derivatives is obtained by using laser photolysis techniques. It was confirmed that the quenching rate constants of triplet CBC by phenols having positive Hammett constants do not follow the Rehm-Weller equation for electron transfer while those by phenols with negative Hammett constants do it. From the viewpoint of thermodynamic parameters for electron transfer, the crucial factors for phenolic H-atom transfer to π,π ∗ triplet are discussed.

  18. Bridge-mediated hopping or superexchange electron-transfer processes in bis(triarylamine) systems

    NASA Astrophysics Data System (ADS)

    Lambert, Christoph; Nöll, Gilbert; Schelter, Jürgen

    2002-09-01

    Hopping and superexchange are generally considered to be alternative electron-transfer mechanisms in molecular systems. In this work we used mixed-valence radical cations as model systems for the investigation of electron-transfer pathways. We show that substituents attached to a conjugated bridge connecting two triarylamine redox centres have a marked influence on the near-infrared absorption spectra of the corresponding cations. Spectral analysis, followed by evaluation of the electron-transfer parameters using the Generalized Mulliken-Hush theory and simulation of the potential energy surfaces, indicate that hopping and superexchange are not alternatives, but are both present in the radical cation with a dimethoxybenzene bridge. We found that the type of electron-transfer mechanism depends on the bridge-reorganization energy as well as on the bridge-state energy. Because superexchange and hopping follow different distance laws, our findings have implications for the design of new molecular and polymeric electron-transfer materials.

  19. Direct Electron Transfer of Dehydrogenases for Development of 3rd Generation Biosensors and Enzymatic Fuel Cells.

    PubMed

    Bollella, Paolo; Gorton, Lo; Antiochia, Riccarda

    2018-04-24

    Dehydrogenase based bioelectrocatalysis has been increasingly exploited in recent years in order to develop new bioelectrochemical devices, such as biosensors and biofuel cells, with improved performances. In some cases, dehydrogeases are able to directly exchange electrons with an appropriately designed electrode surface, without the need for an added redox mediator, allowing bioelectrocatalysis based on a direct electron transfer process. In this review we briefly describe the electron transfer mechanism of dehydrogenase enzymes and some of the characteristics required for bioelectrocatalysis reactions via a direct electron transfer mechanism. Special attention is given to cellobiose dehydrogenase and fructose dehydrogenase, which showed efficient direct electron transfer reactions. An overview of the most recent biosensors and biofuel cells based on the two dehydrogenases will be presented. The various strategies to prepare modified electrodes in order to improve the electron transfer properties of the device will be carefully investigated and all analytical parameters will be presented, discussed and compared.

  20. A Proteomic View at the Biochemistry of Syntrophic Butyrate Oxidation in Syntrophomonas wolfei

    PubMed Central

    Schmidt, Alexander; Müller, Nicolai; Schink, Bernhard; Schleheck, David

    2013-01-01

    In syntrophic conversion of butyrate to methane and CO2, butyrate is oxidized to acetate by secondary fermenting bacteria such as Syntrophomonas wolfei in close cooperation with methanogenic partner organisms, e.g., Methanospirillum hungatei. This process involves an energetically unfavourable shift of electrons from the level of butyryl-CoA oxidation to the substantially lower redox potential of proton and/or CO2 reduction, in order to transfer these electrons to the methanogenic partner via hydrogen and/or formate. In the present study, all prominent membrane-bound and soluble proteins expressed in S. wolfei specifically during syntrophic growth with butyrate, in comparison to pure-culture growth with crotonate, were examined by one- and two-dimensional gel electrophoresis, and identified by peptide fingerprinting-mass spectrometry. A membrane-bound, externally oriented, quinone-linked formate dehydrogenase complex was expressed at high level specifically during syntrophic butyrate oxidation, comprising a selenocystein-linked catalytic subunit with a membrane-translocation pathway signal (TAT), a membrane-bound iron-sulfur subunit, and a membrane-bound cytochrome. Soluble hydrogenases were expressed at high levels specifically during growth with crotonate. The results were confirmed by native protein gel electrophoresis, by formate dehydrogenase and hydrogenase-activity staining, and by analysis of formate dehydrogenase and hydrogenase activities in intact cells and cell extracts. Furthermore, constitutive expression of a membrane-bound, internally oriented iron-sulfur oxidoreductase (DUF224) was confirmed, together with expression of soluble electron-transfer flavoproteins (EtfAB) and two previously identified butyryl-CoA dehydrogenases. Our findings allow to depict an electron flow scheme for syntrophic butyrate oxidation in S. wolfei. Electrons derived from butyryl-CoA are transferred through a membrane-bound EtfAB:quinone oxidoreductase (DUF224) to a menaquinone cycle and further via a b-type cytochrome to an externally oriented formate dehydrogenase. Hence, an ATP hydrolysis-driven proton-motive force across the cytoplasmatic membrane would provide the energy input for the electron potential shift necessary for formate formation. PMID:23468890

  1. Study of ring influence and electronic response to proton transfer reactions. Reaction electronic flux analysis.

    PubMed

    Herrera, Barbara

    2011-05-01

    In this article, a theoretical study of 1-5 proton transfers is presented. Two model systems which represent 1-5 proton transfer, 3-hidroxy-2-propenimine and salicyldenaniline have been studied as shown in Fig. 1. For this purpose, a DFT/B3LYP/6-311+G**, reaction force and reaction electronic flux analysis is made. The obtained results indicate that both proton transfers exhibit energetic and electronic differences emphasizing the role of the neighbor ring and the impact of conjugation on electronic properties.

  2. Food Antioxidants: Chemical Insights at the Molecular Level.

    PubMed

    Galano, Annia; Mazzone, Gloria; Alvarez-Diduk, Ruslán; Marino, Tiziana; Alvarez-Idaboy, J Raúl; Russo, Nino

    2016-01-01

    In this review, we briefly summarize the reliability of the density functional theory (DFT)-based methods to accurately predict the main antioxidant properties and the reaction mechanisms involved in the free radical-scavenging reactions of chemical compounds present in food. The analyzed properties are the bond dissociation energies, in particular those involving OH bonds, electron transfer enthalpies, adiabatic ionization potentials, and proton affinities. The reaction mechanisms are hydrogen-atom transfer, proton-coupled electron transfer, radical adduct formation, single electron transfer, sequential electron proton transfer, proton-loss electron transfer, and proton-loss hydrogen-atom transfer. Furthermore, the chelating ability of these compounds and its role in decreasing or inhibiting the oxidative stress induced by Fe(III) and Cu(II) are considered. Comparisons between theoretical and experimental data confirm that modern theoretical tools are not only able to explain controversial experimental facts but also to predict chemical behavior.

  3. On generalized Mulliken-Hush approach of electronic transfer: Inclusion of non-zero off-diagonal diabatic dipole moment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kryachko, E.S.

    1999-06-03

    The electronic coupling between the initial and final diabatic states is the major factor that determines the rate of electron transfer. A general formula for the adiabatic-to-diabatic mixing angle in terms of the electronic dipole moments is derived within a two-state model. It expresses the electronic coupling determining the rate of electronic transfer in terms of the off-diagonal diabatic dipole moment.

  4. Photo-induced electron transfer method

    DOEpatents

    Wohlgemuth, Roland; Calvin, Melvin

    1984-01-01

    The efficiency of photo-induced electron transfer reactions is increased and the back transfer of electrons in such reactions is greatly reduced when a photo-sensitizer zinc porphyrin-surfactant and an electron donor manganese porphyrin-surfactant are admixed into phospho-lipid membranes. The phospholipids comprising said membranes are selected from phospholipids whose head portions are negatively charged. Said membranes are contacted with an aqueous medium in which an essentially neutral viologen electron acceptor is admixed. Catalysts capable of transfering electrons from reduced viologen electron acceptor to hydrogen to produce elemental hydrogen are also included in the aqueous medium. An oxidizable olefin is also admixed in the phospholipid for the purpose of combining with oxygen that coordinates with oxidized electron donor manganese porphyrin-surfactant.

  5. Electrical Matching at Metal/Molecule Contacts for Efficient Heterogeneous Charge Transfer.

    PubMed

    Sato, Shino; Iwase, Shigeru; Namba, Kotaro; Ono, Tomoya; Hara, Kenji; Fukuoka, Atsushi; Uosaki, Kohei; Ikeda, Katsuyoshi

    2018-02-27

    In a metal/molecule hybrid system, unavoidable electrical mismatch exists between metal continuum states and frontier molecular orbitals. This causes energy loss in the electron conduction across the metal/molecule interface. For efficient use of energy in a metal/molecule hybrid system, it is necessary to control interfacial electronic structures. Here we demonstrate that electrical matching between a gold substrate and π-conjugated molecular wires can be obtained by using monatomic foreign metal interlayers, which can change the degree of d-π* back-donation at metal/anchor contacts. This interfacial control leads to energy level alignment between the Fermi level of the metal electrode and conduction molecular orbitals, resulting in resonant electron conduction in the metal/molecule hybrid system. When this method is applied to molecule-modified electrocatalysts, the heterogeneous electrochemical reaction rate is considerably improved with significant suppression of energy loss at the internal electron conduction.

  6. Carotenoid Photoprotection in Artificial Photosynthetic Antennas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kloz, Miroslav; Pillai, Smitha; Kodis, Gerdenis

    A series of phthalocyanine-carotenoid dyads in which a phenylamino group links a phthalocyanine to carotenoids having 8-11 backbone double bonds were examined by visible and near-infrared femtosecond pump-probe spectroscopy combined with global fitting analysis. The series of molecules has permitted investigation of the role of carotenoids in the quenching of excited states of cyclic tetrapyrroles. The transient behavior varied dramatically with the length of the carotenoid and the solvent environment. Clear spectroscopic signatures of radical species revealed photoinduced electron transfer as the main quenching mechanism for all dyads dissolved in a polar solvent (THF), and the quenching rate was almostmore » independent of carotenoid length. However, in a nonpolar solvent (toluene), quenching rates displayed a strong dependence on the conjugation length of the carotenoid and the mechanism did not include charge separation. The lack of any rise time components of a carotenoid S 1 signature in all experiments in toluene suggests that an excitonic coupling between the carotenoid S 1 state and phthalocyanine Q state, rather than a conventional energy transfer process, is the major mechanism of quenching. A pronounced inhomogeneity of the system was observed and attributed to the presence of a phenyl-amino linker between phthalocyanine and carotenoids. On the basis of accumulated work on various caroteno-phthalocyanine dyads and triads, we have now identified three mechanisms of tetrapyrrole singlet excited state quenching by carotenoids in artificial systems: (i) Car-Pc electron transfer and recombination; (ii) 1Pc to Car S 1 energy transfer and fast internal conversion to the Car ground state; (iii) excitonic coupling between 1Pc and Car S 1 and ensuing internal conversion to the ground state of the carotenoid. The dominant mechanism depends upon the exact molecular architecture and solvent environment. These synthetic systems are providing a deeper understanding of structural and environmental effects on the interactions between carotenoids and tetrapyrroles and thereby better defining their role in controlling natural photosynthetic systems.« less

  7. Theoretical studies of optics and charge transport in organic conducting oligomers and polymers: Rational design of improved transparent and conducting polymers

    NASA Astrophysics Data System (ADS)

    Hutchison, Geoffrey Rogers

    Theoretical studies on a variety of oligo- and polyheterocycles elucidate their optical and charge transport properties, suggesting new, improved transparent conductive polymers. First-principles calculations provide accurate methodologies for predicting both optical band gaps of neutral and cationic oligomers and intrinsic charge transfer rates. Multidimensional analysis reveals important motifs in chemical tailorability of oligoheterocycle optical and charge transport properties. The results suggest new directions for design of novel materials. Using both finite oligomer and infinite polymer calculations, the optical band gaps in polyheterocycles follow a modified particle-in-a-box formalism, scaling approximately as 1/N (where N is the number of monomer units) in short chains, saturating for long chains. Calculations demonstrate that band structure changes upon heteroatom substitution, (e.g., from polythiophene to polypyrrole) derive from heteroatom electron affinity. Further investigation of chemical variability in substituted oligoheterocycles using multidimensional statistics reveals the interplay between heteroatom and substituent in correlations between structure and redox/optical properties of neutral and cationic species. A linear correlation between band gaps of neutral and cationic species upon oxidation of conjugated oligomers, shows redshifts of optical absorption for most species and blueshifts for small band gap species. Interstrand charge-transport studies focus on two contributors to hopping-style charge transfer rates: internal reorganization energy and the electronic coupling matrix element. Statistical analysis of chemical variability of reorganization energies in oligoheterocycles proves the importance of reorganization energy in determining intrinsic charge transfer rates (e.g., charge mobility in unsubstituted oligothiophenes). Computed bandwidths across several oligothiophene crystal packing motifs show similar electron and hole bandwidths, and show that well-known tilted and herringbone motifs in oligothiophenes are driven by electrostatic repulsion. Tilted stacks exhibit intrinsic charge-transfer rates smaller than cofacial stacks, but with lower packing energy. Given similar electron and hole bandwidths, a charge injection model explains substitution-modulated majority carrier changes in n- and p-type oligothiophene field-effect transistors.

  8. Application of Electron-Transfer Theory to Several Systems of Biological Interest

    DOE R&D Accomplishments Database

    Marcus, R. A.; Sutin, N.

    1985-03-23

    Electron-transfer reaction rates are compared with theoretically calculated values for several reactions in the bacterial photosynthetic reaction center. A second aspect of the theory, the cross-relation, is illustrated using protein-protein electron transfers.

  9. Three-dimensionally ordered macroporous (3DOM) gold-nanoparticle-doped titanium dioxide (GTD) photonic crystals modified electrodes for hydrogen peroxide biosensor.

    PubMed

    Li, Jianlin; Han, Tao; Wei, Nannan; Du, Jiangyan; Zhao, Xiangwei

    2009-12-15

    Gold nanoparticles have been introduced into the wall framework of titanium dioxide photonic crystals by the colloidal crystal template technique. The three-dimensionally ordered macroporous gold-nanoparticle-doped titanium dioxide (3DOM GTD) film was modified on the indium-tin oxide (ITO) electrode surface and used for the hydrogen peroxide biosensor. The direct electron transfer and electrocatalysis of horseradish peroxidase (HRP) immobilized on this film have been investigated. The 3DOM GTD film could provide a good microenvironment for retaining the biological bioactivity, large internal area, and superior conductivity. The HRP/3DOM GTD/ITO electrode exhibited two couples of redox peaks corresponding to the HRP intercalated in the mesopores and adsorbed on the external surface of the film with the formal potential of -0.19 and -0.52V in 0.1M PBS (pH 7.4), respectively. The HRP intercalated in the mesopores showed a surface-controlled process with a single proton transfer. The direct electron transfer between the adsorbed HRP and the electrode is achieved without the aid of an electron mediator. The H(2)O(2) biosensor displayed a rapid eletrocatalytic response (less than 3s), a wide linear range from 0.5 microM to 1.4mM with a detection limit of 0.2 microM, high sensitivity (179.9 microAmM(-1)), good stability and reproducibility. Compared with the free-Au doped titanium dioxide photonic crystals modified electrode, the GTD modified electrode could greatly enhance the response current signal, linear detection range and higher sensitivity. The 3DOM GTD provided a new matrix for protein immobilization and direct transfer study and opened a way for low conductivity electrode biosensor.

  10. Synergistic electron transfer effect-based signal amplification strategy for the ultrasensitive detection of dopamine.

    PubMed

    Lu, Qiujun; Chen, Xiaogen; Liu, Dan; Wu, Cuiyan; Liu, Meiling; Li, Haitao; Zhang, Youyu; Yao, Shouzhuo

    2018-05-15

    The selective and sensitive detection of dopamine (DA) is of great significance for the identification of schizophrenia, Huntington's disease, and Parkinson's disease from the perspective of molecular diagnostics. So far, most of DA fluorescence sensors are based on the electron transfer from the fluorescence nanomaterials to DA-quinone. However, the limited electron transfer ability of the DA-quinone affects the level of detection sensitivity of these sensors. In this work, based on the DA can reduce Ag + into AgNPs followed by oxidized to DA-quinone, we developed a novel silicon nanoparticles-based electron transfer fluorescent sensor for the detection of DA. As electron transfer acceptor, the AgNPs and DA-quinone can quench the fluorescence of silicon nanoparticles effectively through the synergistic electron transfer effect. Compared with traditional fluorescence DA sensors, the proposed synergistic electron transfer-based sensor improves the detection sensitivity to a great extent (at least 10-fold improvement). The proposed sensor shows a low detection limit of DA, which is as low as 0.1 nM under the optimal conditions. This sensor has potential applicability for the detection of DA in practical sample. This work has been demonstrated to contribute to a substantial improvement in the sensitivity of the sensors. It also gives new insight into design electron transfer-based sensors. Copyright © 2018. Published by Elsevier B.V.

  11. Beyond superquenching: Hyper-efficient energy transfer from conjugated polymers to gold nanoparticles

    PubMed Central

    Fan, Chunhai; Wang, Shu; Hong, Janice W.; Bazan, Guillermo C.; Plaxco, Kevin W.; Heeger, Alan J.

    2003-01-01

    Gold nanoparticles quench the fluorescence of cationic polyfluorene with Stern–Volmer constants (KSV) approaching 1011 M—1, several orders of magnitude larger than any previously reported conjugated polymer–quencher pair and 9–10 orders of magnitude larger than small molecule dye–quencher pairs. The dependence of KSV on ionic strength, charge and conjugation length of the polymer, and the dimensions (and thus optical properties) of the nanoparticles suggests that three factors account for this extraordinary efficiency: (i) amplification of the quenching via rapid internal energy or electron transfer, (ii) electrostatic interactions between the cationic polymer and anionic nanoparticles, and (iii) the ability of gold nanoparticles to quench via efficient energy transfer. As a result of this extraordinarily high KSV, quenching can be observed even at subpicomolar concentrations of nanoparticles, suggesting that the combination of conjugated polymers with these nanomaterials can potentially lead to improved sensitivity in optical biosensors. PMID:12750470

  12. Quantifying electron transfer reactions in biological systems: what interactions play the major role?

    NASA Astrophysics Data System (ADS)

    Sjulstok, Emil; Olsen, Jógvan Magnus Haugaard; Solov'Yov, Ilia A.

    2015-12-01

    Various biological processes involve the conversion of energy into forms that are usable for chemical transformations and are quantum mechanical in nature. Such processes involve light absorption, excited electronic states formation, excitation energy transfer, electrons and protons tunnelling which for example occur in photosynthesis, cellular respiration, DNA repair, and possibly magnetic field sensing. Quantum biology uses computation to model biological interactions in light of quantum mechanical effects and has primarily developed over the past decade as a result of convergence between quantum physics and biology. In this paper we consider electron transfer in biological processes, from a theoretical view-point; namely in terms of quantum mechanical and semi-classical models. We systematically characterize the interactions between the moving electron and its biological environment to deduce the driving force for the electron transfer reaction and to establish those interactions that play the major role in propelling the electron. The suggested approach is seen as a general recipe to treat electron transfer events in biological systems computationally, and we utilize it to describe specifically the electron transfer reactions in Arabidopsis thaliana cryptochrome-a signaling photoreceptor protein that became attractive recently due to its possible function as a biological magnetoreceptor.

  13. An In Silico Study on the Isomers of Pentacene: The Case for Air-Stable and Alternative C22H14 Acenes for Organic Electronics.

    PubMed

    Jones, Leighton; Lin, Long

    2017-04-13

    Pentacene is one of the most investigated candidates for organic thin film transistor (OTFT) applications over the last few decades even though it unstable in air (E g = 1.80 eV), owing in part to its planar nature and high charge-transfer mobilities as both a single crystal (35 cm 2 V -1 s -1 ) and as a thin-film (3.0 cm 2 V -1 s -1 ). Until now, picene is the only isomer of pentacene to be investigated for organic electronic applications, due to its greater stability (E g = 4.21 eV) and high-charge transfer mobility (3.0 cm 2 V -1 s -1 ); even benefiting from oxygen doping. In the present study, a total of 12 fused-ring isomers (including pentacene, picene and ten other structures) of the formula C 22 H 14 were analyzed and investigated for their electronic and optical properties for worth in OTFT applications. We screened several pure and hybrid DFT functionals against the experimental frontier molecular orbitals (FMOs) of pentacene, then deployed Marcus Theory, Koopmans' Theorem and Green's function with the P3 electron propagator variant, for the internal hole reorganization energy, the hole transfer integral (via the "splitting-in-dimer method" at d = 3.0, 3.5, and 4.0 Å), the charge transfer rate constant, and vertical ionization energies. Using these as a basis, we studied pentacene's isomers and found that the four nonplanar structures, namely, benzo[g]chrysene (3), naphtho[c]phenanthrene (7), benzo[c]chrysene (11) and dibenzo[c,c']phenthrene (12), are (I) more stable than pentacene, by up to 2 eV, and (II) have relatively similar ionization energies (7.5-7.6 eV) to those of picene's experimental value (7.51 eV). The largest charge transfer rates at 3.5 Å dimer separations were given by the isomers benzo[b]chrysene 4, naphtha[c]phenanthrene 7, dibenzo[a,c]anthracene 8 and benzo[a]tetracene 10 and found to be 2.92, 1.72, 1.30, and 3.09 × 10 14 s -1 respectively. In comparison to that of pentacene (K CT = 3.97 × 10 14 s -1 ), these unusual isomers are thus promising air-stable and alternative candidates for organic electronic applications.

  14. ELECTRON TRANSFER MECHANISM AT THE SOLID-LIQUID INTERFACE OF PHYLLOSILICATES

    EPA Science Inventory

    Interfacial electron transfer processes on clay minerals have significant impact in natural environments and geochemical systems. Nitrobenzene was used as molecular probes to study the electron transfer mechanism at the solid-water interfaces of Fe-containing phyllosicates. For...

  15. Tunneling induced electron transfer between separated protons

    NASA Astrophysics Data System (ADS)

    Vindel-Zandbergen, Patricia; Meier, Christoph; Sola, Ignacio R.

    2018-04-01

    We study electron transfer between two separated protons using local control theory. In this symmetric system one can favour a slow transfer by biasing the algorithm, achieving high efficiencies for fixed nuclei. The solution can be parametrized using a sequence of a pump followed by a dump pulse that lead to tunneling-induced electron transfer. Finally, we study the effect of the nuclear kinetic energy on the efficiency. Even in the absence of relative motion between the protons, the spreading of the nuclear wave function is enough to reduce the yield of electronic transfer to less than one half.

  16. X.400: The Standard for Message Handling Systems.

    ERIC Educational Resources Information Center

    Swain, Leigh; Tallim, Paula

    1990-01-01

    Profiles X.400, the Open Systems Interconnection (OSI) Application layer standard that supports interpersonal electronic mail services, facsimile transfer, electronic data interchange, electronic funds transfer, electronic publishing, and electronic invoicing. Also discussed are an electronic directory to support message handling, compatibility…

  17. Application of Degenerately Doped Metal Oxides in the Study of Photoinduced Interfacial Electron Transfer.

    PubMed

    Farnum, Byron H; Morseth, Zachary A; Brennaman, M Kyle; Papanikolas, John M; Meyer, Thomas J

    2015-06-18

    Degenerately doped In2O3:Sn semiconductor nanoparticles (nanoITO) have been used to study the photoinduced interfacial electron-transfer reactivity of surface-bound [Ru(II)(bpy)2(4,4'-(PO3H2)2-bpy)](2+) (RuP(2+)) molecules as a function of driving force over a range of 1.8 eV. The metallic properties of the ITO nanoparticles, present within an interconnected mesoporous film, allowed for the driving force to be tuned by controlling their Fermi level with an external bias while their optical transparency allowed for transient absorption spectroscopy to be used to monitor electron-transfer kinetics. Photoinduced electron transfer from excited-state -RuP(2+*) molecules to nanoITO was found to be dependent on applied bias and competitive with nonradiative energy transfer to nanoITO. Back electron transfer from nanoITO to oxidized -RuP(3+) was also dependent on the applied bias but without complication from inter- or intraparticle electron diffusion in the oxide nanoparticles. Analysis of the electron injection kinetics as a function of driving force using Marcus-Gerischer theory resulted in an experimental estimate of the reorganization energy for the excited-state -RuP(3+/2+*) redox couple of λ* = 0.83 eV and an electronic coupling matrix element, arising from electronic wave function overlap between the donor orbital in the molecule and the acceptor orbital(s) in the nanoITO electrode, of Hab = 20-45 cm(-1). Similar analysis of the back electron-transfer kinetics yielded λ = 0.56 eV for the ground-state -RuP(3+/2+) redox couple and Hab = 2-4 cm(-1). The use of these wide band gap, degenerately doped materials provides a unique experimental approach for investigating single-site electron transfer at the surface of oxide nanoparticles.

  18. Chemical and charge transfer studies on interfaces of a conjugated polymer and ITO

    NASA Astrophysics Data System (ADS)

    David, Tanya M. S.; Arasho, Wondwosson; Smith, O'Neil; Hong, Kunlun; Bonner, Carl; Sun, Sam-Shajing

    2017-08-01

    Conjugated oligomers and polymers are very attractive for potential future plastic electronic and opto-electronic device applications such as plastic photo detectors and solar cells, thermoelectric devices, field effect transistors, and light emitting diodes. Understanding and optimizing charge transport between an active polymer layer and conductive substrate is critical to the optimization of polymer based electronic and opto-electronic devices. This study focused on the design, synthesis, self-assembly, and electron transfers and transports of a phosphonic acid end-functionalized polyphenylenevinylene (PPV) that was covalently attached and self-assembled onto an Indium Tin Oxide (ITO) substrate. This study demonstrated how atomic force microscopy (AFM) can be an effective characterization technique in conjunction with conventional electron transfer methods, including cyclic voltammetry (CV), towards determining electron transfer rates in polymer and polymer/conductor interface systems. This study found that the electron transfer rates of covalently attached and self-assembled films were much faster than the spin coated films. The knowledge from this study can be very useful for designing potential polymer based electronic and opto-electronic thin film devices.

  19. Electron transfer by excited benzoquinone anions: slow rates for two-electron transitions.

    PubMed

    Zamadar, Matibur; Cook, Andrew R; Lewandowska-Andralojc, Anna; Holroyd, Richard; Jiang, Yan; Bikalis, Jin; Miller, John R

    2013-09-05

    Electron transfer (ET) rate constants from the lowest excited state of the radical anion of benzoquinone, BQ(-•)*, were measured in THF solution. Rate constants for bimolecular electron transfer reactions typically reach the diffusion-controlled limit when the free-energy change, ΔG°, reaches -0.3 eV. The rate constants for ET from BQ(-•)* are one-to-two decades smaller at this energy and do not reach the diffusion-controlled limit until -ΔG° is 1.5-2.0 eV. The rates are so slow probably because a second electron must also undergo a transition to make use of the energy of the excited state. Similarly, ET, from solvated electrons to neutral BQ to form the lowest excited state, is slow, while fast ET is observed at a higher excited state, which can be populated in a transition involving only one electron. A simple picture based on perturbation theory can roughly account for the control of electron transfer by the need for transition of a second electron. The picture also explains how extra driving force (-ΔG°) can restore fast rates of electron transfer.

  20. Flavins in Marine Sediments: A Potentially Ubiquitous Intermediary In Microbial Electron Transfer

    NASA Astrophysics Data System (ADS)

    Monteverde, D.; Sylvan, J. B.; Suffridge, C.; Berelson, W.; Sanudo-Wilhelmy, S. A.; Baronas, J. J.

    2016-12-01

    The flavins (riboflavin, flavin mononucleotide [FMN], flavin adenine dinucleotide [FA­­D]) are a class of organic compounds synthesized by organisms to assist in redox reactions. They represent the largest class of required coenzymes, rivaled only by iron in the number of unique enzymes they bind. In addition to internal use, cultured metal-reducing organisms such as Shewanella and Geobacter have been known to release flavins into the extracellular pool to aid in external electron transfer. So called "electron shuttles" can allow organisms to overcome unfavorable geochemical zonation by transferring electrons onto a relatively distant insoluble acceptor. Despite the extensive culture work, flavins have not been systematically measured in the environment. Here we present the first set of flavin profiles from the water column and pore waters of a marine environment. Samples were taken from San Pedro Basin, a 900 meter deep, silled basin, with high seasonal inputs of organic carbon, low bottom water oxygen concentrations, and laminated sediments - making it ideal to explore variations in sediment geochemical zonations. Dissolved flavin concentrations in the water column and pore waters collected from two cores were preconcentrated via solid phase extraction and measured via LC/MS. Flavin profiles are compared to a suite of geochemical parameters as well as sediment microbial 16s rRNA data. Preliminary results show that FMN is typically an order of magnitude higher concentration than riboflavin (800-300pM versus 100-50pM). Porewater concentrations were elevated over water column values for all analytes (ranging from 100-2000pM) and displayed an increasing trend with depth in both cores. This increasing trend correlated with a decrease in dissolved Fe (ranging from 160 µM in surface sediments to 65 µM at 40 cm) and shifts in microbial diversity from sediments shallower than 5 cm depth dominated by Delta- and Gammaproteobacteria to subsurface sediments dominated by Chloroflexi and Archaea at 20-40 cm. These first environmental profiles of flavins in the marine environmental support previous observations of the importance of electron transfer intermediaries in culture and point to an important role for flavins in modern marine microbial communities.

  1. Evidence that Additions of Grignard Reagents to Aliphatic Aldehydes Do Not Involve Single-Electron-Transfer Processes.

    PubMed

    Otte, Douglas A L; Woerpel, K A

    2015-08-07

    Addition of allylmagnesium reagents to an aliphatic aldehyde bearing a radical clock gave only addition products and no evidence of ring-opened products that would suggest single-electron-transfer reactions. The analogous Barbier reaction also did not provide evidence for a single-electron-transfer mechanism in the addition step. Other Grignard reagents (methyl-, vinyl-, t-Bu-, and triphenylmethylmagnesium halides) also do not appear to add to an alkyl aldehyde by a single-electron-transfer mechanism.

  2. Evidence for protein conformational change at a Au(110)/protein interface

    NASA Astrophysics Data System (ADS)

    Messiha, H. L.; Smith, C. I.; Scrutton, N. S.; Weightman, P.

    2008-07-01

    Evidence is presented that reflection anisotropy spectroscopy (RAS) can provide real-time measurements of conformational change in proteins induced by electron transfer reactions. A bacterial electron transferring flavoprotein (ETF) has been modified so as to adsorb on an Au(110) electrode and enable reversible electron transfer to the protein cofactor in the absence of mediators. Reversible changes are observed in the RAS of this protein that are interpreted as arising from conformational changes accompanying the transfer of electrons.

  3. Enhanced electron transfer kinetics through hybrid graphene-carbon nanotube films.

    PubMed

    Henry, Philémon A; Raut, Akshay S; Ubnoske, Stephen M; Parker, Charles B; Glass, Jeffrey T

    2014-11-01

    We report the first study of the electrochemical reactivity of a graphenated carbon nanotube (g-CNT) film. The electron transfer kinetics of the ferri-ferrocyanide couple were examined for a g-CNT film and compared to the kinetics to standard carbon nanotubes (CNTs). The g-CNT film exhibited much higher catalytic activity, with a heterogeneous electron-transfer rate constant, k 0 , approximately two orders of magnitude higher than for standard CNTs. Scanning electron microscopy and Raman spectroscopy were used to correlate the higher electron transfer kinetics with the higher edge-density of the g-CNT film.

  4. Enzymatic cellulose oxidation is linked to lignin by long-range electron transfer

    PubMed Central

    Westereng, Bjørge; Cannella, David; Wittrup Agger, Jane; Jørgensen, Henning; Larsen Andersen, Mogens; Eijsink, Vincent G.H.; Felby, Claus

    2015-01-01

    Enzymatic oxidation of cell wall polysaccharides by lytic polysaccharide monooxygenases (LPMOs) plays a pivotal role in the degradation of plant biomass. While experiments have shown that LPMOs are copper dependent enzymes requiring an electron donor, the mechanism and origin of the electron supply in biological systems are only partly understood. We show here that insoluble high molecular weight lignin functions as a reservoir of electrons facilitating LPMO activity. The electrons are donated to the enzyme by long-range electron transfer involving soluble low molecular weight lignins present in plant cell walls. Electron transfer was confirmed by electron paramagnetic resonance spectroscopy showing that LPMO activity on cellulose changes the level of unpaired electrons in the lignin. The discovery of a long-range electron transfer mechanism links the biodegradation of cellulose and lignin and sheds new light on how oxidative enzymes present in plant degraders may act in concert. PMID:26686263

  5. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE PAGES

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.; ...

    2016-03-22

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  6. CymA and Exogenous Flavins Improve Extracellular Electron Transfer and Couple It to Cell Growth in Mtr-Expressing Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jensen, Heather M.; TerAvest, Michaela A.; Kokish, Mark G.

    Introducing extracellular electron transfer pathways into heterologous organisms offers the opportunity to explore fundamental biogeochemical processes and to biologically alter redox states of exogenous metals for various applications. While expression of the MtrCAB electron nanoconduit from Shewanella oneidensis MR-1 permits extracellular electron transfer in Escherichia coli, the low electron flux and absence of growth in these cells limits their practicality for such applications. In this paper, we investigate how the rate of electron transfer to extracellular Fe(III) and cell survival in engineered E. coli are affected by mimicking different features of the S. oneidensis pathway: the number of electron nanoconduits,more » the link between the quinol pool and MtrA, and the presence of flavin-dependent electron transfer. While increasing the number of pathways does not significantly improve the extracellular electron transfer rate or cell survival, using the native inner membrane component, CymA, significantly improves the reduction rate of extracellular acceptors and increases cell viability. Strikingly, introducing both CymA and riboflavin to Mtr-expressing E. coli also allowed these cells to couple metal reduction to growth, which is the first time an increase in biomass of an engineered E. coli has been observed under Fe 2O 3 (s) reducing conditions. Overall and finally, this work provides engineered E. coli strains for modulating extracellular metal reduction and elucidates critical factors for engineering extracellular electron transfer in heterologous organisms.« less

  7. Flavin Charge Transfer Transitions Assist DNA Photolyase Electron Transfer

    NASA Astrophysics Data System (ADS)

    Skourtis, Spiros S.; Prytkova, Tatiana; Beratan, David N.

    2007-12-01

    This contribution describes molecular dynamics, semi-empirical and ab-initio studies of the primary photo-induced electron transfer reaction in DNA photolyase. DNA photolyases are FADH--containing proteins that repair UV-damaged DNA by photo-induced electron transfer. A DNA photolyase recognizes and binds to cyclobutatne pyrimidine dimer lesions of DNA. The protein repairs a bound lesion by transferring an electron to the lesion from FADH-, upon photo-excitation of FADH- with 350-450 nm light. We compute the lowest singlet excited states of FADH- in DNA photolyase using INDO/S configuration interaction, time-dependent density-functional, and time-dependent Hartree-Fock methods. The calculations identify the lowest singlet excited state of FADH- that is populated after photo-excitation and that acts as the electron donor. For this donor state we compute conformationally-averaged tunneling matrix elements to empty electron-acceptor states of a thymine dimer bound to photolyase. The conformational averaging involves different FADH--thymine dimer confromations obtained from molecular dynamics simulations of the solvated protein with a thymine dimer docked in its active site. The tunneling matrix element computations use INDO/S-level Green's function, energy splitting, and Generalized Mulliken-Hush methods. These calculations indicate that photo-excitation of FADH- causes a π→π* charge-transfer transition that shifts electron density to the side of the flavin isoalloxazine ring that is adjacent to the docked thymine dimer. This shift in electron density enhances the FADH--to-dimer electronic coupling, thus inducing rapid electron transfer.

  8. Photoinduced electron transfer between benzyloxy dendrimer phthalocyanine and benzoquinone

    NASA Astrophysics Data System (ADS)

    Zhang, Tiantian; Ma, Dongdong; Pan, Sujuan; Wu, Shijun; Jiang, Yufeng; Zeng, Di; Yang, Hongqin; Peng, Yiru

    2016-10-01

    Photo-induced electron transfer (PET) is an important and fundamental process in natural photosynthesis. To mimic such interesting PET process, a suitable donor and acceptor couple were properly chosen. Dendrimer phthalocyanines and their derivatives have emerged as promising materials for artificial photosynthesis systems. In this paper, the electron transfer between the light harvest dendrimer phthalocyanine (donor) and the 1,4-benzoquinone (acceptor) was studied by UV/Vis and fluorescence spectroscopic methods. It was found that fluorescence of phthalocyanine was quenched by benzoquinone (BQ) via excited state electron transfer, from the phthalocyanine to the BQ upon excitation at 610 nm. The Stern-Volmer constant (KSV) of electron transfer was calculated. Our study suggests that this dendritic phthalocyanine is an effective new electron donor and transmission complex and could be used as a potential artificial photosynthesis system.

  9. Long-range electron transfer in porphyrin-containing [2]-rotaxanes: tuning the rate by metal cation coordination.

    PubMed

    Andersson, Mikael; Linke, Myriam; Chambron, Jean-Claude; Davidsson, Jan; Heitz, Valérie; Hammarström, Leif; Sauvage, Jean-Pierre

    2002-04-24

    A series of [2]-rotaxanes has been synthesized in which two Zn(II)-porphyrins (ZnP) electron donors were attached as stoppers on the rod. A macrocycle attached to a Au(III)-porphyrin (AuP+) acceptor was threaded on the rod. By selective excitation of either porphyrin, we could induce an electron transfer from the ZnP to the AuP+ unit that generated the same ZnP*+-AuP* charge-transfer state irrespective of which porphyrin was excited. Although the reactants were linked only by mechanical or coordination bonds, electron-transfer rate constants up to 1.2x10(10) x s(-1) were obtained over a 15-17 A edge-to-edge distance between the porphyrins. The resulting charge-transfer state had a relatively long lifetime of 10-40 ns and was formed in high yield (>80%) in most cases. By a simple variation of the link between the reactants, viz. a coordination of the phenanthroline units on the rotaxane rod and ring by either Ag+ or Cu+, we could enhance the electron-transfer rate from the ZnP to the excited 3AuP+. We interpret our data in terms of an enhanced superexchange mechanism with Ag+ and a change to a stepwise hopping mechanism with Cu+, involving the oxidized Cu(phen)22+ unit as a real intermediate. When the ZnP unit was excited instead, electron transfer from the excited 1ZnP to AuP+ was not affected, or even slowed, by Ag+ or Cu+. We discuss this asymmetry in terms of the different orbitals involved in mediating the reaction in an electron- and a hole-transfer mechanism. Our results show the possibility to tune the rates of electron transfer between noncovalently linked reactants by a convenient modification of the link. The different effect of Ag+ and Cu+ on the rate with ZnP and AuP+ excitation shows an additional possibility to control the electron-transfer reactions by selective excitation. We also found that coordination of the Cu+ introduced an energy-transfer reaction from 1ZnP to Cu(phen)2+ (k = 5.1x10(9) x s(-1)) that proceeded in competition with electron transfer to AuP+ and was followed by a quantitative energy transfer to give the 3ZnP state (k = 1.5x10(9) x s(-1)).

  10. A molecular shift register based on electron transfer

    NASA Technical Reports Server (NTRS)

    Hopfield, J. J.; Onuchic, Josenelson; Beratan, David N.

    1988-01-01

    An electronic shift-register memory at the molecular level is described. The memory elements are based on a chain of electron-transfer molecules and the information is shifted by photoinduced electron-transfer reactions. This device integrates designed electronic molecules onto a very large scale integrated (silicon microelectronic) substrate, providing an example of a 'molecular electronic device' that could actually be made. The design requirements for such a device and possible synthetic strategies are discussed. Devices along these lines should have lower energy usage and enhanced storage density.

  11. Ultrafast chemical interface scattering as an additional decay channel for nascent nonthermal electrons in small metal nanoparticles.

    PubMed

    Bauer, Christophe; Abid, Jean-Pierre; Fermin, David; Girault, Hubert H

    2004-05-15

    The use of 4.2 nm gold nanoparticles wrapped in an adsorbates shell and embedded in a TiO2 metal oxide matrix gives the opportunity to investigate ultrafast electron-electron scattering dynamics in combination with electronic surface phenomena via the surface plasmon lifetimes. These gold nanoparticles (NPs) exhibit a large nonclassical broadening of the surface plasmon band, which is attributed to a chemical interface damping. The acceleration of the loss of surface plasmon phase coherence indicates that the energy and the momentum of the collective electrons can be dissipated into electronic affinity levels of adsorbates. As a result of the preparation process, gold NPs are wrapped in a shell of sulfate compounds that gives rise to a large density of interfacial molecules confined between Au and TiO2, as revealed by Fourier-transform-infrared spectroscopy. A detailed analysis of the transient absorption spectra obtained by broadband femtosecond transient absorption spectroscopy allows separating electron-electron and electron-phonon interaction. Internal thermalization times (electron-electron scattering) are determined by probing the decay of nascent nonthermal electrons (NNEs) and the build-up of the Fermi-Dirac electron distribution, giving time constants of 540 to 760 fs at 0.42 and 0.34 eV from the Fermi level, respectively. Comparison with literature data reveals that lifetimes of NNEs measured for these small gold NPs are more than four times longer than for silver NPs with similar sizes. The surprisingly long internal thermalization time is attributed to an additional decay mechanism (besides the classical e-e scattering) for the energy loss of NNEs, identified as the ultrafast chemical interface scattering process. NNEs experience an inelastic resonant scattering process into unoccupied electronic states of adsorbates, that directly act as an efficient heat bath, via the excitation of molecular vibrational modes. The two-temperature model is no longer valid for this system because of (i) the temporal overlap between the internal and external thermalization process is very important; (ii) a part of the photonic energy is directly transferred toward the adsorbates (not among "cold" conduction band electrons). These findings have important consequence for femtochemistry on metal surfaces since they show that reactions can be initiated by nascent nonthermal electrons (as photoexcited, out of a Fermi-Dirac distribution) besides of the hot electron gas.

  12. 12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions for..., for an unauthorized electronic fund transfer involving the consumer's account only if the financial...

  13. Stabilization of non-productive conformations underpins rapid electron transfer to electron-transferring flavoprotein.

    PubMed

    Toogood, Helen S; van Thiel, Adam; Scrutton, Nigel S; Leys, David

    2005-08-26

    Crystal structures of protein complexes with electron-transferring flavoprotein (ETF) have revealed a dual protein-protein interface with one region serving as anchor while the ETF FAD domain samples available space within the complex. We show that mutation of the conserved Glu-165beta in human ETF leads to drastically modulated rates of interprotein electron transfer with both medium chain acyl-CoA dehydrogenase and dimethylglycine dehydrogenase. The crystal structure of free E165betaA ETF is essentially identical to that of wild-type ETF, but the crystal structure of the E165betaA ETF.medium chain acyl-CoA dehydrogenase complex reveals clear electron density for the FAD domain in a position optimal for fast interprotein electron transfer. Based on our observations, we present a dynamic multistate model for conformational sampling that for the wild-type ETF. medium chain acyl-CoA dehydrogenase complex involves random motion between three distinct positions for the ETF FAD domain. ETF Glu-165beta plays a key role in stabilizing positions incompatible with fast interprotein electron transfer, thus ensuring high rates of complex dissociation.

  14. 77 FR 34127 - Financial Management Service; Proposed Collection of Information: Electronic Transfer Account...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-06-08

    ... Information: Electronic Transfer Account (ETA) Financial Agency Agreement AGENCY: Financial Management Service... of information described below: Title: Electronic Transfer Account (ETA) Financial Agency Agreement... public and other Federal agencies to take this opportunity to comment on a continuing information...

  15. 31 CFR 208.4 - Waivers.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) Payment by electronic funds transfer is not required in the following cases: (1) Where an individual: (i... are not required to be made by electronic funds transfer, unless and until such payments become... waiver request with Treasury certifying that payment by electronic funds transfer would impose a hardship...

  16. 12 CFR 1005.7 - Initial disclosures.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's account. (b) Content of... Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E...

  17. Microscopic dynamics research on the "mature" process of dye-sensitized solar cells after injection of highly concentrated electrolyte.

    PubMed

    Liang, Zhongguan; Liu, Weiqing; Chen, Jun; Hu, Linhua; Dai, Songyuan

    2015-01-21

    After injection of electrolyte, the internal three-dimensional solid-liquid penetration system of dye-sensitized solar cells (DSCs) can take a period of time to reach "mature" state. This paper studies the changes of microscopic processes of DSCs including TiO2 energy-level movement, localized state distribution, charge accumulation, electron transport, and recombination dynamics, from the beginning of electrolyte injection to the time of reached mature state. The results show that the microscopic dynamics process of DSCs exhibited a time-dependent behavior and achieved maturity ∼12 h after injecting the electrolyte into DSCs. Within 0-12 h, several results were observed: (1) the conduction band edge of TiO2 moved slightly toward negative potential direction; (2) the localized states in the band gap of TiO2 was reduced according to the same distribution law; (3) the transport resistance in TiO2 film increased, and electron transport time was prolonged as the time of maturity went on, which indicated that the electron transport process is impeded gradually; (4) the recombination resistance at the TiO2/electrolyte (EL) interface increases, and electron lifetime gradually extends, therefore, the recombination process is continuously suppressed. Furthermore, results suggest that the parameters of EL/Pt-transparent conductive oxide (TCO) interface including the interfacial capacitance, electron-transfer resistance, and transfer time constant would change with time of maturity, indicating that the EL/Pt-TCO interface is a potential factor affecting the mature process of DSCs.

  18. Evaluation of Bulk Charging in Geostationary Transfer Orbit and Earth Escape Trajectories Using the Numit 1-D Charging Model

    NASA Technical Reports Server (NTRS)

    Minow, Joseph I.; Coffey, Victoria N.; Parker, Linda N.; Blackwell, William C., Jr.; Jun, Insoo; Garrett, Henry B.

    2007-01-01

    The NUMIT 1-dimensional bulk charging model is used as a screening to ol for evaluating time-dependent bulk internal or deep dielectric) ch arging of dielectrics exposed to penetrating electron environments. T he code is modified to accept time dependent electron flux time serie s along satellite orbits for the electron environment inputs instead of using the static electron flux environment input originally used b y the code and widely adopted in bulk charging models. Application of the screening technique ts demonstrated for three cases of spacecraf t exposure within the Earth's radiation belts including a geostationa ry transfer orbit and an Earth-Moon transit trajectory for a range of orbit inclinations. Electric fields and charge densities are compute d for dielectric materials with varying electrical properties exposed to relativistic electron environments along the orbits. Our objectiv e is to demonstrate a preliminary application of the time-dependent e nvironments input to the NUMIT code for evaluating charging risks to exposed dielectrics used on spacecraft when exposed to the Earth's ra diation belts. The results demonstrate that the NUMIT electric field values in GTO orbits with multiple encounters with the Earth's radiat ion belts are consistent with previous studies of charging in GTO orb its and that potential threat conditions for electrostatic discharge exist on lunar transit trajectories depending on the electrical proper ties of the materials exposed to the radiation environment.

  19. Solvent effects on the oxidation (electron transfer) reaction of [Fe(CN) 6] 4- by [Co(NH 3) 5pz] 3+

    NASA Astrophysics Data System (ADS)

    Muriel, F.; Jiménez, R.; López, M.; Prado-Gotor, R.; Sánchez, F.

    2004-03-01

    Solvent effects on the title reaction were studied in different reaction media constituted by water and organic cosolvents (methanol, tert-butyl alcohol, ethyleneglycol and glucose) at 298.2 K. The results are considered in light of the Marcus-Hush approach for electron transfer reactions. Variations of the electron transfer rate constant are shown to be mainly due to changes in the reaction free energy. On the other hand the energies of the MMCT band, corresponding to the optical electron transfer within the ion pair [Fe(CN) 6] 4-/[Co(NH 3) 5pz] 3+, in the different reaction media, have been obtained. The activation free energies of the thermal electron transfer process have been calculated from the band ( Eop) data, and compared with those obtained from the kinetic study. Quantitative agreement is found between the two series of data. This shows the possibility of estimating activation free energies for electron transfer reactions from static (optical) measurements.

  20. Bidirectional Photoinduced Electron Transfer in Ruthenium(II)-Tris-bipyridyl-Modified PpcA, a Multi-heme c -Type Cytochrome from Geobacter sulfurreducens

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kokhan, Oleksandr; Ponomarenko, Nina S.; Pokkuluri, P. Raj

    PpcA, a tri-heme cytochrome c7 from Geobacter sulfurreducens was investigated as a model for photosensitizer-initiated electron transfer within a multi-heme "molecular wire" protein architecture. E. coli expression of PpcA was found to be tolerant of cysteine site-directed mutagenesis, demonstrated by the successful expression of natively folded proteins bearing cysteine mutations at a series of sites selected to vary characteristically with respect to the three -CXXCH- heme binding domains. A preliminary survey of 5 selected mutants found that the introduced cysteines can be readily covalently linked to a Ru(II)-(2,2'-bpy)2(4-bromomethyl-4’-methyl-2,2'-bpy) photosensitizer (where bpy = bipyridine), and that the linked constructs support bothmore » photo-oxidative and photo-reductive quenching of the photosensitizer excited-state, depending upon the initial heme redox state. For photo-oxidative electron transfer, apparent heme reduction risetimes were found to vary from 7 x 10-12 s to 5 x 10-8 s, depending upon the site of photosensitizer linking. The excited-state electron transfers are about 103-fold faster than any previously reported photosensitizer-redox protein covalently linked construct. Preliminary conformational analysis using molecular dynamics simulations shows that rates for electron transfer track both the distance and pathways for electron transfer. Two mutants with the fastest charge transfer rates, A23C and K29C, showed a significant role of specific paths for electron transfer. While K29C labeled mutant was expected to have approximately 0.8Å greater donor-acceptor distance, it showed 20-fold faster charge separation rate. Clear evidence for inter-heme electron transfer within the multi-heme protein is not detected within the lifetimes of the charge separated states. These results demonstrate an opportunity to develop multi-heme c-cytochromes for investigation of electron transfer in protein "molecular wires" and to serve as frameworks for metalloprotein designs that support multiple electron transfer redox chemistry.« less

  1. Photoemission of Energetic Hot Electrons Produced via Up-Conversion in Doped Quantum Dots.

    PubMed

    Dong, Yitong; Parobek, David; Rossi, Daniel; Son, Dong Hee

    2016-11-09

    The benefits of the hot electrons from semiconductor nanostructures in photocatalysis or photovoltaics result from their higher energy compared to that of the band-edge electrons facilitating the electron-transfer process. The production of high-energy hot electrons usually requires short-wavelength UV or intense multiphoton visible excitation. Here, we show that highly energetic hot electrons capable of above-threshold ionization are produced via exciton-to-hot-carrier up-conversion in Mn-doped quantum dots under weak band gap excitation (∼10 W/cm 2 ) achievable with the concentrated solar radiation. The energy of hot electrons is as high as ∼0.4 eV above the vacuum level, much greater than those observed in other semiconductor or plasmonic metal nanostructures, which are capable of performing energetically and kinetically more-challenging electron transfer. Furthermore, the prospect of generating solvated electron is unique for the energetic hot electrons from up-conversion, which can open a new door for long-range electron transfer beyond short-range interfacial electron transfer.

  2. Quantum Calculations of Electron Tunneling in Respiratory Complex III.

    PubMed

    Hagras, Muhammad A; Hayashi, Tomoyuki; Stuchebrukhov, Alexei A

    2015-11-19

    The most detailed and comprehensive to date study of electron transfer reactions in the respiratory complex III of aerobic cells, also known as bc1 complex, is reported. In the framework of the tunneling current theory, electron tunneling rates and atomistic tunneling pathways between different redox centers were investigated for all electron transfer reactions comprising different stages of the proton-motive Q-cycle. The calculations reveal that complex III is a smart nanomachine, which under certain conditions undergoes conformational changes gating electron transfer, or channeling electrons to specific pathways. One-electron tunneling approximation was adopted in the tunneling calculations, which were performed using hybrid Broken-Symmetry (BS) unrestricted DFT/ZINDO levels of theory. The tunneling orbitals were determined using an exact biorthogonalization scheme that uniquely separates pairs of tunneling orbitals with small overlaps out of the remaining Franck-Condon orbitals with significant overlap. Electron transfer rates in different redox pairs show exponential distance dependence, in agreement with the reported experimental data; some reactions involve coupled proton transfer. Proper treatment of a concerted two-electron bifurcated tunneling reaction at the Q(o) site is given.

  3. Charge transfer from TiO2 into adsorbed benzene diazonium compounds

    NASA Astrophysics Data System (ADS)

    Merson, A.; Dittrich, Th.; Zidon, Y.; Rappich, J.; Shapira, Yoram

    2004-08-01

    Electron transfer from sol-gel-prepared TiO2 into adsorbed benzene diazonium compounds has been investigated using cyclic voltammetry, x-ray photoelectron spectroscopy, contact potential difference, and surface photovoltage spectroscopy. The results show that the potential of maximum electron transfer depends strongly on the dipole moment of the benzene compound. Two reactive surface sites at which electron transfer occurs have been identified.

  4. Direct Observation of Excimer-Mediated Intramolecular Electron Transfer in a Cofacially-Stacked Perylene Bisimide Pair.

    PubMed

    Sung, Jooyoung; Nowak-Król, Agnieszka; Schlosser, Felix; Fimmel, Benjamin; Kim, Woojae; Kim, Dongho; Würthner, Frank

    2016-07-27

    We have elucidated excimer-mediated intramolecular electron transfer in cofacially stacked PBIs tethered by two phenylene-butadiynylene loops. The electron transfer between energetically equivalent PBIs is revealed by the simultaneous observation of the PBI radical anion and cation bands in the transient absorption spectra. The fluorescence decay time of the excimer states is in good agreement with the rise time of PBI radical bands in transient absorption spectra suggesting that the electron transfer dynamics proceed via the excimer state. We can conclude that the excimer state effectuates the efficient charge transfer in the cofacially stacked PBI dimer.

  5. 12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...

  6. 12 CFR 1005.6 - Liability of consumer for unauthorized transfers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... transfers. 1005.6 Section 1005.6 Banks and Banking BUREAU OF CONSUMER FINANCIAL PROTECTION ELECTRONIC FUND TRANSFERS (REGULATION E) General § 1005.6 Liability of consumer for unauthorized transfers. (a) Conditions... this section, for an unauthorized electronic fund transfer involving the consumer's account only if the...

  7. Single-Molecule Interfacial Electron Transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, H. Peter

    This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static andmore » dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO 2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO 2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO 2 nanoparticle surfaces by using ultrafast single-molecule spectroscopy and electrochemical AFM metal tip scanning microscopy, focusing on understanding the interfacial electron transfer dynamics at specific nanoscale electron transfer sites with high-spatially and temporally resolved topographic-and-spectroscopic characterization at individual molecule basis, characterizing single-molecule rate processes, reaction driving force, and molecule-substrate electronic coupling. One of the most significant characteristics of our new approach is that we are able to interrogate the complex interfacial electron transfer dynamics by actively pin-point energetic manipulation of the surface interaction and electronic couplings, beyond the conventional excitation and observation.« less

  8. Pilot Emergency Tutoring System for F-4 Aircraft Fuel System Malfunction Using Means-Ends Analysis

    DTIC Science & Technology

    1990-06-01

    pulled , and wing transfer pressure is normal. What operator do you choose? For example: type look_at INDICATOR for looked_at(INDICATOR) type set...cb internal wing transfer is pulled , and wing transfer pressure is normal. What operator do you choose? For example: type look_at INDICATOR for...at, external transfer is off, internal wing transfer is stop trans, refuel probe is extended, cb internal wing transfer is pulled ,and wing

  9. 75 FR 33681 - Electronic Fund Transfers

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-15

    ... FEDERAL RESERVE SYSTEM 12 CFR Part 205 [Regulation E; Docket No. R-1343] Electronic Fund Transfers June 4, 2010. AGENCY: Board of Governors of the Federal Reserve System. ACTION: Final rule; correction..., published on June 4, 2010 (75 FR 31665) make the following correction: PART 205--ELECTRONIC FUND TRANSFERS...

  10. pH, redox potential and local biofilm potential microenvironments within Geobacter sulfurreducens biofilms and their roles in electron transfer.

    PubMed

    Babauta, Jerome T; Nguyen, Hung Duc; Harrington, Timothy D; Renslow, Ryan; Beyenal, Haluk

    2012-10-01

    The limitation of pH inside electrode-respiring biofilms is a well-known concept. However, little is known about how pH and redox potential are affected by increasing current inside biofilms respiring on electrodes. Quantifying the variations in pH and redox potential with increasing current is needed to determine how electron transfer is tied to proton transfer within the biofilm. In this research, we quantified pH and redox potential variations in electrode-respiring Geobacter sulfurreducens biofilms as a function of respiration rates, measured as current. We also characterized pH and redox potential at the counter electrode. We concluded that (1) pH continued to decrease in the biofilm through different growth phases, showing that the pH is not always a limiting factor in a biofilm and (2) decreasing pH and increasing redox potential at the biofilm electrode were associated only with the biofilm, demonstrating that G. sulfurreducens biofilms respire in a unique internal environment. Redox potential inside the biofilm was also compared to the local biofilm potential measured by a graphite microelectrode, where the tip of the microelectrode was allowed to acclimatize inside the biofilm. Copyright © 2012 Wiley Periodicals, Inc.

  11. International Students in Transition: International Community College Transfer Students in a Texas Research University

    ERIC Educational Resources Information Center

    Zhang, Yi Leaf

    2016-01-01

    This chapter focuses on a unique transfer population, international transfer students, and depicts their demographic backgrounds, academic interests and performance, as well as enrollment trends in the past decade.

  12. The IASLC Lung Cancer Staging Project: A Renewed Call to Participation.

    PubMed

    Giroux, Dorothy J; Van Schil, Paul; Asamura, Hisao; Rami-Porta, Ramón; Chansky, Kari; Crowley, John J; Rusch, Valerie W; Kernstine, Kemp

    2018-06-01

    Over the past two decades, the International Association for the Study of Lung Cancer (IASLC) Staging Project has been a steady source of evidence-based recommendations for the TNM classification for lung cancer published by the Union for International Cancer Control and the American Joint Committee on Cancer. The Staging and Prognostic Factors Committee of the IASLC is now issuing a call for participation in the next phase of the project, which is designed to inform the ninth edition of the TNM classification for lung cancer. Following the case recruitment model for the eighth edition database, volunteer site participants are asked to submit data on patients whose lung cancer was diagnosed between January 1, 2011, and December 31, 2019, to the project by means of a secure, electronic data capture system provided by Cancer Research And Biostatistics in Seattle, Washington. Alternatively, participants may transfer existing data sets. The continued success of the IASLC Staging Project in achieving its objectives will depend on the extent of international participation, the degree to which cases are entered directly into the electronic data capture system, and how closely externally submitted cases conform to the data elements for the project. Copyright © 2018 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  13. Inner reorganization limiting electron transfer controlled hydrogen bonding: intra- vs. intermolecular effects.

    PubMed

    Martínez-González, Eduardo; Frontana, Carlos

    2014-05-07

    In this work, experimental evidence of the influence of the electron transfer kinetics during electron transfer controlled hydrogen bonding between anion radicals of metronidazole and ornidazole, derivatives of 5-nitro-imidazole, and 1,3-diethylurea as the hydrogen bond donor, is presented. Analysis of the variations of voltammetric EpIcvs. log KB[DH], where KB is the binding constant, allowed us to determine the values of the binding constant and also the electron transfer rate k, confirmed by experiments obtained at different scan rates. Electronic structure calculations at the BHandHLYP/6-311++G(2d,2p) level for metronidazole, including the solvent effect by the Cramer/Truhlar model, suggested that the minimum energy conformer is stabilized by intramolecular hydrogen bonding. In this structure, the inner reorganization energy, λi,j, contributes significantly (0.5 eV) to the total reorganization energy of electron transfer, thus leading to a diminishment of the experimental k.

  14. Development of a Simple Electron Transfer and Polarization Model and Its Application to Biological Systems.

    PubMed

    Diller, David J

    2017-01-10

    Here we present a new method for point charge calculation which we call Q ET (charges by electron transfer). The intent of this work is to develop a method that can be useful for studying charge transfer in large biological systems. It is based on the intuitive framework of the Q EQ method with the key difference being that the Q ET method tracks all pairwise electron transfers by augmenting the Q EQ pseudoenergy function with a distance dependent cost function for each electron transfer. This approach solves the key limitation of the Q EQ method which is its handling of formally charged groups. First, we parametrize the Q ET method by fitting to electrostatic potentials calculated using ab initio quantum mechanics on over 11,000 small molecules. On an external test set of over 2500 small molecules the Q ET method achieves a mean absolute error of 1.37 kcal/mol/electron when compared to the ab initio electrostatic potentials. Second, we examine the conformational dependence of the charges on over 2700 tripeptides. With the tripeptide data set, we show that the conformational effects account for approximately 0.4 kcal/mol/electron on the electrostatic potentials. Third, we test the Q ET method for its ability to reproduce the effects of polarization and electron transfer on 1000 water clusters. For the water clusters, we show that the Q ET method captures about 50% of the polarization and electron transfer effects. Finally, we examine the effects of electron transfer and polarizability on the electrostatic interaction between p38 and 94 small molecule ligands. When used in conjunction with the Generalized-Born continuum solvent model, polarization and electron transfer with the Q ET model lead to an average change of 17 kcal/mol on the calculated electrostatic component of ΔG.

  15. Phylogenetic analysis of proteins associated in the four major energy metabolism systems: photosynthesis, aerobic respiration, denitrification, and sulfur respiration.

    PubMed

    Tomiki, Takeshi; Saitou, Naruya

    2004-08-01

    The four electron transfer energy metabolism systems, photosynthesis, aerobic respiration, denitrification, and sulfur respiration, are thought to be evolutionarily related because of the similarity of electron transfer patterns and the existence of some homologous proteins. How these systems have evolved is elusive. We therefore conducted a comprehensive homology search using PSI-BLAST, and phylogenetic analyses were conducted for the three homologous groups (groups 1-3) based on multiple alignments of domains defined in the Pfam database. There are five electron transfer types important for catalytic reaction in group 1, and many proteins bind molybdenum. Deletions of two domains led to loss of the function of binding molybdenum and ferredoxin, and these deletions seem to be critical for the electron transfer pattern changes in group 1. Two types of electron transfer were found in group 2, and all its member proteins bind siroheme and ferredoxin. Insertion of the pyridine nucleotide disulfide oxidoreductase domain seemed to be the critical point for the electron transfer pattern change in this group. The proteins belonging to group 3 are all flavin enzymes, and they bind flavin adenine dinucleotide (FAD) or flavin mononucleotide (FMN). Types of electron transfer in this group are divergent, but there are two common characteristics. NAD(P)H works as an electron donor or acceptor, and FAD or FMN transfers electrons from/to NAD(P)H. Electron transfer functions might be added to these common characteristics by the addition of functional domains through the evolution of group 3 proteins. Based on the phylogenetic analyses in this study and previous studies, we inferred the phylogeny of the energy metabolism systems as follows: photosynthesis (and possibly aerobic respiration) and the sulfur/nitrogen assimilation system first diverged, then the sulfur/nitrogen dissimilation system was produced from the latter system.

  16. Predicting the Rate Constant of Electron Tunneling Reactions at the CdSe-TiO2 Interface.

    PubMed

    Hines, Douglas A; Forrest, Ryan P; Corcelli, Steven A; Kamat, Prashant V

    2015-06-18

    Current interest in quantum dot solar cells (QDSCs) motivates an understanding of the electron transfer dynamics at the quantum dot (QD)-metal oxide (MO) interface. Employing transient absorption spectroscopy, we have monitored the electron transfer rate (ket) at this interface as a function of the bridge molecules that link QDs to TiO2. Using mercaptoacetic acid, 3-mercaptopropionic acid, 8-mercaptooctanoic acid, and 16-mercaptohexadecanoic acid, we observe an exponential attenuation of ket with increasing linker length, and attribute this to the tunneling of the electron through the insulating linker molecule. We model the electron transfer reaction using both rectangular and trapezoidal barrier models that have been discussed in the literature. The one-electron reduction potential (equivalent to the lowest unoccupied molecular orbital) of each molecule as determined by cyclic voltammetry (CV) was used to estimate the effective barrier height presented by each ligand at the CdSe-TiO2 interface. The electron transfer rate (ket) calculated for each CdSe-ligand-TiO2 interface using both models showed the results in agreement with the experimentally determined trend. This demonstrates that electron transfer between CdSe and TiO2 can be viewed as electron tunneling through a layer of linking molecules and provides a useful method for predicting electron transfer rate constants.

  17. Proton-coupled electron transfer versus hydrogen atom transfer: generation of charge-localized diabatic states.

    PubMed

    Sirjoosingh, Andrew; Hammes-Schiffer, Sharon

    2011-03-24

    The distinction between proton-coupled electron transfer (PCET) and hydrogen atom transfer (HAT) mechanisms is important for the characterization of many chemical and biological processes. PCET and HAT mechanisms can be differentiated in terms of electronically nonadiabatic and adiabatic proton transfer, respectively. In this paper, quantitative diagnostics to evaluate the degree of electron-proton nonadiabaticity are presented. Moreover, the connection between the degree of electron-proton nonadiabaticity and the physical characteristics distinguishing PCET from HAT, namely, the extent of electronic charge redistribution, is clarified. In addition, a rigorous diabatization scheme for transforming the adiabatic electronic states into charge-localized diabatic states for PCET reactions is presented. These diabatic states are constructed to ensure that the first-order nonadiabatic couplings with respect to the one-dimensional transferring hydrogen coordinate vanish exactly. Application of these approaches to the phenoxyl-phenol and benzyl-toluene systems characterizes the former as PCET and the latter as HAT. The diabatic states generated for the phenoxyl-phenol system possess physically meaningful, localized electronic charge distributions that are relatively invariant along the hydrogen coordinate. These diabatic electronic states can be combined with the associated proton vibrational states to generate the reactant and product electron-proton vibronic states that form the basis of nonadiabatic PCET theories. Furthermore, these vibronic states and the corresponding vibronic couplings may be used to calculate rate constants and kinetic isotope effects of PCET reactions.

  18. 49 CFR 225.37 - Optical media transfer and electronic submission.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 4 2012-10-01 2012-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...

  19. 49 CFR 225.37 - Optical media transfer and electronic submission.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 49 Transportation 4 2013-10-01 2013-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...

  20. 49 CFR 225.37 - Optical media transfer and electronic submission.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 49 Transportation 4 2011-10-01 2011-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...

  1. 49 CFR 225.37 - Optical media transfer and electronic submission.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 49 Transportation 4 2014-10-01 2014-10-01 false Optical media transfer and electronic submission..., AND INVESTIGATIONS § 225.37 Optical media transfer and electronic submission. (a) A railroad has the option of submitting the following reports, updates, and amendments by way of optical media (CD-ROM), or...

  2. 78 FR 49365 - Electronic Fund Transfers (Regulation E); Correction

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-14

    ... BUREAU OF CONSUMER FINANCIAL PROTECTION 12 CFR Part 1005 [Docket No. CFPB-2012-0050] RIN 3170-AA33 Electronic Fund Transfers (Regulation E); Correction AGENCY: Bureau of Consumer Financial Protection. ACTION... 2013 Final Rule, which along with three other final rules \\1\\ implements the Electronic Fund Transfer...

  3. 76 FR 67153 - Federal Acquisition Regulation; Submission for OMB Review; Payment by Electronic Fund Transfer

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-10-31

    ...; Submission for OMB Review; Payment by Electronic Fund Transfer AGENCY: Department of Defense (DOD), General... collection requirement concerning payment by electronic fund transfer. A notice was published in the Federal... technological collection techniques or other forms of information technology. DATES: Submit comments on or...

  4. 40 CFR Table I-2 to Subpart I - Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Fluorinated Heat Transfer Fluids Used by the Electronics Industry I Table I-2 to Subpart I Protection of... REPORTING Electronics Manufacturing Pt. 98, Subpt. I, Table I-2 Table I-2 to Subpart I—Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry Product type...

  5. On judgement of electron transfer between two regions divided by the separatrix of confronting divergent magnetic fields applied to an inductively coupled plasma

    NASA Astrophysics Data System (ADS)

    Sugawara, Hirotake; Yamamoto, Tappei

    2016-09-01

    In order to quantitatively evaluate the electron confinement effect of the confronting divergent magnetic fields (CDMFs) applied to an inductively coupled plasma, we analyzed the electron transfer between two regions divided by the separatrix of the CDMFs in Ar at 0.67 Pa at 300 K using a Monte Carlo method. A conventional transfer judgement was simply based on the electron passage across the separatrix from the upstream source region to the downstream diffusion region. An issue was an overestimation of the transfer due to temporary stay of electrons in the downstream region. Electrons may pass the downstream region during their gyration even in case they are effectively bound to the upstream region, where their guiding magnetic flux lines run. More than half of the transfers were temporary ones and such seeming transfers were relevantly excluded from the statistics by introducing a newly chosen criterion based on the passage of electron gyrocenters across the separatrix and collisional events in the downstream region. Simulation results showed a tendency that the ratio of the temporary transfers excluded was higher under stronger magnetic fields because of higher cyclotron frequency. Work supported by JSPS Kakenhi Grant Number 16K05626.

  6. The role of defects in Fe(II) – goethite electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andrade de Notini, Luiza; Latta, Drew; Neumann, Anke

    Despite accumulating experimental evidence for Fe(II)-Fe(III) oxide electron transfer, computational chemical calculations suggest that oxidation of sorbed Fe(II) is not energetically feasible unless defects are present. Here we used isotope specific 57Fe Mössbauer spectroscopy to investigate whether Fe(II)-goethite electron transfer is influenced by defects. Specifically, we heated the mineral to try to anneal the goethite surface and ground goethite to try to create defects. We found that heating goethite results in less oxidation of sorbed Fe(II) by goethite. When goethite was re-ground after heating, electron transfer was partially restored. X-ray absorption spectroscopy (XAS) and X-ray magnetic circular dichroism (XMCD) ofmore » heated and ground goethite confirm that heating and grinding alter the surface structure of the goethite. We propose that the heating process annealed the surface and decreased the number of sites where electron transfer could occur. Our experimental findings suggest that surface defects play an important role in Fe(II)-goethite electron transfer as suggested by computational calculations. Our finding that defects influence heterogeneous Fe(II)-goethite electron transfer has important implications for Fe(II) driven recrystallization of Fe oxides, as well as X and Y.« less

  7. Effect of group electronegativity on electron transfer in bis(hydrazine) radical cations.

    PubMed

    Qin, Haimei; Zhong, Xinxin; Si, Yubing; Zhang, Weiwei; Zhao, Yi

    2011-04-14

    The radical cation of 4,10-ditert-butyl-5,9-diisopropyl-4,5,9,10-tetraazatetracyclo[6.2.2.2]-tetradecane (sBI4T(+)), as well as its substituted bis(hydrazine) radical cations, is chosen for the investigation of the electronegativity dependence of its intramolecular electron transfer. To do so, two parameters, reorganization energy and electronic coupling, are calculated with several ab initio approaches. It is found that the electronic couplings decrease with the increase of the group electronegativity while the reorganization energies do not show an explicit dependency. Furthermore, Marcus formula is employed to reveal those effect on the electron transfer rates. The predicted rates of electron transfer generally decrease with increasing group electronegativity, although not monotonically.

  8. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely reconciles the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors.

  9. Dynamics and mechanism of UV-damaged DNA repair in indole-thymine dimer adduct: molecular origin of low repair quantum efficiency.

    PubMed

    Guo, Xunmin; Liu, Zheyun; Song, Qinhua; Wang, Lijuan; Zhong, Dongping

    2015-02-26

    Many biomimetic chemical systems for repair of UV-damaged DNA showed very low repair efficiency, and the molecular origin is still unknown. Here, we report our systematic characterization of the repair dynamics of a model compound of indole-thymine dimer adduct in three solvents with different polarity. By resolving all elementary steps including three electron-transfer processes and two bond-breaking and bond-formation dynamics with femtosecond resolution, we observed the slow electron injection in 580 ps in water, 4 ns in acetonitrile, and 1.38 ns in dioxane, the fast back electron transfer without repair in 120, 150, and 180 ps, and the slow bond splitting in 550 ps, 1.9 ns, and 4.5 ns, respectively. The dimer bond cleavage is clearly accelerated by the solvent polarity. By comparing with the biological repair machine photolyase with a slow back electron transfer (2.4 ns) and a fast bond cleavage (90 ps), the low repair efficiency in the biomimetic system is mainly determined by the fast back electron transfer and slow bond breakage. We also found that the model system exists in a dynamic heterogeneous C-clamped conformation, leading to a stretched dynamic behavior. In water, we even identified another stacked form with ultrafast cyclic electron transfer, significantly reducing the repair efficiency. Thus, the comparison of the repair efficiency in different solvents is complicated and should be cautious, and only the dynamics by resolving all elementary steps can finally determine the total repair efficiency. Finally, we use the Marcus electron-transfer theory to analyze all electron-transfer reactions and rationalize all observed electron-transfer dynamics.

  10. Specimen preparation for cryogenic coherent X-ray diffraction imaging of biological cells and cellular organelles by using the X-ray free-electron laser at SACLA

    PubMed Central

    Kobayashi, Amane; Sekiguchi, Yuki; Oroguchi, Tomotaka; Okajima, Koji; Fukuda, Asahi; Oide, Mao; Yamamoto, Masaki; Nakasako, Masayoshi

    2016-01-01

    Coherent X-ray diffraction imaging (CXDI) allows internal structures of biological cells and cellular organelles to be analyzed. CXDI experiments have been conducted at 66 K for frozen-hydrated biological specimens at the SPring-8 Angstrom Compact Free-Electron Laser facility (SACLA). In these cryogenic CXDI experiments using X-ray free-electron laser (XFEL) pulses, specimen particles dispersed on thin membranes of specimen disks are transferred into the vacuum chamber of a diffraction apparatus. Because focused single XFEL pulses destroy specimen particles at the atomic level, diffraction patterns are collected through raster scanning the specimen disks to provide fresh specimen particles in the irradiation area. The efficiency of diffraction data collection in cryogenic experiments depends on the quality of the prepared specimens. Here, detailed procedures for preparing frozen-hydrated biological specimens, particularly thin membranes and devices developed in our laboratory, are reported. In addition, the quality of the frozen-hydrated specimens are evaluated by analyzing the characteristics of the collected diffraction patterns. Based on the experimental results, the internal structures of the frozen-hydrated specimens and the future development for efficient diffraction data collection are discussed. PMID:27359147

  11. Specimen preparation for cryogenic coherent X-ray diffraction imaging of biological cells and cellular organelles by using the X-ray free-electron laser at SACLA.

    PubMed

    Kobayashi, Amane; Sekiguchi, Yuki; Oroguchi, Tomotaka; Okajima, Koji; Fukuda, Asahi; Oide, Mao; Yamamoto, Masaki; Nakasako, Masayoshi

    2016-07-01

    Coherent X-ray diffraction imaging (CXDI) allows internal structures of biological cells and cellular organelles to be analyzed. CXDI experiments have been conducted at 66 K for frozen-hydrated biological specimens at the SPring-8 Angstrom Compact Free-Electron Laser facility (SACLA). In these cryogenic CXDI experiments using X-ray free-electron laser (XFEL) pulses, specimen particles dispersed on thin membranes of specimen disks are transferred into the vacuum chamber of a diffraction apparatus. Because focused single XFEL pulses destroy specimen particles at the atomic level, diffraction patterns are collected through raster scanning the specimen disks to provide fresh specimen particles in the irradiation area. The efficiency of diffraction data collection in cryogenic experiments depends on the quality of the prepared specimens. Here, detailed procedures for preparing frozen-hydrated biological specimens, particularly thin membranes and devices developed in our laboratory, are reported. In addition, the quality of the frozen-hydrated specimens are evaluated by analyzing the characteristics of the collected diffraction patterns. Based on the experimental results, the internal structures of the frozen-hydrated specimens and the future development for efficient diffraction data collection are discussed.

  12. Electron shuttles in biotechnology.

    PubMed

    Watanabe, Kazuya; Manefield, Mike; Lee, Matthew; Kouzuma, Atsushi

    2009-12-01

    Electron-shuttling compounds (electron shuttles [ESs], or redox mediators) are essential components in intracellular electron transfer, while microbes also utilize self-produced and naturally present ESs for extracellular electron transfer. These compounds assist in microbial energy metabolism by facilitating electron transfer between microbes, from electron-donating substances to microbes, and/or from microbes to electron-accepting substances. Artificially supplemented ESs can create new routes of electron flow in the microbial energy metabolism, thereby opening up new possibilities for the application of microbes to biotechnology processes. Typical examples of such processes include halogenated-organics bioremediation, azo-dye decolorization, and microbial fuel cells. Herein we suggest that ESs can be applied widely to create new microbial biotechnology processes.

  13. Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory.

    PubMed

    Isegawa, Miho; Gao, Jiali; Truhlar, Donald G

    2011-08-28

    Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi-Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi-Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. © 2011 American Institute of Physics

  14. Incorporation of charge transfer into the explicit polarization fragment method by grand canonical density functional theory

    PubMed Central

    Isegawa, Miho; Gao, Jiali; Truhlar, Donald G.

    2011-01-01

    Molecular fragmentation algorithms provide a powerful approach to extending electronic structure methods to very large systems. Here we present a method for including charge transfer between molecular fragments in the explicit polarization (X-Pol) fragment method for calculating potential energy surfaces. In the conventional X-Pol method, the total charge of each fragment is preserved, and charge transfer between fragments is not allowed. The description of charge transfer is made possible by treating each fragment as an open system with respect to the number of electrons. To achieve this, we applied Mermin's finite temperature method to the X-Pol wave function. In the application of this method to X-Pol, the fragments are open systems that partially equilibrate their number of electrons through a quasithermodynamics electron reservoir. The number of electrons in a given fragment can take a fractional value, and the electrons of each fragment obey the Fermi–Dirac distribution. The equilibrium state for the electrons is determined by electronegativity equalization with conservation of the total number of electrons. The amount of charge transfer is controlled by re-interpreting the temperature parameter in the Fermi–Dirac distribution function as a coupling strength parameter. We determined this coupling parameter so as to reproduce the charge transfer energy obtained by block localized energy decomposition analysis. We apply the new method to ten systems, and we show that it can yield reasonable approximations to potential energy profiles, to charge transfer stabilization energies, and to the direction and amount of charge transferred. PMID:21895159

  15. Using the plasmon linewidth to calculate the time and efficiency of electron transfer between gold nanorods and graphene.

    PubMed

    Hoggard, Anneli; Wang, Lin-Yung; Ma, Lulu; Fang, Ying; You, Ge; Olson, Jana; Liu, Zheng; Chang, Wei-Shun; Ajayan, Pulickel M; Link, Stephan

    2013-12-23

    We present a quantitative analysis of the electron transfer between single gold nanorods and monolayer graphene under no electrical bias. Using single-particle dark-field scattering and photoluminescence spectroscopy to access the homogeneous linewidth, we observe broadening of the surface plasmon resonance for gold nanorods on graphene compared to nanorods on a quartz substrate. Because of the absence of spectral plasmon shifts, dielectric interactions between the gold nanorods and graphene are not important and we instead assign the plasmon damping to charge transfer between plasmon-generated hot electrons and the graphene that acts as an efficient acceptor. Analysis of the plasmon linewidth yields an average electron transfer time of 160 ± 30 fs, which is otherwise difficult to measure directly in the time domain with single-particle sensitivity. In comparison to intrinsic hot electron decay and radiative relaxation, we furthermore calculate from the plasmon linewidth that charge transfer between the gold nanorods and the graphene support occurs with an efficiency of ∼10%. Our results are important for future applications of light harvesting with metal nanoparticle plasmons and efficient hot electron acceptors as well as for understanding hot electron transfer in plasmon-assisted chemical reactions.

  16. FILM-30: A Heat Transfer Properties Code for Water Coolant

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    MARSHALL, THERON D.

    2001-02-01

    A FORTRAN computer code has been written to calculate the heat transfer properties at the wetted perimeter of a coolant channel when provided the bulk water conditions. This computer code is titled FILM-30 and the code calculates its heat transfer properties by using the following correlations: (1) Sieder-Tate: forced convection, (2) Bergles-Rohsenow: onset to nucleate boiling, (3) Bergles-Rohsenow: partially developed nucleate boiling, (4) Araki: fully developed nucleate boiling, (5) Tong-75: critical heat flux (CHF), and (6) Marshall-98: transition boiling. FILM-30 produces output files that provide the heat flux and heat transfer coefficient at the wetted perimeter as a function ofmore » temperature. To validate FILM-30, the calculated heat transfer properties were used in finite element analyses to predict internal temperatures for a water-cooled copper mockup under one-sided heating from a rastered electron beam. These predicted temperatures were compared with the measured temperatures from the author's 1994 and 1998 heat transfer experiments. There was excellent agreement between the predicted and experimentally measured temperatures, which confirmed the accuracy of FILM-30 within the experimental range of the tests. FILM-30 can accurately predict the CHF and transition boiling regimes, which is an important advantage over current heat transfer codes. Consequently, FILM-30 is ideal for predicting heat transfer properties for applications that feature high heat fluxes produced by one-sided heating.« less

  17. Sensitization of ultra-long-range excited-state electron transfer by energy transfer in a polymerized film

    PubMed Central

    Ito, Akitaka; Stewart, David J.; Fang, Zhen; Brennaman, M. Kyle; Meyer, Thomas J.

    2012-01-01

    Distance-dependent energy transfer occurs from the Metal-to-Ligand Charge Transfer (MLCT) excited state to an anthracene-acrylate derivative (Acr-An) incorporated into the polymer network of a semirigid poly(ethyleneglycol)dimethacrylate monolith. Following excitation, to Acr-An triplet energy transfer occurs followed by long-range, Acr-3An—Acr-An → Acr-An—Acr-3An, energy migration. With methyl viologen dication (MV2+) added as a trap, Acr-3An + MV2+ → Acr-An+ + MV+ electron transfer results in sensitized electron transfer quenching over a distance of approximately 90 Å. PMID:22949698

  18. 40 CFR Table I-2 to Subpart I of... - Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Fluorinated Heat Transfer Fluids Used by the Electronics Industry I Table I-2 to Subpart I of Part 98... GREENHOUSE GAS REPORTING Electronics Manufacturing Pt. 98, Subpt. I, Table I-2 Table I-2 to Subpart I of Part 98—Examples of Fluorinated GHGs and Fluorinated Heat Transfer Fluids Used by the Electronics Industry...

  19. 76 FR 52862 - Time for Payment of Certain Excise Taxes, and Quarterly Excise Tax Payments for Small Alcohol...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-08-24

    ... 40 Cigars and cigarettes, Claims, Electronic fund transfers, Excise taxes, Labeling, Packaging and... that are not required to pay taxes through electronic funds transfer (EFT), this first payment period..., Electronic funds transfers, Excise taxes, Exports, Food additives, Fruit juices, Labeling, Liquors, Packaging...

  20. Co-adsorption of water and oxygen on GaN: Effects of charge transfer and formation of electron depletion layer.

    PubMed

    Wang, Qi; Puntambekar, Ajinkya; Chakrapani, Vidhya

    2017-09-14

    Species from ambient atmosphere such as water and oxygen are known to affect electronic and optical properties of GaN, but the underlying mechanism is not clearly known. In this work, we show through careful measurement of electrical resistivity and photoluminescence intensity under various adsorbates that the presence of oxygen or water vapor alone is not sufficient to induce electron transfer to these species. Rather, the presence of both water and oxygen is necessary to induce electron transfer from GaN that leads to the formation of an electron depletion region on the surface. Exposure to acidic gases decreases n-type conductivity due to increased electron transfer from GaN, while basic gases increase n-type conductivity and PL intensity due to reduced charge transfer from GaN. These changes in the electrical and optical properties, as explained using a new electrochemical framework based on the phenomenon of surface transfer doping, suggest that gases interact with the semiconductor surface through electrochemical reactions occurring in an adsorbed water layer present on the surface.

  1. The interaction of trimethylamine dehydrogenase and electron-transferring flavoprotein.

    PubMed

    Shi, Weiwei; Mersfelder, John; Hille, Russ

    2005-05-27

    The interaction between the physiological electron transfer partners trimethylamine dehydrogenase (TMADH) and electron-transferring flavoprotein (ETF) from Methylophilus methylotrophus has been examined with particular regard to the proposal that the former protein "imprints" a conformational change on the latter. The results indicate that the absorbance change previously attributed to changes in the environment of the FAD of ETF upon binding to TMADH is instead caused by electron transfer from partially reduced, as-isolated TMADH to ETF. Prior treatment of the as-isolated enzyme with the oxidant ferricenium essentially abolishes the observed spectral change. Further, when the semiquinone form of ETF is used instead of the oxidized form, the mirror image of the spectral change seen with as-isolated TMADH and oxidized ETF is observed. This is attributable to a small amount of electron transfer in the reverse of the physiological direction. Kinetic determination of the dissociation constant and limiting rate constant for electron transfer within the complex of (reduced) TMADH with (oxidized) ETF is reconfirmed and discussed in the context of a recently proposed model for the interaction between the two proteins that involves "structural imprinting" of ETF.

  2. The mechanism of high-T(sub c) superconductivity due to bound hole mediators: Relationship to ferroelectricity

    NASA Technical Reports Server (NTRS)

    Vezzoli, G. C.; Stanley, William

    1990-01-01

    The mediation by bound holes creating Cooper pairing in high T(sub c) superconductors has its origin in charge transfer excitations on the multivalence cation (virtual excitions) and in bound excitions or polarizations associated with the oxygen 2p electrons. These phenomena are produced and/or enhanced by a high internal electric field which is itself created by virtue of the unique crystal structures and polyhedral building blocks of high T(sub c) materials. The polarizations which can create oxygen holes (in addition to excitions) may be due to simply the internal electric field or to polaronic and electron-deficient bond behavior. This gives rise to two energy-dependent oxygen bands near the Fermi level. The magnitude and direction of the internal electric fields were calculated for Y1Ba2Cu3O(7-delta) (1-2-3) and show strong z-direction fields at the Cu(2), O2, and O3 sites and an even stronger -z direction field at the O4 site. The field calculations also show why electrical conductivity in the 1-2-3 material is essentially in the base plane of the CuO5 pyramid (the CuO2 plane).

  3. Protein electron transfer: Dynamics and statistics

    NASA Astrophysics Data System (ADS)

    Matyushov, Dmitry V.

    2013-07-01

    Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.

  4. Protein electron transfer: Dynamics and statistics.

    PubMed

    Matyushov, Dmitry V

    2013-07-14

    Electron transfer between redox proteins participating in energy chains of biology is required to proceed with high energetic efficiency, minimizing losses of redox energy to heat. Within the standard models of electron transfer, this requirement, combined with the need for unidirectional (preferably activationless) transitions, is translated into the need to minimize the reorganization energy of electron transfer. This design program is, however, unrealistic for proteins whose active sites are typically positioned close to the polar and flexible protein-water interface to allow inter-protein electron tunneling. The high flexibility of the interfacial region makes both the hydration water and the surface protein layer act as highly polar solvents. The reorganization energy, as measured by fluctuations, is not minimized, but rather maximized in this region. Natural systems in fact utilize the broad breadth of interfacial electrostatic fluctuations, but in the ways not anticipated by the standard models based on equilibrium thermodynamics. The combination of the broad spectrum of static fluctuations with their dispersive dynamics offers the mechanism of dynamical freezing (ergodicity breaking) of subsets of nuclear modes on the time of reaction/residence of the electron at a redox cofactor. The separation of time-scales of nuclear modes coupled to electron transfer allows dynamical freezing. In particular, the separation between the relaxation time of electro-elastic fluctuations of the interface and the time of conformational transitions of the protein caused by changing redox state results in dynamical freezing of the latter for sufficiently fast electron transfer. The observable consequence of this dynamical freezing is significantly different reorganization energies describing the curvature at the bottom of electron-transfer free energy surfaces (large) and the distance between their minima (Stokes shift, small). The ratio of the two reorganization energies establishes the parameter by which the energetic efficiency of protein electron transfer is increased relative to the standard expectations, thus minimizing losses of energy to heat. Energetically efficient electron transfer occurs in a chain of conformationally quenched cofactors and is characterized by flattened free energy surfaces, reminiscent of the flat and rugged landscape at the stability basin of a folded protein.

  5. To Tunnel or not to Tunnel, Proton Transfer is the Question.

    NASA Astrophysics Data System (ADS)

    Chew, Kathryn; Nemchick, Deacon; Vaccaro, Patrick

    2014-06-01

    The transduction of protons between donor and acceptor sites, as mediated by the action of adjoining hydrogen bonds, represents one of the most ubiquitous of chemical transformations. While the basic mechanisms underlying such phenomena often can be ascribed to simple acid-base chemistry, the putative roles of selective nuclear and electronic displacements should not be discounted, especially when the presence of a sizeable potential barrier impedes classical hydron-migration pathways. The vibrational and isotopic specificity of hindered intramolecular proton transfer taking place within the ground (˜{X1}{A}1) and the lowest-lying excited (˜{A1}B2 (π *π) electronic states of the prototypical tropolone (TrOH) system has been probed by implementing multiple-color variants of resonant four-wave mixing (RFWM) spectroscopy, with polarization-resolved detection allowing for the extraction of quantitative rotation-tunneling information. The marked dependence of unimolecular dynamics on the extent and the type of excitation deposited into TrOH internal degrees of freedom will be discussed. Experimentally observed trends and propensities for tunneling-mediated reactivity will be interpreted through use of accompanying quantum-chemical calculations.

  6. Femtosecond Time-Resolved Photoelectron Imaging of Excited Doped Helium Nanodroplets

    NASA Astrophysics Data System (ADS)

    Saladrigas, Catherine; Bacellar, Camila; Leone, Stephen R.; Neumark, Daniel M.; Gessner, Oliver

    2017-04-01

    Helium nanodroplets are excellent matrices for high resolution spectroscopy and the study of ultracold chemistry. They are optically transparent. In their electronic ground state, interact very weakly with any atomic or molecular dopant. Electronically excited droplets, however, can strongly interact with dopants through a variety of relaxation mechanisms. Previously, these host-dopant interactions were studied in the energy domain, revealing Penning ionization processes enabled by energy transfer between the droplet host and atomic dopants. Using femtosecond time resolved XUV photoelectron imaging, we plan to perform complementary experiments in the time domain to gain deeper insight into the timescales of energy transfer processes and how they compete with internal droplet relaxation. First experiments will be performed using noble gas dopants, such as Kr and Ne, which will be compared to previous energy-domain studies. Femtosecond XUV pulses produced by high harmonic generation will be used to excite the droplets, IR and near-UV light will be used to monitor the relaxation dynamics. Using velocity map imaging, both photoelectron kinetic energies and angular distributions will be recorded as a function of time. Preliminary results and proposed experiments will be presented.

  7. Optical determination of charge transfer times from indoline dyes to ZnO in solid state dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Meyenburg, I.; Hofeditz, N.; Ruess, R.; Rudolph, M.; Schlettwein, D.; Heimbrodt, W.

    2018-05-01

    We studied the electron transfer at the interface of organic-inorganic hybrids consisting of indoline derivatives (D149 and D131) on ZnO substrates using a new optical method. We revealed the electron transfer times from the excited dye, e.g. the excitons formed in the dye aggregates to the ZnO substrate by analyzing the photoluminescence transients of the excitons after femtosecond excitation and applying kinetic model calculations. We reveal the changes of the electron transfer times by applying electrical bias. Pushing the Fermi energy of the ZnO substrate towards the excited dye level the transfer time gets longer and eventually the electron transfer is suppressed. The level alignment between the excited dye state and the ZnO Fermi-level is estimated. The excited state of D131 is about 100 meV higher than the respective state of D149 compared to the ZnO conduction band. This leads to shorter electron transfer times and eventually to higher quantum efficiencies of the solar cells.

  8. Multiple electron injection dynamics in linearly-linked two dye co-sensitized nanocrystalline metal oxide electrodes for dye-sensitized solar cells.

    PubMed

    Shen, Qing; Ogomi, Yuhei; Park, Byung-wook; Inoue, Takafumi; Pandey, Shyam S; Miyamoto, Akari; Fujita, Shinsuke; Katayama, Kenji; Toyoda, Taro; Hayase, Shuzi

    2012-04-07

    Understanding the electron transfer dynamics at the interface between dye sensitizer and semiconductor nanoparticle is very important for both a fundamental study and development of dye-sensitized solar cells (DSCs), which are a potential candidate for next generation solar cells. In this study, we have characterized the ultrafast photoexcited electron dynamics in a newly produced linearly-linked two dye co-sensitized solar cell using both a transient absorption (TA) and an improved transient grating (TG) technique, in which tin(IV) 2,11,20,29-tetra-tert-butyl-2,3-naphthalocyanine (NcSn) and cis-diisothiocyanato-bis(2,2'-bipyridyl-4,4'-dicarboxylato)ruthenium(II) bis(tetrabutylammonium) (N719) are molecularly and linearly linked and are bonded to the surface of a nanocrystalline tin dioxide (SnO(2)) electrode by a metal-O-metal linkage (i.e. SnO(2)-NcSn-N719). By comparing the TA and TG kinetics of NcSn, N719, and hybrid NcSn-N719 molecules adsorbed onto both of the SnO(2) and zirconium dioxide (ZrO(2)) nanocrystalline films, the forward and backward electron transfer dynamics in SnO(2)-NcSn-N719 were clarified. We found that there are two pathways for electron injection from the linearly-linked two dye molecules (NcSn-N719) to SnO(2). The first is a stepwise electron injection, in which photoexcited electrons first transfer from N719 to NcSn with a transfer time of 0.95 ps and then transfer from NcSn to the conduction band (CB) of SnO(2) with two timescales of 1.6 ps and 4.2 ps. The second is direct photoexcited electron transfer from N719 to the CB of SnO(2) with a timescale of 20-30 ps. On the other hand, back electron transfer from SnO(2) to NcSn is on a timescale of about 2 ns, which is about three orders of magnitude slower compared to the forward electron transfer from NcSn to SnO(2). The back electron transfer from NcSn to N719 is on a timescale of about 40 ps, which is about one order slower compared to the forward electron transfer from N719 to NcSn. These results demonstrate that photoexcited electrons can be effectively injected into SnO(2) from both of the N719 and NcSn dyes.

  9. Crumpled graphene nanoreactors

    NASA Astrophysics Data System (ADS)

    Wang, Zhongying; Lv, Xiaoshu; Chen, Yantao; Liu, Dan; Xu, Xinhua; Palmore, G. Tayhas R.; Hurt, Robert H.

    2015-05-01

    Nanoreactors are material structures that provide engineered internal cavities that create unique confined nanoscale environments for chemical reactions. Crumpled graphene nanoparticles or ``nanosacks'' may serve as nanoreactors when filled with reactive or catalytic particles and engineered for a specific chemical function. This article explores the behavior of crumpled graphene nanoreactors containing nanoscale ZnO, Ag, Ni, Cu, Fe, or TiO2 particles, either alone or in combination, in a series of case studies designed to reveal their fundamental behaviors. The first case study shows that ZnO nanoparticles undergo rapid dissolution inside the nanoreactor cavity accompanied by diffusive release of soluble products to surrounding aqueous media through the irregular folded shell. This behavior demonstrates the open nature of the sack structure, which facilitates rapid small-molecule exchange between inside and outside that is a requirement for nanoreactor function. In a case study on copper and silver nanoparticles, encapsulation in graphene nanoreactors is shown in some cases to enhance their oxidation rate in aqueous media, which is attributed to electron transfer from the metal core to graphene that bypasses surface oxides and allows reduction of molecular oxygen on the high-area graphene shell. Nanoreactors also allow particle-particle electron transfer interactions that are mediated by the connecting conductive graphene, which give rise to novel behaviors such as galvanic protection of Ag nanoparticles in Ag/Ni-filled nanoreactors, and the photochemical control of Ag-ion release in Ag/TiO2-filled nanoreactors. It is also shown that internal graphene structures within the sacks provide pockets that reduce particle mobility and inhibit particle sintering during thermal treatment. Finally, these novel behaviors are used to suggest and demonstrate several potential applications for graphene nanoreactors in catalysts, controlled release, and environmental remediation.Nanoreactors are material structures that provide engineered internal cavities that create unique confined nanoscale environments for chemical reactions. Crumpled graphene nanoparticles or ``nanosacks'' may serve as nanoreactors when filled with reactive or catalytic particles and engineered for a specific chemical function. This article explores the behavior of crumpled graphene nanoreactors containing nanoscale ZnO, Ag, Ni, Cu, Fe, or TiO2 particles, either alone or in combination, in a series of case studies designed to reveal their fundamental behaviors. The first case study shows that ZnO nanoparticles undergo rapid dissolution inside the nanoreactor cavity accompanied by diffusive release of soluble products to surrounding aqueous media through the irregular folded shell. This behavior demonstrates the open nature of the sack structure, which facilitates rapid small-molecule exchange between inside and outside that is a requirement for nanoreactor function. In a case study on copper and silver nanoparticles, encapsulation in graphene nanoreactors is shown in some cases to enhance their oxidation rate in aqueous media, which is attributed to electron transfer from the metal core to graphene that bypasses surface oxides and allows reduction of molecular oxygen on the high-area graphene shell. Nanoreactors also allow particle-particle electron transfer interactions that are mediated by the connecting conductive graphene, which give rise to novel behaviors such as galvanic protection of Ag nanoparticles in Ag/Ni-filled nanoreactors, and the photochemical control of Ag-ion release in Ag/TiO2-filled nanoreactors. It is also shown that internal graphene structures within the sacks provide pockets that reduce particle mobility and inhibit particle sintering during thermal treatment. Finally, these novel behaviors are used to suggest and demonstrate several potential applications for graphene nanoreactors in catalysts, controlled release, and environmental remediation. Electronic supplementary information (ESI) available: Fig. S1-S5. See DOI: 10.1039/c5nr00963d

  10. Inorganic carbon fixation by chemosynthetic ectosymbionts and nutritional transfers to the hydrothermal vent host-shrimp Rimicaris exoculata

    PubMed Central

    Ponsard, Julie; Cambon-Bonavita, Marie-Anne; Zbinden, Magali; Lepoint, Gilles; Joassin, André; Corbari, Laure; Shillito, Bruce; Durand, Lucile; Cueff-Gauchard, Valérie; Compère, Philippe

    2013-01-01

    The shrimp Rimicaris exoculata dominates several hydrothermal vent ecosystems of the Mid-Atlantic Ridge and is thought to be a primary consumer harbouring a chemoautotrophic bacterial community in its gill chamber. The aim of the present study was to test current hypotheses concerning the epibiont's chemoautotrophy, and the mutualistic character of this association. In-vivo experiments were carried out in a pressurised aquarium with isotope-labelled inorganic carbon (NaH13CO3 and NaH14CO3) in the presence of two different electron donors (Na2S2O3 and Fe2+) and with radiolabelled organic compounds (14C-acetate and 3H-lysine) chosen as potential bacterial substrates and/or metabolic by-products in experiments mimicking transfer of small biomolecules from epibionts to host. The bacterial epibionts were found to assimilate inorganic carbon by chemoautotrophy, but many of them (thick filaments of epsilonproteobacteria) appeared versatile and able to switch between electron donors, including organic compounds (heterotrophic acetate and lysine uptake). At least some of them (thin filamentous gammaproteobacteria) also seem capable of internal energy storage that could supply chemosynthetic metabolism for hours under conditions of electron donor deprivation. As direct nutritional transfer from bacteria to host was detected, the association appears as true mutualism. Import of soluble bacterial products occurs by permeation across the gill chamber integument, rather than via the digestive tract. This first demonstration of such capabilities in a decapod crustacean supports the previously discarded hypothesis of transtegumental absorption of dissolved organic matter or carbon as a common nutritional pathway. PMID:22914596

  11. 5 CFR 352.302 - Definitions.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... time of consent to transfer or detail, beginning with entrance on duty in the international... Transfer of Federal Employees to International Organizations § 352.302 Definitions. In this subpart: (a) Agency, employee, international organization, and transfer have the meaning given them by section 3581 of...

  12. 12 CFR 205.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...

  13. 12 CFR 205.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...

  14. 12 CFR 205.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...

  15. 12 CFR 205.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...

  16. 12 CFR 205.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... RESERVE SYSTEM ELECTRONIC FUND TRANSFERS (REGULATION E) § 205.9 Receipts at electronic terminals; periodic..., a financial institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following...

  17. Ultrafast above-threshold dynamics of the radical anion of a prototypical quinone electron-acceptor.

    PubMed

    Horke, Daniel A; Li, Quansong; Blancafort, Lluís; Verlet, Jan R R

    2013-08-01

    Quinones feature prominently as electron acceptors in nature. Their electron-transfer reactions are often highly exergonic, for which Marcus theory predicts reduced electron-transfer rates because of a free-energy barrier that occurs in the inverted region. However, the electron-transfer kinetics that involve quinones can appear barrierless. Here, we consider the intrinsic properties of the para-benzoquinone radical anion, which serves as the prototypical electron-transfer reaction product involving a quinone-based acceptor. Using time-resolved photoelectron spectroscopy and ab initio calculations, we show that excitation at 400 and 480 nm yields excited states that are unbound with respect to electron loss. These excited states are shown to decay on a sub-40 fs timescale through a series of conical intersections with lower-lying excited states, ultimately to form the ground anionic state and avoid autodetachment. From an isolated electron-acceptor perspective, this ultrafast stabilization mechanism accounts for the ability of para-benzoquinone to capture and retain electrons.

  18. Quantum state transfer in double-quantum-well devices

    NASA Technical Reports Server (NTRS)

    Jakumeit, Jurgen; Tutt, Marcel; Pavlidis, Dimitris

    1994-01-01

    A Monte Carlo simulation of double-quantum-well (DQW) devices is presented in view of analyzing the quantum state transfer (QST) effect. Different structures, based on the AlGaAs/GaAs system, were simulated at 77 and 300 K and optimized in terms of electron transfer and device speed. The analysis revealed the dominant role of the impurity scattering for the QST. Different approaches were used for the optimization of QST devices and basic physical limitations were found in the electron transfer between the QWs. The maximum transfer of electrons from a high to a low mobility well was at best 20%. Negative differential resistance is hampered by the almost linear rather than threshold dependent relation of electron transfer on electric field. By optimizing the doping profile the operation frequency limit could be extended to 260 GHz.

  19. 12 CFR 347.303 - Allocated transfer risk reserve.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Allocated transfer risk reserve. 347.303... GENERAL POLICY INTERNATIONAL BANKING International Lending § 347.303 Allocated transfer risk reserve. (a) Establishment of Allocated Transfer Risk Reserve. A banking institution shall establish an allocated transfer...

  20. 5 CFR 352.308 - Effecting employment by transfer.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... 5 Administrative Personnel 1 2012-01-01 2012-01-01 false Effecting employment by transfer. 352.308... REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.308 Effecting employment by transfer. (a) Authority to approve transfers. On written request by an international...

  1. 5 CFR 352.308 - Effecting employment by transfer.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... 5 Administrative Personnel 1 2014-01-01 2014-01-01 false Effecting employment by transfer. 352.308... REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.308 Effecting employment by transfer. (a) Authority to approve transfers. On written request by an international...

  2. 5 CFR 352.308 - Effecting employment by transfer.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... 5 Administrative Personnel 1 2013-01-01 2013-01-01 false Effecting employment by transfer. 352.308... REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.308 Effecting employment by transfer. (a) Authority to approve transfers. On written request by an international...

  3. Dioxygen in Polyoxometalate Mediated Reactions.

    PubMed

    Weinstock, Ira A; Schreiber, Roy E; Neumann, Ronny

    2018-03-14

    In this review article, we consider the use of molecular oxygen in reactions mediated by polyoxometalates. Polyoxometalates are anionic metal oxide clusters of a variety of structures that are soluble in liquid phases and therefore amenable to homogeneous catalytic transformations. Often, they are active for electron transfer oxidations of a myriad of substrates and upon reduction can be reoxidized by molecular oxygen. For example, the phosphovanadomolybdate, H 5 PV 2 Mo 10 O 40 , can oxidize Pd(0) thereby enabling aerobic reactions catalyzed by Pd and H 5 PV 2 Mo 10 O 40 . In a similar vein, polyoxometalates can stabilize metal nanoparticles, leading to additional transformations. Furthermore, electron transfer oxidation of other substrates such as halides and sulfur-containing compounds is possible. More uniquely, H 5 PV 2 Mo 10 O 40 and its analogues can mediate electron transfer-oxygen transfer reactions where oxygen atoms are transferred from the polyoxometalate to the substrate. This unique property has enabled correspondingly unique transformations involving carbon-carbon, carbon-hydrogen, and carbon-metal bond activation. The pathway for the reoxidation of vanadomolybdates with O 2 appears to be an inner-sphere reaction, but the oxidation of one-electron reduced polyoxotungstates has been shown through intensive research to be an outer-sphere reaction. Beyond electron transfer and electron transfer-oxygen transfer aerobic transformations, there a few examples of apparent dioxygenase activity where both oxygen atoms are donated to a substrate.

  4. Robust Low-Cost Cathode for Commercial Applications

    NASA Technical Reports Server (NTRS)

    Patterson, Michael J.

    2007-01-01

    Under funding from the NASA Commercial Technology Office, a cathode assembly was designed, developed, fabricated, and tested for use in plasma sources for ground-based materials processing applications. The cathode development activity relied on the large prior NASA investment and successful development of high-current, high-efficiency, long-life hollow cathodes for use on the International Space Station Plasma Contactor System. The hollow cathode was designed and fabricated based on known engineering criteria and manufacturing processes for compatibility with the requirements of the plasma source. The transfer of NASA GRC-developed hollow cathode technology for use as an electron emitter in the commercial plasma source is anticipated to yield a significant increase in process control, while eliminating the present issues of electron emitter lifetime and contamination.

  5. Femtosecond dynamics of a non-steroidal anti-inflammatory drug (piroxicam) in solution: The involvement of twisting motion

    NASA Astrophysics Data System (ADS)

    Gil, Michał; Douhal, Abderrazzak

    2008-06-01

    In this contribution, we report on fast and ultrafast dynamics of a non-steroidal anti-inflammatory drug, piroxicam (PX), in methyl acetate (MAC) and triacetin (TAC), two solvents of different viscosities. The enol form of PX undergoes a femtosecond (shorter than 100 fs) electronically excited state intramolecular proton-transfer reaction to produce keto tautomers. These structures exhibit an internal twisting motion to generate keto rotamers in ˜2-5 ps, a time being longer in TAC. The transient absorption/emission spectrum is very broad indicating that the potential-energy surface at the electronically excited state is very flat, and reflecting the involvement of several coordinates along which the wavepacket of the fs-produced structures evolve.

  6. Simplified calculation procedure of a latent heat reservoir for stabilizing the temperature of electronic devices

    NASA Astrophysics Data System (ADS)

    Witzman, S.; Shitzer, A.; Zvirin, Y.

    A simple mathematical algorithm which facilitates the design of a latent heat reservoir for stabilizing the temperature of an inflight electronic device is developed, and the behavior of paraffin wax in a heat storage capacitor is experimentally studied. The results show that in the solidification stage the heat transfer coefficient h is smaller than 35 W/sq m - C and decreases with time. During the melting process, natural convection could significantly increase h on the internal side and thereby reduce the time required to melt the section compared to the conduction process alone. Values of h up to 60 W/sq m - C can be achieved. The correlation between experimental and theoretical results is good.

  7. Picture of the Week: Hacking the bio-nano interface for better biofuels

    Science.gov Websites

    ) influence electron transfer between the enzyme and the electrode to determine the best placement of enzymes compounds) influence electron transfer between the enzyme and the electrode to determine the best placement studied how three quinones (a class of organic compounds) influence electron transfer between the enzyme

  8. Intramolecular electron-transfer rates in mixed-valence triarylamines: measurement by variable-temperature ESR spectroscopy and comparison with optical data.

    PubMed

    Lancaster, Kelly; Odom, Susan A; Jones, Simon C; Thayumanavan, S; Marder, Seth R; Brédas, Jean-Luc; Coropceanu, Veaceslav; Barlow, Stephen

    2009-02-11

    The electron spin resonance spectra of the radical cations of 4,4'-bis[di(4-methoxyphenyl)amino]tolane, E-4,4'-bis[di(4-methoxyphenyl)amino]stilbene, and E,E-1,4-bis{4-[di(4-methoxyphenyl)amino]styryl}benzene in dichloromethane exhibit five lines over a wide temperature range due to equivalent coupling to two 14N nuclei, indicating either delocalization between both nitrogen atoms or rapid intramolecular electron transfer on the electron spin resonance time scale. In contrast, those of the radical cations of 1,4-bis{4-[di(4-methoxyphenyl)amino]phenylethynyl}benzene and E,E-1,4-bis{4-[di(4-n-butoxyphenyl)amino]styryl}-2,5-dicyanobenzene exhibit line shapes that vary strongly with temperature, displaying five lines at room temperature and only three lines at ca. 190 K, indicative of slow electron transfer on the electron spin resonance time scale at low temperatures. The rates of intramolecular electron transfer in the latter compounds were obtained by simulation of the electron spin resonance spectra and display an Arrhenius temperature dependence. The activation barriers obtained from Arrhenius plots are significantly less than anticipated from Hush analyses of the intervalence bands when the diabatic electron-transfer distance, R, is equated to the N[symbol: see text]N distance. Comparison of optical and electron spin resonance data suggests that R is in fact only ca. 40% of the N[symbol: see text]N distance, while the Arrhenius prefactor indicates that the electron transfer falls in the adiabatic regime.

  9. Role of protein fluctuation correlations in electron transfer in photosynthetic complexes.

    PubMed

    Nesterov, Alexander I; Berman, Gennady P

    2015-04-01

    We consider the dependence of the electron transfer in photosynthetic complexes on correlation properties of random fluctuations of the protein environment. The electron subsystem is modeled by a finite network of connected electron (exciton) sites. The fluctuations of the protein environment are modeled by random telegraph processes, which act either collectively (correlated) or independently (uncorrelated) on the electron sites. We derived an exact closed system of first-order linear differential equations with constant coefficients, for the average density matrix elements and for their first moments. Under some conditions, we obtained analytic expressions for the electron transfer rates and found the range of parameters for their applicability by comparing with the exact numerical simulations. We also compared the correlated and uncorrelated regimes and demonstrated numerically that the uncorrelated fluctuations of the protein environment can, under some conditions, either increase or decrease the electron transfer rates.

  10. Role of coherence and delocalization in photo-induced electron transfer at organic interfaces

    NASA Astrophysics Data System (ADS)

    Abramavicius, V.; Pranculis, V.; Melianas, A.; Inganäs, O.; Gulbinas, V.; Abramavicius, D.

    2016-09-01

    Photo-induced charge transfer at molecular heterojunctions has gained particular interest due to the development of organic solar cells (OSC) based on blends of electron donating and accepting materials. While charge transfer between donor and acceptor molecules can be described by Marcus theory, additional carrier delocalization and coherent propagation might play the dominant role. Here, we describe ultrafast charge separation at the interface of a conjugated polymer and an aggregate of the fullerene derivative PCBM using the stochastic Schrödinger equation (SSE) and reveal the complex time evolution of electron transfer, mediated by electronic coherence and delocalization. By fitting the model to ultrafast charge separation experiments, we estimate the extent of electron delocalization and establish the transition from coherent electron propagation to incoherent hopping. Our results indicate that even a relatively weak coupling between PCBM molecules is sufficient to facilitate electron delocalization and efficient charge separation at organic interfaces.

  11. Alternative ground states enable pathway switching in biological electron transfer

    DOE PAGES

    Abriata, Luciano A.; Alvarez-Paggi, Damian; Ledesma, Gabirela N.; ...

    2012-10-10

    Electron transfer is the simplest chemical reaction and constitutes the basis of a large variety of biological processes, such as photosynthesis and cellular respiration. Nature has evolved specific proteins and cofactors for these functions. The mechanisms optimizing biological electron transfer have been matter of intense debate, such as the role of the protein milieu between donor and acceptor sites. Here we propose a mechanism regulating long-range electron transfer in proteins. Specifically, we report a spectroscopic, electrochemical, and theoretical study on WT and single-mutant CuA redox centers from Thermus thermophilus, which shows that thermal fluctuations may populate two alternative ground-state electronicmore » wave functions optimized for electron entry and exit, respectively, through two different and nearly perpendicular pathways. In conclusion, these findings suggest a unique role for alternative or “invisible” electronic ground states in directional electron transfer. Moreover, it is shown that this energy gap and, therefore, the equilibrium between ground states can be fine-tuned by minor perturbations, suggesting alternative ways through which protein–protein interactions and membrane potential may optimize and regulate electron–proton energy transduction.« less

  12. Technological aspects of hospital communication challenges: an observational study.

    PubMed

    Popovici, Ilinca; Morita, Plinio P; Doran, Diane; Lapinsky, Stephen; Morra, Dante; Shier, Ashleigh; Wu, Robert; Cafazzo, Joseph A

    2015-06-01

    To gain insights into how technological communication tools impact effective communication among clinicians, which is critical for patient safety. This multi-site observational study analyzes inter-clinician communication and interaction with information technology, with a focus on the critical process of patient transfer from the Emergency Department to General Internal Medicine. Mount Sinai Hospital, Sunnybrook Health Sciences Centre and Toronto General Hospital. At least five ED and general internal medicine nurses and physicians directly involved in patient transfers were observed on separate occasions at each institution. N/A. N/A. The study provides insight into clinician workflow, evaluates current hospital communication systems and identifies key issues affecting communication: interruptions, issues with numeric pagers, lack of integrated communication tools, lack of awareness of consultation status, inefficiencies related to the paper chart, unintuitive user interfaces, mixed use of electronic and paper systems and lack of up-to-date contact information. It also identifies design trade-offs to be negotiated: synchronous communication vs. reducing interruptions, notification of patient status vs. reducing interruptions and speed vs. quality of handovers. The issues listed should be considered in the design of new technology for hospital communications. © The Author 2015. Published by Oxford University Press in association with the International Society for Quality in Health Care; all rights reserved.

  13. Ultrafast Electron Transfer Kinetics in the LM Dimer of Bacterial Photosynthetic Reaction Center from Rhodobacter sphaeroides.

    PubMed

    Sun, Chang; Carey, Anne-Marie; Gao, Bing-Rong; Wraight, Colin A; Woodbury, Neal W; Lin, Su

    2016-06-23

    It has become increasingly clear that dynamics plays a major role in the function of many protein systems. One system that has proven particularly facile for studying the effects of dynamics on protein-mediated chemistry is the bacterial photosynthetic reaction center from Rhodobacter sphaeroides. Previous experimental and computational analysis have suggested that the dynamics of the protein matrix surrounding the primary quinone acceptor, QA, may be particularly important in electron transfer involving this cofactor. One can substantially increase the flexibility of this region by removing one of the reaction center subunits, the H-subunit. Even with this large change in structure, photoinduced electron transfer to the quinone still takes place. To evaluate the effect of H-subunit removal on electron transfer to QA, we have compared the kinetics of electron transfer and associated spectral evolution for the LM dimer with that of the intact reaction center complex on picosecond to millisecond time scales. The transient absorption spectra associated with all measured electron transfer reactions are similar, with the exception of a broadening in the QX transition and a blue-shift in the QY transition bands of the special pair of bacteriochlorophylls (P) in the LM dimer. The kinetics of the electron transfer reactions not involving quinones are unaffected. There is, however, a 4-fold decrease in the electron transfer rate from the reduced bacteriopheophytin to QA in the LM dimer compared to the intact reaction center and a similar decrease in the recombination rate of the resulting charge-separated state (P(+)QA(-)). These results are consistent with the concept that the removal of the H-subunit results in increased flexibility in the region around the quinone and an associated shift in the reorganization energy associated with charge separation and recombination.

  14. Photoinduced electron transfer in covalent ruthenium-anthraquinone dyads: relative importance of driving-force, solvent polarity, and donor-bridge energy gap.

    PubMed

    Hankache, Jihane; Wenger, Oliver S

    2012-02-28

    Four rigid rod-like molecules comprised of a Ru(bpy)(3)(2+) (bpy = 2,2'-bipyridine) photosensitizer, a 9,10-anthraquinone electron acceptor, and a molecular bridge connecting the two redox partners were synthesized and investigated by optical spectroscopic and electrochemical means. An attempt was made to assess the relative importance of driving-force, solvent polarity, and bridge variation on the rates of photoinduced electron transfer in these molecules. Expectedly, introduction of tert-butyl substituents in the bipyridine ligands of the ruthenium complex and a change in solvent from dichloromethane to acetonitrile lead to a significant acceleration of charge transfer rates. In dichloromethane, photoinduced electron transfer is not competitive with the inherent excited-state deactivation processes of the photosensitizer. In acetonitrile, an increase in driving-force by 0.2 eV through attachment of tert-butyl substituents to the bpy ancillary ligands causes an increase in electron transfer rates by an order of magnitude. Replacement of a p-xylene bridge by a p-dimethoxybenzene spacer entails an acceleration of charge transfer rates by a factor of 3.5. In the dyads from this study, the relative order of importance of individual influences on electron transfer rates is therefore as follows: solvent polarity ≥ driving-force > donor-bridge energy gap.

  15. CRADA Payment Options | NCI Technology Transfer Center | TTC

    Cancer.gov

    NCI TTC CRADA PAYMENT OPTIONS: Electronic Payments by Wire Transfer via Fedwire, Mail a check to the Institute or Center, or Automated Clearing House (ACH)/Electronic Funds Transfer (ETF) payments via Pay.gov (NCI ONLY).

  16. Transfer coefficients in ultracold strongly coupled plasma

    NASA Astrophysics Data System (ADS)

    Bobrov, A. A.; Vorob'ev, V. S.; Zelener, B. V.

    2018-03-01

    We use both analytical and molecular dynamic methods for electron transfer coefficients in an ultracold plasma when its temperature is small and the coupling parameter characterizing the interaction of electrons and ions exceeds unity. For these conditions, we use the approach of nearest neighbor to determine the average electron (ion) diffusion coefficient and to calculate other electron transfer coefficients (viscosity and electrical and thermal conductivities). Molecular dynamics simulations produce electronic and ionic diffusion coefficients, confirming the reliability of these results. The results compare favorably with experimental and numerical data from earlier studies.

  17. Theory for electron transfer from a mixed-valence dimer with paramagnetic sites to a mononuclear acceptor

    NASA Astrophysics Data System (ADS)

    Bominaar, E. L.; Achim, C.; Borshch, S. A.

    1999-06-01

    Polynuclear transition-metal complexes, such as Fe-S clusters, are the prosthetic groups in a large number of metalloproteins and serve as temporary electron storage units in a number of important redox-based biological processes. Polynuclearity distinguishes clusters from mononuclear centers and confers upon them unique properties, such as spin ordering and the presence of thermally accessible excited spin states in clusters with paramagnetic sites, and fractional valencies in clusters of the mixed-valence type. In an earlier study we presented an effective-mode (EM) analysis of electron transfer from a binuclear mixed-valence donor with paramagnetic sites to a mononuclear acceptor which revealed that the cluster-specific attributes have an important impact on the kinetics of long-range electron transfer. In the present study, the validity of these results is tested in the framework of more detailed theories which we have termed the multimode semiclassical (SC) model and the quantum-mechanical (QM) model. It is found that the qualitative trends in the rate constant are the same in all treatments and that the semiclassical models provide a good approximation of the more rigorous quantum-mechanical description of electron transfer under physiologically relevant conditions. In particular, the present results corroborate the importance of electron transfer via excited spin states in reactions with a low driving force and justify the use of semiclassical theory in cases in which the QM model is computationally too demanding. We consider cases in which either one or two donor sites of a dimer are electronically coupled to the acceptor. In the case of multiconnectivity, the rate constant for electron transfer from a valence-delocalized (class-III) donor is nonadditive with respect to transfer from individual metal sites of the donor and undergoes an order-of-magnitude change by reversing the sign of the intradimer metal-metal resonance parameter (β). In the case of single connectivity, the rate constant for electron transfer from a valence-localized (class-II) donor can readily be tuned over several orders of magnitude by introducing differences in the electronic potentials at the two metal sites of the donor. These results indicate that theories of cluster-based electron transfer, in order to be realistic, need to consider both intrinsic electronic structure and extrinsic interactions of the cluster with the protein environment.

  18. Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Park, Changwon; Atalla, Viktor; Smith, Sean

    Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

  19. Sulfate-reducing bacteria: Microbiology and physiology

    NASA Technical Reports Server (NTRS)

    Peck, H. D.

    1985-01-01

    The sulfate reducing bacteria, the first nonphotosynthetic anaerobic bacteria demonstrated to contain c type cytochromes, perform electron transfer coupled to phosphorylation. A new bioenergetic scheme for the formation of a proton gradient for growth of Desulfovibrio on organic substrates and sulfate involving vectors electron transfer and consistent with the cellular localization of enzymes and electron transfer components was proposed. Hydrogen is produced in the cytoplasm from organic substrates and, as a permease molecule diffuses rapidly across the cytoplasmic membrane, it is oxidized to protons and electrons by the periplasmic hydrogenase. The electrons only are transferred across the cytoplasmic membrane to the cytoplasm where they are used to reduce sulfate to sulfide. The protons are used for transport or to drive a reversible ATPOSE. The net effect is the transfer of protons across the cytoplasmic membrane with the intervention of a proton pump. This type of H2 cycling is relevant to the bioenergetics of other types of anaerobic microorganisms.

  20. Understanding the Charge Transfer at the Interface of Electron Donors and Acceptors: TTF–TCNQ as an Example

    DOE PAGES

    Park, Changwon; Atalla, Viktor; Smith, Sean; ...

    2017-06-16

    Charge transfer between an electron donor and an electron acceptor is widely accepted as being independent of their relative configurations if the interaction between them is weak; however, the limit of this concept for an interacting system has not yet been well established. Our study of prototypical electron donor–acceptor molecules, tetrathiafulvalene–tetracyanoquinodimethane, using density functional theory based on an advanced functional, clearly demonstrates that for interacting molecules, their configurational arrangement is as important as their individual electronic properties in the asymptotic limit to determine the charge transfer direction. For the first time, we demonstrate that by changing their relative orientation, onemore » can reverse the charge transfer direction of the pair, causing the molecules to exchange roles as donor and acceptor. In conclusion, our theory has important implications for understanding the interfacial charge-transfer mechanism of hybrid systems and related phenomena.« less

  1. Vibrational and Electronic Energy Transfer and Dissociation of Diatomic Molecules by Electron Collisions

    NASA Technical Reports Server (NTRS)

    Huo, Winifred M.; Langhoff, Stephen R. (Technical Monitor)

    1995-01-01

    At high altitudes and velocities equal to or greater than the geosynchronous return velocity (10 kilometers per second), the shock layer of a hypersonic flight will be in thermochemical nonequilibrium and partially ionized. The amount of ionization is determined by the velocity. For a trans atmospheric flight of 10 kilometers per second and at an altitude of 80 kilometers, a maximum of 1% ionization is expected. At a velocity of 12 - 17 kilometer per second, such as a Mars return mission, up to 30% of the atoms and molecules in the flow field will be ionized. Under those circumstances, electrons play an important role in determining the internal states of atoms and molecules in the flow field and hence the amount of radiative heat load and the distance it takes for the flow field to re-establish equilibrium. Electron collisions provide an effective means of transferring energy even when the electron number density is as low as 1%. Because the mass of an electron is 12,760 times smaller than the reduced mass of N2, its average speed, and hence its average collision frequency, is more than 100 times larger. Even in the slightly ionized regime with only 1% electrons, the frequency of electron-molecule collisions is equal to or larger than that of molecule-molecule collisions, an important consideration in the low density part of the atmosphere. Three electron-molecule collision processes relevant to hypersonic flows will be considered: (1) vibrational excitation/de-excitation of a diatomic molecule by electron impact, (2) electronic excitation/de-excitation, and (3) dissociative recombination in electron-diatomic ion collisions. A review of available data, both theory and experiment, will be given. Particular attention will be paid to tailoring the molecular physics to the condition of hypersonic flows. For example, the high rotational temperatures in a hypersonic flow field means that most experimental data carried out under room temperatures are not applicable. Also, the average electron temperature is expected to be between 10,000 and 20,000 K. Thus only data for low energy electrons are relevant to the model.

  2. Nanoantioxidant-driven plasmon enhanced proton-coupled electron transfer

    NASA Astrophysics Data System (ADS)

    Sotiriou, Georgios A.; Blattmann, Christoph O.; Deligiannakis, Yiannis

    2015-12-01

    Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer.Proton-coupled electron transfer (PCET) reactions involve the transfer of a proton and an electron and play an important role in a number of chemical and biological processes. Here, we describe a novel phenomenon, plasmon-enhanced PCET, which is manifested using SiO2-coated Ag nanoparticles functionalized with gallic acid (GA), a natural antioxidant molecule that can perform PCET. These GA-functionalized nanoparticles show enhanced plasmonic response at near-IR wavelengths, due to particle agglomeration caused by the GA molecules. Near-IR laser irradiation induces strong local hot-spots on the SiO2-coated Ag nanoparticles, as evidenced by surface enhanced Raman scattering (SERS). This leads to plasmon energy transfer to the grafted GA molecules that lowers the GA-OH bond dissociation enthalpy by at least 2 kcal mol-1 and therefore facilitates PCET. The nanoparticle-driven plasmon-enhancement of PCET brings together the so far unrelated research domains of nanoplasmonics and electron/proton translocation with significant impact on applications based on interfacial electron/proton transfer. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04942c

  3. Electron energy distribution function, effective electron temperature, and dust charge in the temporal afterglow of a plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Denysenko, I. B.; Azarenkov, N. A.; Kersten, H.

    2016-05-15

    Analytical expressions describing the variation of electron energy distribution function (EEDF) in an afterglow of a plasma are obtained. Especially, the case when the electron energy loss is mainly due to momentum-transfer electron-neutral collisions is considered. The study is carried out for different EEDFs in the steady state, including Maxwellian and Druyvesteyn distributions. The analytical results are not only obtained for the case when the rate for momentum-transfer electron-neutral collisions is independent on electron energy but also for the case when the collisions are a power function of electron energy. Using analytical expressions for the EEDF, the effective electron temperaturemore » and charge of the dust particles, which are assumed to be present in plasma, are calculated for different afterglow durations. An analytical expression for the rate describing collection of electrons by dust particles for the case when the rate for momentum-transfer electron-neutral collisions is independent on electron energy is also derived. The EEDF profile and, as a result, the effective electron temperature and dust charge are sufficiently different in the cases when the rate for momentum-transfer electron-neutral collisions is independent on electron energy and when the rate is a power function of electron energy.« less

  4. The structure of Escherichia coli signal recognition particle revealed by scanning transmission electron microscopy.

    PubMed

    Mainprize, Iain L; Beniac, Daniel R; Falkovskaia, Elena; Cleverley, Robert M; Gierasch, Lila M; Ottensmeyer, F Peter; Andrews, David W

    2006-12-01

    Structural studies on various domains of the ribonucleoprotein signal recognition particle (SRP) have not converged on a single complete structure of bacterial SRP consistent with the biochemistry of the particle. We obtained a three-dimensional structure for Escherichia coli SRP by cryoscanning transmission electron microscopy and mapped the internal RNA by electron spectroscopic imaging. Crystallographic data were fit into the SRP reconstruction, and although the resulting model differed from previous models, they could be rationalized by movement through an interdomain linker of Ffh, the protein component of SRP. Fluorescence resonance energy transfer experiments determined interdomain distances that were consistent with our model of SRP. Docking our model onto the bacterial ribosome suggests a mechanism for signal recognition involving interdomain movement of Ffh into and out of the nascent chain exit site and suggests how SRP could interact and/or compete with the ribosome-bound chaperone, trigger factor, for a nascent chain during translation.

  5. Liquid-permeable electrode

    DOEpatents

    Folser, George R.

    1980-01-01

    Electrodes for use in an electrolytic cell, which are liquid-permeable and have low electrical resistance and high internal surface area are provided of a rigid, porous, carbonaceous matrix having activated carbon uniformly embedded throughout. The activated carbon may be catalyzed with platinum for improved electron transfer between electrode and electrolyte. Activated carbon is mixed with a powdered thermosetting phenolic resin and compacted to the desired shape in a heated mold to melt the resin and form the green electrode. The compact is then heated to a pyrolyzing temperature to carbonize and volatilize the resin, forming a rigid, porous structure. The permeable structure and high internal surface area are useful in electrolytic cells where it is necessary to continuously remove the products of the electrochemical reaction.

  6. Arylethynyl Substituted 9,lO-Anthraquinones: Tunable Stokes Shifts by Substitution and Solvent Polarity

    NASA Technical Reports Server (NTRS)

    Yang, Jinhua; Dass, Amala; Rawashdeh, Abdel-Monem M.; Sotiriou-Leventis, Chariklia; Panzner, Matthew J.; Tyson, Daniel S.; Kinder, James D.; Leventis, Nicholas

    2004-01-01

    2-Arylethynyl- and 2,6- and 2,7-diarylethynyl-substituted 9,lO-anthraquinones were synthesized via Sonogashira coupling reactions of 2-bromo-, 2,6-dibromo-, and 2,7-dibromo-9,10- anthraquinone with para-substituted phenylacetylenes. While the redox properties of those compounds are almost insensitive to substitution, their absorption maxima are linearly related to the Hammett constants with different slopes for electron donors and electron acceptors. ABI compounds are photoluminescent both in solution (quantum yields of emission <= 6 %), and as solids. The emission spectra have the characteristics of charge-transfer bands with large Stokes shifts (100-250 nm). The charge-transfer character of the emitting state is supported by large dipole moment differences between the ground and the excited state as concluded on the basis of molecular modeling and Lippert-Mataga correlations of the Stokes shifts with solvent polarity. Maximum Stokes shifts are attained by both electron-donating and -withdrawing groups. This is explained by a destabilization of the HOMO by electron donors and a stabilization of the LUMO by electron acceptors. X-ray crystallographic analysis of, for example, 2,7-bisphenylethynfl- 9,lO-anthraquinone reveals a monoclinic P21In space group and no indication for pi-overlap that would promote quenching, thus explaining emission from the solid state. Representative reduced forms of the title compounds were isolated as stable acetates of the corresponding dihydrs-9,10- anthraquinones. The emission of these compounds is blue-shifted relative to the parent oxidized forms and is attributed to internal transitions in the dihydro-9,lO-anthraquinone core.

  7. Electron transfer across a thermal gradient

    PubMed Central

    Craven, Galen T.

    2016-01-01

    Charge transfer is a fundamental process that underlies a multitude of phenomena in chemistry and biology. Recent advances in observing and manipulating charge and heat transport at the nanoscale, and recently developed techniques for monitoring temperature at high temporal and spatial resolution, imply the need for considering electron transfer across thermal gradients. Here, a theory is developed for the rate of electron transfer and the associated heat transport between donor–acceptor pairs located at sites of different temperatures. To this end, through application of a generalized multidimensional transition state theory, the traditional Arrhenius picture of activation energy as a single point on a free energy surface is replaced with a bithermal property that is derived from statistical weighting over all configurations where the reactant and product states are equienergetic. The flow of energy associated with the electron transfer process is also examined, leading to relations between the rate of heat exchange among the donor and acceptor sites as functions of the temperature difference and the electronic driving bias. In particular, we find that an open electron transfer channel contributes to enhanced heat transport between sites even when they are in electronic equilibrium. The presented results provide a unified theory for charge transport and the associated heat conduction between sites at different temperatures. PMID:27450086

  8. Ultrafast Electron Transfer across a Nanocapsular Wall: Coumarins as Donors, Viologen as Acceptor, and Octa Acid Capsule as the Mediator.

    PubMed

    Chuang, Chi-Hung; Porel, Mintu; Choudhury, Rajib; Burda, Clemens; Ramamurthy, V

    2018-01-11

    Results of our study on ultrafast electron transfer (eT) dynamics from coumarins (coumarin-1, coumarin-480, and coumarin-153) incarcerated within octa acid (OA) capsules as electron donors to methyl viologen dissolved in water as acceptor are presented. Upon photoexcitation, coumarin inside the OA capsule transfers an electron to the acceptor electrostatically attached to the capsule leading to a long-lived radical-ion pair separated by the OA capsular wall. This charge-separated state returns to the neutral ground state via back electron transfer on the nanosecond time scale. This system allows for ultrafast electron transfer processes through a molecular wall from the apolar capsular interior to the highly polar (aqueous) environment on the femtosecond time scale. Employing femtosecond transient absorption spectroscopy, distinct rates of both forward (1-25 ps) and backward eT (700-1200 ps) processes were measured. Further understanding of the energetics is provided using Rehm-Weller analysis for the investigated photoinduced eT reactions. The results provide the rates of the eT across a molecular wall, akin to an isotropic solution, depending on the standard free energy of the reaction. The insights from this work could be utilized in the future design of efficient electron transfer processes across interfaces separating apolar and polar environments.

  9. A unified diabatic description for electron transfer reactions, isomerization reactions, proton transfer reactions, and aromaticity.

    PubMed

    Reimers, Jeffrey R; McKemmish, Laura K; McKenzie, Ross H; Hush, Noel S

    2015-10-14

    While diabatic approaches are ubiquitous for the understanding of electron-transfer reactions and have been mooted as being of general relevance, alternate applications have not been able to unify the same wide range of observed spectroscopic and kinetic properties. The cause of this is identified as the fundamentally different orbital configurations involved: charge-transfer phenomena involve typically either 1 or 3 electrons in two orbitals whereas most reactions are typically closed shell. As a result, two vibrationally coupled electronic states depict charge-transfer scenarios whereas three coupled states arise for closed-shell reactions of non-degenerate molecules and seven states for the reactions implicated in the aromaticity of benzene. Previous diabatic treatments of closed-shell processes have considered only two arbitrarily chosen states as being critical, mapping these states to those for electron transfer. We show that such effective two-state diabatic models are feasible but involve renormalized electronic coupling and vibrational coupling parameters, with this renormalization being property dependent. With this caveat, diabatic models are shown to provide excellent descriptions of the spectroscopy and kinetics of the ammonia inversion reaction, proton transfer in N2H7(+), and aromaticity in benzene. This allows for the development of a single simple theory that can semi-quantitatively describe all of these chemical phenomena, as well as of course electron-transfer reactions. It forms a basis for understanding many technologically relevant aspects of chemical reactions, condensed-matter physics, chemical quantum entanglement, nanotechnology, and natural or artificial solar energy capture and conversion.

  10. Electronic Transfer of School Records.

    ERIC Educational Resources Information Center

    Yeagley, Raymond

    2001-01-01

    Describes the electronic transfer of student records, notably the use of a Web-server named CHARLOTTE sponsored by the National Forum on Education Statistics and an Electronic Data Exchange system named SPEEDE/ExPRESS. (PKP)

  11. Production of vibrationally excited N 2 by electron impact

    NASA Astrophysics Data System (ADS)

    Campbell, L.; Brunger, M. J.; Cartwright, D. C.; Teubner, P. J. O.

    2004-08-01

    Energy transfer from electrons to neutral gases and ions is one of the dominant electron cooling processes in the ionosphere, and the role of vibrationally excited N 2 in this is particularly significant. We report here the results from a new calculation of electron energy transfer rates ( Q) for vibrational excitation of N 2, as a function of the electron temperature Te. The present study was motivated by the development of a new cross-section compilation for vibrational excitation processes in N 2 which supercedes those used in the earlier calculations of the electron energy transfer rates. We show that the energy dependence and magnitude of these cross sections, particularly in the region of the well-known 2Π g resonance in N 2, significantly affect the calculated values of Q. A detailed comparison between the current and previous calculated electron energy transfer rates is made and coefficients are provided so that these rates for transitions from level 0 to levels 1-10 can be calculated for electron temperatures less than 6000 K.

  12. Photogeneration of Charge Carriers in Bilayer Assemblies of Conjugated Rigid-Rod Polymers

    DTIC Science & Technology

    1994-07-08

    photoinduced electron transfer and exciplex formation at the bilayer interface. Thus photocarrier generation on photoexcitation of the conjugated rigid...rod polymers in the bilayer occurs by photoinduced electron transfer, forming intermolecular exciplexes which dissociate efficiently in electric field...photogeneration, conjugated rigid-rod polymers, is. MACI COD bilayer assemblies, electron transfer, exciplexes . 11. SEOJUTY CLASUICA 10. 51(11MIE CLASSIMIAVION

  13. Telematics and satellites. Part 1: Information systems

    NASA Astrophysics Data System (ADS)

    Burke, W. R.

    1980-06-01

    Telematic systems are identified and described. The applications are examined emphasizing the role played by satellite links. The discussion includes file transfer, examples of distributed processor systems, terminal communication, information retrieval systems, office information systems, electronic preparation and publishing of information, electronic systems for transfer of funds, electronic mail systems, record file transfer characteristics, intra-enterprise networks, and inter-enterprise networks.

  14. Is back-electron transfer process in Betaine-30 coherent?

    NASA Astrophysics Data System (ADS)

    Rafiq, Shahnawaz; Scholes, Gregory D.

    2017-09-01

    The possible role of coherent vibrational motion in ultrafast photo-induced electron transfer remains unclear despite considerable experimental and theoretical advances. We revisited this problem by tracking the back-electron transfer (bET) process in Betaine-30 with broadband pump-probe spectroscopy. Dephasing time constant of certain high-frequency vibrations as a function of solvent shows a trend similar to the ET rates. In the purview of Bixon-Jortner model, high-frequency quantum vibrations bridge the reactant-product energy gap by providing activationless vibronic channels. Such interaction reduces the effective coupling significantly and thereby the coherence effects are eliminated due to energy gap fluctuations, making the back-electron transfer incoherent.

  15. Modeling time-coincident ultrafast electron transfer and solvation processes at molecule-semiconductor interfaces

    NASA Astrophysics Data System (ADS)

    Li, Lesheng; Giokas, Paul G.; Kanai, Yosuke; Moran, Andrew M.

    2014-06-01

    Kinetic models based on Fermi's Golden Rule are commonly employed to understand photoinduced electron transfer dynamics at molecule-semiconductor interfaces. Implicit in such second-order perturbative descriptions is the assumption that nuclear relaxation of the photoexcited electron donor is fast compared to electron injection into the semiconductor. This approximation breaks down in systems where electron transfer transitions occur on 100-fs time scale. Here, we present a fourth-order perturbative model that captures the interplay between time-coincident electron transfer and nuclear relaxation processes initiated by light absorption. The model consists of a fairly small number of parameters, which can be derived from standard spectroscopic measurements (e.g., linear absorbance, fluorescence) and/or first-principles electronic structure calculations. Insights provided by the model are illustrated for a two-level donor molecule coupled to both (i) a single acceptor level and (ii) a density of states (DOS) calculated for TiO2 using a first-principles electronic structure theory. These numerical calculations show that second-order kinetic theories fail to capture basic physical effects when the DOS exhibits narrow maxima near the energy of the molecular excited state. Overall, we conclude that the present fourth-order rate formula constitutes a rigorous and intuitive framework for understanding photoinduced electron transfer dynamics that occur on the 100-fs time scale.

  16. Microbial Biofilm Voltammetry: Direct Electrochemical Characterization of Catalytic Electrode-Attached Biofilms▿ †

    PubMed Central

    Marsili, Enrico; Rollefson, Janet B.; Baron, Daniel B.; Hozalski, Raymond M.; Bond, Daniel R.

    2008-01-01

    While electrochemical characterization of enzymes immobilized on electrodes has become common, there is still a need for reliable quantitative methods for study of electron transfer between living cells and conductive surfaces. This work describes growth of thin (<20 μm) Geobacter sulfurreducens biofilms on polished glassy carbon electrodes, using stirred three-electrode anaerobic bioreactors controlled by potentiostats and nondestructive voltammetry techniques for characterization of viable biofilms. Routine in vivo analysis of electron transfer between bacterial cells and electrodes was performed, providing insight into the main redox-active species participating in electron transfer to electrodes. At low scan rates, cyclic voltammetry revealed catalytic electron transfer between cells and the electrode, similar to what has been observed for pure enzymes attached to electrodes under continuous turnover conditions. Differential pulse voltammetry and electrochemical impedance spectroscopy also revealed features that were consistent with electron transfer being mediated by an adsorbed catalyst. Multiple redox-active species were detected, revealing complexity at the outer surfaces of this bacterium. These techniques provide the basis for cataloging quantifiable, defined electron transfer phenotypes as a function of potential, electrode material, growth phase, and culture conditions and provide a framework for comparisons with other species or communities. PMID:18849456

  17. 5 CFR 352.307 - Eligibility for transfer.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 352.307 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.307 Eligibility for transfer. An employee is eligible for transfer to an international organization with the rights provided...

  18. Real-time electron transfer in respiratory complex I

    PubMed Central

    Verkhovskaya, Marina L.; Belevich, Nikolai; Euro, Liliya; Wikström, Mårten; Verkhovsky, Michael I.

    2008-01-01

    Electron transfer in complex I from Escherichia coli was investigated by an ultrafast freeze-quench approach. The reaction of complex I with NADH was stopped in the time domain from 90 μs to 8 ms and analyzed by electron paramagnetic resonance (EPR) spectroscopy at low temperatures. The data show that after binding of the first molecule of NADH, two electrons move via the FMN cofactor to the iron–sulfur (Fe/S) centers N1a and N2 with an apparent time constant of ≈90 μs, implying that these two centers should have the highest redox potential in the enzyme. The rate of reduction of center N2 (the last center in the electron transfer sequence) is close to that predicted by electron transfer theory, which argues for the absence of coupled proton transfer or conformational changes during electron transfer from FMN to N2. After fast reduction of N1a and N2, we observe a slow, ≈1-ms component of reduction of other Fe/S clusters. Because all elementary electron transfer rates between clusters are several orders of magnitude higher than this observed rate, we conclude that the millisecond component is limited by a single process corresponding to dissociation of the oxidized NAD+ molecule from its binding site, where it prevents entry of the next NADH molecule. Despite the presence of approximately one ubiquinone per enzyme molecule, no transient semiquinone formation was observed, which has mechanistic implications, suggesting a high thermodynamic barrier for ubiquinone reduction to the semiquinone radical. Possible consequences of these findings for the proton translocation mechanism are discussed. PMID:18316732

  19. Dexter energy transfer pathways

    PubMed Central

    Skourtis, Spiros S.; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M.; Beratan, David N.

    2016-01-01

    Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor–acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways. PMID:27382185

  20. Dexter energy transfer pathways.

    PubMed

    Skourtis, Spiros S; Liu, Chaoren; Antoniou, Panayiotis; Virshup, Aaron M; Beratan, David N

    2016-07-19

    Energy transfer with an associated spin change of the donor and acceptor, Dexter energy transfer, is critically important in solar energy harvesting assemblies, damage protection schemes of photobiology, and organometallic opto-electronic materials. Dexter transfer between chemically linked donors and acceptors is bridge mediated, presenting an enticing analogy with bridge-mediated electron and hole transfer. However, Dexter coupling pathways must convey both an electron and a hole from donor to acceptor, and this adds considerable richness to the mediation process. We dissect the bridge-mediated Dexter coupling mechanisms and formulate a theory for triplet energy transfer coupling pathways. Virtual donor-acceptor charge-transfer exciton intermediates dominate at shorter distances or higher tunneling energy gaps, whereas virtual intermediates with an electron and a hole both on the bridge (virtual bridge excitons) dominate for longer distances or lower energy gaps. The effects of virtual bridge excitons were neglected in earlier treatments. The two-particle pathway framework developed here shows how Dexter energy-transfer rates depend on donor, bridge, and acceptor energetics, as well as on orbital symmetry and quantum interference among pathways.

  1. Dipole and Coulomb forces in electron capture dissociation and electron transfer dissociation mass spectroscopy.

    PubMed

    Świerszcz, Iwona; Skurski, Piotr; Simons, Jack

    2012-02-23

    Ab initio electronic structure calculations were performed on a doubly charged polypeptide model H(+)-Lys(Ala)(19)-CO-CH(NH(2))-CH(2)-SS-CH(2)-(NH(2))CH-CO-(Ala)(19)-Lys-H(+) consisting of a C-terminal protonated Lys followed by a 19-Ala α-helix with a 20th Ala-like unit whose side chain is linked by a disulfide bond to a corresponding Ala-like unit connected to a second 19-Ala α-helix terminated by a second C-terminal-protonated Lys. The Coulomb potentials arising from the two charged Lys residues and dipole potentials arising from the two oppositely directed 72 D dipoles of the α-helices act to stabilize the SS bond's σ* orbital. The Coulomb potentials provide stabilization of 1 eV, while the two large dipoles generate an additional 4 eV. Such stabilization allows the SS σ* orbital to attach an electron and thereby generate disulfide bond cleavage products. Although calculations are performed only on SS bond cleavage, discussion of N-C(α) bond cleavage caused by electron attachment to amide π* orbitals is also presented. The magnitudes of the stabilization energies as well as the fact that they arise from Coulomb and dipole potentials are supported by results on a small model system consisting of a H(3)C-SS-CH(3) molecule with positive and negative fractional point charges to its left and right designed to represent (i) two positive charges ca. 32 Å distant (i.e., the two charged Lys sites of the peptide model) and (ii) two 72 D dipoles (i.e., the two α-helices). Earlier workers suggested that internal dipole forces in polypeptides could act to guide incoming free electrons (i.e., in electron capture dissociation (ECD)) toward the positive end of the dipole and thus affect the branching ratios for cleaving various bonds. Those workers argued that, because of the huge mass difference between an anion donor and a free electron, internal dipole forces would have a far smaller influence over the trajectory of a donor (i.e., in electron transfer dissociation (ETD)). The present findings suggest that, in addition to their effects on guiding electron or donor trajectories, dipole potentials (in combination with Coulomb potentials) also alter the energies of SS σ* and amide π* orbitals, which then affects the ability of these orbitals to bind an electron. Thus, both by trajectory-guiding and by orbital energy stabilization, Coulomb and dipole potentials can have significant influences on the branching ratios of ECD and ETC in which disulfide or N-C(α) bonds are cleaved. © 2012 American Chemical Society

  2. Effect of proton transfer on the electronic coupling in DNA

    NASA Astrophysics Data System (ADS)

    Rak, Janusz; Makowska, Joanna; Voityuk, Alexander A.

    2006-06-01

    The effects of single and double proton transfer within Watson-Crick base pairs on donor-acceptor electronic couplings, Vda, in DNA are studied on the bases of quantum chemical calculations. Four dimers [AT,AT], [GC,GC], [GC,AT] and [GC,TA)] are considered. Three techniques - the generalized Mulliken-Hush scheme, the fragment charge method and the diabatic states method - are employed to estimate Vda for hole transfer between base pairs. We show that both single- and double proton transfer (PT) reactions may substantially affect the electronic coupling in DNA. The electronic coupling in [AT,AT] is predicted to be most sensitive to PT. Single PT within the first base pair in the dimer leads to increase in the hole transfer efficiency by a factor of 4, while proton transfer within the second pair should substantially, by 2.7 times, decrease the rate of charge transfer. Thus, directional asymmetry of the PT effects on the electronic coupling is predicted. The changes in the Vda matrix elements correlate with the topological properties of orbitals of donor and acceptor and can be qualitatively rationalized in terms of resonance structures of donor and acceptor. Atomic pair contributions to the Vda matrix elements are also analyzed.

  3. Ultrafast electron and hole transfer dynamics of a solar cell dye containing hole acceptors on mesoporous TiO2 and Al2O3.

    PubMed

    Scholz, Mirko; Flender, Oliver; Boschloo, Gerrit; Oum, Kawon; Lenzer, Thomas

    2017-03-08

    The stability of dye cations against recombination with conduction band electrons in mesoporous TiO 2 electrodes is a key property for improving light harvesting in dye-sensitised solar cells. Using ultrafast transient broadband absorption spectroscopy, we monitor efficient intramolecular hole transfer in the solar cell dye E6 having two peripheral triarylamine acceptors. After photoexcitation, two hole transfer mechanisms are identified: a concerted mechanism for electron injection and hole transfer (2.4 ps) and a sequential mechanism with time constants of 3.9 ps and 30 ps. This way the dye retards unwanted recombination with a TiO 2 conduction band electron by quickly moving the hole further away from the surface. Contact of the E6/TiO 2 surface with the solvent acetonitrile has almost no influence on the electron injection and hole transfer kinetics. Fast hole transfer (2.8 ps) is also observed on a "non-injecting" Al 2 O 3 surface generating a radical cation-radical anion species with a lifetime of 530 ps. The findings confirm the good intramolecular hole transfer properties of this dye on both thin films. In contrast, intramolecular hole transfer does not occur in the mid-polar organic solvent methyl acetate. This is confirmed by TDDFT calculations suggesting a polarity-induced reduction of the driving force for hole transfer. In methyl acetate, only the relaxation of the initially photoexcited core chromophore is observed including solvent relaxation processes of the electronically excited state S 1 /ICT.

  4. Electronic Data Interchange: Using Technology to Exchange Transcripts.

    ERIC Educational Resources Information Center

    Stewart, John T.

    1994-01-01

    Describes the Florida Automated System for Transferring Educational Records (FASTER) project, which permits the electronic exchange of student transcripts; uses of similar electronic data interchange (EDI) programs in other states; and the national SPEEDE/ExPRESS project, which uses a standard format for transferring electronic transcripts.…

  5. Electronic coupling in long-range electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Newton, M.D.

    1996-12-31

    One of the quantities crucial in controlling electron transfer (et) kinetics is the donor/acceptor electronic coupling integral (HDA). Recent theoretical models for HDA will be presented, and the results of ab initio computational implementation will be reported and analyzed for several metal-to-metal ligand charge transfer processes in complex molecular aggregates. New procedures for defining diabatic states, including a generalization of the Mulliken-Hush model, allow applications to optical and excited state as well as ground state et in a many-state framework.

  6. International Co-operation and Trends in Social Science Information Transfer.

    ERIC Educational Resources Information Center

    Rozsa, Gyorgy; Foldi, Tamas

    1980-01-01

    Identifies the role and mechanism of information transfer in the social sciences, and surveys selected, significant institutions and organizations (mostly international), which promote such transfer. (RAA)

  7. Decorrelation dynamics and spectra in drift-Alfven turbulence

    NASA Astrophysics Data System (ADS)

    Fernandez Garcia, Eduardo

    Motivated by the inability of one-fluid magnetohydrodynamics (MHD) to explain key turbulence characteristics in systems ranging from the solar wind and interstellar medium to fusion devices like the reversed field pinch, this thesis studies magnetic turbulence using a drift-Alfven model that extends MHD by including electron density dynamics. Electron effects play a significant role in the dynamics by changing the structure of turbulent decorrelation in the Alfvenic regime (where fast Alfvenic propagation provides the fastest decorrelation of the system): besides the familiar counter-propagating Alfvenic branches of MHD, an additional branch tied to the diamagnetic and eddy-turn- over rates enters in the turbulent response. This kinematic branch gives hydrodynamic features to turbulence that is otherwise strongly magnetic. Magnetic features are observed in the RMS frequency, energy partitions, cross-field energy transfer and in the turbulent response, whereas hydrodynamic features appear in the average frequency, self-field transfer, turbulent response and finally the wavenumber spectrum. These features are studied via renormalized closure theory and numerical simulation. The closure calculation naturally incorporates the eigenmode structure of the turbulent response in specifying spectral energy balance equations for the magnetic, kinetic and internal (density) energies. Alfvenic terms proportional to cross correlations and involved in cross field transfer compete with eddy-turn-over, self transfer, auto-correlation terms. In the steady state, the kinematic terms dominate the energy balances and yield a 5/3 Kolmogorov spectrum (as observed in the interstellar medium) for the three field energies in the strong turbulence, long wavelength limit. Alfvenic terms establish equipartition of kinetic and magnetic energies. In the limit where wavelengths are short compared to the gyroradius, the Alfvenic terms equipartition the internal and magnetic energies resulting in a steep (-2) spectrum fall-off for those energies while the largely uncoupled kinetic modes still obey a 5/3 law. From the numerical simulations, the response function of drift-Alfven turbulence is measured. Here, a statistical ensemble is constructed from small perturbations of the turbulent amplitudes at fixed wavenumber. The decorrelation structure born out of the eigenmode calculation is verified in the numerical measurement.

  8. Hydride transfer made easy in the oxidation of alcohols catalyzed by choline oxidase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gadda, G.; Orville, A.; Pennati, A.

    2008-06-08

    Choline oxidase (E.C. 1.1.3.17) catalyzes the two-step, four-electron oxidation of choline to glycine betaine with betaine aldehyde as enzyme-associated intermediate and molecular oxygen as final electron acceptor (Scheme 1). The gem-diol, hydrated species of the aldehyde intermediate of the reaction acts as substrate for aldehyde oxidation, suggesting that the enzyme may use similar strategies for the oxidation of the alcohol substrate and aldehyde intermediate. The determination of the chemical mechanism for alcohol oxidation has emerged from biochemical, mechanistic, mutagenetic, and structural studies. As illustrated in the mechanism of Scheme 2, the alcohol substrate is initially activated in the active sitemore » of the enzyme by removal of the hydroxyl proton. The resulting alkoxide intermediate is then stabilized in the enzyme-substrate complex via electrostatic interactions with active site amino acid residues. Alcohol oxidation then occurs quantum mechanically via the transfer of the hydride ion from the activated substrate to the N(5) flavin locus. An essential requisite for this mechanism of alcohol oxidation is the high degree of preorganization of the activated enzyme-substrate complex, which is achieved through an internal equilibrium of the Michaelis complex occurring prior to, and independently from, the subsequent hydride transfer reaction. The experimental evidence that support the mechanism for alcohol oxidation shown in Scheme 2 is briefly summarized in the Results and Discussion section.« less

  9. Electron transfer statistics and thermal fluctuations in molecular junctions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goswami, Himangshu Prabal; Harbola, Upendra

    2015-02-28

    We derive analytical expressions for probability distribution function (PDF) for electron transport in a simple model of quantum junction in presence of thermal fluctuations. Our approach is based on the large deviation theory combined with the generating function method. For large number of electrons transferred, the PDF is found to decay exponentially in the tails with different rates due to applied bias. This asymmetry in the PDF is related to the fluctuation theorem. Statistics of fluctuations are analyzed in terms of the Fano factor. Thermal fluctuations play a quantitative role in determining the statistics of electron transfer; they tend tomore » suppress the average current while enhancing the fluctuations in particle transfer. This gives rise to both bunching and antibunching phenomena as determined by the Fano factor. The thermal fluctuations and shot noise compete with each other and determine the net (effective) statistics of particle transfer. Exact analytical expression is obtained for delay time distribution. The optimal values of the delay time between successive electron transfers can be lowered below the corresponding shot noise values by tuning the thermal effects.« less

  10. Extracellular electron transfer mechanisms between microorganisms and minerals.

    PubMed

    Shi, Liang; Dong, Hailiang; Reguera, Gemma; Beyenal, Haluk; Lu, Anhuai; Liu, Juan; Yu, Han-Qing; Fredrickson, James K

    2016-10-01

    Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels and nanomaterials.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bose, A; Gardel, EJ; Vidoudez, C

    Oxidation-reduction reactions underlie energy generation in nearly all life forms. Although most organisms use soluble oxidants and reductants, some microbes can access solid-phase materials as electron-acceptors or -donors via extracellular electron transfer. Many studies have focused on the reduction of solid-phase oxidants. Far less is known about electron uptake via microbial extracellular electron transfer, and almost nothing is known about the associated mechanisms. Here we show that the iron-oxidizing photoautotroph Rhodopseudomonas palustris TIE-1 accepts electrons from a poised electrode, with carbon dioxide as the sole carbon source/electron acceptor. Both electron uptake and ruBisCo form I expression are stimulated by light.more » Electron uptake also occurs in the dark, uncoupled from photosynthesis. Notably, the pioABC operon, which encodes a protein system essential for photoautotrophic growth by ferrous iron oxidation, influences electron uptake. These data reveal a previously unknown metabolic versatility of photoferrotrophs to use extracellular electron transfer for electron uptake.« less

  12. 77 FR 10373 - Greenhouse Gas Reporting Program: Electronics Manufacturing: Revisions to Heat Transfer Fluid...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-22

    ... Greenhouse Gas Reporting Program: Electronics Manufacturing: Revisions to Heat Transfer Fluid Provisions... technical revisions to the electronics manufacturing source category of the Greenhouse Gas Reporting Rule... related to the electronics manufacturing source category. DATES: This rule will be effective on March 23...

  13. 12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... TRANSFERS (REGULATION E) General § 1005.9 Receipts at electronic terminals; periodic statements. (a... institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...

  14. 12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... TRANSFERS (REGULATION E) General § 1005.9 Receipts at electronic terminals; periodic statements. (a... institution shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...

  15. 12 CFR 1005.9 - Receipts at electronic terminals; periodic statements.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ... TRANSFERS (REGULATION E) § 1005.9 Receipts at electronic terminals; periodic statements. (a) Receipts at... shall make a receipt available to a consumer at the time the consumer initiates an electronic fund transfer at an electronic terminal. The receipt shall set forth the following information, as applicable...

  16. 78 FR 48913 - Agency Information Collection Activities: Submission to OMB for Reinstatement, Without Change, of...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-08-12

    ... electronic funds transfer information to maintain its vendor (credit union) records to make electronic... maintain current electronic funds transfer data for its vendor (credit union) electronic routing and... the information on the respondents such as through the use of automated collection techniques or other...

  17. Rapid electron transfer by the carbon matrix in natural pyrogenic carbon

    PubMed Central

    Sun, Tianran; Levin, Barnaby D. A.; Guzman, Juan J. L.; Enders, Akio; Muller, David A.; Angenent, Largus T.; Lehmann, Johannes

    2017-01-01

    Surface functional groups constitute major electroactive components in pyrogenic carbon. However, the electrochemical properties of pyrogenic carbon matrices and the kinetic preference of functional groups or carbon matrices for electron transfer remain unknown. Here we show that environmentally relevant pyrogenic carbon with average H/C and O/C ratios of less than 0.35 and 0.09 can directly transfer electrons more than three times faster than the charging and discharging cycles of surface functional groups and have a 1.5 V potential range for biogeochemical reactions that invoke electron transfer processes. Surface functional groups contribute to the overall electron flux of pyrogenic carbon to a lesser extent with greater pyrolysis temperature due to lower charging and discharging capacities, although the charging and discharging kinetics remain unchanged. This study could spur the development of a new generation of biogeochemical electron flux models that focus on the bacteria–carbon–mineral conductive network. PMID:28361882

  18. Development of highly accurate approximate scheme for computing the charge transfer integral

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pershin, Anton; Szalay, Péter G.

    The charge transfer integral is a key parameter required by various theoretical models to describe charge transport properties, e.g., in organic semiconductors. The accuracy of this important property depends on several factors, which include the level of electronic structure theory and internal simplifications of the applied formalism. The goal of this paper is to identify the performance of various approximate approaches of the latter category, while using the high level equation-of-motion coupled cluster theory for the electronic structure. The calculations have been performed on the ethylene dimer as one of the simplest model systems. By studying different spatial perturbations, itmore » was shown that while both energy split in dimer and fragment charge difference methods are equivalent with the exact formulation for symmetrical displacements, they are less efficient when describing transfer integral along the asymmetric alteration coordinate. Since the “exact” scheme was found computationally expensive, we examine the possibility to obtain the asymmetric fluctuation of the transfer integral by a Taylor expansion along the coordinate space. By exploring the efficiency of this novel approach, we show that the Taylor expansion scheme represents an attractive alternative to the “exact” calculations due to a substantial reduction of computational costs, when a considerably large region of the potential energy surface is of interest. Moreover, we show that the Taylor expansion scheme, irrespective of the dimer symmetry, is very accurate for the entire range of geometry fluctuations that cover the space the molecule accesses at room temperature.« less

  19. 26 CFR 20.2013-4 - Valuation of property transferred.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Valuation of property transferred. 20.2013-4 Section 20.2013-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE....2013-4 Valuation of property transferred. (a) For purposes of section 2013 and §§ 20.2013-1 to 20.2013...

  20. 26 CFR 20.2013-4 - Valuation of property transferred.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Valuation of property transferred. 20.2013-4 Section 20.2013-4 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE....2013-4 Valuation of property transferred. (a) For purposes of section 2013 and §§ 20.2013-1 to 20.2013...

  1. Global League Tables, Big Data and the International Transfer of Educational Research Modalities

    ERIC Educational Resources Information Center

    Crossley, Michael

    2014-01-01

    The international transfer of educational policy and practice has long been a key theme in comparative research and scholarship. Recent years have seen renewed attention to the processes of international policy transfer, with new understandings emerging from innovative theorising and analysis. This article examines the nature and implications of…

  2. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  3. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  4. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 26 Internal Revenue 14 2013-04-01 2013-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  5. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 26 Internal Revenue 14 2014-04-01 2013-04-01 true Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  6. 26 CFR 26.6081-1 - Automatic extension of time for filing generation-skipping transfer tax returns.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 26 Internal Revenue 14 2012-04-01 2012-04-01 false Automatic extension of time for filing generation-skipping transfer tax returns. 26.6081-1 Section 26.6081-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE AND GIFT TAXES GENERATION-SKIPPING TRANSFER TAX...

  7. Hybrid fusions show that inter-monomer electron transfer robustly supports cytochrome bc{sub 1} function in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ekiert, Robert; Czapla, Monika; Sarewicz, Marcin

    2014-08-22

    Highlights: • We used hybrid fusion bc{sub 1} complex to test inter-monomer electron transfer in vivo. • Cross-inactivated complexes were able to sustain photoheterotrophic growth. • Inter-monomer electron transfer supports catalytic cycle in vivo. • bc{sub 1} dimer is functional even when cytochrome b subunits come from different species. - Abstract: Electronic connection between Q{sub o} and Q{sub i} quinone catalytic sites of dimeric cytochrome bc{sub 1} is a central feature of the energy-conserving Q cycle. While both the intra- and inter-monomer electron transfers were shown to connect the sites in the enzyme, mechanistic and physiological significance of the lattermore » remains unclear. Here, using a series of mutated hybrid cytochrome bc{sub 1}-like complexes, we show that inter-monomer electron transfer robustly sustains the function of the enzyme in vivo, even when the two subunits in a dimer come from different species. This indicates that minimal requirement for bioenergetic efficiency is to provide a chain of cofactors for uncompromised electron flux between the catalytic sites, while the details of protein scaffold are secondary.« less

  8. Distal [FeS]-Cluster Coordination in [NiFe]-Hydrogenase Facilitates Intermolecular Electron Transfer

    PubMed Central

    Petrenko, Alexander; Stein, Matthias

    2017-01-01

    Biohydrogen is a versatile energy carrier for the generation of electric energy from renewable sources. Hydrogenases can be used in enzymatic fuel cells to oxidize dihydrogen. The rate of electron transfer (ET) at the anodic side between the [NiFe]-hydrogenase enzyme distal iron–sulfur cluster and the electrode surface can be described by the Marcus equation. All parameters for the Marcus equation are accessible from Density Functional Theory (DFT) calculations. The distal cubane FeS-cluster has a three-cysteine and one-histidine coordination [Fe4S4](His)(Cys)3 first ligation sphere. The reorganization energy (inner- and outer-sphere) is almost unchanged upon a histidine-to-cysteine substitution. Differences in rates of electron transfer between the wild-type enzyme and an all-cysteine mutant can be rationalized by a diminished electronic coupling between the donor and acceptor molecules in the [Fe4S4](Cys)4 case. The fast and efficient electron transfer from the distal iron–sulfur cluster is realized by a fine-tuned protein environment, which facilitates the flow of electrons. This study enables the design and control of electron transfer rates and pathways by protein engineering. PMID:28067774

  9. Yurchikhin in Service Module

    NASA Image and Video Library

    2013-06-15

    ISS036-E-008165 (15 June 2013) --- Expedition 36 Flight Engineer Fyodor Yurchikhin with Russia's Federal Space Agency (Roscosmos) takes pictures of a highly anticipated event from a window in the Pirs module on the International Space Station. His electronic still camera is equipped with a 400mm lens to capture distant images of the European Space Agency's Automated Transfer Vehicle-4 (ATV-4) “Albert Einstein.” The spacecraft eventually moved in much closer and successfully docked to the orbital outpost at 2:07 GMT, June 15, 2013, following a ten-day period of free-flight.

  10. Influence of hydrogen oxidation kinetics on hydrogen environment embrittlement

    NASA Technical Reports Server (NTRS)

    Walter, R. J.; Kendig, M. W.; Meisels, A. P.

    1992-01-01

    Results are presented from experiments performed to determine the roles of hydrogen absorption and hydrogen electron transfer on the susceptibility of Fe- and Ni-base alloys to ambient-temperature hydroen embrittlement. An apparent independence is noted between hydrogen environment embrittlement and internal hydrogen embrittlement. The experiments were performed on Inconel 718, Incoloy 903, and A286. The electrochemical results obtained indicate that Inconel 718 either adsorbs hydrogen more rapidly and/or the electrochemical oxidation of the adsorbed hydrogen occurred more rapidly than in the other two materials.

  11. KSC-02pd1914

    NASA Image and Video Library

    2002-12-11

    KENNEDY SPACE CENTER, FLA. -- KSC technicians supervise the transfer of the Integrated Equipment Assembly (IEA), one of two major components of the Starboard 6 (S6) truss segment for the International Space Station (ISS), onto a cargo transporter following its arrival at the Shuttle Landing Facility. The IEA will be joined to its companion piece, the Long Spacer, before launch early in 2004. The S6 truss segment will be the 11th and final piece of the Station's Integrated Truss Structure and will support the fourth and final set of solar arrays, batteries, and electronics.

  12. Large space structures and systems in the space station era: A bibliography with indexes (supplement 03)

    NASA Technical Reports Server (NTRS)

    1991-01-01

    Bibliographies and abstracts are listed for 1221 reports, articles, and other documents introduced into the NASA scientific and technical information system between January 1, 1991 and June 30, 1991. Topics covered include large space structures and systems, space stations, extravehicular activity, thermal environments and control, tethering, spacecraft power supplies, structural concepts and control systems, electronics, advanced materials, propulsion, policies and international cooperation, vibration and dynamic controls, robotics and remote operations, data and communication systems, electric power generation, space commercialization, orbital transfer, and human factors engineering.

  13. Electron transfer mediators accelerated the microbiologically influence corrosion against carbon steel by nitrate reducing Pseudomonas aeruginosa biofilm.

    PubMed

    Jia, Ru; Yang, Dongqing; Xu, Dake; Gu, Tingyue

    2017-12-01

    Electron transfer is a rate-limiting step in microbiologically influenced corrosion (MIC) caused by microbes that utilize extracellular electrons. Cross-cell wall electron transfer is necessary to transport the electrons released from extracellular iron oxidation into the cytoplasm of cells. Electron transfer mediators were found to accelerate the MIC caused by sulfate reducing bacteria. However, there is no publication in the literature showing the effect of electron transfer mediators on MIC caused by nitrate reducing bacteria (NRB). This work demonstrated that the corrosion of anaerobic Pseudomonas aeruginosa (PAO1) grown as a nitrate reducing bacterium biofilm on C1018 carbon steel was enhanced by two electron transfer mediators, riboflavin and flavin adenine dinucleotide (FAD) separately during a 7-day incubation period. The addition of either 10ppm (w/w) (26.6μM) riboflavin or 10ppm (12.7μM) FAD did not increase planktonic cell counts, but they increased the maximum pit depth on carbon steel coupons considerably from 17.5μm to 24.4μm and 25.0μm, respectively. Riboflavin and FAD also increased the specific weight loss of carbon steel from 2.06mg/cm 2 to 2.34mg/cm 2 and 2.61mg/cm 2 , respectively. Linear polarization resistance, electrochemical impedance spectroscopy and potentiodynamic polarization curves all corroborated the pitting and weight loss data. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Cytochromes and iron sulfur proteins in sulfur metabolism of phototrophic bacteria

    NASA Technical Reports Server (NTRS)

    Fischer, U.

    1985-01-01

    Dissimilatory sulfur metabolism in phototrophic sulfur bacteria provides the bacteria with electrons for photosynthetic electron transport chain and, with energy. Assimilatory sulfate reduction is necessary for the biosynthesis of sulfur-containing cell components. Sulfide, thiosulfate, and elemental sulfur are the sulfur compounds most commonly used by phototrophic bacteria as electron donors for anoxygenic photosynthesis. Cytochromes or other electron transfer proteins, like high-potential-iron-sulfur protein (HIPIP) function as electron acceptors or donors for most enzymatic steps during the oxidation pathways of sulfide or thiosulfate. Yet, heme- or siroheme-containing proteins themselves undergo enzymatic activities in sulfur metabolism. Sirohemes comprise a porphyrin-like prosthetic group of sulfate reductase. eenzymatic reactions involve electron transfer. Electron donors or acceptors are necessary for each reaction. Cytochromes and iron sulfur problems, are able to transfer electrons.

  15. Frenkel versus charge-transfer exciton dispersion in molecular crystals

    NASA Astrophysics Data System (ADS)

    Cudazzo, Pierluigi; Gatti, Matteo; Rubio, Angel; Sottile, Francesco

    2013-11-01

    By solving the many-body Bethe-Salpeter equation at finite momentum transfer, we characterize the exciton dispersion in two prototypical molecular crystals, picene and pentacene, in which localized Frenkel excitons compete with delocalized charge-transfer excitons. We explain the exciton dispersion on the basis of the interplay between electron and hole hopping and electron-hole exchange interaction, unraveling a simple microscopic description to distinguish Frenkel and charge-transfer excitons. This analysis is general and can be applied to other systems in which the electron wave functions are strongly localized, as in strongly correlated insulators.

  16. Extracellular Electron Uptake: Among Autotrophs and Mediated by Surfaces.

    PubMed

    Tremblay, Pier-Luc; Angenent, Largus T; Zhang, Tian

    2017-04-01

    Autotrophic microbes can acquire electrons from solid donors such as steel, other microbial cells, or electrodes. Based on this feature, bioprocesses are being developed for the microbial electrosynthesis (MES) of useful products from the greenhouse gas CO 2 . Extracellular electron-transfer mechanisms involved in the acquisition of electrons from metals by electrical microbially influenced corrosion (EMIC), from other living cells by interspecies electron transfer (IET), or from an electrode during MES rely on: (i) mediators such as H 2 ; (ii) physical contact through electron-transfer proteins; or (iii) mediator-generating enzymes detached from cells. This review explores the interactions of autotrophs with solid electron donors and their importance in nature and for biosustainable technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. The Electronic Flux in Chemical Reactions. Insights on the Mechanism of the Maillard Reaction

    NASA Astrophysics Data System (ADS)

    Flores, Patricio; Gutiérrez-Oliva, Soledad; Herrera, Bárbara; Silva, Eduardo; Toro-Labbé, Alejandro

    2007-11-01

    The electronic transfer that occurs during a chemical process is analysed in term of a new concept, the electronic flux, that allows characterizing the regions along the reaction coordinate where electron transfer is actually taking place. The electron flux is quantified through the variation of the electronic chemical potential with respect to the reaction coordinate and is used, together with the reaction force, to shed light on reaction mechanism of the Schiff base formation in the Maillard reaction. By partitioning the reaction coordinate in regions in which different process might be taking place, electronic reordering associated to polarization and transfer has been identified and found to be localized at specific transition state regions where most bond forming and breaking occur.

  18. A molecular Debye-Hückel approach to the reorganization energy of electron transfer reactions in an electric cell

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiao, Tiejun; Department of Chemistry, Iowa State University, Ames, Iowa 50011; Song, Xueyu

    2014-10-07

    Electron transfer near an electrode immersed in ionic fluids is studied using the linear response approximation, namely, mean value of the vertical energy gap can be used to evaluate the reorganization energy, and hence any linear response model that can treat Coulomb interactions successfully can be used for the reorganization energy calculation. Specifically, a molecular Debye-Hückel theory is used to calculate the reorganization energy of electron transfer reactions in an electric cell. Applications to electron transfer near an electrode in molten salts show that the reorganization energies from our molecular Debye-Hückel theory agree well with the results from MD simulations.

  19. Studying electron transfer through alkanethiol self-assembled monolayers on a hanging mercury drop electrode using potentiometric measurements.

    PubMed

    Cohen-Atiya, Meirav; Mandler, Daniel

    2006-10-14

    A new approach based on measuring the change of the open-circuit potential (OCP) of a hanging mercury drop electrode (HMDE), modified with alkanethiols of different chain length conducted in a solution containing a mixture of Ru(NH3)6(2+) and Ru(NH3)6(3+) is used for studying electron transfer across the monolayer. Following the time dependence of the OCP allowed the extraction of the kinetic parameters, such as the charge transfer resistance (R(ct)) and the electron transfer rate constant (k(et)), for different alkanethiol monolayers. An electron tunneling coefficient, beta, of 0.9 A(-1) was calculated for the monolayers on Hg.

  20. Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Boning; Liang, Min; Zmich, Nicole

    Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

  1. Photoinduced Bimolecular Electron Transfer in Ionic Liquids: Cationic Electron Donors

    DOE PAGES

    Wu, Boning; Liang, Min; Zmich, Nicole; ...

    2018-01-29

    Recently, we have reported a systematic study of photoinduced electron-transfer reactions in ionic liquid solvents using neutral and anionic electron donors and a series of cyano-substituted anthracene acceptors [Wu, B.; Maroncelli, M.; Castner, E. W., Jr.Photoinduced Bimolecular Electron Transfer in Ionic Liquids. J. Am. Chem. Soc.139, 2017, 14568]. In this paper, we report complementary results for a cationic class of 1-alkyl-4-dimethylaminopyridinium electron donors. Reductive quenching of cyano-substituted anthracene fluorophores by these cationic quenchers is studied in solutions of acetonitrile and the ionic liquid 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide. Varying the length of the alkyl chain permits tuning of the quencher diffusivities in solution.more » The observed quenching kinetics are interpreted using a diffusion-reaction analysis. Finally, together with results from the prior study, these results show that the intrinsic electron-transfer rate constant does not depend on the quencher charge in this family of reactions.« less

  2. Feasibility study of electron transfer quantum well infrared photodetectors for spectral tuning in the long-wave infrared band

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jolley, Greg; Dehdashti Akhavan, Nima; Umana-Membreno, Gilberto

    An electron transfer quantum well infrared photodetector (QWIP) consisting of repeating units of two coupled quantum wells (QWs) is capable of exhibiting a two color voltage dependent spectral response. However, significant electron transfer between the coupled QWs is required for spectral tuning, which may require the application of relatively high electric fields. Also, the band structure of coupled quantum wells is more complicated in comparison to a regular quantum well and, therefore, it is not always obvious if an electron transfer QWIP can be designed such that it meets specific performance characteristics. This paper presents a feasibility study of themore » electron transfer QWIP and its suitability for spectral tuning. Self consistent calculations have been performed of the bandstructure and the electric field that results from electron population within the quantum wells, from which the optical characteristics have been obtained. The band structure, spectral response, and the resonant final state energy locations have been compared with standard QWIPs. It is shown that spectral tuning in the long-wave infrared band can be achieved over a wide wavelength range of several microns while maintaining a relatively narrow spectral response FWHM. However, the total absorption strength is more limited in comparison to a standard QWIP, since the higher QW doping densities require much higher electric fields for electron transfer.« less

  3. Operation of a cascade air conditioning system with two-phase loop

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feng, Yinshan; Wang, Jinliang; Zhao, Futao

    A method of operating a heat transfer system includes starting operation of a first heat transfer fluid vapor/compression circulation loop including a fluid pumping mechanism, a heat exchanger for rejecting thermal energy from a first heat transfer fluid, and a heat absorption side of an internal heat exchanger. A first conduit in a closed fluid circulation loop circulates the first heat transfer fluid therethrough. Operation of a second two-phase heat transfer fluid circulation loop is started after starting operation of the first heat transfer fluid circulation loop. The second heat transfer fluid circulation loop transfers heat to the first heatmore » transfer fluid circulation loop through the internal heat exchanger and includes a heat rejection side of the internal heat exchanger, a liquid pump, and a heat exchanger evaporator. A second conduit in a closed fluid circulation loop circulates a second heat transfer fluid therethrough.« less

  4. Toddlers' word learning and transfer from electronic and print books.

    PubMed

    Strouse, Gabrielle A; Ganea, Patricia A

    2017-04-01

    Transfer from symbolic media to the real world can be difficult for young children. A sample of 73 toddlers aged 17 to 23months were read either an electronic book displayed on a touchscreen device or a traditional print book in which a novel object was paired with a novel label. Toddlers in both conditions learned the label within the context of the book. However, only those who read the traditional format book generalized and transferred the label to other contexts. An older group of 28 toddlers aged 24 to 30months did generalize and transfer from the electronic book. Across ages, those children who primarily used screens to watch prerecorded video at home transferred less from the electronic book than those with more diverse home media experiences. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Interplay between barrier width and height in electron tunneling: photoinduced electron transfer in porphyrin-based donor-bridge-acceptor systems.

    PubMed

    Pettersson, Karin; Wiberg, Joanna; Ljungdahl, Thomas; Mårtensson, Jerker; Albinsson, Bo

    2006-01-12

    The rate of electron tunneling in molecular donor-bridge-acceptor (D-B-A) systems is determined both by the tunneling barrier width and height, that is, both by the distance between the donor and acceptor as well as by the energy gap between the donor and bridge moieties. These factors are therefore important to control when designing functional electron transfer systems, such as constructs for photovoltaics, artificial photosynthesis, and molecular scale electronics. In this paper we have investigated a set of D-B-A systems in which the distance and the energy difference between the donor and bridge states (DeltaEDB) are systematically varied. Zinc(II) and gold(III) porphyrins were chosen as electron donor and acceptor because of their suitable driving force for photoinduced electron transfer (-0.9 eV in butyronitrile) and well-characterized photophysics. We have previously shown, in accordance with the superexchange mechanism for electron transfer, that the electron transfer rate is proportional to the inverse of DeltaEDB in a series of zinc/gold porphyrin D-B-A systems with bridges of constant edge to edge distance (19.6 A) and varying DeltaEDB (3900-17 600 cm(-1)). Here, we use the same donor and acceptor but the bridge is shortened or extended giving a set of oligo-p-phenyleneethynylene bridges (OPE) with four different edge to edge distances ranging from 12.7 to 33.4 A. These two sets of D-B-A systems-ZnP-RB-AuP+ and ZnP-nB-AuP+-have one bridge in common, and hence, for the first time both the distance and DeltaEDB dependence of electron transfer can be studied simultaneously in a systematic way.

  6. Electron transfer dynamics and yield from gold nanoparticle to different semiconductors induced by plasmon band excitation

    NASA Astrophysics Data System (ADS)

    Du, L. C.; Xi, W. D.; Zhang, J. B.; Matsuzaki, H.; Furube, A.

    2018-06-01

    Photoinduced electron transfer from gold nanoparticles (NPs) to semiconductor under plasmon excitation is an important phenomenon in photocatalysis and solar cell applications. Femtosecond plasmon-induced electron transfer from gold NPs to the conduction band of different semiconductor like TiO2, SnO2, and ZnO was monitored at 3440 nm upon optical excitation of the surface plasmon band of gold NPs. It was found that electron injection was completed within 240 fs and the electron injection yield reached 10-30% under 570 nm excitation. It means TiO2 is not the only proper semiconductor as electron acceptors in such gold/semiconductor nanoparticle systems.

  7. Probing the coupling between proton and electron transfer in Photosystem II core complexes containing a 3-fluorotyrosine

    PubMed Central

    Rappaport, Fabrice; Boussac, Alain; Force, Dee Ann; Peloquin, Jeffrey; Brynda, Marcin; Sugiura, Miwa; Un, Sun; Britt, R. David; Diner, Bruce A.

    2009-01-01

    The catalytic cycle of numerous enzymes involves the coupling between proton transfer and electron transfer. Yet, the understanding of this coordinated transfer in biological systems remains limited, likely because its characterization relies on the controlled but experimentally challenging modifications of the free energy changes associated with either the electron or proton transfer. We have performed such a study here in Photosystem II. The driving force for electron transfer from TyrZ to P680•+ has been decreased by ~ 80 meV by mutating the axial ligand of P680, and that for proton transfer upon oxidation of TyrZ by substituting a 3-fluorotyrosine (3F-TyrZ) for TyrZ. In Mn-depleted Photosystem II, the dependence upon pH of the oxidation rates of TyrZ and 3F-TyrZ were found to be similar. However, in the pH range where the phenolic hydroxyl of TyrZ is involved in a H-bond with a proton acceptor, the activation energy of the oxidation of 3F-TyrZ is decreased by 110 meV, a value which correlates with the in vitro finding of a 90 meV stabilization energy to the phenolate form of 3F-Tyr when compared to Tyr (Seyedsayamdost et al., 2006, JACS 128:1569–79). Thus, when the phenol of YZ acts as a H-bond-donor, its oxidation by P680•+ is controlled by its prior deprotonation. This contrasts with the situation prevailing at lower pH, where the proton acceptor is protonated and therefore unavailable, in which the oxidation-induced proton transfer from the phenolic hydroxyl of TyrZ has been proposed to occur concertedly with the electron transfer to P680•+. This suggests a switch between a concerted proton/electron transfer at pHs < 7.5 to a sequential one at pHs > 7.5 and illustrates the roles of the H-bond and of the likely salt-bridge existing between the phenolate and the nearby proton acceptor in determining the coupling between proton and electron transfer. PMID:19265377

  8. ZnO-nanorods/graphene heterostructure: a direct electron transfer glucose biosensor

    NASA Astrophysics Data System (ADS)

    Zhao, Yu; Li, Wenbo; Pan, Lijia; Zhai, Dongyuan; Wang, Yu; Li, Lanlan; Cheng, Wen; Yin, Wei; Wang, Xinran; Xu, Jian-Bin; Shi, Yi

    2016-08-01

    ZnO-nanorods/graphene heterostructure was synthesized by hydrothermal growth of ZnO nanorods on chemically reduced graphene (CRG) film. The hybrid structure was demonstrated as a biosensor, where direct electron transfer between glucose oxidase (GOD) and electrode was observed. The charge transfer was attributed to the ZnO nanorod wiring between the redox center of GOD and electrode, and the ZnO/graphene heterostructure facilitated the transport of electrons on the hybride electrode. The glucose sensor based on the GOD-ZnO/CRG/Pt electrode had a high sensitivity of 17.64 μA mM-1, which is higher than most of the previously reported values for direct electron transfer based glucose biosensors. Moreover, this biosensor is linearly proportional to the concentration of glucose in the range of 0.2-1.6 mM. The study revealed that the band structure of electrode could affect the detection of direct electron transfer of GOD, which would be helpful for the design of the biosensor electrodes in the future.

  9. Role of pendant proton relays and proton-coupled electron transfer on the hydrogen evolution reaction by nickel hangman porphyrins

    DOE PAGES

    Bediako, D. Kwabena; Solis, Brian H.; Dogutan, Dilek K.; ...

    2014-10-08

    Here, the hangman motif provides mechanistic insights into the role of pendant proton relays in governing proton-coupled electron transfer (PCET) involved in the hydrogen evolution reaction (HER). We now show improved HER activity of Ni compared with Co hangman porphyrins. Cyclic voltammogram data and simulations, together with computational studies using density functional theory, implicate a shift in electrokinetic zone between Co and Ni hangman porphyrins due to a change in the PCET mechanism. Unlike the Co hangman porphyrin, the Ni hangman porphyrin does not require reduction to the formally metal(0) species before protonation by weak acids in acetonitrile. We concludemore » that protonation likely occurs at the Ni(I) state followed by reduction, in a stepwise proton transfer–electron transfer pathway. Spectroelectrochemical and computational studies reveal that upon reduction of the Ni(II) compound, the first electron is transferred to a metal-based orbital, whereas the second electron is transferred to a molecular orbital on the porphyrin ring.« less

  10. Role of pendant proton relays and proton-coupled electron transfer on the hydrogen evolution reaction by nickel hangman porphyrins

    PubMed Central

    Bediako, D. Kwabena; Solis, Brian H.; Dogutan, Dilek K.; Roubelakis, Manolis M.; Maher, Andrew G.; Lee, Chang Hoon; Chambers, Matthew B.; Hammes-Schiffer, Sharon; Nocera, Daniel G.

    2014-01-01

    The hangman motif provides mechanistic insights into the role of pendant proton relays in governing proton-coupled electron transfer (PCET) involved in the hydrogen evolution reaction (HER). We now show improved HER activity of Ni compared with Co hangman porphyrins. Cyclic voltammogram data and simulations, together with computational studies using density functional theory, implicate a shift in electrokinetic zone between Co and Ni hangman porphyrins due to a change in the PCET mechanism. Unlike the Co hangman porphyrin, the Ni hangman porphyrin does not require reduction to the formally metal(0) species before protonation by weak acids in acetonitrile. We conclude that protonation likely occurs at the Ni(I) state followed by reduction, in a stepwise proton transfer–electron transfer pathway. Spectroelectrochemical and computational studies reveal that upon reduction of the Ni(II) compound, the first electron is transferred to a metal-based orbital, whereas the second electron is transferred to a molecular orbital on the porphyrin ring. PMID:25298534

  11. Energy gap law of electron transfer in nonpolar solvents.

    PubMed

    Tachiya, M; Seki, Kazuhiko

    2007-09-27

    We investigate the energy gap law of electron transfer in nonpolar solvents for charge separation and charge recombination reactions. In polar solvents, the reaction coordinate is given in terms of the electrostatic potentials from solvent permanent dipoles at solutes. In nonpolar solvents, the energy fluctuation due to solvent polarization is absent, but the energy of the ion pair state changes significantly with the distance between the ions as a result of the unscreened strong Coulomb potential. The electron transfer occurs when the final state energy coincides with the initial state energy. For charge separation reactions, the initial state is a neutral pair state, and its energy changes little with the distance between the reactants, whereas the final state is an ion pair state and its energy changes significantly with the mutual distance; for charge recombination reactions, vice versa. We show that the energy gap law of electron-transfer rates in nonpolar solvents significantly depends on the type of electron transfer.

  12. Simulation-Based Approach to Determining Electron Transfer Rates Using Square-Wave Voltammetry.

    PubMed

    Dauphin-Ducharme, Philippe; Arroyo-Currás, Netzahualcóyotl; Kurnik, Martin; Ortega, Gabriel; Li, Hui; Plaxco, Kevin W

    2017-05-09

    The efficiency with which square-wave voltammetry differentiates faradic and charging currents makes it a particularly sensitive electroanalytical approach, as evidenced by its ability to measure nanomolar or even picomolar concentrations of electroactive analytes. Because of the relative complexity of the potential sweep it uses, however, the extraction of detailed kinetic and mechanistic information from square-wave data remains challenging. In response, we demonstrate here a numerical approach by which square-wave data can be used to determine electron transfer rates. Specifically, we have developed a numerical approach in which we model the height and the shape of voltammograms collected over a range of square-wave frequencies and amplitudes to simulated voltammograms as functions of the heterogeneous rate constant and the electron transfer coefficient. As validation of the approach, we have used it to determine electron transfer kinetics in both freely diffusing and diffusionless surface-tethered species, obtaining electron transfer kinetics in all cases in good agreement with values derived using non-square-wave methods.

  13. Chemical dynamics of the first proton-coupled electron transfer of water oxidation on TiO2 anatase.

    PubMed

    Chen, Jia; Li, Ye-Fei; Sit, Patrick; Selloni, Annabella

    2013-12-18

    Titanium dioxide (TiO2) is a prototype, water-splitting (photo)catalyst, but its performance is limited by the large overpotential for the oxygen evolution reaction (OER). We report here a first-principles density functional theory study of the chemical dynamics of the first proton-coupled electron transfer (PCET), which is considered responsible for the large OER overpotential on TiO2. We use a periodic model of the TiO2/water interface that includes a slab of anatase TiO2 and explicit water molecules, sample the solvent configurations by first principles molecular dynamics, and determine the energy profiles of the two electronic states involved in the electron transfer (ET) by hybrid functional calculations. Our results suggest that the first PCET is sequential, with the ET following the proton transfer. The ET occurs via an inner sphere process, which is facilitated by a state in which one electronic hole is shared by the two oxygen ions involved in the transfer.

  14. Extracellular enzymes facilitate electron uptake in biocorrosion and bioelectrosynthesis.

    PubMed

    Deutzmann, Jörg S; Sahin, Merve; Spormann, Alfred M

    2015-04-21

    Direct, mediator-free transfer of electrons between a microbial cell and a solid phase in its surrounding environment has been suggested to be a widespread and ecologically significant process. The high rates of microbial electron uptake observed during microbially influenced corrosion of iron [Fe(0)] and during microbial electrosynthesis have been considered support for a direct electron uptake in these microbial processes. However, the underlying molecular mechanisms of direct electron uptake are unknown. We investigated the electron uptake characteristics of the Fe(0)-corroding and electromethanogenic archaeon Methanococcus maripaludis and discovered that free, surface-associated redox enzymes, such as hydrogenases and presumably formate dehydrogenases, are sufficient to mediate an apparent direct electron uptake. In genetic and biochemical experiments, we showed that these enzymes, which are released from cells during routine culturing, catalyze the formation of H2 or formate when sorbed to an appropriate redox-active surface. These low-molecular-weight products are rapidly consumed by M. maripaludis cells when present, thereby preventing their accumulation to any appreciable or even detectable level. Rates of H2 and formate formation by cell-free spent culture medium were sufficient to explain the observed rates of methane formation from Fe(0) and cathode-derived electrons by wild-type M. maripaludis as well as by a mutant strain carrying deletions in all catabolic hydrogenases. Our data collectively show that cell-derived free enzymes can mimic direct extracellular electron transfer during Fe(0) corrosion and microbial electrosynthesis and may represent an ecologically important but so far overlooked mechanism in biological electron transfer. The intriguing trait of some microbial organisms to engage in direct electron transfer is thought to be widespread in nature. Consequently, direct uptake of electrons into microbial cells from solid surfaces is assumed to have a significant impact not only on fundamental microbial and biogeochemical processes but also on applied bioelectrochemical systems, such as microbial electrosynthesis and biocorrosion. This study provides a simple mechanistic explanation for frequently observed fast electron uptake kinetics in microbiological systems without a direct transfer: free, cell-derived enzymes can interact with cathodic surfaces and catalyze the formation of intermediates that are rapidly consumed by microbial cells. This electron transfer mechanism likely plays a significant role in various microbial electron transfer reactions in the environment. Copyright © 2015 Deutzmann et al.

  15. Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis

    DTIC Science & Technology

    2016-07-08

    AFRL-AFOSR-VA-TR-2016-0244 Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis Jahan Dawlaty UNIVERSITY OF SOUTHERN...TITLE AND SUBTITLE Ultrafast Spectroscopy of Proton-Coupled Electron Transfer (PCET) in Photocatalysis 5a. CONTRACT NUMBER 5b. GRANT NUMBER FA9550...298 Back (Rev. 8/98) DISTRIBUTION A: Distribution approved for public release. Final Report: AFOSR YIP Grant FA9550-13-1-0128: Ultrafast Spectroscopy

  16. Stimulated Electron Desorption Studies from Microwave Vacuum Electronics / High Power Microwave Materials

    DTIC Science & Technology

    2010-02-11

    purchase a new gun. Mr. Mike Ackeret ( Transfer Engineering Inc.) Transfer Engineering’s expertise in specialty UHV work and machining propelled...modifications they helped design for the test stand. With UNLV guidance, Transfer Engineering designed and built the original UNLV SEE Test Stand...Staib electron gun, an isolated beam drift tube, a hexanode delay line with a chevron microchannel plate (MCP) stack, an isolated grid, an isolated

  17. Electron-transfer and acid-base properties of a two-electron oxidized form of quaterpyrrole that acts as both an electron donor and an acceptor.

    PubMed

    Zhang, Min; E, Wenbo; Ohkubo, Kei; Sanchez-Garcia, David; Yoon, Dae-Wi; Sessler, Jonathan L; Fukuzumi, Shunichi; Kadish, Karl M

    2008-02-21

    Electron-transfer interconversion between the four-electron oxidized form of a quaterpyrrole (abbreviated as P4 for four pyrroles) and the two-electron oxidized form (P4H2) as well as between P4H2 and its fully reduced form (P4H4) bearing analogous substituents in the alpha- and beta-pyrrolic positions was studied by means of cyclic voltammetry and UV-visible spectroelectrochemistry combined with ESR and laser flash photolysis measurements. The two-electron oxidized form, P4H2, acts as both an electron donor and an electron acceptor. The radical cation (P4H2*+) and radical anion (P4H2*-) are both produced by photoinduced electron transfer from dimeric 1-benzyl-1,4-dihydronicotinamide to P4H2, whereas the cation radical form of the compound is also produced by electron-transfer oxidation of P4H2 with [Ru(bpy)3]3+. The ESR spectra of P4H2*+ and P4H2*- were recorded at low temperature and exhibit spin delocalization over all four pyrrole units. Thus, the two-electron oxidized form of the quaterpyrrole (P4H2) displays redox and electronic features analogous to those seen in the case of porphyrins and may be considered as a simple, open-chain model of this well-studied tetrapyrrolic macrocycle. The dynamics of deprotonation from P4H2*+ and disproportionation of P4H2 were examined by laser flash photolysis measurements of photoinduced electron-transfer oxidation and reduction of P4H2, respectively.

  18. Dependence of intramolecular electron-transfer rates on driving force, pH, and temperature in ammineruthenium-modified ferrocytochromes c

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wishart, J.F.; Sun, J.; Su, C.

    1997-01-23

    Several ruthenium ammine complexes were used to modify horse-heart cytochrome c at histidine-33, creating a series of (NH{sub 3}){sub 4}(L)Ru-Cyt c derivatives (L = H{sub 2}O/OH{sup -}, ammonia, 4-ethylpyridine, 3,5-lutidine, pyridine, isonicotinamide, N-methylpyrazinium) with a wide range of driving forces for Fe-to-Ru electron transfer (-{Delta}G{degree} = -0.125 to +0.46 eV). Electron-transfer rates and activation parameters were measured by pulse radiolysis using azide or carbonate radicals. The driving-force dependence of electron-transfer rates between redox centers of the same charge types obeys Marcus-Hush theory. The activationless rate limit for all of the ruthenium derivatives except the N-methylpyrazinium complex is 3.9x10{sup 5} s{supmore » -1}. Thermodynamic parameters obtained from nonisothermal differential pulse voltammetry show that the electron-transfer reactions are entropy-driven. The thermodynamic and kinetic effects of phosphate ion binding to the ruthenium center are examined. The rate of intramolecular electron transfer in (NH{sub 3}){sub 4}(isn)Ru{sup III}-Cyt c{sup II} decreases at high pH, with a midpoint at pH 9.1. 28 refs., 4 figs., 3 tabs.« less

  19. Excitation energy transfer in the photosystem I

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Webber, Andrew N

    2012-09-25

    Photosystem I is a multimeric pigment protein complex in plants, green alage and cyanobacteria that functions in series with Photosystem II to use light energy to oxidize water and reduce carbon dioxide. The Photosystem I core complex contains 96 chlorophyll a molecules and 22 carotenoids that are involved in light harvesting and electron transfer. In eucaryotes, PSI also has a peripheral light harvesting complex I (LHCI). The role of specific chlorophylls in excitation and electron transfer are still unresolved. In particular, the role of so-called bridging chlorophylls, located between the bulk antenna and the core electron transfer chain, in themore » transfer of excitation energy to the reaction center are unknown. During the past funding period, site directed mutagenesis has been used to create mutants that effect the physical properties of these key chlorophylls, and to explore how this alters the function of the photosystem. Studying these mutants using ultrafast absorption spectroscopy has led to a better understanding of the process by which excitation energy is transferred from the antenna chlorophylls to the electron transfer chain chlorophylls, and what the role of connecting chlorophylls and A_0 chlorophylls is in this process. We have also used these mutants to investigate whch of the central group of six chlorophylls are involved in the primary steps of charge separation and electron transfer.« less

  20. Dynamics of charge-transfer excitons in type-II semiconductor heterostructures

    NASA Astrophysics Data System (ADS)

    Stein, M.; Lammers, C.; Richter, P.-H.; Fuchs, C.; Stolz, W.; Koch, M.; Vänskä, O.; Weseloh, M. J.; Kira, M.; Koch, S. W.

    2018-03-01

    The formation, decay, and coherence properties of charge-transfer excitons in semiconductor heterostructures are investigated by applying four-wave-mixing and terahertz spectroscopy in combination with a predictive microscopic theory. A charge-transfer process is identified where the optically induced coherences decay directly into a charge-transfer electron-hole plasma and exciton states. It is shown that charge-transfer excitons are more sensitive to the fermionic electron-hole substructure than regular excitons.

  1. 36 CFR § 1235.44 - What general transfer requirements apply to electronic records?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... requirements apply to electronic records? § 1235.44 Section § 1235.44 Parks, Forests, and Public Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF RECORDS TO THE NATIONAL... requirements apply to electronic records? (a) Each agency must retain a copy of permanent electronic records...

  2. Vibrational Heat Transport in Molecular Junctions

    NASA Astrophysics Data System (ADS)

    Segal, Dvira; Agarwalla, Bijay Kumar

    2016-05-01

    We review studies of vibrational energy transfer in a molecular junction geometry, consisting of a molecule bridging two heat reservoirs, solids or large chemical compounds. This setup is of interest for applications in molecular electronics, thermoelectrics, and nanophononics, and for addressing basic questions in the theory of classical and quantum transport. Calculations show that system size, disorder, structure, dimensionality, internal anharmonicities, contact interaction, and quantum coherent effects are factors that combine to determine the predominant mechanism (ballistic/diffusive), effectiveness (poor/good), and functionality (linear/nonlinear) of thermal conduction at the nanoscale. We review recent experiments and relevant calculations of quantum heat transfer in molecular junctions. We recount the Landauer approach, appropriate for the study of elastic (harmonic) phononic transport, and outline techniques that incorporate molecular anharmonicities. Theoretical methods are described along with examples illustrating the challenge of reaching control over vibrational heat conduction in molecules.

  3. 26 CFR 20.2013-1 - Credit for tax on prior transfers.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 14 2010-04-01 2010-04-01 false Credit for tax on prior transfers. 20.2013-1 Section 20.2013-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE....2013-1 Credit for tax on prior transfers. (a) In general. A credit is allowed under section 2013...

  4. 26 CFR 20.2013-1 - Credit for tax on prior transfers.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 26 Internal Revenue 14 2011-04-01 2010-04-01 true Credit for tax on prior transfers. 20.2013-1 Section 20.2013-1 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) ESTATE....2013-1 Credit for tax on prior transfers. (a) In general. A credit is allowed under section 2013...

  5. Vibronic coupling explains the ultrafast carotenoid-to-bacteriochlorophyll energy transfer in natural and artificial light harvesters

    NASA Astrophysics Data System (ADS)

    Perlík, Václav; Seibt, Joachim; Cranston, Laura J.; Cogdell, Richard J.; Lincoln, Craig N.; Savolainen, Janne; Šanda, František; Mančal, Tomáš; Hauer, Jürgen

    2015-06-01

    The initial energy transfer steps in photosynthesis occur on ultrafast timescales. We analyze the carotenoid to bacteriochlorophyll energy transfer in LH2 Marichromatium purpuratum as well as in an artificial light-harvesting dyad system by using transient grating and two-dimensional electronic spectroscopy with 10 fs time resolution. We find that Förster-type models reproduce the experimentally observed 60 fs transfer times, but overestimate coupling constants, which lead to a disagreement with both linear absorption and electronic 2D-spectra. We show that a vibronic model, which treats carotenoid vibrations on both electronic ground and excited states as part of the system's Hamiltonian, reproduces all measured quantities. Importantly, the vibronic model presented here can explain the fast energy transfer rates with only moderate coupling constants, which are in agreement with structure based calculations. Counterintuitively, the vibrational levels on the carotenoid electronic ground state play the central role in the excited state population transfer to bacteriochlorophyll; resonance between the donor-acceptor energy gap and the vibrational ground state energies is the physical basis of the ultrafast energy transfer rates in these systems.

  6. Electron transfer from plastocyanin to photosystem I.

    PubMed Central

    Haehnel, W; Jansen, T; Gause, K; Klösgen, R B; Stahl, B; Michl, D; Huvermann, B; Karas, M; Herrmann, R G

    1994-01-01

    Mutant plastocyanins with Leu at position 10, 90 or 83 (Gly, Ala and Tyr respectively in wildtype) were constructed by site-specific mutagenesis of the spinach gene, and expressed in transgenic potato plants under the control of the authentic plastocyanin promoter, as well as in Escherichia coli as truncated precursor intermediates carrying the C-terminal 22 amino acid residues of the transit peptide, i.e. the thylakoid-targeting domain that acts as a bacterial export signal. The identity of the purified plastocyanins was verified by matrix-assisted laser desorption/ionization mass spectrometry. The formation of a complex between authentic or mutant spinach plastocyanin and isolated photosystem I and the electron transfer has been studied from the biphasic reduction kinetics of P700+ after excitation with laser flashes. The formation of the complex was abolished by the bulky hydrophobic group of Leu at the respective position of G10 or A90 which are part of the conserved flat hydrophobic surface around the copper ligand H87. The rate of electron transfer decreased by both mutations to < 20% of that found with wildtype plastocyanin. We conclude that the conserved flat surface of plastocyanin represents one of two crucial structural elements for both the docking at photosystem I and the efficient electron transfer via H87 to P700+. The Y83L mutant exhibited faster electron transfer to P700+ than did authentic plastocyanin. This proves that Y83 is not involved in electron transfer to P700 and suggests that electron transfer from cytochrome f and to P700 follows different routes in the plastocyanin molecule. Plastocyanin (Y83L) expressed in either E. coli or potato exhibited different isoelectric points and binding constants to photosystem I indicative of differences in the folding of the protein. The structure of the binding site at photosystem I and the mechanism of electron transfer are discussed. Images PMID:8131737

  7. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  8. Pendant acid-base groups in molecular catalysts: H-bond promoters or proton relays? Mechanisms of the conversion of CO2 to CO by electrogenerated iron(0)porphyrins bearing prepositioned phenol functionalities.

    PubMed

    Costentin, Cyrille; Passard, Guillaume; Robert, Marc; Savéant, Jean-Michel

    2014-08-20

    Two derivatives of iron tetraphenylporphyrin bearing prepositioned phenolic functionalities on two of the opposed phenyl groups prove to be remarkable catalysts for the reduction of CO2 to CO when generated electrochemically at the Fe(0) oxidation state. In one case, the same substituents are present on the two other phenyls, whereas in the other the two other phenyls are perfluorinated. They are taken as examples of the possible role of pendant acid-base groups in molecular catalysis. The prepositioned phenol groups incorporated into the catalyst molecule induce strong stabilization of the initial Fe(0)CO2 adduct through H-bonding, confirmed by DFT calculations. This positive factor is partly counterbalanced by the necessity, resulting from the same stabilization, to inject an additional electron to trigger catalysis. Thanks to the preprotonation of the initial Fe(0)CO2 adduct, the potential required for this second electron transfer is not very distant from the potential at which the adduct is generated by addition of CO2 to the Fe(0) complex. The protonation step involves an internal phenolic group and the reprotonation of the phenoxide ion thus generated by added phenol. The prepositioned phenol groups thus play both the role of H-bonding stabilizers and high-concentration proton donors. They play the same role in the second electron transfer step which closes the catalytic loop concertedly with the breaking of one of the two C-O bonds of CO2 and with proton transfer. It is also remarkable that reprotonation by added phenol is concerted with the three other events.

  9. Mass-gathering Medicine: Risks and Patient Presentations at a 2-Day Electronic Dance Music Event.

    PubMed

    Lund, Adam; Turris, Sheila A

    2015-06-01

    Music festivals, including electronic dance music events (EDMEs), increasingly are common in Canada and internationally. Part of a US $4.5 billion industry annually, the target audience is youth and young adults aged 15-25 years. Little is known about the impact of these events on local emergency departments (EDs). Drawing on prospective data over a 2-day EDME, the authors of this study employed mixed methods to describe the case mix and prospectively compared patient presentation rate (PPR) and ambulance transfer rate (ATR) between a first aid (FA) only and a higher level of care (HLC) model. There were 20,301 ticketed attendees. Seventy patient encounters were recorded over two days. The average age was 19.1 years. Roughly 69% were female (n=48/70). Forty-six percent of those seen in the main medical area were under the age of 19 years (n=32/70). The average length of stay in the main medical area was 70.8 minutes. The overall PPR was 4.09 per 1,000 attendees. The ATR with FA only would have been 1.98; ATR with HLC model was 0.52. The presence of an on-site HLC team had a significant positive effect on avoiding ambulance transfers. Twenty-nine ambulance transfers and ED visits were avoided by the presence of an on-site HLC medical team. Reduction of impact to the public health care system was substantial. Electronic dance music events have predictable risks and patient presentations, and appropriate on-site health care resources may reduce significantly the impact on the prehospital and emergency health resources in the host community.

  10. 12 CFR 205.7 - Initial disclosures.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... TRANSFERS (REGULATION E) § 205.7 Initial disclosures. (a) Timing of disclosures. A financial institution shall make the disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's...

  11. 12 CFR 205.7 - Initial disclosures.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... TRANSFERS (REGULATION E) § 205.7 Initial disclosures. (a) Timing of disclosures. A financial institution shall make the disclosures required by this section at the time a consumer contracts for an electronic fund transfer service or before the first electronic fund transfer is made involving the consumer's...

  12. Rapid electron exchange between surface-exposed bacterial cytochromes and Fe(III) minerals

    PubMed Central

    White, Gaye F.; Shi, Zhi; Shi, Liang; Wang, Zheming; Dohnalkova, Alice C.; Marshall, Matthew J.; Fredrickson, James K.; Zachara, John M.; Butt, Julea N.; Richardson, David J.; Clarke, Thomas A.

    2013-01-01

    The mineral-respiring bacterium Shewanella oneidensis uses a protein complex, MtrCAB, composed of two decaheme cytochromes, MtrC and MtrA, brought together inside a transmembrane porin, MtrB, to transport electrons across the outer membrane to a variety of mineral-based electron acceptors. A proteoliposome system containing a pool of internalized electron carriers was used to investigate how the topology of the MtrCAB complex relates to its ability to transport electrons across a lipid bilayer to externally located Fe(III) oxides. With MtrA facing the interior and MtrC exposed on the outer surface of the phospholipid bilayer, the established in vivo orientation, electron transfer from the interior electron carrier pool through MtrCAB to solid-phase Fe(III) oxides was demonstrated. The rates were 103 times higher than those reported for reduction of goethite, hematite, and lepidocrocite by S. oneidensis, and the order of the reaction rates was consistent with those observed in S. oneidensis cultures. In contrast, established rates for single turnover reactions between purified MtrC and Fe(III) oxides were 103 times lower. By providing a continuous flow of electrons, the proteoliposome experiments demonstrate that conduction through MtrCAB directly to Fe(III) oxides is sufficient to support in vivo, anaerobic, solid-phase iron respiration. PMID:23538304

  13. Automated Data Abstraction of Cardiopulmonary Resuscitation Process Measures for Complete Episodes of Cardiac Arrest Resuscitation.

    PubMed

    Lin, Steve; Turgulov, Anuar; Taher, Ahmed; Buick, Jason E; Byers, Adam; Drennan, Ian R; Hu, Samantha; J Morrison, Laurie

    2016-10-01

    Cardiopulmonary resuscitation (CPR) process measures research and quality assurance has traditionally been limited to the first 5 minutes of resuscitation due to significant costs in time, resources, and personnel from manual data abstraction. CPR performance may change over time during prolonged resuscitations, which represents a significant knowledge gap. Moreover, currently available commercial software output of CPR process measures are difficult to analyze. The objective was to develop and validate a software program to help automate the abstraction and transfer of CPR process measures data from electronic defibrillators for complete episodes of cardiac arrest resuscitation. We developed a software program to facilitate and help automate CPR data abstraction and transfer from electronic defibrillators for entire resuscitation episodes. Using an intermediary Extensible Markup Language export file, the automated software transfers CPR process measures data (electrocardiogram [ECG] number, CPR start time, number of ventilations, number of chest compressions, compression rate per minute, compression depth per minute, compression fraction, and end-tidal CO 2 per minute). We performed an internal validation of the software program on 50 randomly selected cardiac arrest cases with resuscitation durations between 15 and 60 minutes. CPR process measures were manually abstracted and transferred independently by two trained data abstractors and by the automated software program, followed by manual interpretation of raw ECG tracings, treatment interventions, and patient events. Error rates and the time needed for data abstraction, transfer, and interpretation were measured for both manual and automated methods, compared to an additional independent reviewer. A total of 9,826 data points were each abstracted by the two abstractors and by the software program. Manual data abstraction resulted in a total of six errors (0.06%) compared to zero errors by the software program. The mean ± SD time measured per case for manual data abstraction was 20.3 ± 2.7 minutes compared to 5.3 ± 1.4 minutes using the software program (p = 0.003). We developed and validated an automated software program that efficiently abstracts and transfers CPR process measures data from electronic defibrillators for complete cardiac arrest episodes. This software will enable future cardiac arrest studies and quality assurance programs to evaluate the impact of CPR process measures during prolonged resuscitations. © 2016 by the Society for Academic Emergency Medicine.

  14. Extracellular electron transfer mechanisms between microorganisms and minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shi, Liang; Dong, Hailiang; Reguera, Gemma

    Electrons can be transferred from microorganisms to multivalent metal ions that are associated with minerals and vice versa. As the microbial cell envelope is neither physically permeable to minerals nor electrically conductive, microorganisms have evolved strategies to exchange electrons with extracellular minerals. In this Review, we discuss the molecular mechanisms that underlie the ability of microorganisms to exchange electrons, such as c-type cytochromes and microbial nanowires, with extracellular minerals and with microorganisms of the same or different species. Microorganisms that have extracellular electron transfer capability can be used for biotechnological applications, including bioremediation, biomining and the production of biofuels andmore » nanomaterials.« less

  15. Quantum dynamical simulation of photoinduced electron transfer processes in dye-semiconductor systems: theory and application to coumarin 343 at TiO₂.

    PubMed

    Li, Jingrui; Kondov, Ivan; Wang, Haobin; Thoss, Michael

    2015-04-10

    A recently developed methodology to simulate photoinduced electron transfer processes at dye-semiconductor interfaces is outlined. The methodology employs a first-principles-based model Hamiltonian and accurate quantum dynamics simulations using the multilayer multiconfiguration time-dependent Hartree approach. This method is applied to study electron injection in the dye-semiconductor system coumarin 343-TiO2. Specifically, the influence of electronic-vibrational coupling is analyzed. Extending previous work, we consider the influence of Dushinsky rotation of the normal modes as well as anharmonicities of the potential energy surfaces on the electron transfer dynamics.

  16. On the origin of red and blue shifts of X-H and C-H stretching vibrations in formic acid (formate ion) and proton donor complexes.

    PubMed

    Tâme Parreira, Renato Luis; Galembeck, Sérgio Emanuel; Hobza, Pavel

    2007-01-08

    Complexes between formic acid or formate anion and various proton donors (HF, H(2)O, NH(3), and CH(4)) are studied by the MP2 and B3LYP methods with the 6-311++G(3df,3pd) basis set. Formation of a complex is characterized by electron-density transfer from electron donor to ligands. This transfer is much larger with the formate anion, for which it exceeds 0.1 e. Electron-density transfer from electron lone pairs of the electron donor is directed into sigma* antibonding orbitals of X--H bonds of the electron acceptor and leads to elongation of the bond and a red shift of the X--H stretching frequency (standard H-bonding). However, pronounced electron-density transfer from electron lone pairs of the electron donor also leads to reorganization of the electron density in the electron donor, which results in changes in geometry and vibrational frequency. These changes are largest for the C--H bonds of formic acid and formate anion, which do not participate in H-bonding. The resulting blue shift of this stretching frequency is substantial and amounts to almost 35 and 170 cm(-1), respectively.

  17. 5 CFR 352.304 - International organizations covered.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false International organizations covered. 352... REEMPLOYMENT RIGHTS Detail and Transfer of Federal Employees to International Organizations § 352.304 International organizations covered. (a) An agency may detail or transfer an employee under this subpart...

  18. Influence of Hydration on Proton Transfer in the Guanine-Cytosine Radical Cation (G•+-C) Base Pair: A Density Functional Theory Study

    PubMed Central

    Kumar, Anil; Sevilla, Michael D.

    2009-01-01

    On one-electron oxidation all molecules including DNA bases become more acidic in nature. For the GC base pair experiments suggest that a facile proton transfer takes place in the G•+-C base pair from N1 of G•+ to N3 of cytosine. This intra-base pair proton transfer reaction has been extensively considered using theoretical methods for the gas phase and it is predicted that the proton transfer is slightly unfavorable in disagreement with experiment. In the present study, we consider the effect of the first hydration layer on the proton transfer reaction in G•+-C by the use of density functional theory (DFT), B3LYP/6-31+G** calculations of the G•+-C base pair in the presence of 6 and 11 water molecules. Under the influence of hydration of 11 waters, a facile proton transfer from N1 of G•+ to N3 of C is predicted. The zero point energy (ZPE) corrected forward and backward energy barriers, for the proton transfer from N1 of G•+ to N3 of C, was found to be 1.4 and 2.6 kcal/mol, respectively. The proton transferred G•-(H+)C + 11H2O was found to be 1.2 kcal/mol more stable than G•+-C + 11H2O in agreement with experiment. The present calculation demonstrates that the inclusion of the first hydration shell around G•+-C base pair has an important effect on the internal proton transfer energetics. PMID:19485319

  19. USING MOLECULAR PROBES TO STUDY INTERFACIAL REDOX REACTION AT FE-BEARING SMECTITES

    EPA Science Inventory

    The interfacial electron transfer of clay-water systems has a wide range of significance in geochemical and biogeochernical environments. However the mechanism of interfacial electron transport is poorly understood. The electron transfer mechanism at the solid-water interfaces of...

  20. Redox Modulation of Flavin and Tyrosine Determines Photoinduced Proton-coupled Electron Transfer and Photoactivation of BLUF Photoreceptors

    PubMed Central

    Mathes, Tilo; van Stokkum, Ivo H. M.; Stierl, Manuela; Kennis, John T. M.

    2012-01-01

    Photoinduced electron transfer in biological systems, especially in proteins, is a highly intriguing matter. Its mechanistic details cannot be addressed by structural data obtained by crystallography alone because this provides only static information on a given redox system. In combination with transient spectroscopy and site-directed manipulation of the protein, however, a dynamic molecular picture of the ET process may be obtained. In BLUF (blue light sensors using FAD) photoreceptors, proton-coupled electron transfer between a tyrosine and the flavin cofactor is the key reaction to switch from a dark-adapted to a light-adapted state, which corresponds to the biological signaling state. Particularly puzzling is the fact that, although the various naturally occurring BLUF domains show little difference in the amino acid composition of the flavin binding pocket, the reaction rates of the forward reaction differ quite largely from a few ps up to several hundred ps. In this study, we modified the redox potential of the flavin/tyrosine redox pair by site-directed mutagenesis close to the flavin C2 carbonyl and fluorination of the tyrosine, respectively. We provide information on how changes in the redox potential of either reaction partner significantly influence photoinduced proton-coupled electron transfer. The altered redox potentials allowed us furthermore to experimentally describe an excited state charge transfer intermediately prior to electron transfer in the BLUF photocycle. Additionally, we show that the electron transfer rate directly correlates with the quantum yield of signaling state formation. PMID:22833672

  1. 12 CFR 205.11 - Procedures for resolving errors.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... institution's findings and shall note the consumer's right to request the documents that the institution... transfer; (ii) An incorrect electronic fund transfer to or from the consumer's account; (iii) The omission... made by the financial institution relating to an electronic fund transfer; (v) The consumer's receipt...

  2. Photoinduced electron transfer in a molecular dyad by nanosecond pump-pump-probe spectroscopy.

    PubMed

    Ha-Thi, M-H; Pham, V-T; Pino, T; Maslova, V; Quaranta, A; Lefumeux, C; Leibl, W; Aukauloo, A

    2018-06-01

    The design of robust and inexpensive molecular photocatalysts for the conversion of abundant stable molecules like H2O and CO2 into an energetic carrier is one of the major fundamental questions for scientists nowadays. The outstanding challenge is to couple single photoinduced charge separation events with the sequential accumulation of redox equivalents at the catalytic unit for performing multielectronic catalytic reactions. Herein, double excitation by nanosecond pump-pump-probe experiments was used to interrogate the photoinduced charge transfer and charge accumulation on a molecular dyad composed of a porphyrin chromophore and a ruthenium-based catalyst in the presence of a reversible electron acceptor. An accumulative charge transfer state is unattainable because of rapid reverse electron transfer to the photosensitizer upon the second excitation and the low driving force of the forward photodriven electron transfer reaction. Such a method allows the fundamental understanding of the relaxation mechanism after two sequential photon absorptions, deciphering the undesired electron transfer reactions that limit the charge accumulation efficiency. This study is a step toward the improvement of synthetic strategies of molecular photocatalysts for light-induced charge accumulation and more generally, for solar energy conversion.

  3. Excited state electron transfer in systems with a well-defined geometry. [cyclophane

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaufmann, K.J.

    1980-12-01

    The effect of temperature, dielectric strength and ligand on the structure of the mesopyropheophorbide cyclophanes will be studied. ESR, NMR, emission and absorption spectroscopy, as well as circular dichroism will be used. The changes in structure will be correlated with changes in the photochemical activity. Electron acceptors such as benzoquinone will be utilized to stabilize the charge separation. Charge separation in porphyrin quinone dimers will also be studied. It was found that electron transfer in the cyclophane system is relatively slow. This is presumably due to an orientation requirement for fast electron transfer. Solvent dielectric also is important in producingmore » a charge separation. Decreasing the temperature effects the yield of charge transfer, but not the kinetics.« less

  4. Investigating molecule-semiconductor interfaces with nonlinear spectroscopies

    NASA Astrophysics Data System (ADS)

    Giokas, Paul George

    Knowledge of electronic structures and transport mechanisms at molecule-semiconductor interfaces is motivated by their ubiquity in photoelectrochemical cells. In this dissertation, optical spectroscopies are used uncover the influence of electronic coupling, coherent vibrational motion, and molecular geometry, and other factors on dynamics initiated by light absorption at such interfaces. These are explored for a family of ruthenium bipyridyl chromophores bound to titanium dioxide. Transient absorption measurements show molecular singlet state electron injection in 100 fs or less. Resonance Raman intensity analysis suggests the electronic excitations possess very little charge transfer character. The connections drawn in this work between molecular structure and photophysical behavior contribute to the general understanding of photoelectrochemical cells. Knowledge of binding geometry in nanocrystalline films is challenged by heterogeneity of semiconductor surfaces. Polarized resonance Raman spectroscopy is used to characterize the ruthenium chromophore family on single crystal titanium dioxide . Chromophores display a broad distribution of molecular geometries at the interface, with increased variation in binding angle due to the presence of a methylene bridge, as well as additional phosphonate anchors. This result implies multiple binding configurations for chromophores which incorporate multiple phosphonate ligands, and indicates the need for careful consideration when developing surface-assembled chromophore-catalyst cells. Electron transfer transitions occurring on the 100 fs time scale challenge conventional second-order approximations made when modeling these reactions. A fourth-order perturbative model which includes the relationship between coincident electron transfer and nuclear relaxation processes is presented. Insights provided by the model are illustrated for a two-level donor molecule. The presented fourth-order rate formula constitutes a rigorous and intuitive framework for understanding sub-picosecond photoinduced electron transfer dynamics. Charge transfer systems fit by this model include catechol-sensitized titanium dioxide nanoparticles and a closely-related molecular complex. These systems exhibit vibrational coherence coincident with back-electron transfer in the first picosecond after excitation, which suggests that intramolecular nuclear motion strongly influences the electronic transfer process and plays an important role in the dynamics of interfacial systems following light absorption.

  5. PTB’s radiometric scales for UV and VUV source calibration based on synchrotron radiation

    NASA Astrophysics Data System (ADS)

    Klein, Roman; Kroth, Simone; Paustian, Wolfgang; Richter, Mathias; Thornagel, Reiner

    2018-06-01

    The radiant intensity of synchrotron radiation can be accurately calculated with classical electrodynamics. This primary realization of the spectral radiant intensity has been used by PTB at several electron storage rings which have been optimized to be operated as primary source standards for the calibration of transfer sources in the spectral range of UV and VUV for almost 30 years. The transfer sources are compared to the primary source standard by means of suitable wavelength-dispersive transfer stations. The spectral range covered by deuterium lamps, which represent transfer sources that are easy to handle, is of particular relevance in practice. Here, we report on developments in the realization and preservation of the radiometric scales for spectral radiant intensity and spectral radiance in the wavelength region from 116 nm to 400 nm, based on a set of deuterium reference lamps, over the last few decades. An inside view and recommendations on the operation of the D2 lamps used for the realization of the radiometric scale are presented. The data has been recently compiled to illustrate the chronological behaviour at various wavelengths. Moreover, an overview of the internal and external validation measurements and intercomparisons is given.

  6. Biofilms in 3D porous media: Delineating the influence of the pore network geometry, flow and mass transfer on biofilm development.

    PubMed

    Carrel, Maxence; Morales, Verónica L; Beltran, Mario A; Derlon, Nicolas; Kaufmann, Rolf; Morgenroth, Eberhard; Holzner, Markus

    2018-05-01

    This study investigates the functional correspondence between porescale hydrodynamics, mass transfer, pore structure and biofilm morphology during progressive biofilm colonization of a porous medium. Hydrodynamics and the structure of both the porous medium and the biofilm are experimentally measured with 3D particle tracking velocimetry and micro X-ray Computed Tomography, respectively. The analysis focuses on data obtained in a clean porous medium after 36 h of biofilm growth. Registration of the particle tracking and X-ray data sets allows to delineate the interplay between porous medium geometry, hydrodynamic and mass transfer processes on the morphology of the developing biofilm. A local analysis revealed wide distributions of wall shear stresses and concentration boundary layer thicknesses. The spatial distribution of the biofilm patches uncovered that the wall shear stresses controlled the biofilm development. Neither external nor internal mass transfer limitations were noticeable in the considered system, consistent with the excess supply of nutrient and electron acceptors. The wall shear stress remained constant in the vicinity of the biofilm but increased substantially elsewhere. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. A Versatile High-Vacuum Cryo-transfer System for Cryo-microscopy and Analytics

    PubMed Central

    Tacke, Sebastian; Krzyzanek, Vladislav; Nüsse, Harald; Wepf, Roger Albert; Klingauf, Jürgen; Reichelt, Rudolf

    2016-01-01

    Cryogenic microscopy methods have gained increasing popularity, as they offer an unaltered view on the architecture of biological specimens. As a prerequisite, samples must be handled under cryogenic conditions below their recrystallization temperature, and contamination during sample transfer and handling must be prevented. We present a high-vacuum cryo-transfer system that streamlines the entire handling of frozen-hydrated samples from the vitrification process to low temperature imaging for scanning transmission electron microscopy and transmission electron microscopy. A template for cryo-electron microscopy and multimodal cryo-imaging approaches with numerous sample transfer steps is presented. PMID:26910419

  8. Manipulating charge transfer excited state relaxation and spin crossover in iron coordination complexes with ligand substitution

    DOE PAGES

    Zhang, Wenkai; Kjaer, Kasper S.; Alonso-Mori, Roberto; ...

    2016-08-25

    Developing light-harvesting and photocatalytic molecules made with iron could provide a cost effective, scalable, and environmentally benign path for solar energy conversion. To date these developments have been limited by the sub-picosecond metal-to-ligand charge transfer (MLCT) electronic excited state lifetime of iron based complexes due to spin crossover – the extremely fast intersystem crossing and internal conversion to high spin metal-centered excited states. We revitalize a 30 year old synthetic strategy for extending the MLCT excited state lifetimes of iron complexes by making mixed ligand iron complexes with four cyanide (CN –) ligands and one 2,2'-bipyridine (bpy) ligand. This enablesmore » MLCT excited state and metal-centered excited state energies to be manipulated with partial independence and provides a path to suppressing spin crossover. We have combined X-ray Free-Electron Laser (XFEL) Kβ hard X-ray fluorescence spectroscopy with femtosecond time-resolved UV-visible absorption spectroscopy to characterize the electronic excited state dynamics initiated by MLCT excitation of [Fe(CN) 4(bpy)] 2–. The two experimental techniques are highly complementary; the time-resolved UV-visible measurement probes allowed electronic transitions between valence states making it sensitive to ligand-centered electronic states such as MLCT states, whereas the Kβ fluorescence spectroscopy provides a sensitive measure of changes in the Fe spin state characteristic of metal-centered excited states. Here, we conclude that the MLCT excited state of [Fe(CN) 4(bpy)] 2– decays with roughly a 20 ps lifetime without undergoing spin crossover, exceeding the MLCT excited state lifetime of [Fe(2,2'-bipyridine) 3] 2+ by more than two orders of magnitude.« less

  9. Role of Surface-Capping Ligands in Photoexcited Electron Transfer between CdS Nanorods and [FeFe] Hydrogenase and the Subsequent H 2 Generation

    DOE PAGES

    Wilker, Molly B.; Utterback, James K.; Greene, Sophie; ...

    2017-12-08

    Complexes of CdS nanorods and [FeFe] hydrogenase from Clostridium acetobutylicum have been shown to photochemically produce H 2. This study examines the role of the ligands that passivate the nanocrystal surfaces in the electron transfer from photoexcited CdS to hydrogenase and the H 2 generation that follows. We functionalized CdS nanorods with a series of mercaptocarboxylate surface-capping ligands of varying lengths and measured their photoexcited electron relaxation by transient absorption (TA) spectroscopy before and after hydrogenase adsorption. Rate constants for electron transfer from the nanocrystals to the enzyme, extracted by modeling of TA kinetics, decrease exponentially with ligand length, suggestingmore » that the ligand layer acts as a barrier to charge transfer and controls the degree of electronic coupling. Relative light-driven H 2 production efficiencies follow the relative quantum efficiencies of electron transfer, revealing the critical role of surface-capping ligands in determining the photochemical activity of these nanocrystal-enzyme complexes. Our results suggest that the H 2 production in this system could be maximized with a choice of a surface-capping ligand that decreases the distance between the nanocrystal surface and the electron injection site of the enzyme.« less

  10. Role of Surface-Capping Ligands in Photoexcited Electron Transfer between CdS Nanorods and [FeFe] Hydrogenase and the Subsequent H 2 Generation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilker, Molly B.; Utterback, James K.; Greene, Sophie

    Complexes of CdS nanorods and [FeFe] hydrogenase from Clostridium acetobutylicum have been shown to photochemically produce H 2. This study examines the role of the ligands that passivate the nanocrystal surfaces in the electron transfer from photoexcited CdS to hydrogenase and the H 2 generation that follows. We functionalized CdS nanorods with a series of mercaptocarboxylate surface-capping ligands of varying lengths and measured their photoexcited electron relaxation by transient absorption (TA) spectroscopy before and after hydrogenase adsorption. Rate constants for electron transfer from the nanocrystals to the enzyme, extracted by modeling of TA kinetics, decrease exponentially with ligand length, suggestingmore » that the ligand layer acts as a barrier to charge transfer and controls the degree of electronic coupling. Relative light-driven H 2 production efficiencies follow the relative quantum efficiencies of electron transfer, revealing the critical role of surface-capping ligands in determining the photochemical activity of these nanocrystal-enzyme complexes. Our results suggest that the H 2 production in this system could be maximized with a choice of a surface-capping ligand that decreases the distance between the nanocrystal surface and the electron injection site of the enzyme.« less

  11. Electron transfer between colloidal ZnO nanocrystals.

    PubMed

    Hayoun, Rebecca; Whitaker, Kelly M; Gamelin, Daniel R; Mayer, James M

    2011-03-30

    Colloidal ZnO nanocrystals capped with dodecylamine and dissolved in toluene can be charged photochemically to give stable solutions in which electrons are present in the conduction bands of the nanocrystals. These conduction-band electrons are readily monitored by EPR spectroscopy, with g* values that correlate with the nanocrystal sizes. Mixing a solution of charged small nanocrystals (e(-)(CB):ZnO-S) with a solution of uncharged large nanocrystals (ZnO-L) caused changes in the EPR spectrum indicative of quantitative electron transfer from small to large nanocrystals. EPR spectra of the reverse reaction, e(-)(CB):ZnO-L + ZnO-S, showed that electrons do not transfer from large to small nanocrystals. Stopped-flow kinetics studies monitoring the change in the UV band-edge absorption showed that reactions of 50 μM nanocrystals were complete within the 5 ms mixing time of the instrument. Similar results were obtained for the reaction of charged nanocrystals with methyl viologen (MV(2+)). These and related results indicate that the electron-transfer reactions of these colloidal nanocrystals are quantitative and very rapid, despite the presence of ~1.5 nm long dodecylamine capping ligands. These soluble ZnO nanocrystals are thus well-defined redox reagents suitable for studies of electron transfer involving semiconductor nanostructures.

  12. Real Time Quantification of Ultrafast Photoinduced Bimolecular Electron Transfer Rate: Direct Probing of the Transient Intermediate.

    PubMed

    Mukherjee, Puspal; Biswas, Somnath; Sen, Pratik

    2015-08-27

    Fluorescence quenching studies through steady-state and time-resolved measurements are inadequate to quantify the bimolecular electron transfer rate in bulk homogeneous solution due to constraints from diffusion. To nullify the effect of diffusion, direct evaluation of the rate of formation of a transient intermediate produced upon the electron transfer is essential. Methyl viologen, a well-known electron acceptor, produces a radical cation after accepting an electron, which has a characteristic strong and broad absorption band centered at 600 nm. Hence it is a good choice to evaluate the rate of photoinduced electron transfer reaction employing femtosecond broadband transient absorption spectroscopy. The time constant of the aforementioned process between pyrene and methyl viologen in methanol has been estimated to be 2.5 ± 0.4 ps using the same technique. The time constant for the backward reaction was found to be 14 ± 1 ps. These values did not change with variation of concentration of quencher, i.e., methyl viologen. Hence, we can infer that diffusion has no contribution in the estimation of rate constants. However, on changing the solvent from methanol to ethanol, the time constant of the electron transfer reaction has been found to increase and has accounted for the change in solvent reorganization energy.

  13. Flow-field differences and electromagnetic-field properties of air and N2 inductively coupled plasmas

    NASA Astrophysics Data System (ADS)

    Yu, Minghao; Yamada, Kazuhiko; Takahashi, Yusuke; Liu, Kai; Zhao, Tong

    2016-12-01

    A numerical model for simulating air and nitrogen inductively coupled plasmas (ICPs) was developed considering thermochemical nonequilibrium and the third-order electron transport properties. A modified far-field electromagnetic model was introduced and tightly coupled with the flow field equations to describe the Joule heating and inductive discharge phenomena. In total, 11 species and 49 chemical reactions of air, which include 5 species and 8 chemical reactions of nitrogen, were employed to model the chemical reaction process. The internal energy transfers among translational, vibrational, rotational, and electronic energy modes of chemical species were taken into account to study thermal nonequilibrium effects. The low-Reynolds number Abe-Kondoh-Nagano k-ɛ turbulence model was employed to consider the turbulent heat transfer. In this study, the fundamental characteristics of an ICP flow, such as the weak ionization, high temperature but low velocity in the torch, and wide area of the plasma plume, were reproduced by the developed numerical model. The flow field differences between the air and nitrogen ICP flows inside the 10-kW ICP wind tunnel were made clear. The interactions between the electromagnetic and flow fields were also revealed for an inductive discharge.

  14. Multisite constrained model of trans-4-(N,N-dimethylamino)-4'-nitrostilbene for structural elucidation of radiative and nonradiative excited states.

    PubMed

    Lin, Cheng-Kai; Wang, Yu-Fu; Cheng, Yuan-Chung; Yang, Jye-Shane

    2013-04-18

    A constrained model compound of trans-4-(N,N-dimethylamino)-4'-nitrostilbene (DNS), namely, compound DNS-B3 that is limited to torsions about the phenyl-nitro C-N bond and the central C═C bond, was prepared to investigate the structural nature of the radiative and nonradiative states of electronically excited DNS. The great similarities in solvent-dependent electronic spectra, fluorescence decay times, and quantum yields for fluorescence (Φf) and trans → cis photoisomerization (Φtc) between DNS and DNS-B3 indicate that the fluorescence is from a planar charge-transfer state and torsion of the nitro group is sufficient to account for the nonradiative decay of DNS. This conclusion is supported by TDDFT calculations on DNS-B3 in dichloromethane. The structure at the conical intersection for internal conversion is associated with not only a twisting but also a pyramidalization of the nitro group. The mechanism of the NO2 torsion is discussed in terms of the effects of solvent polarity, the substituents, and the volume demand. The differences and analogies of the NO2- vs amino-twisted intramolecular charge-transfer (TICT) state of trans-aminostilbenes are also discussed.

  15. Tentative anatomy of ZnS-type electroluminescence

    NASA Astrophysics Data System (ADS)

    Bringuier, E.

    1994-05-01

    The paper reviews the electrical and optical mechanisms at work in sulfide-based thin-film electroluminescence display devices within the framework of general semiconductor physics. The electrical problem is twofold: (i) charge carriers are sourced at high electric field in a nominally insulating material, the carrier density increasing by almost eight orders of magnitude; (ii) the carriers are transported at high field, with an average energy largely exceeding the thermal one. (i) Carrier sourcing is best understood from direct-current-driven ZnS films, and is ascribed to partly filled deep donors transferring electrons to the conduction band by Fowler-Nordheim tunneling. The deep donors also act as carrier sinkers, and evidence for space charge is afforded by small-signal impedance analysis disclosing a markedly inductive behavior. The conduction picture obtained from dc-driven films is then used to clarify the operation of alternating-current electroluminescence structures where the sulfide is sandwiched between two blocking oxide layers. The electrostatics of the ac structure is investigated in detail including space charge and field nonuniformity, and external observables are related to internal quantities. The simple model of interfacial carrier sourcing and sinking is examined. (ii) High-field electronic transport is controlled by the electron-phonon interaction, and the modeling resorts to numerical simulations or the lucky-drift concept. At low electron energies the interaction with phonons is predominantly polar, while at optical energies it proceeds via deformation potential scattering. In spite of the uncertainties in transport models in that range, it is likely that ˜50% of the electrons overtake 2 eV at the usual operating fields in ZnS. Light emission is associated with impurity luminescence centers embedded in the sulfide host. They are excited while current is flowing, and the ensuing relaxation is partly radiative. We describe the two ways in which an impurity may be excited electrically, namely, impact excitation (internal promotion of the center to a state of higher energy) or impact ionization (with an electron released to the host conduction band). The actual excitation mechanism depends on the position of the impurity excited level relative to the host energy bands. A calculation of the excitation yield (number of excited centers per transferred electron) is detailed in the case of impact excitation. Lastly, a phenomenological description of the various relaxation channels is given in terms of formal kinetics, and the relative importance of radiative relaxation is assessed by means of the deexcitation yield (fraction of centers decaying radiatively), which is defined in the case of the impulse response.

  16. Supramolecular networks with electron transfer in two dimensions

    DOEpatents

    Stupp, Samuel I.; Stoddart, J. Fraser; Shveyd, Alexander K.; Tayi, Alok S.; Sue, Chi-Hau; Narayanan, Ashwin

    2016-09-13

    Organic charge-transfer (CT) co-crystals in a crossed stack system are disclosed. The co-crystals exhibit bidirectional charge transfer interactions where one donor molecule shares electrons with two different acceptors, one acceptor face-to-face and the other edge-to-face. The assembly and charge transfer interaction results in a pleochroic material whereby the optical absorption continuously changes depending on the polarization angle of incident light.

  17. The European Glaucoma Society Glaucocard project: improved digital documentation of medical data for glaucoma patients based on standardized structured international datasets.

    PubMed

    Schargus, Marc; Grehn, Franz; Glaucocard Workgroup

    2008-12-01

    To evaluate existing international IT-based ophthalmological medical data projects, and to define a glaucoma data set based on existing international standards of medical and ophthalmological documentation. To develop the technical environment for easy data mining and data exchange in different countries in Europe. Existing clinical and IT-based projects for documentation of medical data in general medicine and ophthalmology were analyzed to create new data sets for medical documentation in glaucoma patients. Different types of data transfer methods were evaluated to find the best method of data exchange between ophthalmologists in different European countries. Data sets from existing IT projects showed a wide variability in specifications, use of codes, terms and graphical data (perimetry, optic nerve analysis etc.) in glaucoma patients. New standardized digital datasets for glaucoma patients were defined, based on existing standards, which can be used by general ophthalmologists for follow-up examinations and for glaucoma specialists to perform teleconsultation, also across country borders. Datasets are available in different languages. Different types of data exchange methods using secure medical data transfer by internet, USB stick and smartcard were tested for different countries with regard to legal acceptance, practicability and technical realization (e.g. compatibility with EMR systems). By creating new standardized glaucoma specific cross-national datasets, it is now possible to develop an electronic glaucoma patient record system for data storage and transfer based on internet, smartcard or USB stick. The digital data can be used for referrals and for teleconsultation of glaucoma specialists in order to optimize glaucoma treatment. This should lead to an increase of quality in glaucoma care, and prevent expenses in health care costs by unnecessary repeated examinations.

  18. pH-dependent electron transfer reaction and direct bioelectrocatalysis of the quinohemoprotein pyranose dehydrogenase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takeda, Kouta; Matsumura, Hirotoshi; Ishida, Takuya

    A pyranose dehydrogenase from Coprinopsis cinerea (CcPDH) is an extracellular quinohemoeprotein, which consists a b-type cytochrome domain, a pyrroloquinoline-quinone (PQQ) domain, and a family 1-type carbohydrate-binding module. The electron transfer reaction of CcPDH was studied using some electron acceptors and a carbon electrode at various pH levels. Phenazine methosulfate (PMS) reacted directly at the PQQ domain, whereas cytochrome c (cyt c) reacted via the cytochrome domain of intact CcPDH. Thus, electrons are transferred from reduced PQQ in the catalytic domain of CcPDH to heme b in the N-terminal cytochrome domain, which acts as a built-in mediator and transfers electron tomore » a heterogenous electron transfer protein. The optimal pH values of the PMS reduction (pH 6.5) and the cyt c reduction (pH 8.5) differ. The catalytic currents for the oxidation of L-fucose were observed within a range of pH 4.5 to 11. Bioelectrocatalysis of CcPDH based on direct electron transfer demonstrated that the pH profile of the biocatalytic current was similar to the reduction activity of cyt c characters. - Highlights: • pH dependencies of activity were different for the reduction of cyt c and DCPIP. • DET-based bioelectrocatalysis of CcPDH was observed. • The similar pH-dependent profile was found with cyt c and electrode. • The present results suggested that IET reaction of CcPDH shows pH dependence.« less

  19. Electron Transfer Strategies Regulate Carbonate Mineral and Micropore Formation.

    PubMed

    Zeng, Zhirui; Tice, Michael M

    2018-01-01

    Some microbial carbonates are robust biosignatures due to their distinct morphologies and compositions. However, whether carbonates induced by microbial iron reduction have such features is unknown. Iron-reducing bacteria use various strategies to transfer electrons to iron oxide minerals (e.g., membrane-bound enzymes, soluble electron shuttles, nanowires, as well as different mechanisms for moving over or attaching to mineral surfaces). This diversity has the potential to create mineral biosignatures through manipulating the microenvironments in which carbonate precipitation occurs. We used Shewanella oneidensis MR-1, Geothrix fermentans, and Geobacter metallireducens GS-15, representing three different strategies, to reduce solid ferric hydroxide in order to evaluate their influence on carbonate and micropore formation (micro-size porosity in mineral rocks). Our results indicate that electron transfer strategies determined the morphology (rhombohedral, spherical, or long-chained) of precipitated calcium-rich siderite by controlling the level of carbonate saturation and the location of carbonate formation. Remarkably, electron transfer strategies also produced distinctive cell-shaped micropores in both carbonate and hydroxide minerals, thus producing suites of features that could potentially serve as biosignatures recording information about the sizes, shapes, and physiologies of iron-reducing organisms. Key Words: Microbial iron reduction-Micropore-Electron transfer strategies-Microbial carbonate. Astrobiology 18, 28-36.

  20. 36 CFR § 1235.50 - What specifications and standards for transfer apply to electronic records?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF RECORDS TO THE... Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi Road... and Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi...

  1. 36 CFR 1235.50 - What specifications and standards for transfer apply to electronic records?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Property NATIONAL ARCHIVES AND RECORDS ADMINISTRATION RECORDS MANAGEMENT TRANSFER OF REC- ORDS TO THE... Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi Road... and Records Administration, Electronic/Special Media Records Services Division (NWME), 8601 Adelphi...

  2. Monte-Carlo modelling of nano-material photocatalysis: bridging photocatalytic activity and microscopic charge kinetics.

    PubMed

    Liu, Baoshun

    2016-04-28

    In photocatalysis, it is known that light intensity, organic concentration, and temperature affect the photocatalytic activity by changing the microscopic kinetics of holes and electrons. However, how the microscopic kinetics of holes and electrons relates to the photocatalytic activity was not well known. In the present research, we developed a Monte-Carlo random walking model that involved all of the charge kinetics, including the photo-generation, the recombination, the transport, and the interfacial transfer of holes and electrons, to simulate the overall photocatalytic reaction, which we called a "computer experiment" of photocatalysis. By using this model, we simulated the effect of light intensity, temperature, and organic surface coverage on the photocatalytic activity and the density of the free electrons that accumulate in the simulated system. It was seen that the increase of light intensity increases the electron density and its mobility, which increases the probability for a hole/electron to find an electron/hole for recombination, and consequently led to an apparent kinetics that the quantum yield (QY) decreases with the increase of light intensity. It was also seen that the increase of organic surface coverage could increase the rate of hole interfacial transfer and result in the decrease of the probability for an electron to recombine with a hole. Moreover, the increase of organic coverage on the nano-material surface can also increase the accumulation of electrons, which enhances the mobility for electrons to undergo interfacial transfer, and finally leads to the increase of photocatalytic activity. The simulation showed that the temperature had a more complicated effect, as it can simultaneously change the activation of electrons, the interfacial transfer of holes, and the interfacial transfer of electrons. It was shown that the interfacial transfer of holes might play a main role at low temperature, with the temperature-dependence of QY conforming to the Arrhenius model. The activation of electrons from the traps to the conduction band might become important at high temperature, which accelerates the electron movement for recombination and leads to a temperature dependence of QY that deviates from the Arrhenius model.

  3. 12 CFR 205.3 - Coverage.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...

  4. 12 CFR 205.3 - Coverage.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...

  5. 12 CFR 205.3 - Coverage.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ... to initiate a one-time electronic fund transfer from a consumer's account. The consumer must...-time electronic fund transfer (in providing a check to a merchant or other payee for the MICR encoding... information for the transfer shall also provide a notice to the consumer at the same time it provides the...

  6. Charge-transfer complexes and their role in exciplex emission and near-infrared photovoltaics.

    PubMed

    Ng, Tsz-Wai; Lo, Ming-Fai; Fung, Man-Keung; Zhang, Wen-Jun; Lee, Chun-Sing

    2014-08-20

    Charge transfer and interactions at organic heterojunctions (OHJs) are known to have critical influences on various properties of organic electronic devices. In this Research News article, a short review is given from the electronic viewpoint on how the local molecular interactions and interfacial energetics at P/N OHJs contribute to the recombination/dissociation of electron-hole pairs. Very often, the P-type materials donate electrons to the N-type materials, giving rise to charge-transfer complexes (CTCs) with a P(δ+) -N(δ-) configuration. A recently observed opposite charge-transfer direction in OHJs is also discussed (i.e., N-type material donates electrons to P-type material to form P(δ-) -N(δ+) ). Recent studies on the electronic structures of CTC-forming material pairs are also summarized. The formation of P(δ-) -N(δ+) -type CTCs and their correlations with exciplex emission are examined. Furthermore, the potential applications of CTCs in NIR photovoltaic devices are reviewed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Visualizing the non-equilibrium dynamics of photoinduced intramolecular electron transfer with femtosecond X-ray pulses

    PubMed Central

    Canton, Sophie E.; Kjær, Kasper S.; Vankó, György; van Driel, Tim B.; Adachi, Shin-ichi; Bordage, Amélie; Bressler, Christian; Chabera, Pavel; Christensen, Morten; Dohn, Asmus O.; Galler, Andreas; Gawelda, Wojciech; Gosztola, David; Haldrup, Kristoffer; Harlang, Tobias; Liu, Yizhu; Møller, Klaus B.; Németh, Zoltán; Nozawa, Shunsuke; Pápai, Mátyás; Sato, Tokushi; Sato, Takahiro; Suarez-Alcantara, Karina; Togashi, Tadashi; Tono, Kensuke; Uhlig, Jens; Vithanage, Dimali A.; Wärnmark, Kenneth; Yabashi, Makina; Zhang, Jianxin; Sundström, Villy; Nielsen, Martin M.

    2015-01-01

    Ultrafast photoinduced electron transfer preceding energy equilibration still poses many experimental and conceptual challenges to the optimization of photoconversion since an atomic-scale description has so far been beyond reach. Here we combine femtosecond transient optical absorption spectroscopy with ultrafast X-ray emission spectroscopy and diffuse X-ray scattering at the SACLA facility to track the non-equilibrated electronic and structural dynamics within a bimetallic donor–acceptor complex that contains an optically dark centre. Exploiting the 100-fold increase in temporal resolution as compared with storage ring facilities, these measurements constitute the first X-ray-based visualization of a non-equilibrated intramolecular electron transfer process over large interatomic distances. Experimental and theoretical results establish that mediation through electronically excited molecular states is a key mechanistic feature. The present study demonstrates the extensive potential of femtosecond X-ray techniques as diagnostics of non-adiabatic electron transfer processes in synthetic and biological systems, and some directions for future studies, are outlined. PMID:25727920

  8. Visualizing the non-equilibrium dynamics of photoinduced intramolecular electron transfer with femtosecond X-ray pulses

    DOE PAGES

    Canton, Sophie E.; Kjær, Kasper S.; Vankó, György; ...

    2015-03-02

    Ultrafast photoinduced electron transfer preceding energy equilibration still poses many experimental and conceptual challenges to the optimization of photoconversion since an atomic-scale description has so far been beyond reach. Here we combine femtosecond transient optical absorption spectroscopy with ultrafast X-ray emission spectroscopy and diffuse X-ray scattering at the SACLA facility to track the non-equilibrated electronic and structural dynamics within a bimetallic donor–acceptor complex that contains an optically dark centre. Exploiting the 100-fold increase in temporal resolution as compared with storage ring facilities, these measurements constitute the first X-ray-based visualization of a non-equilibrated intramolecular electron transfer process over large interatomic distances.more » Thus experimental and theoretical results establish that mediation through electronically excited molecular states is a key mechanistic feature. The present study demonstrates the extensive potential of femtosecond X-ray techniques as diagnostics of non-adiabatic electron transfer processes in synthetic and biological systems, and some directions for future studies, are outlined.« less

  9. Photosensitizing Electron Transfer Processes of Fullerenes, Carbon Nanotubes, and Carbon Nanohorns.

    PubMed

    Ito, Osamu

    2017-03-01

    In this account, studies on the photosensitizing electron transfer of nanocarbons, such as fullerenes, single-walled carbon nanotubes (SWCNTs), and carbon nanohorns (CNH), performed in our laboratory for about 15 years in the early 21st century have been briefly reviewed. These novel nanocarbons act as excellent electron acceptors, when they are linked to light-absorbing electron donors, such as porphyrins or phthalocyanines. For such molecule-nanocarbon hybrids, the direct confirmation of fast, transient, electron-transfer phenomena must be performed with time-resolved spectroscopic methods, such as transient absorption spectral measurements, in addition to fluorescence time-profile measurements in the wide-wavelength regions. Careful use of these methods affords useful information to understand photoinduced electron-transfer mechanisms. In addition, kinetic data obtained by these methods can assist in the construction of light-active devices, such as photovoltaic cells and solar H 2 -generation systems. © 2017 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Experimental and Theoretical Demonstrations for the Mechanism behind Enhanced Microbial Electron Transfer by CNT Network

    NASA Astrophysics Data System (ADS)

    Liu, Xian-Wei; Chen, Jie-Jie; Huang, Yu-Xi; Sun, Xue-Fei; Sheng, Guo-Ping; Li, Dao-Bo; Xiong, Lu; Zhang, Yuan-Yuan; Zhao, Feng; Yu, Han-Qing

    2014-01-01

    Bioelectrochemical systems (BESs) share the principle of the microbially catalyzed anodic substrate oxidation. Creating an electrode interface to promote extracellular electron transfer from microbes to electrode and understanding such mechanisms are crucial for engineering BESs. In this study, significantly promoted electron transfer and a 10-times increase in current generation in a BES were achieved by the utilization of carbon nanotube (CNT) network, compared with carbon paper. The mechanisms for the enhanced current generation with the CNT network were elucidated with both experimental approach and molecular dynamic simulations. The fabricated CNT network was found to be able to substantially enhance the interaction between the c-type cytochromes and solid electron acceptor, indicating that the direct electron transfer from outer-membrane decaheme c-type cytochromes to electrode might occur. The results obtained in this study will benefit for the optimized design of new materials to target the outer membrane proteins for enhanced electron exchanges.

  11. An overview of the first half-century of molecular electronics.

    PubMed

    Hush, Noel S

    2003-12-01

    The seminal ideas from which molecular electronics has developed were the theories of molecular conduction advanced in the late 1940s by Robert S. Mulliken and Albert Szent-Gyorgi. These were, respectively, the concept of donor-acceptor charge transfer complexes and the possibility that proteins might in fact not be insulators The next two decades saw a burgeoning of experimental and theoretical work on electron transfer systems, together with a lone effort by D.D. Eley on conduction in proteins. The call by Feynman in his famous 1959 lecture There's Plenty of Room at the Bottom for chemists, engineers and physicists to combine to build up structures from the molecular level was influential in turning attention to the possibility of engineering single molecules to function as elements in information-processing systems. This was made tangible by the proposal of Aviram and Ratner in 1974 to use a Mulliken-like electron donor-acceptor molecule as a molecular diode, generalizing molecular conduction into molecular electronics. In the early 1970s the remarkably visionary work of Forrest L. Carter of the U.S. Naval Research Laboratories began to appear: designs for molecular wires, switches, complex molecular logic elements, and a host of related ideas were advanced. Shortly after that, conferences on molecular electronics began to be held, and the interdisciplinary programs that Feynman envisaged. There was a surge in both experimental and theoretical work in molecular electronics, and the establishment of many research centres. The past five years or so have seen extraordinarily rapid progress in fabrication and theoretical understanding. The history of how separate lines of research emanating from fundamental insights of about 50 years ago have coalesced into a thriving international research program in what might be called the ultimate nanotechnology is the subject of this review; it concentrates on the lesser-appreciated early developments in the field.

  12. Phonon-electron coupling and tunneling effect on charge transport in organic semi-conductor crystals of Cn-BTBT.

    PubMed

    Zhou, Yecheng; Deng, Wei-Qiao; Zhang, Hao-Li

    2016-09-14

    Cn-[1]benzothieno[3,2-b][1]-benzothiophene (BTBT) crystals show very high hole mobilities in experiments. These high mobilities are beyond existing theory prediction. Here, we employed different quantum chemistry methods to investigate charge transfer in Cn-BTBT crystals and tried to find out the reasons for the underestimation in the theory. It was found that the hopping rate estimated by the Fermi Golden Rule is higher than that of the Marcus theory due to the high temperature approximation and failure at the classic limit. More importantly, molecular dynamics simulations revealed that the phonon induced fluctuation of electronic transfer integral is much larger than the average of the electronic transfer integral itself. Mobilities become higher if simulations implement the phonon-electron coupling. This conclusion indicates that the phonon-electron coupling promotes charge transfer in organic semi-conductors at room temperature.

  13. Phonon-electron coupling and tunneling effect on charge transport in organic semi-conductor crystals of Cn-BTBT

    NASA Astrophysics Data System (ADS)

    Zhou, Yecheng; Deng, Wei-Qiao; Zhang, Hao-Li

    2016-09-01

    Cn-[1]benzothieno[3,2-b][1]-benzothiophene (BTBT) crystals show very high hole mobilities in experiments. These high mobilities are beyond existing theory prediction. Here, we employed different quantum chemistry methods to investigate charge transfer in Cn-BTBT crystals and tried to find out the reasons for the underestimation in the theory. It was found that the hopping rate estimated by the Fermi Golden Rule is higher than that of the Marcus theory due to the high temperature approximation and failure at the classic limit. More importantly, molecular dynamics simulations revealed that the phonon induced fluctuation of electronic transfer integral is much larger than the average of the electronic transfer integral itself. Mobilities become higher if simulations implement the phonon-electron coupling. This conclusion indicates that the phonon-electron coupling promotes charge transfer in organic semi-conductors at room temperature.

  14. Electronic and Vibrational Coherence in Charge-Transfer Reactions

    NASA Astrophysics Data System (ADS)

    Scherer, Norbert

    1996-03-01

    The ultrafast dynamics associated with optically-induced intervalence charge-transfer reactions in solution and protein environments are reported. These studies include the Fe^(II)-Fe^(III) MMCT complex Prussian blue and the mixed valence dimer (CN)_5Ru^(II)CNRuRu^(III)(NH_3)_5. The protein systems include blue copper proteins and the bacterial photosynthetic reaction center. The experimental approaches include photon echo, wavelength-resolved pump-probe and anisotropy measurements performed with 12-16fs duration optical pulses. Complicated time-domain waveforms reflect the several different p[rocesses and time scales for relaxation of coherences (both electronic and vibrational) and populations within these systems. The photon echo and anisotropy results probe electronic coherence and dephasing prior to back electron transfer. Wavelength-resolved pump-probe results reveal vibrational modes coupled to the CT-coordinate as well as formation of new product states or vibrational cooling in the ground state following back electron transfer.

  15. Electron Transfer Dissociation: Effects of Cation Charge State on Product Partitioning in Ion/Ion Electron Transfer to Multiply Protonated Polypeptides

    PubMed Central

    Liu, Jian; McLuckey, Scott A.

    2012-01-01

    The effect of cation charge state on product partitioning in the gas-phase ion/ion electron transfer reactions of multiply protonated tryptic peptides, model peptides, and relatively large peptides with singly charged radical anions has been examined. In particular, partitioning into various competing channels, such as proton transfer (PT) versus electron transfer (ET), electron transfer with subsequent dissociation (ETD) versus electron transfer with no dissociation (ET,noD), and fragmentation of backbone bonds versus fragmentation of side chains, was measured quantitatively as a function of peptide charge state to allow insights to be drawn about the fundamental aspects of ion/ion reactions that lead to ETD. The ET channel increases relative to the PT channel, ETD increases relative to ET,noD, and fragmentation at backbone bonds increases relative to side-chain cleavages as cation charge state increases. The increase in ET versus PT with charge state is consistent with a Landau-Zener based curve-crossing model. An optimum charge state for ET is predicted by the model for the ground state-to-ground state reaction. However, when the population of excited product ion states is considered, it is possible that a decrease in ET efficiency as charge state increases will not be observed due to the possibility of the population of excited electronic states of the products. Several factors can contribute to the increase in ETD versus ET,noD and backbone cleavage versus side-chain losses. These factors include an increase in reaction exothermicity and charge state dependent differences in precursor and product ion structures, stabilities, and sites of protonation. PMID:23264749

  16. Copper-Containing Nitrite Reductase Employing Proton-Coupled Spin-Exchanged Electron-Transfer and Multiproton Synchronized Transfer to Reduce Nitrite.

    PubMed

    Qin, Xin; Deng, Li; Hu, Caihong; Li, Li; Chen, Xiaohua

    2017-10-20

    The possible catalytic mechanism of the reduction of nitrite by copper-containing nitrite reductases (CuNiRs) is examined by using the M06 function according to two copper models, which include type-one copper (T1Cu) and type-two copper (T2Cu) sites. Examinations confirm that the protonation of two residues, His255 and Asp98, near the T2Cu site, can modulate the redox states of T1Cu and T2Cu, but cannot directly cause electron transfer from T1Cu to T2Cu. The electron hole remains at the T2Cu site when only one residue, His255 or Asp98, is protonated. However, the hole resides at the T1Cu site when both His255 and Asp98 are protonated. Then, the first protonation of nitrite takes place through indirect proton transfer from protonated His255 through the bridging H 2 O and Asp98 with three protons moving together, which cannot cause the cleavage of the HO-NO bond. Subsequently, the substrate is required to obtain another proton from reprotonated His255 through the bridging H 2 O. The reprotonation of nitrite induces the generation of nitric oxide (NO) and H 2 O at the T2Cu site through a special double-proton-coupled spin-exchanged electron-transfer mechanism with indirect proton transfer from His255 to the substrate, a beta-electron of T2Cu I shift to the NO cation, and the remaining alpha-electron changing spin direction at the same time. These results may provide useful information to better understand detailed proton-/electron-transfer reactions for the catalytic processes of CuNiR. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Constraint-based modeling of carbon fixation and the energetics of electron transfer in Geobacter metallireducens.

    PubMed

    Feist, Adam M; Nagarajan, Harish; Rotaru, Amelia-Elena; Tremblay, Pier-Luc; Zhang, Tian; Nevin, Kelly P; Lovley, Derek R; Zengler, Karsten

    2014-04-01

    Geobacter species are of great interest for environmental and biotechnology applications as they can carry out direct electron transfer to insoluble metals or other microorganisms and have the ability to assimilate inorganic carbon. Here, we report on the capability and key enabling metabolic machinery of Geobacter metallireducens GS-15 to carry out CO2 fixation and direct electron transfer to iron. An updated metabolic reconstruction was generated, growth screens on targeted conditions of interest were performed, and constraint-based analysis was utilized to characterize and evaluate critical pathways and reactions in G. metallireducens. The novel capability of G. metallireducens to grow autotrophically with formate and Fe(III) was predicted and subsequently validated in vivo. Additionally, the energetic cost of transferring electrons to an external electron acceptor was determined through analysis of growth experiments carried out using three different electron acceptors (Fe(III), nitrate, and fumarate) by systematically isolating and examining different parts of the electron transport chain. The updated reconstruction will serve as a knowledgebase for understanding and engineering Geobacter and similar species.

  18. Concerted electron-proton transfer in the optical excitation of hydrogen-bonded dyes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Westlake, Brittany C.; Brennaman, Kyle M.; Concepcion, Javier J.

    2011-05-24

    The simultaneous, concerted transfer of electrons and protons—electron-proton transfer (EPT)—is an important mechanism utilized in chemistry and biology to avoid high energy intermediates. There are many examples of thermally activated EPT in ground-state reactions and in excited states following photoexcitation and thermal relaxation. Here we report application of ultrafast excitation with absorption and Raman monitoring to detect a photochemically driven EPT process (photo-EPT). In this process, both electrons and protons are transferred during the absorption of a photon. Photo-EPT is induced by intramolecular charge-transfer (ICT) excitation of hydrogen-bonded-base adducts with either a coumarin dye or 4-nitro-4'-biphenylphenol. Femtosecond transient absorption spectralmore » measurements following ICT excitation reveal the appearance of two spectroscopically distinct states having different dynamical signatures. One of these states corresponds to a conventional ICT excited state in which the transferring H⁺ is initially associated with the proton donor. Proton transfer to the base (B) then occurs on the picosecond time scale. The other state is an ICT-EPT photoproduct. Upon excitation it forms initially in the nuclear configuration of the ground state by application of the Franck–Condon principle. However, due to the change in electronic configuration induced by the transition, excitation is accompanied by proton transfer with the protonated base formed with a highly elongated ⁺H–B bond. Coherent Raman spectroscopy confirms the presence of a vibrational mode corresponding to the protonated base in the optically prepared state.« less

  19. Concerted electron-proton transfer in the optical excitation of hydrogen-bonded dyes.

    PubMed

    Westlake, Brittany C; Brennaman, M Kyle; Concepcion, Javier J; Paul, Jared J; Bettis, Stephanie E; Hampton, Shaun D; Miller, Stephen A; Lebedeva, Natalia V; Forbes, Malcolm D E; Moran, Andrew M; Meyer, Thomas J; Papanikolas, John M

    2011-05-24

    The simultaneous, concerted transfer of electrons and protons--electron-proton transfer (EPT)--is an important mechanism utilized in chemistry and biology to avoid high energy intermediates. There are many examples of thermally activated EPT in ground-state reactions and in excited states following photoexcitation and thermal relaxation. Here we report application of ultrafast excitation with absorption and Raman monitoring to detect a photochemically driven EPT process (photo-EPT). In this process, both electrons and protons are transferred during the absorption of a photon. Photo-EPT is induced by intramolecular charge-transfer (ICT) excitation of hydrogen-bonded-base adducts with either a coumarin dye or 4-nitro-4'-biphenylphenol. Femtosecond transient absorption spectral measurements following ICT excitation reveal the appearance of two spectroscopically distinct states having different dynamical signatures. One of these states corresponds to a conventional ICT excited state in which the transferring H(+) is initially associated with the proton donor. Proton transfer to the base (B) then occurs on the picosecond time scale. The other state is an ICT-EPT photoproduct. Upon excitation it forms initially in the nuclear configuration of the ground state by application of the Franck-Condon principle. However, due to the change in electronic configuration induced by the transition, excitation is accompanied by proton transfer with the protonated base formed with a highly elongated (+)H ─ B bond. Coherent Raman spectroscopy confirms the presence of a vibrational mode corresponding to the protonated base in the optically prepared state.

  20. Role of cation size in the energy of electron transfer to 1:1 polyoxometalate ion pairs {(M+)(Xn+VW11O40)}(8–n)–(M=Li, Na, K)

    Treesearch

    Vladimir A. Grigoriev; Craig L. Hill; Ira A. Weinstock

    2000-01-01

    The use of soluble salts of polyoxometalates (d0-early-transition metal oxygen-anion clusters or POMs) as selective oxidation or electron-transfer catalysts, as probes in physical-organic and biological chemistry, and in the study of electron-and energy-transfer phenomena constitutes a substantial and rapidly growing literature. While rarely addressed, however, POM...

  1. Special Inspector General for Iraq Reconstruction. Quarterly Report and Semiannual Report to the United States Congress

    DTIC Science & Technology

    2008-01-30

    Energy Fusion Cell, and allocations include $110 million for oil pipeline exclusion zones—which aim to prevent illegal tapping and sabotage of...sectors in Iraq. This quarter SIGIR highlights two of these programs: the electronic funds transfer ( EFT ) system and U.S. advisory support provided to...the Iraq Stock Exchange. eleCTroniC funds Transfer SIGIR noted last quarter that Iraq finally acti- vated an electronic funds transfer ( EFT ) system

  2. Special Inspector General for Iraq Reconstruction: Quarterly Report and Semiannual Report to the United States Congress

    DTIC Science & Technology

    2008-01-30

    Cell, and allocations include $110 million for oil pipeline exclusion zones—which aim to prevent illegal tapping and sabotage of pipelines—$51...This quarter SIGIR highlights two of these programs: the electronic funds transfer ( EFT ) system and U.S. advisory support provided to the Iraq Stock...Exchange. eleCTroniC funds Transfer SIGIR noted last quarter that Iraq finally acti- vated an electronic funds transfer ( EFT ) system. The United

  3. Extensive domain motion and electron transfer in the human electron transferring flavoprotein.medium chain Acyl-CoA dehydrogenase complex.

    PubMed

    Toogood, Helen S; van Thiel, Adam; Basran, Jaswir; Sutcliffe, Mike J; Scrutton, Nigel S; Leys, David

    2004-07-30

    The crystal structure of the human electron transferring flavoprotein (ETF).medium chain acyl-CoA dehydrogenase (MCAD) complex reveals a dual mode of protein-protein interaction, imparting both specificity and promiscuity in the interaction of ETF with a range of structurally distinct primary dehydrogenases. ETF partitions the functions of partner binding and electron transfer between (i) the recognition loop, which acts as a static anchor at the ETF.MCAD interface, and (ii) the highly mobile redox active FAD domain. Together, these enable the FAD domain of ETF to sample a range of conformations, some compatible with fast interprotein electron transfer. Disorders in amino acid or fatty acid catabolism can be attributed to mutations at the protein-protein interface. Crucially, complex formation triggers mobility of the FAD domain, an induced disorder that contrasts with general models of protein-protein interaction by induced fit mechanisms. The subsequent interfacial motion in the MCAD.ETF complex is the basis for the interaction of ETF with structurally diverse protein partners. Solution studies using ETF and MCAD with mutations at the protein-protein interface support this dynamic model and indicate ionic interactions between MCAD Glu(212) and ETF Arg alpha(249) are likely to transiently stabilize productive conformations of the FAD domain leading to enhanced electron transfer rates between both partners.

  4. Molecular implementation of molecular shift register memories

    NASA Technical Reports Server (NTRS)

    Beratan, David N. (Inventor); Onuchic, Jose N. (Inventor)

    1991-01-01

    An electronic shift register memory (20) at the molecular level is described. The memory elements are based on a chain of electron transfer molecules (22) and the information is shifted by photoinduced (26) electron transfer reactions. Thus, multi-step sequences of charge transfer reactions are used to move charge with high efficiency down a molecular chain. The device integrates compositions of the invention onto a VLSI substrate (36), providing an example of a molecular electronic device which may be fabricated. Three energy level schemes, molecular implementation of these schemes, optical excitation strategies, charge amplification strategies, and error correction strategies are described.

  5. Communication: Charge transfer dominates over proton transfer in the reaction of nitric acid with gas-phase hydrated electrons

    NASA Astrophysics Data System (ADS)

    Lengyel, Jozef; Med, Jakub; Slavíček, Petr; Beyer, Martin K.

    2017-09-01

    The reaction of HNO3 with hydrated electrons (H2O)n- (n = 35-65) in the gas phase was studied using Fourier transform ion cyclotron resonance (FT-ICR) mass spectrometry and ab initio molecular dynamics simulations. Kinetic analysis of the experimental data shows that OH-(H2O)m is formed primarily via a reaction of the hydrated electron with HNO3 inside the cluster, while proton transfer is not observed and NO3-(H2O)m is just a secondary product. The reaction enthalpy was determined using nanocalorimetry, revealing a quite exothermic charge transfer with -241 ± 69 kJ mol-1. Ab initio molecular dynamics simulations indicate that proton transfer is an allowed reaction pathway, but the overall thermochemistry favors charge transfer.

  6. Robust and stretchable indium gallium zinc oxide-based electronic textiles formed by cilia-assisted transfer printing

    PubMed Central

    Yoon, Jongwon; Jeong, Yunkyung; Kim, Heeje; Yoo, Seonggwang; Jung, Hoon Sun; Kim, Yonghun; Hwang, Youngkyu; Hyun, Yujun; Hong, Woong-Ki; Lee, Byoung Hun; Choa, Sung-Hoon; Ko, Heung Cho

    2016-01-01

    Electronic textile (e-textile) allows for high-end wearable electronic devices that provide easy access for carrying, handling and using. However, the related technology does not seem to be mature because the woven fabric hampers not only the device fabrication process directly on the complex surface but also the transfer printing of ultrathin planar electronic devices. Here we report an indirect method that enables conformal wrapping of surface with arbitrary yet complex shapes. Artificial cilia are introduced in the periphery of electronic devices as adhesive elements. The cilia also play an important role in confining a small amount of glue and damping mechanical stress to maintain robust electronic performance under mechanical deformation. The example of electronic applications depicts the feasibility of cilia for ‘stick-&-play' systems, which provide electronic functions by transfer printing on unconventional complex surfaces. PMID:27248982

  7. Nonadiabatic one-electron transfer mechanism for the O-O bond formation in the oxygen-evolving complex of photosystem II

    NASA Astrophysics Data System (ADS)

    Shoji, Mitsuo; Isobe, Hiroshi; Shigeta, Yasuteru; Nakajima, Takahito; Yamaguchi, Kizashi

    2018-04-01

    The reaction mechanism of the O2 formation in the S4 state of the oxygen-evolving complex of photosystem II was clarified at the quantum mechanics/molecular mechanics (QM/MM) level. After the Yz (Y161) oxidation and the following proton transfer in the S3 state, five reaction steps are required to produce the molecular dioxygen. The highest barrier step is the first proton transfer reaction (0 → 1). The following reactions involving electron transfers were precisely analyzed in terms of their energies, structures and spin densities. We found that the one-electron transfer from the Mn4Ca cluster to Y161 triggers the O-O sigma bond formation.

  8. 12 CFR 205.10 - Preauthorized transfers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 12 Banks and Banking 2 2011-01-01 2011-01-01 false Preauthorized transfers. 205.10 Section 205.10 Banks and Banking FEDERAL RESERVE SYSTEM BOARD OF GOVERNORS OF THE FEDERAL RESERVE SYSTEM ELECTRONIC...'s account—(1) Notice by financial institution. When a person initiates preauthorized electronic fund...

  9. Elucidating nitric oxide synthase domain interactions by molecular dynamics.

    PubMed

    Hollingsworth, Scott A; Holden, Jeffrey K; Li, Huiying; Poulos, Thomas L

    2016-02-01

    Nitric oxide synthase (NOS) is a multidomain enzyme that catalyzes the production of nitric oxide (NO) by oxidizing L-Arg to NO and L-citrulline. NO production requires multiple interdomain electron transfer steps between the flavin mononucleotide (FMN) and heme domain. Specifically, NADPH-derived electrons are transferred to the heme-containing oxygenase domain via the flavin adenine dinucleotide (FAD) and FMN containing reductase domains. While crystal structures are available for both the reductase and oxygenase domains of NOS, to date there is no atomic level structural information on domain interactions required for the final FMN-to-heme electron transfer step. Here, we evaluate a model of this final electron transfer step for the heme-FMN-calmodulin NOS complex based on the recent biophysical studies using a 105-ns molecular dynamics trajectory. The resulting equilibrated complex structure is very stable and provides a detailed prediction of interdomain contacts required for stabilizing the NOS output state. The resulting equilibrated complex model agrees well with previous experimental work and provides a detailed working model of the final NOS electron transfer step required for NO biosynthesis. © 2015 The Protein Society.

  10. ZnO-nanorods/graphene heterostructure: a direct electron transfer glucose biosensor

    PubMed Central

    Zhao, Yu; Li, Wenbo; Pan, Lijia; Zhai, Dongyuan; Wang, Yu; Li, Lanlan; Cheng, Wen; Yin, Wei; Wang, Xinran; Xu, Jian-Bin; Shi, Yi

    2016-01-01

    ZnO-nanorods/graphene heterostructure was synthesized by hydrothermal growth of ZnO nanorods on chemically reduced graphene (CRG) film. The hybrid structure was demonstrated as a biosensor, where direct electron transfer between glucose oxidase (GOD) and electrode was observed. The charge transfer was attributed to the ZnO nanorod wiring between the redox center of GOD and electrode, and the ZnO/graphene heterostructure facilitated the transport of electrons on the hybride electrode. The glucose sensor based on the GOD-ZnO/CRG/Pt electrode had a high sensitivity of 17.64 μA mM−1, which is higher than most of the previously reported values for direct electron transfer based glucose biosensors. Moreover, this biosensor is linearly proportional to the concentration of glucose in the range of 0.2–1.6 mM. The study revealed that the band structure of electrode could affect the detection of direct electron transfer of GOD, which would be helpful for the design of the biosensor electrodes in the future. PMID:27572675

  11. Ultrafast electronic dynamics driven by nuclear motion

    NASA Astrophysics Data System (ADS)

    Vendrell, Oriol

    2016-05-01

    The transfer of electrical charge on a microscopic scale plays a fundamental role in chemistry, in biology, and in technological applications. In this contribution, we will discuss situations in which nuclear motion plays a central role in driving the electronic dynamics of photo-excited or photo-ionized molecular systems. In particular, we will explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we will illustrate how the double hole can be transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. We thank the Hamburg Centre for Ultrafast Imaging and the Volkswagen Foundation for financial support.

  12. Effects of Charge-Transfer Excitons on the Photophysics of Organic Semiconductors

    NASA Astrophysics Data System (ADS)

    Hestand, Nicholas J.

    The field of organic electronics has received considerable attention over the past several years due to the promise of novel electronic materials that are cheap, flexible and light weight. While some devices based on organic materials have already emerged on the market (e.g. organic light emitting diodes), a deeper understanding of the excited states within the condensed phase is necessary both to improve current commercial products and to develop new materials for applications that are currently in the commercial pipeline (e.g. organic photovoltaics, wearable displays, and field effect transistors). To this end, a model for pi-conjugated molecular aggregates and crystals is developed and analyzed. The model considers two types of electronic excitations, namely Frenkel and charge-transfer excitons, both of which play a prominent role in determining the nature of the excited states within tightly-packed organic systems. The former consist of an electron-hole pair bound to the same molecule while in the later the electron and hole are located on different molecules. The model also considers the important nuclear reorganization that occurs when the system switches between electronic states. This is achieved using a Holstein-style Hamiltonian that includes linear vibronic coupling of the electronic states to the nuclear motion associated with the high frequency vinyl-stretching and ring-breathing modes. Analysis of the model reveals spectroscopic signatures of charge-transfer mediated J- and H-aggregation in systems where the photophysical properties are determined primarily by charge-transfer interactions. Importantly, such signatures are found to be sensitive to the relative phase of the intermolecular electron and hole transfer integrals, and the relative energy of the Frenkel and charge-transfer states. When the charge-transfer integrals are in phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits J-aggregate characteristics including a positive band curvature, a red shifted main absorption peak, and an increase in the ratio of the first two vibronic peaks relative to the monomer. On the other hand, when the charge-transfer integrals are out of phase and the energy of the charge-transfer state is higher than the Frenkel state, the system exhibits H-aggregate characteristics including a negative band curvature, a blue shifted main absorption peak, and a decrease in the ratio of the first two vibronic peaks relative to the monomer. Notably, these signatures are consistent with those exhibited by Coulombically coupled J- and H-aggregates. Additional signatures of charge-transfer J- and H-aggregation are also discovered, the most notable of which is the appearance of a second absorption band when the charge-transfer integrals are in phase and the charge-transfer and Frenkel excitons are near resonance. In such instances, the peak-to-peak spacing is found to be proportional to the sum of the electron and hole transfer integrals. Further analysis of the charge-transfer interactions within the context of an effective Frenkel exciton coupling reveals that the charge-transfer interactions interfere directly with the intermolecular Coulombic coupling. The interference can be either constructive or destructive resulting in either enhanced or suppressed J- or H- aggregate behavior relative to what is expected based on Coulombic coupling alone. Such interferences result in four new aggregate types, namely HH-, HJ-, JH-, and JJ-aggregates, where the first letter indicates the nature of the Coulombic coupling and the second indicates the nature of the charge-transfer coupling. Vibronic signatures of such aggregates are developed and provide a means by which to rapidly screen materials for certain electronic characteristics. Notably, a large total (Coulombic plus charge-transfer) exciton coupling is associated with an absorption spectrum in which the ratio of the first two vibronic peaks deviates significantly from that of the unaggregated monomer. Hence, strongly coupled, high exciton mobility aggregates can be readily distinguished from low mobility aggregates by the ratio of their first two vibronic peaks. (Abstract shortened by ProQuest.).

  13. 26 CFR 1.1015-2 - Transfer of property in trust after December 31, 1920.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Transfer of property in trust after December 31, 1920. 1.1015-2 Section 1.1015-2 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Basis Rules of General Application § 1.1015-2 Transfer of property in trust after December 31, 192...

  14. Fast electron transfer through a single molecule natively structured redox protein

    NASA Astrophysics Data System (ADS)

    Della Pia, Eduardo Antonio; Chi, Qijin; MacDonald, J. Emyr; Ulstrup, Jens; Jones, D. Dafydd; Elliott, Martin

    2012-10-01

    The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is achieved by thiol (SH) linker pairs at opposite ends of the molecule through protein engineering, resulting in defined covalent contact between a gold surface and a platinum-iridium STM tip. Two different orientations of the linkers were examined: a long-axis configuration (SH-LA) and a short-axis configuration (SH-SA). In each case, the molecular conductance could be `gated' through electrochemical control of the heme redox state. Reproducible and remarkably high conductance was observed in this relatively complex electron transfer system, with single-molecule conductance values peaking around 18 nS and 12 nS for the SH-SA and SH-LA cytochrome b562 molecules near zero electrochemical overpotential. This strongly points to the important role of the heme co-factor bound to the natively structured protein. We suggest that the two-step model of protein electron transfer in the STM geometry requires a multi-electron transfer to explain such a high conductance. The model also yields a low value for the reorganisation energy, implying that solvent reorganisation is largely absent.The electron transfer properties of proteins are normally measured as molecularly averaged ensembles. Through these and related measurements, proteins are widely regarded as macroscopically insulating materials. Using scanning tunnelling microscopy (STM), we present new measurements of the conductance through single-molecules of the electron transfer protein cytochrome b562 in its native conformation, under pseudo-physiological conditions. This is achieved by thiol (SH) linker pairs at opposite ends of the molecule through protein engineering, resulting in defined covalent contact between a gold surface and a platinum-iridium STM tip. Two different orientations of the linkers were examined: a long-axis configuration (SH-LA) and a short-axis configuration (SH-SA). In each case, the molecular conductance could be `gated' through electrochemical control of the heme redox state. Reproducible and remarkably high conductance was observed in this relatively complex electron transfer system, with single-molecule conductance values peaking around 18 nS and 12 nS for the SH-SA and SH-LA cytochrome b562 molecules near zero electrochemical overpotential. This strongly points to the important role of the heme co-factor bound to the natively structured protein. We suggest that the two-step model of protein electron transfer in the STM geometry requires a multi-electron transfer to explain such a high conductance. The model also yields a low value for the reorganisation energy, implying that solvent reorganisation is largely absent. Electronic supplementary information (ESI) available: Experimental methods, DNA and protein sequences, additional STM statistical analysis and images, electrochemical data and It-z data analysis. See DOI: 10.1039/c2nr32131a

  15. Crystallography with online optical and X-ray absorption spectroscopies demonstrates an ordered mechanism in copper nitrite reductase.

    PubMed

    Hough, Michael A; Antonyuk, Svetlana V; Strange, Richard W; Eady, Robert R; Hasnain, S Samar

    2008-04-25

    Nitrite reductases are key enzymes that perform the first committed step in the denitrification process and reduce nitrite to nitric oxide. In copper nitrite reductases, an electron is delivered from the type 1 copper (T1Cu) centre to the type 2 copper (T2Cu) centre where catalysis occurs. Despite significant structural and mechanistic studies, it remains controversial whether the substrates, nitrite, electron and proton are utilised in an ordered or random manner. We have used crystallography, together with online X-ray absorption spectroscopy and optical spectroscopy, to show that X-rays rapidly and selectively photoreduce the T1Cu centre, but that the T2Cu centre does not photoreduce directly over a typical crystallographic data collection time. Furthermore, internal electron transfer between the T1Cu and T2Cu centres does not occur, and the T2Cu centre remains oxidised. These data unambiguously demonstrate an 'ordered' mechanism in which electron transfer is gated by binding of nitrite to the T2Cu. Furthermore, the use of online multiple spectroscopic techniques shows their value in assessing radiation-induced redox changes at different metal sites and demonstrates the importance of ensuring the correct status of redox centres in a crystal structure determination. Here, optical spectroscopy has shown a very high sensitivity for detecting the change in T1Cu redox state, while X-ray absorption spectroscopy has reported on the redox status of the T2Cu site, as this centre has no detectable optical absorption.

  16. Quantitative structure-activity relationships for reactivities of sulfate and hydroxyl radicals with aromatic contaminants through single-electron transfer pathway.

    PubMed

    Luo, Shuang; Wei, Zongsu; Spinney, Richard; Villamena, Frederick A; Dionysiou, Dionysios D; Chen, Dong; Tang, Chong-Jian; Chai, Liyuan; Xiao, Ruiyang

    2018-02-15

    Sulfate radical anion (SO 4 •- ) and hydroxyl radical (OH) based advanced oxidation technologies has been extensively used for removal of aromatic contaminants (ACs) in waters. In this study, we investigated the Gibbs free energy (ΔG SET ∘ ) of the single electron transfer (SET) reactions for 76 ACs with SO 4 •- and OH, respectively. The result reveals that SO 4 •- possesses greater propensity to react with ACs through the SET channel than OH. We hypothesized that the electron distribution within the molecule plays an essential role in determining the ΔG SET ∘ and subsequent SET reactions. To test the hypothesis, a quantitative structure-activity relationship (QSAR) model was developed for predicting ΔG SET ∘ using the highest occupied molecular orbital energies (E HOMO ), a measure of electron distribution and donating ability. The standardized QSAR models are reported to be ΔG ° SET =-0.97×E HOMO - 181 and ΔG ° SET =-0.97×E HOMO - 164 for SO 4 •- and OH, respectively. The models were internally and externally validated to ensure robustness and predictability, and the application domain and limitations were discussed. The single-descriptor based models account for 95% of the variability for SO 4 •- and OH. These results provide the mechanistic insight into the SET reaction pathway of radical and non-radical bimolecular reactions, and have important applications for radical based oxidation technologies to remove target ACs in different waters. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Technology Transfer: Technocultures, Power and Communication--The Australian Experience.

    ERIC Educational Resources Information Center

    More, Elizabeth; Irwin, Harry

    1995-01-01

    Discusses issues of communication and power in the organizational dimensions of international technology transfer, including technoculture differences and strategic political alliances. Theoretical discussion is supplemented by analysis of international technology transfer activities involving Australian participation in the aerospace and…

  18. 2012 Gordon Research Conference, Electron donor-acceptor interactions, August 5-10 2012

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCusker, James

    The upcoming incarnation of the Gordon Research Conference on Electron Donor Acceptor Interactions will feature sessions on classic topics including proton-coupled electron transfer, dye-sensitized solar cells, and biological electron transfer, as well as emerging areas such as quantum coherence effects in donor-acceptor interactions, spintronics, and the application of donor-acceptor interactions in chemical synthesis.

  19. Vibronic coupling explains the ultrafast carotenoid-to-bacteriochlorophyll energy transfer in natural and artificial light harvesters

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perlík, Václav; Seibt, Joachim; Šanda, František

    The initial energy transfer steps in photosynthesis occur on ultrafast timescales. We analyze the carotenoid to bacteriochlorophyll energy transfer in LH2 Marichromatium purpuratum as well as in an artificial light-harvesting dyad system by using transient grating and two-dimensional electronic spectroscopy with 10 fs time resolution. We find that Förster-type models reproduce the experimentally observed 60 fs transfer times, but overestimate coupling constants, which lead to a disagreement with both linear absorption and electronic 2D-spectra. We show that a vibronic model, which treats carotenoid vibrations on both electronic ground and excited states as part of the system’s Hamiltonian, reproduces all measuredmore » quantities. Importantly, the vibronic model presented here can explain the fast energy transfer rates with only moderate coupling constants, which are in agreement with structure based calculations. Counterintuitively, the vibrational levels on the carotenoid electronic ground state play the central role in the excited state population transfer to bacteriochlorophyll; resonance between the donor-acceptor energy gap and the vibrational ground state energies is the physical basis of the ultrafast energy transfer rates in these systems.« less

  20. Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family.

    PubMed

    Garcia Costas, Amaya M; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J; Ledbetter, Rhesa N; Fixen, Kathryn R; Seefeldt, Lance C; Adams, Michael W W; Harwood, Caroline S; Boyd, Eric S; Peters, John W

    2017-11-01

    Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. Copyright © 2017 American Society for Microbiology.

  1. Defining Electron Bifurcation in the Electron-Transferring Flavoprotein Family

    PubMed Central

    Garcia Costas, Amaya M.; Poudel, Saroj; Miller, Anne-Frances; Schut, Gerrit J.; Ledbetter, Rhesa N.; Seefeldt, Lance C.; Adams, Michael W. W.

    2017-01-01

    ABSTRACT Electron bifurcation is the coupling of exergonic and endergonic redox reactions to simultaneously generate (or utilize) low- and high-potential electrons. It is the third recognized form of energy conservation in biology and was recently described for select electron-transferring flavoproteins (Etfs). Etfs are flavin-containing heterodimers best known for donating electrons derived from fatty acid and amino acid oxidation to an electron transfer respiratory chain via Etf-quinone oxidoreductase. Canonical examples contain a flavin adenine dinucleotide (FAD) that is involved in electron transfer, as well as a non-redox-active AMP. However, Etfs demonstrated to bifurcate electrons contain a second FAD in place of the AMP. To expand our understanding of the functional variety and metabolic significance of Etfs and to identify amino acid sequence motifs that potentially enable electron bifurcation, we compiled 1,314 Etf protein sequences from genome sequence databases and subjected them to informatic and structural analyses. Etfs were identified in diverse archaea and bacteria, and they clustered into five distinct well-supported groups, based on their amino acid sequences. Gene neighborhood analyses indicated that these Etf group designations largely correspond to putative differences in functionality. Etfs with the demonstrated ability to bifurcate were found to form one group, suggesting that distinct conserved amino acid sequence motifs enable this capability. Indeed, structural modeling and sequence alignments revealed that identifying residues occur in the NADH- and FAD-binding regions of bifurcating Etfs. Collectively, a new classification scheme for Etf proteins that delineates putative bifurcating versus nonbifurcating members is presented and suggests that Etf-mediated bifurcation is associated with surprisingly diverse enzymes. IMPORTANCE Electron bifurcation has recently been recognized as an electron transfer mechanism used by microorganisms to maximize energy conservation. Bifurcating enzymes couple thermodynamically unfavorable reactions with thermodynamically favorable reactions in an overall spontaneous process. Here we show that the electron-transferring flavoprotein (Etf) enzyme family exhibits far greater diversity than previously recognized, and we provide a phylogenetic analysis that clearly delineates bifurcating versus nonbifurcating members of this family. Structural modeling of proteins within these groups reveals key differences between the bifurcating and nonbifurcating Etfs. PMID:28808132

  2. Internal Temperature Control For Vibration Testers

    NASA Technical Reports Server (NTRS)

    Dean, Richard J.

    1996-01-01

    Vibration test fixtures with internal thermal-transfer capabilities developed. Made of aluminum for rapid thermal transfer. Small size gives rapid response to changing temperatures, with better thermal control. Setup quicker and internal ducting facilitates access to parts being tested. In addition, internal flows smaller, so less energy consumed in maintaining desired temperature settings.

  3. Screening of exciplex formation by distant electron transfer.

    PubMed

    Fedorenko, S G; Khokhlova, S S; Burshtein, A I

    2012-01-12

    The excitation quenching by reversible exciplex formation, combined with irreversible but distant electron transfer, is considered by means of the integral encounter theory (IET). Assuming that the quenchers are in great excess, the set of IET equations for the excitations, free ions, and exciplexes is derived. Solving these equations gives the Laplace images of all these populations, and these are used to specify the quantum yields of the corresponding reaction products. It appears that diffusion facilitates the exciplex production and the electron transfer. On the other hand the stronger the electron transfer is, the weaker is the exciplex production. At slow diffusion the distant quenching of excitations by ionization prevents their reaching the contact where they can turn into exciplexes. This is a screening effect that is most pronounced when the ionization rate is large.

  4. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Peters, K.S.; Freilich, S.C.; Schaeffer, C.G.

    Studies were initiated utilizing picosecond (ps) absorption spectroscopy, to directly monitor the dynamics of electron transfer from 1,4-diazabicyclo(2.2.2)octane (Dabco) to the excited states of benzophenone and fluorenone. These two systems were chosen because of their contrasting photochemistry. The quantum yield for photoreduction of benzophenone in polar solvents is generally greater than 0.1, while that of fluorenone is zero. In polar solvents, the proposed mechanism dictates that an electron is transferred to the excited singlet state fluorenone, which then back-transfers the electron, regenerating ground-state fluorenone and amine. Photolysis of benzophenone in the presence of an amine transfers an electron to anmore » excited triplet state, forming an ion pair that is stable relative to diffusional separation. The results of this study verify this proposal.« less

  5. Tuning of quantum entanglement in molecular quantum cellular automata based on mixed-valence tetrameric units.

    PubMed

    Palii, Andrew; Tsukerblat, Boris

    2016-10-25

    In this article we consider two coupled tetrameric mixed-valence (MV) units accommodating electron pairs, which play the role of cells in molecular quantum cellular automata. It is supposed that the Coulombic interaction between instantly localized electrons within the cell markedly inhibits the transfer processes between the redox centers. Under this condition, as well as due to the vibronic localization of the electron pair, the cell can encode binary information, which is controlled by neighboring cells. We show that under certain conditions the two low-lying vibronic spin levels of the cell (ground and first excited states) can be regarded as originating from an effective spin-spin interaction. This is shown to depend on the internal parameters of the cell as well as on the induced polarization. Within this simplified two-level picture we evaluate the quantum entanglement in the system represented by the two electrons in the cell and show how the entanglement within the cell and concurrence can be controlled via polarization of the neighboring cells and temperature.

  6. Electron Acceleration and Efficiency in Nonthermal Gamma-Ray Sources

    NASA Astrophysics Data System (ADS)

    Bykov, A. M.; Meszaros, P.

    1996-04-01

    In energetic nonthermal sources such as gamma-ray bursts, active galactic nuclei, or galactic jets, etc., one expects both relativistic and transrelativistic shocks accompanied by violent motions of moderately relativistic plasma. We present general considerations indicating that these sites are electron and positron accelerators leading to a modified power-law spectrum. The electron (or e+/-) energy index is very hard, ~ gamma -1 or flatter, up to a comoving frame break energy gamma *, and becomes steeper above that. In the example of gamma-ray bursts, the Lorentz factor reaches gamma * ~ 103 for e+/- accelerated by the internal shock ensemble on subhydrodynamical timescales. For pairs accelerated on hydrodynamical timescales in the external shocks, similar hard spectra are obtained, and the break Lorentz factor can be as high as gamma * <~ 105. Radiation from the nonthermal electrons produces photon spectra with shapes and characteristic energies in qualitative agreement with observed generic gamma-ray burst and blazar spectra. The scenario described here provides a plausible way to solve one of the crucial problems of nonthermal high-energy sources, namely, the efficient transfer of energy from the proton flow to an appropriate nonthermal lepton component.

  7. Cryogenic coherent X-ray diffraction imaging of biological samples at SACLA: a correlative approach with cryo-electron and light microscopy.

    PubMed

    Takayama, Yuki; Yonekura, Koji

    2016-03-01

    Coherent X-ray diffraction imaging at cryogenic temperature (cryo-CXDI) allows the analysis of internal structures of unstained, non-crystalline, whole biological samples in micrometre to sub-micrometre dimensions. Targets include cells and cell organelles. This approach involves preparing frozen-hydrated samples under controlled humidity, transferring the samples to a cryo-stage inside a vacuum chamber of a diffractometer, and then exposing the samples to coherent X-rays. Since 2012, cryo-coherent diffraction imaging (CDI) experiments have been carried out with the X-ray free-electron laser (XFEL) at the SPring-8 Ångstrom Compact free-electron LAser (SACLA) facility in Japan. Complementary use of cryo-electron microscopy and/or light microscopy is highly beneficial for both pre-checking samples and studying the integrity or nature of the sample. This article reports the authors' experience in cryo-XFEL-CDI of biological cells and organelles at SACLA, and describes an attempt towards reliable and higher-resolution reconstructions, including signal enhancement with strong scatterers and Patterson-search phasing.

  8. Experimental studies of fundamental issues in electron transfer through nanometer scale devices

    NASA Astrophysics Data System (ADS)

    Yamamoto, Hiromichi

    Electron transfer reactions constitute many of the primary events in materials science, chemistry, physics, and biochemistry, e.g. the electron transport properties and photoexcited processes in solids and molecules, chemical reactions, corrosion, photosynthesis, respiration, and so forth. A self-assembled monolayer (SAM) film provides us with a unique environment not only to understand and manipulate the surface electronic properties of a solid, but also to control electron transfer processes at the interface. The first topic in this thesis describes the structure and electron tunneling characterization of alkanethiol SAMs on InP(100). Angle-resolved X-ray photoelectron spectroscopy was used to characterize the bonding of alkanethiols to n-InP surfaces and to measure the monolayer thickness. The results showed that the sulfur binds to In atoms on the surface, and provided film thicknesses of 6.4 A for C8H17SH, 11.1 A for C12H25SH, and 14.9 A for C16H 33SH, resulting in an average tilt angle of 55°. The analysis indicated that super-exchange coupling between the alkane chains plays an important role in defining electron tunneling barriers, especially for highly tilted chains. The second topic describes studies of cytochrome c bound to pure and mixed SAMs of o-terminated alkanethiol (terminated with pyridine, imidazole or nitrile groups) and alkanethiol on gold. Electrochemical methods are used to determine electron transfer rate constants of cytochrome c, and scanning tunneling microscopy to observe the cytochrome c on the SAM. Detailed analysis revealed direct association of the heme of cytochrome c with the terminal groups of the SAMs and a 'turning-over' of the electron transfer of cytochrome c from adiabatic to non-adiabatic regime. The third topic describes studies of oxidation and reduction of cytochrome c in solution through eleven different self-assembled monolayers (SAMs) on gold electrodes by cyclic voltammetry. Electron transfer rate constants of cytochrome c through the eleven SAMs ranged from ≤10-4 to ˜10-1 cm/sec. A strong correlation between the electron transfer rate constants and the hydrogen bonding ability of the SAM is identified. This correlation is discussed in terms of the dependence of the rate constant on the outer-sphere reorganization energy and the electronic coupling between the cytochrome and the differently terminated monolayer films.

  9. Single-molecule interfacial electron transfer dynamics in solar energy conversion

    NASA Astrophysics Data System (ADS)

    Dhital, Bharat

    This dissertation work investigated the parameters affecting the interfacial electron transfer (ET) dynamics in dye-semiconductor nanoparticles (NPs) system by using single-molecule fluorescence spectroscopy and imaging combined with electrochemistry. The influence of the molecule-substrate electronic coupling, the molecular structure, binding geometry on the surface and the molecule-attachment surface chemistry on interfacial charge transfer processes was studied on zinc porphyrin-TiO2 NP systems. The fluorescence blinking measurement on TiO2 NP demonstrated that electronic coupling regulates dynamics of charge transfer processes at the interface depending on the conformation of molecule on the surface. Moreover, semiconductor surface charge induced electronic coupling of molecule which is electrostatically adsorbed on the semiconductor surface also predominantly alters the ET dynamics. Furthermore, interfacial electric field and electron accepting state density dependent ET dynamics has been dissected in zinc porphyrin-TiO2 NP system by observing the single-molecule fluorescence blinking dynamics and fluorescence lifetime with and without applied bias. The significant difference in fluorescence fluctuation and lifetime suggested the modulation of charge transfer dynamics at the interface with external electric field perturbation. Quasi-continuous distribution of fluorescence intensity with applied negative potential was attributed to the faster charge recombination due to reduced density of electron accepting states. The driving force and electron accepting state density ET dependent dynamics has also been probed in zinc porphyrin-TiO2 NP and zinc porphyrin-indium tin oxide (ITO) systems. Study of a molecule adsorbed on two different semiconductors (ITO and TiO2), with large difference in electron densities and distinct driving forces, allows us to observe the changes in rates of back electron transfer process reflected by the suppressed fluorescence blinking of molecule on ITO surface. Finally, the electric field effect on the interface properties has been probed by using surface-enhanced Raman spectroscopy and supported by density functional theory calculations in alizarin-TiO2 system. The perturbation, created by the external potential, has been observed to cause a shift and/or splitting interfacial bond vibrational mode, typical indicator of the coupling energy changes between alizarin and TiO2. Such splitting provides evidence for electric field-dependent electronic coupling changes that have a significant impact on the interfacial electron transfer dynamics.

  10. Laser photolysis studies of the phenolic H-atom transfer mechanism for a triplet π,π ∗ ketone in solution revisited

    NASA Astrophysics Data System (ADS)

    Yamaji, Minoru; Aoyama, Yutaka; Furukawa, Takashi; Itoh, Takao; Tobita, Seiji

    2006-03-01

    The mechanism of the H-atom transfer from phenols or thiophenols to triplet π,π ∗ 5,12-naphthacenequinone (5,12-NQ) has been examined by means of laser flash photolysis at 295 K. Based on the Hammett plots and the Rehm-Weller equation for the quenching rate constants, the phenolic H-atom transfer from phenols or thiophenols to triplet π,π ∗ 5,12-NQ is shown to proceed via the electron transfer followed by proton transfer. The previously proposed mechanism for H-atom transfer of π,π ∗ triplets, that proton transfer is followed by electron transfer, was not verified in the present systems.

  11. Fragment-based Quantum Mechanical/Molecular Mechanical Simulations of Thermodynamic and Kinetic Process of the Ru2+-Ru3+ Self-Exchange Electron Transfer.

    PubMed

    Zeng, Xiancheng; Hu, Xiangqian; Yang, Weitao

    2012-12-11

    A fragment-based fractional number of electron (FNE) approach, is developed to study entire electron transfer (ET) processes from the electron donor region to the acceptor region in condensed phase. Both regions are described by the density-fragment interaction (DFI) method while FNE as an efficient ET order parameter is applied to simulate the electron transfer process. In association with the QM/MM energy expression, the DFI-FNE method is demonstrated to describe ET processes robustly with the Ru 2+ -Ru 3+ self-exchange ET as a proof-of-concept example. This method allows for systematic calculations of redox free energies, reorganization energies, and electronic couplings, and the absolute ET rate constants within the Marcus regime.

  12. Efficient algorithms for the simulation of non-adiabatic electron transfer in complex molecular systems: application to DNA.

    PubMed

    Kubař, Tomáš; Elstner, Marcus

    2013-04-28

    In this work, a fragment-orbital density functional theory-based method is combined with two different non-adiabatic schemes for the propagation of the electronic degrees of freedom. This allows us to perform unbiased simulations of electron transfer processes in complex media, and the computational scheme is applied to the transfer of a hole in solvated DNA. It turns out that the mean-field approach, where the wave function of the hole is driven into a superposition of adiabatic states, leads to over-delocalization of the hole charge. This problem is avoided using a surface hopping scheme, resulting in a smaller rate of hole transfer. The method is highly efficient due to the on-the-fly computation of the coarse-grained DFT Hamiltonian for the nucleobases, which is coupled to the environment using a QM/MM approach. The computational efficiency and partial parallel character of the methodology make it possible to simulate electron transfer in systems of relevant biochemical size on a nanosecond time scale. Since standard non-polarizable force fields are applied in the molecular-mechanics part of the calculation, a simple scaling scheme was introduced into the electrostatic potential in order to simulate the effect of electronic polarization. It is shown that electronic polarization has an important effect on the features of charge transfer. The methodology is applied to two kinds of DNA sequences, illustrating the features of transfer along a flat energy landscape as well as over an energy barrier. The performance and relative merit of the mean-field scheme and the surface hopping for this application are discussed.

  13. 77 FR 50146 - Agency Information Collection Activities: Extension, With Change, of an Existing Information...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-20

    ... Request ACTION: 60-day notice of information collection; 10-002; Electronic Funds Transfer Waiver Request... appropriate automated, electronic, mechanical, or other technological collection techniques or other forms of.... (2) Title of the Form/Collection: Electronic Funds Transfer Waiver Request. (3) Agency form number...

  14. Group transfer and electron transfer reactions of organometallic complexes

    NASA Astrophysics Data System (ADS)

    Atwood, Jim D.

    During 1994, despite the disruptions, the authors have made progress in several aspects of their research on electron transfer reactions between organometallic complexes. This summary covers three areas that are relatively complete: (1) reactions between metal carbonyl anions and metal carbonyl halides, (2) reactions of hydrido- and alkyl-containing anions (RFe(CO)4(-) and RW(CO)5(-) with metal carbonyl cations; and (3) reactions of a seventeen-electron complex (Cp* Cr(CO)3*) with metal carbonyl derivatives. Two areas of examination that have just begun (possible carbene transfer and the possible role of metal carbonyl anions in carbon-hydrogen bond activation) will also be described.

  15. Tuning of Hemes b Equilibrium Redox Potential Is Not Required for Cross-Membrane Electron Transfer.

    PubMed

    Pintscher, Sebastian; Kuleta, Patryk; Cieluch, Ewelina; Borek, Arkadiusz; Sarewicz, Marcin; Osyczka, Artur

    2016-03-25

    In biological energy conversion, cross-membrane electron transfer often involves an assembly of two hemesb The hemes display a large difference in redox midpoint potentials (ΔEm_b), which in several proteins is assumed to facilitate cross-membrane electron transfer and overcome a barrier of membrane potential. Here we challenge this assumption reporting on hemebligand mutants of cytochromebc1in which, for the first time in transmembrane cytochrome, one natural histidine has been replaced by lysine without loss of the native low spin type of heme iron. With these mutants we show that ΔEm_b can be markedly increased, and the redox potential of one of the hemes can stay above the level of quinone pool, or ΔEm_b can be markedly decreased to the point that two hemes are almost isopotential, yet the enzyme retains catalytically competent electron transfer between quinone binding sites and remains functionalin vivo This reveals that cytochromebc1can accommodate large changes in ΔEm_b without hampering catalysis, as long as these changes do not impose overly endergonic steps on downhill electron transfer from substrate to product. We propose that hemesbin this cytochrome and in other membranous cytochromesbact as electronic connectors for the catalytic sites with no fine tuning in ΔEm_b required for efficient cross-membrane electron transfer. We link this concept with a natural flexibility in occurrence of several thermodynamic configurations of the direction of electron flow and the direction of the gradient of potential in relation to the vector of the electric membrane potential. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Estimates of electronic coupling for excess electron transfer in DNA

    NASA Astrophysics Data System (ADS)

    Voityuk, Alexander A.

    2005-07-01

    Electronic coupling Vda is one of the key parameters that determine the rate of charge transfer through DNA. While there have been several computational studies of Vda for hole transfer, estimates of electronic couplings for excess electron transfer (ET) in DNA remain unavailable. In the paper, an efficient strategy is established for calculating the ET matrix elements between base pairs in a π stack. Two approaches are considered. First, we employ the diabatic-state (DS) method in which donor and acceptor are represented with radical anions of the canonical base pairs adenine-thymine (AT) and guanine-cytosine (GC). In this approach, similar values of Vda are obtained with the standard 6-31G* and extended 6-31++G** basis sets. Second, the electronic couplings are derived from lowest unoccupied molecular orbitals (LUMOs) of neutral systems by using the generalized Mulliken-Hush or fragment charge methods. Because the radical-anion states of AT and GC are well reproduced by LUMOs of the neutral base pairs calculated without diffuse functions, the estimated values of Vda are in good agreement with the couplings obtained for radical-anion states using the DS method. However, when the calculation of a neutral stack is carried out with diffuse functions, LUMOs of the system exhibit the dipole-bound character and cannot be used for estimating electronic couplings. Our calculations suggest that the ET matrix elements Vda for models containing intrastrand thymine and cytosine bases are essentially larger than the couplings in complexes with interstrand pyrimidine bases. The matrix elements for excess electron transfer are found to be considerably smaller than the corresponding values for hole transfer and to be very responsive to structural changes in a DNA stack.

  17. Monitoring the Reaction Process During the S2 → S3 Transition in Photosynthetic Water Oxidation Using Time-Resolved Infrared Spectroscopy.

    PubMed

    Sakamoto, Hiroki; Shimizu, Tatsuki; Nagao, Ryo; Noguchi, Takumi

    2017-02-08

    Photosynthetic water oxidation performed at the Mn 4 CaO 5 cluster in photosystem II plays a crucial role in energy production as electron and proton sources necessary for CO 2 fixation. Molecular oxygen, a byproduct, is a source of the oxygenic atmosphere that sustains life on earth. However, the molecular mechanism of water oxidation is not yet well-understood. In the reaction cycle of intermediates called S states, the S 2 → S 3 transition is particularly important; it consists of multiple processes of electron transfer, proton release, and water insertion, and generates an intermediate leading to O-O bond formation. In this study, we monitored the reaction process during the S 2 → S 3 transition using time-resolved infrared spectroscopy to clarify its molecular mechanism. A change in the hydrogen-bond interaction of the oxidized Y Z • radical, an immediate electron acceptor of the Mn 4 CaO 5 cluster, was clearly observed as a ∼100 μs phase before the electron-transfer phase with a time constant of ∼350 μs. This observation provides strong experimental evidence that rearrangement of the hydrogen-bond network around Y Z • , possibly due to the movement of a water molecule located near Y Z • to the Mn site, takes place before the electron transfer. The electron transfer was coupled with proton release, as revealed by a relatively high deuterium kinetic isotope effect of 1.9. This proton release, which decreases the redox potential of the Mn 4 CaO 5 cluster to facilitate electron transfer to Y Z • , was proposed to determine, as a rate-limiting step, the relatively slow electron-transfer rate of the S 2 → S 3 transition.

  18. New electron-energy transfer rates for vibrational excitation of O2

    NASA Astrophysics Data System (ADS)

    Jones, D. B.; Campbell, L.; Bottema, M. J.; Brunger, M. J.

    2003-09-01

    We report on our computation of electron-energy transfer rates for vibrational excitation of O2. This work was necessitated by inadequacies in the electron-impact cross section databases employed in previous studies and, in one case, an inaccurate approximate formulation to the rate equation. Both these inadequacies led to incorrect energy transfer rates being published in the literature. We also demonstrate the importance of using cross sections that encompass an energy range that is extended enough to appropriately describe the environment under investigation.

  19. Transient alkylaminium radicals in n-hexane. Condensed-phase ion-molecule reactions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Werst, D.W.; Trifunac, A.D.

    Time-resolved fluorescence detected magnetic resonance (FDMR) is used to observe alkylaminium radicals formed in n-hexane solutions by electron pulse radiolysis. The ease of observation of aminium radical FDMR signals increases with increasing alkyl substitution of the amine solutes. The results are discussed in terms of the ion-molecule reactions, such as proton transfer, which compete with the electron-transfer processes, i.e, the electron transfer from solute molecules to n-hexane radical cations and geminate recombination.

  20. Ultrafast Charge Transfer of a Valence Double Hole in Glycine Driven Exclusively by Nuclear Motion

    NASA Astrophysics Data System (ADS)

    Li, Zheng; Vendrell, Oriol; Santra, Robin

    2015-10-01

    We explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K -shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we find that the double hole is transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. The nuclear displacements along specific vibrational modes are of the order of 15% of a typical chemical bond between carbon, oxygen, and nitrogen atoms and about 30% for bonds involving hydrogen atoms. The time required for the hole transfer corresponds to less than half a vibrational period of the involved nuclear modes. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. It also indicates that in x-ray imaging experiments, in which ionization is unavoidable, valence electron redistribution caused by nuclear dynamics might be much faster than previously anticipated. Thus, non-Born-Oppenheimer effects may affect the apparent electron densities extracted from such measurements.

  1. Ultrafast Charge Transfer of a Valence Double Hole in Glycine Driven Exclusively by Nuclear Motion.

    PubMed

    Li, Zheng; Vendrell, Oriol; Santra, Robin

    2015-10-02

    We explore theoretically the ultrafast transfer of a double electron hole between the functional groups of glycine after K-shell ionization and subsequent Auger decay. Although a large energy gap of about 15 eV initially exists between the two electronic states involved and coherent electronic dynamics play no role in the hole transfer, we find that the double hole is transferred within 3 to 4 fs between both functional ends of the glycine molecule driven solely by specific nuclear displacements and non-Born-Oppenheimer effects. The nuclear displacements along specific vibrational modes are of the order of 15% of a typical chemical bond between carbon, oxygen, and nitrogen atoms and about 30% for bonds involving hydrogen atoms. The time required for the hole transfer corresponds to less than half a vibrational period of the involved nuclear modes. This finding challenges the common wisdom that nuclear dynamics of the molecular skeleton are unimportant for charge transfer processes at the few-femtosecond time scale and shows that they can even play a prominent role. It also indicates that in x-ray imaging experiments, in which ionization is unavoidable, valence electron redistribution caused by nuclear dynamics might be much faster than previously anticipated. Thus, non-Born-Oppenheimer effects may affect the apparent electron densities extracted from such measurements.

  2. NASA/DOD Aerospace Knowledge Diffusion Research Project. Report 14: Engineering work and information use in aerospace: Results of a telephone survey

    NASA Technical Reports Server (NTRS)

    Pinelli, Thomas E.; Kennedy, John M.; White, Terry F.

    1992-01-01

    A telephone survey of U.S. aerospace engineers and scientists who were on the Society of Automotive Engineers (SAE) mailing list was conducted between August 14-26, 1991. The survey was undertaken to obtain information on the daily work activities of aerospace engineers and scientists, to measure various practices used by aerospace engineers and scientists to obtain STI, and to ask aerospace engineers and scientists about their use of electronic networks. Co-workers were found important sources of information. Co-workers are used to obtain technical information because the information they have is relevant, not because co-workers are accessible. As technical uncertainty increases, so does the need for information internal and external to the organization. Electronic networks enjoy widespread use within the aerospace community. These networks are accessible and they are used to contact people at remote sites. About 80 percent of the respondents used electronic mail, file transfer, and information or data retrieval to commercial or in-house data bases.

  3. Multiple hydrogen bonding in excited states of aminopyrazine in methanol solution: time-dependent density functional theory study.

    PubMed

    Chai, Shuo; Yu, Jie; Han, Yong-Chang; Cong, Shu-Lin

    2013-11-01

    Aminopyrazine (AP) and AP-methanol complexes have been theoretically studied by using density functional theory (DFT) and time-dependent density functional theory (TDDFT). The excited-state hydrogen bonds are discussed in detail. In the ground state the intermolecular multiple hydrogen bonds can be formed between AP molecule and protic solvents. The AP monomer and hydrogen-bonded complex of AP with one methanol are photoexcited initially to the S2 state, and then transferred to the S1 state via internal conversion. However the complex of AP with two methanol molecules is directly excited to the S1 state. From the calculated electronic excited energies and simulated absorption spectra, we find that the intermolecular hydrogen bonds are strengthened in the electronic excited states. The strengthening is confirmed by the optimized excited-state geometries. The photochemical processes in the electronic excited states are significantly influenced by the excited-state hydrogen bond strengthening. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. A structural route to tuning the orbital structure of nickelates

    NASA Astrophysics Data System (ADS)

    Kumah, Divine; Disa, Ankit; Malashevich, Andrei; Chen, Hanghui; Ismail-Beigi, Sohrab; Walker, Fred; Ahn, Charles

    2014-03-01

    The rare-earth nickelates display a range of interesting magnetic and electronic phenomena arising from the strong coupling of the atomic-scale structural properties of these systems to the charge and orbital degrees of freedom. We report on modifying the orbital polarization in nickelate based heterostructures, motivated by the goal of emulating high-Tc cuprate behavior in the nickelates. Using a combination of synchrotron diffraction structural and spectroscopic characterization and first principles theory, we show how the design of a structure that splits the relative electronic occupation of Ni d x2-y2 and Ni d 3z2-r2 orbitals, is achieved in three-component heterostructures. These structures are comprised of LaTiO3/LaNiO3/LaAlO3 and are grown using molecular beam epitaxy. The key features of the theoretically proposed structure, including an internal polar field, a electron transfer from Ti to Ni, and a orbital polarization of the Ni-eg states, are experimentally studied.

  5. European X-Ray Free Electron Laser (EXFEL): local implications

    NASA Astrophysics Data System (ADS)

    Romaniuk, Ryszard S.

    2013-10-01

    European X-Ray FEL - free electron laser is under construction in DESY Hamburg. It is scheduled to be operational at 2015/16 at a cost more than 1 billion Euro. The laser uses SASE method to generate x-ray light. It is propelled by an electron linac of 17,5GeV energy and more than 2km in length. The linac uses superconducting SRF TESLA technology working at 1,3 GHz in frequency. The prototype of EXFEL is FLASH Laser (200 m in length), where the "proof of principle" was checked, and from the technologies were transferred to the bigger machine. The project was stared in the nineties by building a TTF Laboratory -Tesla Test Facility. The EXFEL laser is a child of a much bigger teraelectronovolt collider project TESLA (now abandoned in Germany but undertaken by international community in a form the ILC). A number of experts and young researchers from Poland participate in the design, construction and research of the FLASH and EXFEL lasers.

  6. Synthesis of a Neutral Mixed-Valence Diferrocenyl Carborane for Molecular Quantum-Dot Cellular Automata Applications.

    PubMed

    Christie, John A; Forrest, Ryan P; Corcelli, Steven A; Wasio, Natalie A; Quardokus, Rebecca C; Brown, Ryan; Kandel, S Alex; Lu, Yuhui; Lent, Craig S; Henderson, Kenneth W

    2015-12-14

    The preparation of 7-Fc(+) -8-Fc-7,8-nido-[C2 B9 H10 ](-) (Fc(+) FcC2 B9 (-) ) demonstrates the successful incorporation of a carborane cage as an internal counteranion bridging between ferrocene and ferrocenium units. This neutral mixed-valence Fe(II) /Fe(III) complex overcomes the proximal electronic bias imposed by external counterions, a practical limitation in the use of molecular switches. A combination of UV/Vis-NIR spectroscopic and TD-DFT computational studies indicate that electron transfer within Fc(+) FcC2 B9 (-) is achieved through a bridge-mediated mechanism. This electronic framework therefore provides the possibility of an all-neutral null state, a key requirement for the implementation of quantum-dot cellular automata (QCA) molecular computing. The adhesion, ordering, and characterization of Fc(+) FcC2 B9 (-) on Au(111) has been observed by scanning tunneling microscopy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. The development of silicon carbide-based power electronics devices

    NASA Astrophysics Data System (ADS)

    Hopkins, Richard H.; Perkins, John F.

    1995-01-01

    In 1989 Westinghouse created an internally funded initiative to develop silicon carbide materials and device technology for a variety of potential commercial and military applications. Westinghouse saw silicon carbide as having the potential for dual use. For space applications, size and weight reductions could be achieved, together with increased reliability. Terrestrially, uses in harsh-temperature environments would be enabled. Theoretically, the physical and electrical properties of silicon carbide were highly promising for high-power, high-temperature, radiation-hardened electronics. However, bulk material with the requisite electronic qualities was not available, and the methods needed to produce a silicon carbide wafer—to fabricate high-quality devices—and to transition these technologies into a commercial product were considered to be a high-risk investment. It was recognized that through a collaborative effort, the CCDS could provide scientific expertise in several areas, thus reducing this risk. These included modeling of structures, electrical contacts, dielectrics, and epitaxial growth. This collaboration has been very successful, with developed technologies being transferred to Westinghouse.

  8. Quasi-chemical theory of F-(aq): The "no split occupancies rule" revisited

    NASA Astrophysics Data System (ADS)

    Chaudhari, Mangesh I.; Rempe, Susan B.; Pratt, Lawrence R.

    2017-10-01

    We use ab initio molecular dynamics (AIMD) calculations and quasi-chemical theory (QCT) to study the inner-shell structure of F-(aq) and to evaluate that single-ion free energy under standard conditions. Following the "no split occupancies" rule, QCT calculations yield a free energy value of -101 kcal/mol under these conditions, in encouraging agreement with tabulated values (-111 kcal/mol). The AIMD calculations served only to guide the definition of an effective inner-shell constraint. QCT naturally includes quantum mechanical effects that can be concerning in more primitive calculations, including electronic polarizability and induction, electron density transfer, electron correlation, molecular/atomic cooperative interactions generally, molecular flexibility, and zero-point motion. No direct assessment of the contribution of dispersion contributions to the internal energies has been attempted here, however. We anticipate that other aqueous halide ions might be treated successfully with QCT, provided that the structure of the underlying statistical mechanical theory is absorbed, i.e., that the "no split occupancies" rule is recognized.

  9. 26 CFR 1.1015-3 - Gift or transfer in trust before January 1, 1921.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 26 Internal Revenue 11 2010-04-01 2010-04-01 true Gift or transfer in trust before January 1, 1921. 1.1015-3 Section 1.1015-3 Internal Revenue INTERNAL REVENUE SERVICE, DEPARTMENT OF THE TREASURY (CONTINUED) INCOME TAX (CONTINUED) INCOME TAXES Basis Rules of General Application § 1.1015-3 Gift or transfer in trust before January 1, 1921. (a) In...

  10. Cascading electron and hole transfer dynamics in a CdS/CdTe core-shell sensitized with bromo-pyrogallol red (Br-PGR): slow charge recombination in type II regime.

    PubMed

    Maity, Partha; Debnath, Tushar; Chopra, Uday; Ghosh, Hirendra Nath

    2015-02-14

    Ultrafast cascading hole and electron transfer dynamics have been demonstrated in a CdS/CdTe type II core-shell sensitized with Br-PGR using transient absorption spectroscopy and the charge recombination dynamics have been compared with those of CdS/Br-PGR composite materials. Steady state optical absorption studies suggest that Br-PGR forms strong charge transfer (CT) complexes with both the CdS QD and CdS/CdTe core-shell. Hole transfer from the photo-excited QD and QD core-shell to Br-PGR was confirmed by both steady state and time-resolved emission spectroscopy. Charge separation was also confirmed by detecting electrons in the conduction band of the QD and the cation radical of Br-PGR as measured from femtosecond transient absorption spectroscopy. Charge separation in the CdS/Br-PGR composite materials was found to take place in three different pathways, by transferring the photo-excited hole of CdS to Br-PGR, electron injection from the photo-excited Br-PGR to the CdS QD, and direct electron transfer from the HOMO of Br-PGR to the conduction band of the CdS QD. However, in the CdS/CdTe/Br-PGR system hole transfer from the photo-excited CdS to Br-PGR and electron injection from the photo-excited Br-PGR to CdS take place after cascading through the CdTe shell QD. Charge separation also takes place via direct electron transfer from the Br-PGR HOMO to the conduction band of CdS/CdTe. Charge recombination (CR) dynamics between the electron in the conduction band of the CdS QD and the Br-PGR cation radical were determined by monitoring the bleach recovery kinetics. The CR dynamics were found to be much slower in the CdS/CdTe/Br-PGR system than in the CdS/Br-PGR system. The formation of the strong CT complex and the separation of charges cascading through the CdTe shell help to slow down charge recombination in the type II regime.

  11. Time-resolved measurement of intramolecular photoinduced electron transfer processes in perylene diimides (Conference Presentation)

    NASA Astrophysics Data System (ADS)

    Döring, Robin Carl; Baal, Eduard; Sundermeyer, Jörg; Chatterjee, Sangam

    2017-02-01

    Perylene-3,4,9,10-tetracarboxylic acid (PTCDA) and respective derivatives (e.g. perylene diimide - PDI) are widely used as dyes but also for device applications such as organic field effect transistors or in organic photovoltaics. Due to their intrinsically high quantum efficiencies they are also used as spectroscopic standards. One major drawback of these materials is their low solubility in organic solvents which can be addressed by long alkyl substitutions. When introducing a tertiary amine into the molecule a mechanism known as photoinduced electron transfer (PET) can occur. Here, following an optically excited HOMO-LUMO transition of the core, an electron from the electron lone pair of the amine is transferred to the HOMO of the perylene core. Hence, radiative recombination is disallowed and photoluminescence effectively quenched. Here, we perform a systematic study of the distance dependence of the PET by introducing alkyle groups as spacer units between PDI core and the tertiary amine. Dynamics of the PET are extracted from ultrafast time-resolved photoluminescence measurement data. A rate equation model, simulating a three level system, reveals rate constant of the back electron transfer, otherwise not accessible with our experimental methods. Assuming a Marcus model of electron transfer, electronic coupling strength between the electronic states involved in the respective transitions can be calculated. In addition to the distance dependence, the effects of protonation and methylation of the the tertiary amine units are studied.

  12. Near field wireless power transfer using curved relay resonators for extended transfer distance

    NASA Astrophysics Data System (ADS)

    Zhu, D.; Clare, L.; Stark, B. H.; Beeby, S. P.

    2015-12-01

    This paper investigates the performance of a near field wireless power transfer system that uses curved relay resonator to extend transfer distance. Near field wireless power transfer operates based on the near-field electromagnetic coupling of coils. Such a system can transfer energy over a relatively short distance which is of the same order of dimensions of the coupled coils. The energy transfer distance can be increased using flat relay resonators. Recent developments in printing electronics and e-textiles have seen increasing demand of embedding electronics into fabrics. Near field wireless power transfer is one of the most promising methods to power electronics on fabrics. The concept can be applied to body-worn textiles by, for example, integrating a transmitter coil into upholstery, and a flexible receiver coil into garments. Flexible textile coils take on the shape of the supporting materials such as garments, and therefore curved resonator and receiver coils are investigated in this work. Experimental results showed that using curved relay resonator can effectively extend the wireless power transfer distance. However, as the curvature of the coil increases, the performance of the wireless power transfer, especially the maximum received power, deteriorates.

  13. Teleportation between distant qudits via scattering of mobile qubits

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ciccarello, Francesco; Zarcone, Michelangelo; Bose, Sougato

    2010-04-15

    We consider a one-dimensional structure where noninteracting spin-s scattering centers, such as quantum impurities or multilevel atoms, are embedded at given positions. We show that the injection into the structure of unpolarized flying qubits, such as electrons or photons, along with path detection suffice to accomplish spin-state teleportation between two centers via a third ancillary one. No action over the internal quantum state of both the spin-s particles and the flying qubits is required. The protocol enables the transfer of quantum information between well-separated static entities in nanostructures by exploiting a very low control mechanism, namely scattering.

  14. Conversion and origin of normal and abnormal temperature dependences of kinetic isotope effect in hydride transfer reactions.

    PubMed

    Zhu, Xiao-Qing; Li, Xiu-Tao; Han, Su-Hui; Mei, Lian-Rui

    2012-05-18

    The effects of substituents on the temperature dependences of kinetic isotope effect (KIE) for the reactions of the hydride transfer from the substituted 5-methyl-6-phenyl-5,6-dihydrophenanthridine (G-PDH) to thioxanthylium (TX(+)) in acetonitrile were examined, and the results show that the temperature dependences of KIE for the hydride transfer reactions can be converted by adjusting the nature of the substituents in the molecule of the hydride donor. In general, electron-withdrawing groups can make the KIE to have normal temperature dependence, but electron-donating groups can make the KIE to have abnormal temperature dependence. Thermodynamic analysis on the possible pathways of the hydride transfer from G-PDH to TX(+) in acetonitrile suggests that the transfers of the hydride anion in the reactions are all carried out by the concerted one-step mechanism whether the substituent is an electron-withdrawing group or an electron-donating group. But the examination of Hammett-type free energy analysis on the hydride transfer reactions supports that the concerted one-step hydride transfer is not due to an elementary chemical reaction. The experimental values of KIE at different temperatures for the hydride transfer reactions were modeled by using a kinetic equation formed according to a multistage mechanism of the hydride transfer including a returnable charge-transfer complex as the reaction intermediate; the real mechanism of the hydride transfer and the root that why the temperature dependences of KIE can be converted as the nature of the substituents are changed were discovered.

  15. Experimental exploration of the Mulliken-Hush relationship for intramolecular electron transfer reactions.

    PubMed

    Mukherjee, Tamal; Ito, Naoki; Gould, Ian R

    2011-03-17

    The Mulliken-Hush (M-H) relationship provides the critical link between optical and thermal electron transfer processes, and yet very little direct experimental support for its applicability has been provided. Dicyanovinylazaadamantane (DCVA) represents a simple two-state (neutral/charge-transfer) intramolecular electron transfer system that exhibits charge-transfer absorption and emission spectra that are readily measurable in solvents with a wide range of polarities. In this regard it represents an ideal model system for studying the factors that control both optical charge separation (absorption) and recombination (emission) processes in solution. Here we explore the applicability of the M-H relation to quantitative descriptions of the optical charge-transfer processes in DCVA. For DCVA, the measured radiative rate constants exhibit a linear dependence on transition energy, and transition dipole moments exhibit an inverse dependence on transition energy, consistent with the M-H relationship.

  16. Embryo transfer: a comparative biosecurity advantage in international movements of germplasm.

    PubMed

    Thibier, M

    2011-04-01

    This paper uses cattle as a model to provide an overview of the hazards involved in the transfer of in vivo-derived and in vitro-produced embryos. While scientific studies in recent decades have led to the identification of pathogens that may be associated with both in vivo- and in vitro-derived embryos, those studies have also been the basis of appropriate disease control measures to reduce the risks to a negligible level. These disease control measures have been identified and assessed by the International Embryo Transfer Society's (lETS) Health and Safety Advisory Committee, the expert body that advises the World Organisation for Animal Health (OIE) on matters related to the safety of embryo transfer. Through the OIE's processes for developing and adopting international standards, the disease control measures identified by the IETS have been incorporated into the Terrestrial Animal Health Code. The basic principles rely on the crucial ethical roles of the embryo collection team and embryo transfer team, under the leadership of approved veterinarians. Decades of experience, with nearly 10 million embryos transferred, have demonstrated the very significant biosecurity advantage that embryo transfer technology has when moving germplasm internationally, provided that the international standards developed by the IETS and adopted by the OIE are strictly followed.

  17. Metabolic spatial variability in electrode-respiring Geobacter sulfurreducens biofilms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Renslow, Ryan S.; Babauta, Jerome T.; Dohnalkova, Alice

    2013-06-01

    Certain bacteria are capable of transferring electrons derived from respiratory metabolism to solid extracellular electron-accepting materials1-4. This ability allows the organisms to use conductive substrata as their sole electron sink, generating electricity that is available for practical applications5-7. Geobacter is a biofilm-forming genus capable of this extracellular electron transfer8-11. Evidence in the literature suggests that Geobacter cells produce a conductive matrix to gain access to electron-accepting surfaces12,13. It has been hypothesized that cells that are more than tens of microns from the electron-accepting surface cannot respire because of electrical resistance in the matrix and thus remain metabolically inactive14-16. To testmore » this hypothesis, we sought to determine whether the entire biofilm remains metabolically active and able to respire on an electron-accepting surface as the biofilm thickness increases. We developed and used a novel electrochemical-nuclear magnetic resonance (EC-NMR) microimaging system capable of sustaining an electrochemically active biofilm on a polarized electrode inside a superconducting magnet, allowing for simultaneous NMR and electrochemical investigation of a biofilm for the first time. Here, we show that Geobacter biofilms can grow to several hundred microns thick while respiring on an electrode and that the top of the biofilm remains metabolically active. This is only possible if the cells near the top are able to transfer electrons through the initial biofilm matrix to the electrode. We used X-ray absorption spectroscopy to verify electron transfer to uranium ions by metabolically active cells near the top of the biofilm. Our results reveal that extracellular electron transfer is not prevented by electrical resistance, even when the biofilm is hundreds of microns thick. Furthermore, the electron donor may be the limiting factor for respiration and the base of the biofilm may be less active despite being in close proximity to the electrode. Long-range electron transfer across metabolically inactive regions within Geobacter biofilms adds a novel facet to our comprehension of electrochemically active biology.« less

  18. Electron impact cross-sections and cooling rates for methane. [in thermal balance of electrons in atmospheres and ionospheres of planets and satellites in outer solar system

    NASA Technical Reports Server (NTRS)

    Gan, L.; Cravens, T. E.

    1992-01-01

    Energy transfer between electrons and methane gas by collisional processes plays an important role in the thermal balance of electrons in the atmospheres and ionospheres of planets and satellites in the outer solar system. The literature is reviewed for electron impact cross-sections for methane in this paper. Energy transfer rates are calculated for elastic and inelastic processes using a Maxwellian electron distribution. Vibrational, rotational, and electronic excitation and ionization are included. Results are presented for a wide range of electron temperatures and neutral temperatures.

  19. Impact excitation and electron-hole multiplication in graphene and carbon nanotubes.

    PubMed

    Gabor, Nathaniel M

    2013-06-18

    In semiconductor photovoltaics, photoconversion efficiency is governed by a simple competition: the incident photon energy is either transferred to the crystal lattice (heat) or transferred to electrons. In conventional materials, energy loss to the lattice is more efficient than energy transferred to electrons, thus limiting the power conversion efficiency. Quantum electronic systems, such as quantum dots, nanowires, and two-dimensional electronic membranes, promise to tip the balance in this competition by simultaneously limiting energy transfer to the lattice and enhancing energy transfer to electrons. By exploring the optical, thermal, and electronic properties of quantum materials, we may perhaps find an ideal optoelectronic material that provides low cost fabrication, facile systems integration, and a means to surpass the standard limit for photoconversion efficiency. Nanoscale carbon materials, such as graphene and carbon nanotubes, provide ideal experimental quantum systems in which to explore optoelectronic behavior for applications in solar energy harvesting. Within essentially the same material, researchers can achieve a broad spectrum of energetic configurations, from a gapless semimetal to a large band-gap semiconducting nanowire. Owing to their nanoscale dimensions, graphene and carbon nanotubes exhibit electronic and optical properties that reflect strong electron-electron interactions. Such strong interactions may lead to exotic low-energy electron transport behavior and high-energy electron scattering processes such as impact excitation and the inverse process of Auger recombination. High-energy processes, which become very important under photoexcitation, may be particularly efficient in nanoscale carbon materials due to the relativistic-like, charged particle band structure and sensitivity to the dielectric environment. In addition, due to the covalently bonded carbon framework that makes up these materials, electron-phonon coupling is very weak. In carbon nanomaterials, strong electron-electron interactions combined with weak electron-phonon interactions results in excellent optical, thermal and electronic properties, the exploration of which promises to reveal fundamentally new physical processes and deliver advanced nanotechnologies. In this Account, we review the results of novel optoelectronic experiments that explore the intrinsic photoresponse of carbon nanomaterials integrated into nanoscale devices. By fabricating gate voltage-controlled photodetectors composed of atomically thin sheets of graphene and individual carbon nanotubes, we are able to fully explore electron transport in these systems under optical illumination. We find that strong electron-electron interactions play a key role in the intrinsic photoresponse of both materials, as evidenced by hot carrier transport in graphene and highly efficient multiple electron-hole pair generation in nanotubes. In both of these quantum systems, photoexcitation leads to high-energy electron-hole pairs that relax energy predominantly into the electronic system, rather than heating the lattice. Due to highly efficient energy transfer from photons into electrons, graphene and carbon nanotubes may be ideal materials for solar energy harvesting devices with efficiencies that could exceed the Shockley-Queisser limit.

  20. Making Sense of Rocket Science - Building NASA's Knowledge Management Program

    NASA Technical Reports Server (NTRS)

    Holm, Jeanne

    2002-01-01

    The National Aeronautics and Space Administration (NASA) has launched a range of KM activities-from deploying intelligent "know-bots" across millions of electronic sources to ensuring tacit knowledge is transferred across generations. The strategy and implementation focuses on managing NASA's wealth of explicit knowledge, enabling remote collaboration for international teams, and enhancing capture of the key knowledge of the workforce. An in-depth view of the work being done at the Jet Propulsion Laboratory (JPL) shows the integration of academic studies and practical applications to architect, develop, and deploy KM systems in the areas of document management, electronic archives, information lifecycles, authoring environments, enterprise information portals, search engines, experts directories, collaborative tools, and in-process decision capture. These systems, together, comprise JPL's architecture to capture, organize, store, and distribute key learnings for the U.S. exploration of space.

Top