Molecular Cloning, Characterization, and Differential Expression of a Glucoamylase Gene from the Basidiomycetous Fungus Lentinula edodes

PubMed Central

Zhao, J.; Chen, Y. H.; Kwan, H. S.

2000-01-01

The complete nucleotide sequence of putative glucoamylase gene gla1 from the basidiomycetous fungus Lentinula edodes strain L54 is reported. The coding region of the genomic glucoamylase sequence, which is preceded by eukaryotic promoter elements CAAT and TATA, spans 2,076 bp. The gla1 gene sequence codes for a putative polypeptide of 571 amino acids and is interrupted by seven introns. The open reading frame sequence of the gla1 gene shows strong homology with those of other fungal glucoamylase genes and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The similarity between the Gla1 protein and other fungal glucoamylases is from 45 to 61%, with the region of highest conservation found in catalytic domains and starch-binding domains. We compared the kinetics of glucoamylase activity and levels of gene expression in L. edodes strain L54 grown on different carbon sources (glucose, starch, cellulose, and potato extract) and in various developmental stages (mycelium growth, primordium appearance, and fruiting body formation). Quantitative reverse transcription PCR utilizing pairs of primers specific for gla1 gene expression shows that expression of gla1 was induced by starch and increased during the process of fruiting body formation, which indicates that glucoamylases may play an important role in the morphogenesis of the basidiomycetous fungus. PMID:10831434

Molecular control of copper homeostasis in filamentous fungi: increased expression of a metallothionein gene during aging of Podospora anserina.

PubMed

Averbeck, N B; Borghouts, C; Hamann, A; Specke, V; Osiewacz, H D

2001-01-01

The lifespan of the ascomycete Podospora anserina was previously demonstrated to be significantly increased in a copper-uptake mutant, suggesting that copper is a potential stressor involved in degenerative processes. In order to determine whether changes in copper stress occur in the cells during normal aging of cultures, we cloned and characterized a gene coding for a component of the molecular machinery involved in the control of copper homeostasis. This gene, PaMt1, is a single-copy gene that encodes a metallothionein of 26 amino acids. The coding sequence of PaMt1 is interrupted by a single intron. The deduced amino acid sequence shows a high degree of sequence identity to metallothioneins of the filamentous ascomycete Neurospora crassa and the basidiomycete Agaricus bisporus, and to the N-terminal portion of mammalian metallothioneins. Levels of PaMt1 transcript increase in response to elevated amounts of copper in the growth medium and during aging of wild-type cultures. In contrast, in the long-lived mutant grisea, transcript levels first increase but then decrease again. The ability of wild-type cultures to respond to exogenous copper stress via the induction of PaMt1 transcription is not affected as they grow older.

Chemical and UV Mutagenesis.

PubMed

Bose, Jeffrey L

2016-01-01

The ability to create mutations is an important step towards understanding bacterial physiology and virulence. While targeted approaches are invaluable, the ability to produce genome-wide random mutations can lead to crucial discoveries. Transposon mutagenesis is a useful approach, but many interesting mutations can be missed by these insertions that interrupt coding and noncoding sequences due to the integration of an entire transposon. Chemical mutagenesis and UV-based random mutagenesis are alternate approaches to isolate mutations of interest with the potential of only single nucleotide changes. Once a standard method, difficulty in identifying mutation sites had decreased the popularity of this technique. However, thanks to the recent emergence of economical whole-genome sequencing, this approach to making mutations can once again become a viable option. Therefore, this chapter provides an overview protocol for random mutagenesis using UV light or DNA-damaging chemicals.

Interruptions in emergency medicine: things are not always what they seem.

PubMed

Walter, Scott R

2018-06-20

We have all felt the cognitive disjuncture of being interrupted during an important task. Most ED physicians will readily proffer the high frequency and/or burden of interruptions during their work, and of the many observational studies of interruptions in healthcare EDs do indeed have high interruption rates[2]. In experimental psychology, where many of these ideas originated, there is plenty of evidence that interruptions negatively affect performance. Interruptions have been associated with reduced performance on complex tasks[3,4], increased sequence errors[5], increased task completion time and augmented annoyance and anxiety[6]. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Localization, structure and polymorphism of two paralogous Xenopus laevis mitochondrial malate dehydrogenase genes.

PubMed

Tlapakova, Tereza; Krylov, Vladimir; Macha, Jaroslav

2005-01-01

Two paralogous mitochondrial malate dehydrogenase 2 (Mdh2) genes of Xenopus laevis have been cloned and sequenced, revealing 95% identity. Fluorescence in-situ hybridization (FISH) combined with tyramide amplification discriminates both genes; Mdh2a was localized into chromosome q3 and Mdh2b into chromosome q8. One kb cDNA probes detect both genes with 85% accuracy. The remaining signals were on the paralogous counterpart. Introns interrupt coding sequences at the same nucleotide as defined for mouse. Restriction polymorphism has been detected in the first intron of Mdh2a, while the individual variability in intron 6 of Mdh2b gene is represented by an insertion of incomplete retrotransposon L1Xl. Rates of nucleotide substitutions indicate that both genes are under similar evolutionary constraints. X. laevis Mdh2 genes can be used as markers for physical mapping and linkage analysis.

Instability of expanded CAG/CAA repeats in spinocerebellar ataxia type 17.

PubMed

Gao, Rui; Matsuura, Tohru; Coolbaugh, Mary; Zühlke, Christine; Nakamura, Koichiro; Rasmussen, Astrid; Siciliano, Michael J; Ashizawa, Tetsuo; Lin, Xi

2008-02-01

Trinucleotide repeat expansions are dynamic mutations causing many neurological disorders, and their instability is influenced by multiple factors. Repeat configuration seems particularly important, and pure repeats are thought to be more unstable than interrupted repeats. But direct evidence is still lacking. Here, we presented strong support for this hypothesis from our studies on spinocerebellar ataxia type 17 (SCA17). SCA17 is a typical polyglutamine disease caused by CAG repeat expansion in TBP (TATA binding protein), and is unique in that the pure expanded polyglutamine tract is coded by either a simple configuration with long stretches of pure CAGs or a complex configuration containing CAA interruptions. By small pool PCR (SP-PCR) analysis of blood DNA from SCA17 patients of distinct racial backgrounds, we quantitatively assessed the instability of these two types of expanded alleles coding similar length of polyglutamine expansion. Mutation frequency in patients harboring pure CAG repeats is 2-3 folds of those with CAA interruptions. Interestingly, the pure CAG repeats showed both expansion and deletion while the interrupted repeats exhibited mostly deletion at a significantly lower frequency. These data strongly suggest that repeat configuration is a critical determinant for instability, and CAA interruptions might serve as a limiting element for further expansion of CAG repeats in SCA17 locus, suggesting a molecular basis for lack of anticipation in SCA17 families with interrupted CAG expansion.

Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential

PubMed Central

Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael

2013-01-01

Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328

Disruption of Neurexin 1 Associated with Autism Spectrum Disorder

PubMed Central

Kim, Hyung-Goo; Kishikawa, Shotaro; Higgins, Anne W.; Seong, Ihn-Sik; Donovan, Diana J.; Shen, Yiping; Lally, Eric; Weiss, Lauren A.; Najm, Juliane; Kutsche, Kerstin; Descartes, Maria; Holt, Lynn; Braddock, Stephen; Troxell, Robin; Kaplan, Lee; Volkmar, Fred; Klin, Ami; Tsatsanis, Katherine; Harris, David J.; Noens, Ilse; Pauls, David L.; Daly, Mark J.; MacDonald, Marcy E.; Morton, Cynthia C.; Quade, Bradley J.; Gusella, James F.

2008-01-01

Autism is a neurodevelopmental disorder of complex etiology in which genetic factors play a major role. We have implicated the neurexin 1 (NRXN1) gene in two independent subjects who display an autism spectrum disorder (ASD) in association with a balanced chromosomal abnormality involving 2p16.3. In the first, with karyotype 46,XX,ins(16;2)(q22.1;p16.1p16.3)pat, NRXN1 is directly disrupted within intron 5. Importantly, the father possesses the same chromosomal abnormality in the absence of ASD, indicating that the interruption of α-NRXN1 is not fully penetrant and must interact with other factors to produce ASD. The breakpoint in the second subject, with 46,XY,t(1;2)(q31.3;p16.3)dn, occurs ∼750 kb 5′ to NRXN1 within a 2.6 Mb genomic segment that harbors no currently annotated genes. A scan of the NRXN1 coding sequence in a cohort of ASD subjects, relative to non-ASD controls, revealed that amino acid alterations in neurexin 1 are not present at high frequency in ASD. However, a number of rare sequence variants in the coding region, including two missense changes in conserved residues of the α-neurexin 1 leader sequence and of an epidermal growth factor (EGF)-like domain, respectively, suggest that even subtle changes in NRXN1 might contribute to susceptibility to ASD. PMID:18179900

On Why It Is Impossible to Prove that the BDX90 Dispatcher Implements a Time-sharing System

NASA Technical Reports Server (NTRS)

Boyer, R. S.; Moore, J. S.

1983-01-01

The Software Implemented Fault Tolerance SIFT system, is written in PASCAL except for about a page of machine code. The SIFT system implements a small time sharing system in which PASCAL programs for separate application tasks are executed according to a schedule with real time constraints. The PASCAL language has no provision for handling the notion of an interrupt such as the B930 clock interrupt. The PASCAL language also lacks the notion of running a PASCAL subroutine for a given amount of time, suspending it, saving away the suspension, and later activating the suspension. Machine code was used to overcome these inadequacies of PASCAL. Code which handles clock interrupts and suspends processes is called a dispatcher. The time sharing/virtual machine idea is completely destroyed by the reconfiguration task. After termination of the reconfiguration task, the tasks run by the dispatcher have no relation to those run before reconfiguration. It is impossible to view the dispatcher as a time-sharing system implementing virtual BDX930s running concurrently when one process can wipe out the others.

Demonstration program for Omega receiver prototype microcomputer data processing

NASA Technical Reports Server (NTRS)

Lilley, R. W.

1976-01-01

The JOLT (TM) commercial microcomputer, based on the MOS Technology 6502 processor chip, for use in Omega navigation system is evaluated. A computer program was prepared in hand-assembled code to demonstrate receiver operation. The processor provides binary processing with interrupts enabled, a carriage return is given to initialize the teleprinter, and a jump is performed to enter the program loop to wait for an interrupt. The program loop operates continuously testing the interrupt flag. The interrupt routine reads the receiver status word and determines whether the current time-slot is the A slot. If so, the interrupt flag, which is also the data index pointer, is reset to zero. The status word is stored in the status buffer. If the time-slot is not A, the interrupt flag/pointer is incremented by one to index the phase and status to the proper buffer words for later use by the print routine.

Method of inactivation of an end product of energy metabolism in Zymomonas mobilis

DOEpatents

Zhang, Min [Lakewood, CO; Chou, Yat-Chen [Lakewood, CO

2008-05-20

The present invention briefly provides a method of site-specific insertion in Zymomonas, comprising, providing a Zymomonas gene fragment, interrupting a DNA sequence the fragment, and transforming the Zymomonas through homologous recombination with the interrupted fragment.

PolyQ repeat expansions in ATXN2 associated with ALS are CAA interrupted repeats.

PubMed

Yu, Zhenming; Zhu, Yongqing; Chen-Plotkin, Alice S; Clay-Falcone, Dana; McCluskey, Leo; Elman, Lauren; Kalb, Robert G; Trojanowski, John Q; Lee, Virginia M-Y; Van Deerlin, Vivianna M; Gitler, Aaron D; Bonini, Nancy M

2011-03-29

Amyotrophic lateral sclerosis (ALS) is a devastating, rapidly progressive disease leading to paralysis and death. Recently, intermediate length polyglutamine (polyQ) repeats of 27-33 in ATAXIN-2 (ATXN2), encoding the ATXN2 protein, were found to increase risk for ALS. In ATXN2, polyQ expansions of ≥ 34, which are pure CAG repeat expansions, cause spinocerebellar ataxia type 2. However, similar length expansions that are interrupted with other codons, can present atypically with parkinsonism, suggesting that configuration of the repeat sequence plays an important role in disease manifestation in ATXN2 polyQ expansion diseases. Here we determined whether the expansions in ATXN2 associated with ALS were pure or interrupted CAG repeats, and defined single nucleotide polymorphisms (SNPs) rs695871 and rs695872 in exon 1 of the gene, to assess haplotype association. We found that the expanded repeat alleles of 40 ALS patients and 9 long-repeat length controls were all interrupted, bearing 1-3 CAA codons within the CAG repeat. 21/21 expanded ALS chromosomes with 3CAA interruptions arose from one haplotype (GT), while 18/19 expanded ALS chromosomes with <3CAA interruptions arose from a different haplotype (CC). Moreover, age of disease onset was significantly earlier in patients bearing 3 interruptions vs fewer, and was distinct between haplotypes. These results indicate that CAG repeat expansions in ATXN2 associated with ALS are uniformly interrupted repeats and that the nature of the repeat sequence and haplotype, as well as length of polyQ repeat, may play a role in the neurological effect conferred by expansions in ATXN2.

Nucleotide sequence of the ribosomal RNA gene of Physarum polycephalum: intron 2 and its flanking regions of the 26S rRNA gene.

PubMed Central

Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y

1981-01-01

The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776

Importation and outbreak of wild polioviruses from 2000 to 2014 and interruption of transmission in Cameroon.

PubMed

Endegue-Zanga, Marie Claire; Sadeuh-Mba, Serge Alain; Iber, Jane; Burns, Cara C; Moeletsi, Nicksy Gumede; Baba, Marycelin; Bukbuk, David; Delpeyroux, Francis; Mengouo, Marcellin Nimpa; Demanou, Maurice; Vernet, Guy; Etoa, François-Xavier; Njouom, Richard

2016-06-01

Efficient implementation of the global eradication strategies consisting of Acute Flaccid Paralysis (AFP) surveillance and mass immunization campaigns led to interruption of indigenous wild poliovirus transmission in Cameroon in 1999. This study describes type 1 and type 3 wild poliovirus (WPV) importation, incidence, geographic distribution and control since the original interruption of transmission in Cameroon. Stool samples from AFP patients under the age of 15 years in Cameroon were collected nationwide and subjected to virus isolation on RD and L20B cell cultures. Resulting virus isolates were typed by intratypic differentiation (ITD) and analysis of the VP1 coding sequence of the viral genome. Surveillance data originating from Cameroon between 2000 and 2014 were considered for retrospective descriptive analyses. From 2003 to 2009, multiple WPV importation events from neighboring countries affected mainly in the northern regions of Cameroon but did not led to sustained local transmission. Throughout this period, 16 WPV1 and 5 WPV3 were detected and identified as members of multiple clusters within type-specific West Africa B genotypes (WEAF-B). In 2013-2014, a polio outbreak associated to a highly evolved ("orphan") WPV1 affected four southern regions of Cameroon. The appearance of highly evolved lineage of type 1 WPV suggests potential surveillance gap and underscore the need to maintain comprehensive polio immunization activities and sensitive surveillance systems in place as long as any country in the world remains endemic for WPV. Copyright © 2016 Elsevier B.V. All rights reserved.

Orpinomyces cellulase celf protein and coding sequences

DOEpatents

Li, Xin-Liang; Chen, Huizhong; Ljungdahl, Lars G.

2000-09-05

A cDNA (1,520 bp), designated celF, consisting of an open reading frame (ORF) encoding a polypeptide (CelF) of 432 amino acids was isolated from a cDNA library of the anaerobic rumen fungus Orpinomyces PC-2 constructed in Escherichia coli. Analysis of the deduced amino acid sequence showed that starting from the N-terminus, CelF consists of a signal peptide, a cellulose binding domain (CBD) followed by an extremely Asn-rich linker region which separate the CBD and the catalytic domains. The latter is located at the C-terminus. The catalytic domain of CelF is highly homologous to CelA and CelC of Orpinomyces PC-2, to CelA of Neocallimastix patriciarum and also to cellobiohydrolase IIs (CBHIIs) from aerobic fungi. However, Like CelA of Neocallimastix patriciarum, CelF does not have the noncatalytic repeated peptide domain (NCRPD) found in CelA and CelC from the same organism. The recombinant protein CelF hydrolyzes cellooligosaccharides in the pattern of CBHII, yielding only cellobiose as product with cellotetraose as the substrate. The genomic celF is interrupted by a 111 bp intron, located within the region coding for the CBD. The intron of the celF has features in common with genes from aerobic filamentous fungi.

The DNA of ciliated protozoa.

PubMed Central

Prescott, D M

1994-01-01

Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435

Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

PubMed

René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

2000-01-04

In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

Exploring the impact of an automated prescription-filling device on community pharmacy technician workflow.

PubMed

Walsh, Kristin E; Chui, Michelle Anne; Kieser, Mara A; Williams, Staci M; Sutter, Susan L; Sutter, John G

2011-01-01

To explore community pharmacy technician workflow change after implementation of an automated robotic prescription-filling device. At an independent community pharmacy in rural Mayville, WI, pharmacy technicians were observed before and 3 months after installation of an automated robotic prescription-filling device. The main outcome measures were sequences and timing of technician workflow steps, workflow interruptions, automation surprises, and workarounds. Of the 77 and 80 observations made before and 3 months after robot installation, respectively, 17 different workflow sequences were observed before installation and 38 after installation. Average prescription filling time was reduced by 40 seconds per prescription with use of the robot. Workflow interruptions per observation increased from 1.49 to 1.79 (P = 0.11), and workarounds increased from 10% to 36% after robot use. Although automated prescription-filling devices can increase efficiency, workflow interruptions and workarounds may negate that efficiency. Assessing changes in workflow and sequencing of tasks that may result from the use of automation can help uncover opportunities for workflow policy and procedure redesign.

FPGA based control system for space instrumentation

NASA Astrophysics Data System (ADS)

Di Giorgio, Anna M.; Cerulli Irelli, Pasquale; Nuzzolo, Francesco; Orfei, Renato; Spinoglio, Luigi; Liu, Giovanni S.; Saraceno, Paolo

2008-07-01

The prototype for a general purpose FPGA based control system for space instrumentation is presented, with particular attention to the instrument control application software. The system HW is based on the LEON3FT processor, which gives the flexibility to configure the chip with only the necessary HW functionalities, from simple logic up to small dedicated processors. The instrument control SW is developed in ANSI C and for time critical (<10μs) commanding sequences implements an internal instructions sequencer, triggered via an interrupt service routine based on a HW high priority interrupt.

The Voltage Distribution Characteristics of a Hybrid Circuit Breaker During High Current Interruption

NASA Astrophysics Data System (ADS)

Cheng, Xian; Duan, Xiongying; Liao, Minfu; Huang, Zhihui; Luo, Yan; Zou, Jiyan

2013-08-01

Hybrid circuit breaker (HCB) technology based on a vacuum interrupter and a SF6 interrupter in series has become a new research direction because of the low-carbon requirements for high voltage switches. The vacuum interrupter has an excellent ability to deal with the steep rising part of the transient recovery voltage (TRV), while the SF6 interrupter can withstand the peak part of the voltage easily. An HCB can take advantage of the interrupters in the current interruption process. In this study, an HCB model based on the vacuum ion diffusion equations, ion density equation, and modified Cassie-Mayr arc equation is explored. A simulation platform is constructed by using a set of software called the alternative transient program (ATP). An HCB prototype is also designed, and the short circuit current is interrupted by the HCB under different action sequences of contacts. The voltage distribution of the HCB is analyzed through simulations and tests. The results demonstrate that if the vacuum interrupter withstands the initial TRV and interrupts the post-arc current first, then the recovery speed of the dielectric strength of the SF6 interrupter will be fast. The voltage distribution between two interrupters is determined by their post-arc resistance, which happens after current-zero, and subsequently, it is determined by the capacitive impedance after the post-arc current decays to zero.

Exploring the impact of an automated prescription-filling device on community pharmacy technician workflow

PubMed Central

Walsh, Kristin E.; Chui, Michelle Anne; Kieser, Mara A.; Williams, Staci M.; Sutter, Susan L.; Sutter, John G.

2012-01-01

Objective To explore community pharmacy technician workflow change after implementation of an automated robotic prescription-filling device. Methods At an independent community pharmacy in rural Mayville, WI, pharmacy technicians were observed before and 3 months after installation of an automated robotic prescription-filling device. The main outcome measures were sequences and timing of technician workflow steps, workflow interruptions, automation surprises, and workarounds. Results Of the 77 and 80 observations made before and 3 months after robot installation, respectively, 17 different workflow sequences were observed before installation and 38 after installation. Average prescription filling time was reduced by 40 seconds per prescription with use of the robot. Workflow interruptions per observation increased from 1.49 to 1.79 (P = 0.11), and workarounds increased from 10% to 36% after robot use. Conclusion Although automated prescription-filling devices can increase efficiency, workflow interruptions and workarounds may negate that efficiency. Assessing changes in workflow and sequencing of tasks that may result from the use of automation can help uncover opportunities for workflow policy and procedure redesign. PMID:21896459

A safety mechanism for observational learning.

PubMed

Badets, Arnaud; Boutin, Arnaud; Michelet, Thomas

2018-04-01

This empirical article presents the first evidence of a "safety mechanism" based on an observational-learning paradigm. It is accepted that during observational learning, a person can use different strategies to learn a motor skill, but it is unknown whether the learner is able to circumvent the encoding of an uncompleted observed skill. In this study, participants were tested in a dyadic protocol in which an observer watched a participant practicing two different motor sequences during a learning phase. During this phase, one of the two motor sequences was interrupted by a stop signal that precluded motor learning. The results of the subsequent retention test revealed that both groups learned the two motor sequences, but only the physical practice group showed worse performance for the interrupted sequence. The observers were consequently able to use a safety strategy to learn both sequences equally. Our findings are discussed in light of the implications of the action observation network for sequence learning and the cognitive mechanisms of error-based observation.

Building and Verifying a Predictive Model of Interruption Resumption

DTIC Science & Technology

2012-03-01

field, the vocal module speaks, the motor module moves the body, and the con- figural and manipulative modules perform spatial proces- sing [14]–[16...person cannot remember themselves. As described earlier, the model depends critically upon the basic properties of declarative memories. When a...success because the model’s ability to re- trieve an episodic code depends critically on the amount of time spent on the interruption. Also recall that

The culture contributing to interruptions in the nursing work environment: An ethnography.

PubMed

Hopkinson, Susan G; Wiegand, Debra L

2017-12-01

To understand the occurrence of interruptions within the culture of the medical nursing unit work environment. Interruptions may lead to errors in nursing work. Little is known about how the culture of the nursing work environment contributes to interruptions. A micro-focused ethnographic study was conducted. Data collection involved extensive observation of a nursing unit, 1:1 observations of nurses and follow-up interviews with the nurses. Data were analysed from unstructured field notes and interview transcripts. The definitions of interruption and culture guided coding, categorising and identification of themes. A framework was developed that describes the medical nursing unit as a complex culture full of unpredictable, nonlinear changes that affect the entire interconnected system, often in the form of an interruption. The cultural elements contributing to interruptions included (i) the value placed on excellence in patient care and meeting personal needs, (ii) the beliefs that the nurses had to do everything by themselves and that every phone call was important, (iii) the patterns of changing patients, patient transport and coordination of resources and (iv) the normative practices of communicating and adapting. Interruptions are an integral part of the culture of a medical nursing unit. Uniformly decreasing interruptions may disrupt current practices, such as communication to coordinate care, that are central to nursing work. In future research, the nursing work environment must be looked at through the lens of a complex system. Interventions to minimise the negative impact of interruptions must take into account the culture of the nursing as a complex adaptive system. Nurses should be educated on their own contribution to interruptions and issues addressed at a system level, rather than isolating the interruption as the central issue. © 2017 John Wiley & Sons Ltd.

Microsatellite Interruptions Stabilize Primate Genomes and Exist as Population-Specific Single Nucleotide Polymorphisms within Individual Human Genomes

PubMed Central

Ananda, Guruprasad; Hile, Suzanne E.; Breski, Amanda; Wang, Yanli; Kelkar, Yogeshwar; Makova, Kateryna D.; Eckert, Kristin A.

2014-01-01

Interruptions of microsatellite sequences impact genome evolution and can alter disease manifestation. However, human polymorphism levels at interrupted microsatellites (iMSs) are not known at a genome-wide scale, and the pathways for gaining interruptions are poorly understood. Using the 1000 Genomes Phase-1 variant call set, we interrogated mono-, di-, tri-, and tetranucleotide repeats up to 10 units in length. We detected ∼26,000–40,000 iMSs within each of four human population groups (African, European, East Asian, and American). We identified population-specific iMSs within exonic regions, and discovered that known disease-associated iMSs contain alleles present at differing frequencies among the populations. By analyzing longer microsatellites in primate genomes, we demonstrate that single interruptions result in a genome-wide average two- to six-fold reduction in microsatellite mutability, as compared with perfect microsatellites. Centrally located interruptions lowered mutability dramatically, by two to three orders of magnitude. Using a biochemical approach, we tested directly whether the mutability of a specific iMS is lower because of decreased DNA polymerase strand slippage errors. Modeling the adenomatous polyposis coli tumor suppressor gene sequence, we observed that a single base substitution interruption reduced strand slippage error rates five- to 50-fold, relative to a perfect repeat, during synthesis by DNA polymerases α, β, or η. Computationally, we demonstrate that iMSs arise primarily by base substitution mutations within individual human genomes. Our biochemical survey of human DNA polymerase α, β, δ, κ, and η error rates within certain microsatellites suggests that interruptions are created most frequently by low fidelity polymerases. Our combined computational and biochemical results demonstrate that iMSs are abundant in human genomes and are sources of population-specific genetic variation that may affect genome stability. The genome-wide identification of iMSs in human populations presented here has important implications for current models describing the impact of microsatellite polymorphisms on gene expression. PMID:25033203

Design and Control of Omnidirectional Unmanned Ground Vehicles for Rough Terrain

DTIC Science & Technology

2012-08-29

company, Quantum Signal. This rigid body dynamics simulation, housed within the Autonomous Navigation and Virtual Environment Laboratory (ANVEL) software...72 Figure 22: PIC main code. Page 24 of 72 Figure 23: PIC interrupt code. 3.3 Central Body Embedded Electronics As described above...located on the main body of the vehicle. This section describes how the on-board electronics works. The outline of the code is presented as is how

A Verification Method of Inter-Task Cooperation in Embedded Real-time Systems and its Evaluation

NASA Astrophysics Data System (ADS)

Yoshida, Toshio

In software development process of embedded real-time systems, the design of the task cooperation process is very important. The cooperating process of such tasks is specified by task cooperation patterns. Adoption of unsuitable task cooperation patterns has fatal influence on system performance, quality, and extendibility. In order to prevent repetitive work caused by the shortage of task cooperation performance, it is necessary to verify task cooperation patterns in an early software development stage. However, it is very difficult to verify task cooperation patterns in an early software developing stage where task program codes are not completed yet. Therefore, we propose a verification method using task skeleton program codes and a real-time kernel that has a function of recording all events during software execution such as system calls issued by task program codes, external interrupts, and timer interrupt. In order to evaluate the proposed verification method, we applied it to the software development process of a mechatronics control system.

Structure of the horseradish peroxidase isozyme C genes.

PubMed

Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H

1988-05-02

We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.

Comparative Genomic and Transcriptomic Characterization of the Toxigenic Marine Dinoflagellate Alexandrium ostenfeldii

PubMed Central

Jaeckisch, Nina; Yang, Ines; Wohlrab, Sylke; Glöckner, Gernot; Kroymann, Juergen; Vogel, Heiko; Cembella, Allan; John, Uwe

2011-01-01

Many dinoflagellate species are notorious for the toxins they produce and ecological and human health consequences associated with harmful algal blooms (HABs). Dinoflagellates are particularly refractory to genomic analysis due to the enormous genome size, lack of knowledge about their DNA composition and structure, and peculiarities of gene regulation, such as spliced leader (SL) trans-splicing and mRNA transposition mechanisms. Alexandrium ostenfeldii is known to produce macrocyclic imine toxins, described as spirolides. We characterized the genome of A. ostenfeldii using a combination of transcriptomic data and random genomic clones for comparison with other dinoflagellates, particularly Alexandrium species. Examination of SL sequences revealed similar features as in other dinoflagellates, including Alexandrium species. SL sequences in decay indicate frequent retro-transposition of mRNA species. This probably contributes to overall genome complexity by generating additional gene copies. Sequencing of several thousand fosmid and bacterial artificial chromosome (BAC) ends yielded a wealth of simple repeats and tandemly repeated longer sequence stretches which we estimated to comprise more than half of the whole genome. Surprisingly, the repeats comprise a very limited set of 79–97 bp sequences; in part the genome is thus a relatively uniform sequence space interrupted by coding sequences. Our genomic sequence survey (GSS) represents the largest genomic data set of a dinoflagellate to date. Alexandrium ostenfeldii is a typical dinoflagellate with respect to its transcriptome and mRNA transposition but demonstrates Alexandrium-like stop codon usage. The large portion of repetitive sequences and the organization within the genome is in agreement with several other studies on dinoflagellates using different approaches. It remains to be determined whether this unusual composition is directly correlated to the exceptionally genome organization of dinoflagellates with a low amount of histones and histone-like proteins. PMID:22164224

Transposon Invasion of the Paramecium Germline Genome Countered by a Domesticated PiggyBac Transposase and the NHEJ Pathway

PubMed Central

Dubois, Emeline; Bischerour, Julien; Marmignon, Antoine; Mathy, Nathalie; Régnier, Vinciane; Bétermier, Mireille

2012-01-01

Sequences related to transposons constitute a large fraction of extant genomes, but insertions within coding sequences have generally not been tolerated during evolution. Thanks to their unique nuclear dimorphism and to their original mechanism of programmed DNA elimination from their somatic nucleus (macronucleus), ciliates are emerging model organisms for the study of the impact of transposable elements on genomes. The germline genome of the ciliate Paramecium, located in its micronucleus, contains thousands of short intervening sequences, the IESs, which interrupt 47% of genes. Recent data provided support to the hypothesis that an evolutionary link exists between Paramecium IESs and Tc1/mariner transposons. During development of the macronucleus, IESs are excised precisely thanks to the coordinated action of PiggyMac, a domesticated piggyBac transposase, and of the NHEJ double-strand break repair pathway. A PiggyMac homolog is also required for developmentally programmed DNA elimination in another ciliate, Tetrahymena. Here, we present an overview of the life cycle of these unicellular eukaryotes and of the developmentally programmed genome rearrangements that take place at each sexual cycle. We discuss how ancient domestication of a piggyBac transposase might have allowed Tc1/mariner elements to spread throughout the germline genome of Paramecium, without strong counterselection against insertion within genes. PMID:22888464

Cloning and Genomic Organization of a Rhamnogalacturonase Gene from Locally Isolated Strain of Aspergillus niger.

PubMed

Damak, Naourez; Abdeljalil, Salma; Taeib, Noomen Hadj; Gargouri, Ali

2015-08-01

The rhg gene encoding a rhamnogalacturonase was isolated from the novel strain A1 of Aspergillus niger. It consists of an ORF of 1.505 kb encoding a putative protein of 446 amino acids with a predicted molecular mass of 47 kDa, belonging to the family 28 of glycosyl hydrolases. The nature and position of amino acids comprising the active site as well as the three-dimensional structure were well conserved between the A. niger CTM10548 and fungal rhamnogalacturonases. The coding region of the rhg gene is interrupted by three short introns of 56 (introns 1 and 3) and 52 (intron 2) bp in length. The comparison of the peptide sequence with A. niger rhg sequences revealed that the A1 rhg should be an endo-rhamnogalacturonases, more homologous to rhg A than rhg B A. niger known enzymes. The comparison of rhg nucleotide sequence from A. niger A1 with rhg A from A. niger shows several base changes. Most of these changes (59 %) are located at the third base of codons suggesting maintaining the same enzyme function. We used the rhamnogalacturonase A from Aspergillus aculeatus as a template to build a structural model of rhg A1 that adopted a right-handed parallel β-helix.

Target mimicry provides a new mechanism for regulation of microRNA activity.

PubMed

Franco-Zorrilla, José Manuel; Valli, Adrián; Todesco, Marco; Mateos, Isabel; Puga, María Isabel; Rubio-Somoza, Ignacio; Leyva, Antonio; Weigel, Detlef; García, Juan Antonio; Paz-Ares, Javier

2007-08-01

MicroRNAs (miRNA) regulate key aspects of development and physiology in animals and plants. These regulatory RNAs act as guides of effector complexes to recognize specific mRNA sequences based on sequence complementarity, resulting in translational repression or site-specific cleavage. In plants, most miRNA targets are cleaved and show almost perfect complementarity with the miRNAs around the cleavage site. Here, we examined the non-protein coding gene IPS1 (INDUCED BY PHOSPHATE STARVATION 1) from Arabidopsis thaliana. IPS1 contains a motif with sequence complementarity to the phosphate (Pi) starvation-induced miRNA miR-399, but the pairing is interrupted by a mismatched loop at the expected miRNA cleavage site. We show that IPS1 RNA is not cleaved but instead sequesters miR-399. Thus, IPS1 overexpression results in increased accumulation of the miR-399 target PHO2 mRNA and, concomitantly, in reduced shoot Pi content. Engineering of IPS1 to be cleavable abolishes its inhibitory activity on miR-399. We coin the term 'target mimicry' to define this mechanism of inhibition of miRNA activity. Target mimicry can be generalized beyond the control of Pi homeostasis, as demonstrated using artificial target mimics.

Impact of Frequent Interruption on Nurses' Patient-Controlled Analgesia Programming Performance.

PubMed

Campoe, Kristi R; Giuliano, Karen K

2017-12-01

The purpose was to add to the body of knowledge regarding the impact of interruption on acute care nurses' cognitive workload, total task completion times, nurse frustration, and medication administration error while programming a patient-controlled analgesia (PCA) pump. Data support that the severity of medication administration error increases with the number of interruptions, which is especially critical during the administration of high-risk medications. Bar code technology, interruption-free zones, and medication safety vests have been shown to decrease administration-related errors. However, there are few published data regarding the impact of number of interruptions on nurses' clinical performance during PCA programming. Nine acute care nurses completed three PCA pump programming tasks in a simulation laboratory. Programming tasks were completed under three conditions where the number of interruptions varied between two, four, and six. Outcome measures included cognitive workload (six NASA Task Load Index [NASA-TLX] subscales), total task completion time (seconds), nurse frustration (NASA-TLX Subscale 6), and PCA medication administration error (incorrect final programming). Increases in the number of interruptions were associated with significant increases in total task completion time ( p = .003). We also found increases in nurses' cognitive workload, nurse frustration, and PCA pump programming errors, but these increases were not statistically significant. Complex technology use permeates the acute care nursing practice environment. These results add new knowledge on nurses' clinical performance during PCA pump programming and high-risk medication administration.

The mitochondrial genome of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae).

PubMed

Yang, Ming Ru; Zhou, Zhi Jun; Chang, Yan Lin; Zhao, Le Hong

2012-08-01

To help determine whether the typical arthropod arrangement was a synapomorphy for the whole Tettigoniidae, we sequenced the mitochondrial genome (mitogenome) of the quiet-calling katydids, Xizicus fascipes (Orthoptera: Tettigoniidae: Meconematinae). The 16,166-bp nucleotide sequences of X. fascipes mitogenome contains the typical gene content, gene order, base composition, and codon usage found in arthropod mitogenomes. As a whole, the X. fascipes mitogenome contains a lower A+T content (70.2%) found in the complete orthopteran mitogenomes determined to date. All protein-coding genes started with a typical ATN codon. Ten of the 13 protein-coding genes have a complete termination codon, but the remaining three genes (COIII, ND5 and ND4) terminate with incomplete T. All tRNAs have the typical clover-leaf structure of mitogenome tRNA, except for tRNA(Ser(AGN)), in which lengthened anticodon stem (9 bp) with a bulged nuleotide in the middle, an unusual T-stem (6 bp in constrast to the normal 5 bp), a mini DHU arm (2 bp) and no connector nucleotides. In the A+T-rich region, two (TA)n conserved blocks that were previously described in Ensifera and two 150-bp tandem repeats plus a partial copy of the composed at 61 bp of the beginning were present. Phylogenetic analysis found: i) the monophyly of Conocephalinae was interrupted by Elimaea cheni from Phaneropterinae; and ii) Meconematinae was the most basal group among these five subfamilies.

A Detailed History of Intron-rich Eukaryotic Ancestors Inferred from a Global Survey of 100 Complete Genomes

PubMed Central

Csuros, Miklos; Rogozin, Igor B.; Koonin, Eugene V.

2011-01-01

Protein-coding genes in eukaryotes are interrupted by introns, but intron densities widely differ between eukaryotic lineages. Vertebrates, some invertebrates and green plants have intron-rich genes, with 6–7 introns per kilobase of coding sequence, whereas most of the other eukaryotes have intron-poor genes. We reconstructed the history of intron gain and loss using a probabilistic Markov model (Markov Chain Monte Carlo, MCMC) on 245 orthologous genes from 99 genomes representing the three of the five supergroups of eukaryotes for which multiple genome sequences are available. Intron-rich ancestors are confidently reconstructed for each major group, with 53 to 74% of the human intron density inferred with 95% confidence for the Last Eukaryotic Common Ancestor (LECA). The results of the MCMC reconstruction are compared with the reconstructions obtained using Maximum Likelihood (ML) and Dollo parsimony methods. An excellent agreement between the MCMC and ML inferences is demonstrated whereas Dollo parsimony introduces a noticeable bias in the estimations, typically yielding lower ancestral intron densities than MCMC and ML. Evolution of eukaryotic genes was dominated by intron loss, with substantial gain only at the bases of several major branches including plants and animals. The highest intron density, 120 to 130% of the human value, is inferred for the last common ancestor of animals. The reconstruction shows that the entire line of descent from LECA to mammals was intron-rich, a state conducive to the evolution of alternative splicing. PMID:21935348

47 CFR 11.51 - EAS code and Attention Signal Transmission requirements.

Code of Federal Regulations, 2011 CFR

2011-10-01

... transmitting requirements contained in this section for the combined stations or systems with one EAS Encoder... the encoder. (2) Manual interrupt of programming and transmission of EAS messages may be used. EAS...

Evaluation of Gaussia luciferase and foot-and-mouth disease virus 2A translational interrupter chimeras as polycistronic reporters for transgene expression.

PubMed

Puckette, Michael; Burrage, Thomas; Neilan, John G; Rasmussen, Max

2017-06-12

The Gaussia princeps luciferase is used as a stand-alone reporter of transgene expression for in vitro and in vivo expression systems due to the rapid and easy monitoring of luciferase activity. We sought to simultaneously quantitate production of other recombinant proteins by transcriptionally linking the Gaussia princeps luciferase gene to other genes of interest through the foot-and-mouth disease virus 2A translational interrupter sequence. We produced six plasmids, each encoding a single open reading frame, with the foot-and-mouth disease virus 2A sequence placed either N-terminal or C-terminal to the Gaussia princeps luciferase gene. Two plasmids included novel Gaussia princeps luciferase variants with the position 1 methionine deleted. Placing a foot-and-mouth disease virus 2A translational interrupter sequence on either the N- or C-terminus of the Gaussia princeps luciferase gene did not prevent the secretion or luminescence of resulting chimeric luciferase proteins. We also measured the ability of another polycistronic plasmid vector with a 2A-luciferase sequence placed downstream of the foot-and-mouth disease virus P1 and 3C protease genes to produce of foot-and-mouth disease virus-like particles and luciferase activity from transfected cells. Incorporation of the 2A-luciferase sequence into a transgene encoding foot-and-mouth disease virus structural proteins retained luciferase activity and the ability to form virus-like particles. We demonstrated a mechanism for the near real-time, sequential, non-destructive quantitative monitoring of transcriptionally-linked recombinant proteins and a valuable method for monitoring transgene expression in recombinant vaccine constructs.

Diversity and duplication of DQB and DRB-like genes of the MHC in baleen whales (suborder: Mysticeti).

PubMed

Baker, C S; Vant, M D; Dalebout, M L; Lento, G M; O'Brien, S J; Yuhki, N

2006-05-01

The molecular diversity and phylogenetic relationships of two class II genes of the baleen whale major histocompatibility complex were investigated and compared to toothed whales and out-groups. Amplification of the DQB exon 2 provided sequences showing high within-species and between-species nucleotide diversity and uninterrupted reading frames consistent with functional class II loci found in related mammals (e.g., ruminants). Cloning of amplified products indicated gene duplication in the humpback whale and triplication in the southern right whale, with average nucleotide diversity of 5.9 and 6.3%, respectively, for alleles of each species. Significantly higher nonsynonymous divergence at sites coding for peptide binding (32% for humpback and 40% for southern right) suggested that these loci were subject to positive (overdominant) selection. A population survey of humpback whales detected 23 alleles, differing by up to 21% of their inferred amino acid sequences. Amplification of the DRB exon 2 resulted in two groups of sequences. One was most similar to the DRB3 of the cow and present in all whales screened to date, including toothed whales. The second was most similar to the DRB2 of the cow and was found only in the bowhead and right whales. Both loci showed low diversity among species and apparent loss of function or altered function including interruption of reading frames. Finally, comparison of inferred protein sequence of the DRB3-like locus suggested convergence with the DQB, perhaps resulting from intergenic conversion or recombination.

Isolation, expression, and chromosomal localization of the human mitochondrial capsule selenoprotein gene (MCSP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aho, Hanne; Schwemmer, M.; Tessmann, D.

1996-03-01

The mitochondrial capsule selenoprotein (MCS) (HGMW-approved symbol MCSP) is one of three proteins that are important for the maintenance and stabilization of the crescent structure of the sperm mitochondria. We describe here the isolation of a cDNA, the exon-intron organization, the expression, and the chromosomal localization of the human MCS gene. Nucleotide sequence analysis of the human and mouse MCS cDNAs reveals that the 5{prime}- and 3{prime}-untranslated sequences are more conserved (71%) than the coding sequences (59%). The open reading frame encodes a 116-amino-acid protein and lacks the UGA codons, which have been reported to encode the selenocysteines in themore » N-terminal of the deduced mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein. The deduced human protein shows a low degree of amino acid sequence identity to the mouse protein (39%). The most striking homology lies in the dicysteine motifs. Northern and Southern zooblot analyses reveal that the MCS gene in human, baboon, and bovine is more conserved than its counterparts in mouse and rat. The single intron in the human MCS gene is approximately 6 kb and interrupts the 5{prime}-untranslated region at a position equivalent to that in the mouse and rat genes. Northern blot and in situ hybridization experiments demonstrate that the expression of the human MCS gene is restricted to haploid spermatids. The human gene was assigned to q21 of chromosome 1. 30 refs., 9 figs.« less

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

SSR allelic variation in almond (Prunus dulcis Mill.).

PubMed

Xie, Hua; Sui, Yi; Chang, Feng-Qi; Xu, Yong; Ma, Rong-Cai

2006-01-01

Sixteen SSR markers including eight EST-SSR and eight genomic SSRs were used for genetic diversity analysis of 23 Chinese and 15 international almond cultivars. EST- and genomic SSR markers previously reported in species of Prunus, mainly peach, proved to be useful for almond genetic analysis. DNA sequences of 117 alleles of six of the 16 SSR loci were analysed to reveal sequence variation among the 38 almond accessions. For the four SSR loci with AG/CT repeats, no insertions or deletions were observed in the flanking regions of the 98 alleles sequenced. Allelic size variation of these loci resulted exclusively from differences in the structures of repeat motifs, which involved interruptions or occurrences of new motif repeats in addition to varying number of AG/CT repeats. Some alleles had a high number of uninterrupted repeat motifs, indicating that SSR mutational patterns differ among alleles at a given SSR locus within the almond species. Allelic homoplasy was observed in the SSR loci because of base substitutions, interruptions or compound repeat motifs. Substitutions in the repeat regions were found at two SSR loci, suggesting that point mutations operate on SSRs and hinder the further SSR expansion by introducing repeat interruptions to stabilize SSR loci. Furthermore, it was shown that some potential point mutations in the flanking regions are linked with new SSR repeat motif variation in almond and peach.

Two-terminal video coding.

PubMed

Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

2009-03-01

Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

Are Technology Interruptions Impacting Your Bottom Line? An Innovative Proposal for Change.

PubMed

Ledbetter, Tamera; Shultz, Sarah; Beckham, Roxanne

2017-10-01

Nursing interruptions are a costly and dangerous variable in acute care hospitals. Malfunctioning technology equipment interrupts nursing care and prevents full utilization of computer safety systems to prevent patient care errors. This paper identifies an innovative approach to nursing interruptions related to computer and computer cart malfunctions. The impact on human resources is defined and outcome measures were proposed. A multifaceted proposal, based on a literature review, aimed at reducing nursing interruptions is presented. This proposal is expected to increase patient safety, as well as patient and nurse satisfaction. Acute care hospitals utilizing electronic medical records and bar-coded medication administration technology. Nurses, information technology staff, nursing informatics staff, and all leadership teams affected by technology problems and their proposed solutions. Literature from multiple fields was reviewed to evaluate research related to computer/computer cart failures, and the approaches used to resolve these issues. Outcome measured strategic goals related to patient safety, and nurse and patient satisfaction. Specific help desk metrics will demonstrate the effect of interventions. This paper addresses a gap in the literature and proposes practical and innovative solutions. A comprehensive computer and computer cart repair program is essential for patient safety, financial stewardship, and utilization of resources. © 2015 Wiley Periodicals, Inc.

mCSF1, a nucleus-encoded CRM protein required for the processing of many mitochondrial introns, is involved in the biogenesis of respiratory complexes I and IV in Arabidopsis.

PubMed

Zmudjak, Michal; Colas des Francs-Small, Catherine; Keren, Ido; Shaya, Felix; Belausov, Eduard; Small, Ian; Ostersetzer-Biran, Oren

2013-07-01

The coding regions of many mitochondrial genes in plants are interrupted by intervening sequences that are classified as group II introns. Their splicing is essential for the expression of the genes they interrupt and hence for respiratory function, and is facilitated by various protein cofactors. Despite the importance of these cofactors, only a few of them have been characterized. CRS1-YhbY domain (CRM) is a recently recognized RNA-binding domain that is present in several characterized splicing factors in plant chloroplasts. The Arabidopsis genome encodes 16 CRM proteins, but these are largely uncharacterized. Here, we analyzed the intracellular location of one of these hypothetical proteins in Arabidopsis, mitochondrial CAF-like splicing factor 1 (mCSF1; At4 g31010), and analyzed the growth phenotypes and organellar activities associated with mcsf1 mutants in plants. Our data indicated that mCSF1 resides within mitochondria and its functions are essential during embryogenesis. Mutant plants with reduced mCSF1 displayed inhibited germination and retarded growth phenotypes that were tightly associated with reduced complex I and IV activities. Analogously to the functions of plastid-localized CRM proteins, analysis of the RNA profiles in wildtype and mcsf1 plants showed that mCSF1 acts in the splicing of many of the group II intron RNAs in Arabidopsis mitochondria. © 2013 The Authors. New Phytologist © 2013 New Phytologist Trust.

A rare variant P507L in TPP1 interrupts TPP1-TIN2 interaction, influences telomere length, and confers colorectal cancer risk in Chinese population.

PubMed

Li, Jiaoyuan; Chang, Jiang; Tian, Jianbo; Ke, Juntao; Zhu, Ying; Yang, Yang; Gong, Yajie; Zou, Danyi; Peng, Xiating; Yang, Nan; Mei, Shufang; Wang, Xiaoyang; Cheng, Liming; Hu, Weiguo; Gong, Jing; Zhong, Rong; Miao, Xiaoping

2018-06-11

Telomere dysfunction triggers cellular senescence and constitutes a driving force for cancer initiation. Genetic variants in genes involved in telomere maintenance may contribute to colorectal cancer (CRC) susceptibility. In this study, we firstly captured germline mutations in 192 CRC patients by sequencing the coding regions of 13 core components implicated in telomere biology. Five potential functional variants were then genotyped and assessed in a case-control set with 3,761 CRC cases and 3,839 healthy controls. The promising association was replicated in additional 6,765 cases and 6,906 controls. Functional experiments were used to further clarify the potential function of the significant variant and uncover the underlying mechanism in CRC development. The two-stage association studies showed that a rare missense variant rs149418249 (c.C1520T, p.P507L) in the 11th exon of TPP1 (also known as ACD, gene ID 65057) was significantly associated with CRC risk with the ORs being 2.90 (95% CI:1.04-8.07, P=0.041), 2.50 (95% CI:1.04-6.04, P=0.042), and 2.66 (95%CI:1.36-5.18, P=0.004) in discovery, replication, and the combined samples, respectively. Further functional annotation indicated that the TPP1 P507L substitution interrupted TPP1-TIN2 interaction, impaired telomerase processivity, and shortened telomere length, which subsequently facilitated cell proliferation and promoted CRC development. A rare variant P507L in TPP1 confers increased risk of CRC through interrupting TPP1-TIN2 interaction, impairing telomerase processivity, and shrinking telomere length. These findings emphasize the important role of telomere dysfunction in CRC development, and provide new insights about the prevention of this type of cancer. Copyright ©2018, American Association for Cancer Research.

Embedded interruptions and task complexity influence schema-related cognitive load progression in an abstract learning task.

PubMed

Wirzberger, Maria; Esmaeili Bijarsari, Shirin; Rey, Günter Daniel

2017-09-01

Cognitive processes related to schema acquisition comprise an essential source of demands in learning situations. Since the related amount of cognitive load is supposed to change over time, plausible temporal models of load progression based on different theoretical backgrounds are inspected in this study. A total of 116 student participants completed a basal symbol sequence learning task, which provided insights into underlying cognitive dynamics. Two levels of task complexity were determined by the amount of elements within the symbol sequence. In addition, interruptions due to an embedded secondary task occurred at five predefined stages over the task. Within the resulting 2x5-factorial mixed between-within design, the continuous monitoring of efficiency in learning performance enabled assumptions on relevant resource investment. From the obtained results, a nonlinear change of learning efficiency over time seems most plausible in terms of cognitive load progression. Moreover, different effects of the induced interruptions show up in conditions of task complexity, which indicate the activation of distinct cognitive mechanisms related to structural aspects of the task. Findings are discussed in the light of evidence from research on memory and information processing. Copyright © 2017 Elsevier B.V. All rights reserved.

Phased array ghost elimination (PAGE) for segmented SSFP imaging with interrupted steady-state.

PubMed

Kellman, Peter; Guttman, Michael A; Herzka, Daniel A; McVeigh, Elliot R

2002-12-01

Steady-state free precession (SSFP) has recently proven to be valuable for cardiac imaging due to its high signal-to-noise ratio and blood-myocardium contrast. Data acquired using ECG-triggered, segmented sequences during the approach to steady-state, or return to steady-state after interruption, may have ghost artifacts due to periodic k-space distortion. Schemes involving several preparatory RF pulses have been proposed to restore steady-state, but these consume imaging time during early systole. Alternatively, the phased-array ghost elimination (PAGE) method may be used to remove ghost artifacts from the first several frames. PAGE was demonstrated for cardiac cine SSFP imaging with interrupted steady-state using a simple alpha/2 magnetization preparation and storage scheme and a spatial tagging preparation.

Characterization of the novel antifungal protein PgAFP and the encoding gene of Penicillium chrysogenum.

PubMed

Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A

2010-04-01

The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.

The site-specific ribosomal insertion element type II of Bombyx mori (R2Bm) contains the coding sequence for a reverse transcriptase-like enzyme.

PubMed Central

Burke, W D; Calalang, C C; Eickbush, T H

1987-01-01

Two classes of DNA elements interrupt a fraction of the rRNA repeats of Bombyx mori. We have analyzed by genomic blotting and sequence analysis one class of these elements which we have named R2. These elements occupy approximately 9% of the rDNA units of B. mori and appear to be homologous to the type II rDNA insertions detected in Drosophila melanogaster. Approximately 25 copies of R2 exist within the B. mori genome, of which at least 20 are located at a precise location within otherwise typical rDNA units. Nucleotide sequence analysis has revealed that the 4.2-kilobase-pair R2 element has a single large open reading frame, occupying over 82% of the total length of the element. The central region of this 1,151-amino-acid open reading frame shows homology to the reverse transcriptase enzymes found in retroviruses and certain transposable elements. Amino acid homology of this region is highest to the mobile line 1 elements of mammals, followed by the mitochondrial type II introns of fungi, and the pol gene of retroviruses. Less homology exists with transposable elements of D. melanogaster and Saccharomyces cerevisiae. Two additional regions of sequence homology between L1 and R2 elements were also found outside the reverse transcriptase region. We suggest that the R2 elements are retrotransposons that are site specific in their insertion into the genome. Such mobility would enable these elements to occupy a small fraction of the rDNA units of B. mori despite their continual elimination from the rDNA locus by sequence turnover. Images PMID:2439905

Structure of the germline genome of Tetrahymena thermophila and relationship to the massively rearranged somatic genome

PubMed Central

Hamilton, Eileen P; Kapusta, Aurélie; Huvos, Piroska E; Bidwell, Shelby L; Zafar, Nikhat; Tang, Haibao; Hadjithomas, Michalis; Krishnakumar, Vivek; Badger, Jonathan H; Caler, Elisabet V; Russ, Carsten; Zeng, Qiandong; Fan, Lin; Levin, Joshua Z; Shea, Terrance; Young, Sarah K; Hegarty, Ryan; Daza, Riza; Gujja, Sharvari; Wortman, Jennifer R; Birren, Bruce W; Nusbaum, Chad; Thomas, Jainy; Carey, Clayton M; Pritham, Ellen J; Feschotte, Cédric; Noto, Tomoko; Mochizuki, Kazufumi; Papazyan, Romeo; Taverna, Sean D; Dear, Paul H; Cassidy-Hanley, Donna M; Xiong, Jie; Miao, Wei; Orias, Eduardo; Coyne, Robert S

2016-01-01

The germline genome of the binucleated ciliate Tetrahymena thermophila undergoes programmed chromosome breakage and massive DNA elimination to generate the somatic genome. Here, we present a complete sequence assembly of the germline genome and analyze multiple features of its structure and its relationship to the somatic genome, shedding light on the mechanisms of genome rearrangement as well as the evolutionary history of this remarkable germline/soma differentiation. Our results strengthen the notion that a complex, dynamic, and ongoing interplay between mobile DNA elements and the host genome have shaped Tetrahymena chromosome structure, locally and globally. Non-standard outcomes of rearrangement events, including the generation of short-lived somatic chromosomes and excision of DNA interrupting protein-coding regions, may represent novel forms of developmental gene regulation. We also compare Tetrahymena’s germline/soma differentiation to that of other characterized ciliates, illustrating the wide diversity of adaptations that have occurred within this phylum. DOI: http://dx.doi.org/10.7554/eLife.19090.001 PMID:27892853

CGG repeat length and AGG interruptions as indicators of fragile X-associated diminished ovarian reserve.

PubMed

Lekovich, Jovana; Man, Limor; Xu, Kangpu; Canon, Chelsea; Lilienthal, Debra; Stewart, Joshua D; Pereira, Nigel; Rosenwaks, Zev; Gerhardt, Jeannine

2017-12-21

PurposeFragile X premutation (PM) carriers may experience difficulties conceiving a child probably due to fragile X-associated diminished ovarian reserve (FXDOR). We investigated which subgroups of carriers with a PM are at higher risk of FXDOR, and whether the number of AGG interruptions within the repeat sequence further ameliorates the risk.MethodsWe compared markers of ovarian reserve, including anti-Müllerian hormone, antral follicle count, and number of oocytes retrieved between different subgroups of patients with a PM.ResultsWe found that carriers with midrange repeats size (70-90 CGG) demonstrate significantly lower ovarian reserve. Additionally, the number of AGG interruptions directly correlated with parameters of ovarian reserve. Patients with longer uninterrupted CGG repeats post-AGG interruptions had the lowest ovarian reserve.ConclusionThis study connects AGG interruptions and certain CGG repeat length to reduced ovarian reserve in carriers with a PM. A possible explanation for our findings is the proposed gonadotoxicity of the FMR1 transcripts. Reduction of AGG interruptions could increase the likelihood that secondary RNA structures in the FMR1 messenger RNA are formed, which could cause cell dysfunction within the ovaries. These findings may provide women with guidance regarding their fertility potential and accordingly assist with their family planning.GENETICS in MEDICINE advance online publication, 21 December 2017; doi:10.1038/gim.2017.220.

Improvement of a yeast self-excising integrative vector by prevention of expression leakage of the intronated Cre recombinase gene during plasmid maintenance in Escherichia coli.

PubMed

Agaphonov, Michael O

2017-12-01

The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Mutations Related to Antiretroviral Resistance Identified by Ultra-Deep Sequencing in HIV-1 Infected Children under Structured Interruptions of HAART

PubMed Central

Vazquez-Guillen, Jose Manuel; Palacios-Saucedo, Gerardo C.; Rivera-Morales, Lydia G.; Garcia-Campos, Jorge; Ortiz-Lopez, Rocio; Noguera-Julian, Marc; Paredes, Roger; Vielma-Ramirez, Herlinda J.; Ramirez, Teresa J.; Chavez-Garcia, Marcelino; Lopez-Guillen, Paulo; Briones-Lara, Evangelina; Sanchez-Sanchez, Luz M.; Vazquez-Martinez, Carlos A.; Rodriguez-Padilla, Cristina

2016-01-01

Although Structured Treatment Interruptions (STI) are currently not considered an alternative strategy for antiretroviral treatment, their true benefits and limitations have not been fully established. Some studies suggest the possibility of improving the quality of life of patients with this strategy; however, the information that has been obtained corresponds mostly to studies conducted in adults, with a lack of knowledge about its impact on children. Furthermore, mutations associated with antiretroviral resistance could be selected due to sub-therapeutic levels of HAART at each interruption period. Genotyping methods to determine the resistance profiles of the infecting viruses have become increasingly important for the management of patients under STI, thus low-abundance antiretroviral drug-resistant mutations (DRM’s) at levels under limit of detection of conventional genotyping (<20% of quasispecies) could increase the risk of virologic failure. In this work, we analyzed the protease and reverse transcriptase regions of the pol gene by ultra-deep sequencing in pediatric patients under STI with the aim of determining the presence of high- and low-abundance DRM’s in the viral rebounds generated by the STI. High-abundance mutations in protease and high- and low-abundance mutations in reverse transcriptase were detected but no one of these are directly associated with resistance to antiretroviral drugs. The results could suggest that the evaluated STI program is virologically safe, but strict and carefully planned studies, with greater numbers of patients and interruption/restart cycles, are still needed to evaluate the selection of DRM’s during STI. PMID:26807922

Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells.

PubMed

Chang, Chia-Wei; Lai, Yi-Shin; Pawlik, Kevin M; Liu, Kaimao; Sun, Chiao-Wang; Li, Chao; Schoeb, Trenton R; Townes, Tim M

2009-05-01

We report the derivation of induced pluripotent stem (iPS) cells from adult skin fibroblasts using a single, polycistronic lentiviral vector encoding the reprogramming factors Oct4, Sox2, and Klf4. Porcine teschovirus-1 2A sequences that trigger ribosome skipping were inserted between human cDNAs for these factors, and the polycistron was subcloned downstream of the elongation factor 1 alpha promoter in a self-inactivating (SIN) lentiviral vector containing a loxP site in the truncated 3' long terminal repeat (LTR). Adult skin fibroblasts from a humanized mouse model of sickle cell disease were transduced with this single lentiviral vector, and iPS cell colonies were picked within 30 days. These cells expressed endogenous Oct4, Sox2, Nanog, alkaline phosphatase, stage-specific embryonic antigen-1, and other markers of pluripotency. The iPS cells produced teratomas containing tissue derived from all three germ layers after injection into immunocompromised mice and formed high-level chimeras after injection into murine blastocysts. iPS cell lines with as few as three lentiviral insertions were obtained. Expression of Cre recombinase in these iPS cells resulted in deletion of the lentiviral vector, and sequencing of insertion sites demonstrated that remnant 291-bp SIN LTRs containing a single loxP site did not interrupt coding sequences, promoters, or known regulatory elements. These results suggest that a single, polycistronic "hit and run" vector can safely and effectively reprogram adult dermal fibroblasts into iPS cells.

Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

NASA Astrophysics Data System (ADS)

Farzan Sabahi, Mohammad; Dehghanfard, Ali

2014-12-01

The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

Phase and widening construction of steel bridges.

DOT National Transportation Integrated Search

2014-03-01

Phase construction is used to maintain traffic without interruption and generally refers to sequenced construction where a portion of the bridge is under construction while the remainder continues to carry traffic. The method typically results in two...

[Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

PubMed

Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

2012-01-01

Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

Informational structure of genetic sequences and nature of gene splicing

NASA Astrophysics Data System (ADS)

Trifonov, E. N.

1991-10-01

Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

Isolation and characterization of polygalacturonase genes (pecA and pecB) from Aspergillus flavus.

PubMed Central

Whitehead, M P; Shieh, M T; Cleveland, T E; Cary, J W; Dean, R A

1995-01-01

Two genes, pecA and pecB, encoding endopolyglacturonases were cloned from a highly aggressive strain of Aspergillus flavus. The pecA gene consisted of 1,228 bp encoding a protein of 363 amino acids with a predicted molecular mass of 37.6 kDa, interrupted by two introns of 58 and 81 bp in length. Accumulation of pecA mRNA in both pectin- or glucose-grown mycelia in the highly aggressive strain matched the activity profile of a pectinase previously identified as P2c. Transformants of a weakly aggressive strain containing a functional copy of the pecA gene produced P2c in vitro, confirming that pecA encodes P2c. The coding region of pecB was determined to be 1,217 bp in length interrupted by two introns of 65 and 54 bp in length. The predicted protein of 366 amino acids had an estimated molecular mass of 38 kDa. Transcripts of this gene accumulated in mycelia grown in medium containing pectin alone, never in mycelia grown in glucose-containing medium, for both highly and weakly aggressive strains. Thus, pecB encodes the activity previously identified as P1 or P3. pecA and pecB share a high degree of sequence identity with polygalacturonase genes from Aspergillus parasiticus and Aspergillus oryzae, further establishing the close relationships between members of the A. flavus group. Conservation of intron positions in these genes also indicates that they share a common ancestor with genes encoding endopolyglacturonases of Aspergillus niger. PMID:7574642

Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

NASA Astrophysics Data System (ADS)

Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

2018-01-01

The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

An Anatomy of a Seismic Sequence in a Deep Gold Mine

NASA Astrophysics Data System (ADS)

Gibowicz, S. J.

1997-12-01

An unusual swarm-like seismic sequence occurred in April 1993 at the Western Deep Levels gold mine, South Africa. Altogether 199 events with moment magnitude from -0.5 to 3.1 were recorded and located by the mine seismic network. The sequence lasted 12 days and was composed in fact of four main shock-aftershocks sequences, closely following each other in space and time. The events were confined to a volume of rock extending to 670 m in the N-S, 630 m in the E-W, and 390 m in the vertical directions. The first sequence lasted 179 hours and the second only 13 hours, being interrupted by the third sequence which lasted 31 hours, being in turn interrupted by the fourth sequence. The parameter p, describing the rate of occurrence of aftershocks, ranged from 0.7 to 1. The first sequence is characterized by the lowest value of the fractal correlation dimension D = 1.75 and the second by the highest value of D = 2.4, whereas the third and fourth sequences are characterized by the middle value of D = 1.9.¶The corner frequencies of P and S waves are in close proximity and range from 14 to 220 Hz. A display of source parameters as a function of time shows that the four main shocks are most distinctly marked by their source radius. For 46 events a moment tensor inversion was performed. In most cases the double-couple component is dominant, ranging from 60 to 90 percent of the solution. The double-couple solutions correspond to the same number of normal and reverse faults and oblique-slip focal mechanisms. An analysis of space distribution of P, T and B axes reveals that the distribution of B axes is the most regular.

SEQassembly: A Practical Tools Program for Coding Sequences Splicing

NASA Astrophysics Data System (ADS)

Lee, Hongbin; Yang, Hang; Fu, Lei; Qin, Long; Li, Huili; He, Feng; Wang, Bo; Wu, Xiaoming

CDS (Coding Sequences) is a portion of mRNA sequences, which are composed by a number of exon sequence segments. The construction of CDS sequence is important for profound genetic analysis such as genotyping. A program in MATLAB environment is presented, which can process batch of samples sequences into code segments under the guide of reference exon models, and splice these code segments of same sample source into CDS according to the exon order in queue file. This program is useful in transcriptional polymorphism detection and gene function study.

Correlation approach to identify coding regions in DNA sequences

NASA Technical Reports Server (NTRS)

Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1994-01-01

Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

Statistical properties of DNA sequences

NASA Technical Reports Server (NTRS)

Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

1995-01-01

We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

Cellulases and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2001-02-20

The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

Cellulases and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2001-01-01

The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

A free interactive matching program

DOE Office of Scientific and Technical Information (OSTI.GOV)

J.-F. Ostiguy

1999-04-16

For physicists and engineers involved in the design and analysis of beamlines (transfer lines or insertions) the lattice function matching problem is central and can be time-consuming because it involves constrained nonlinear optimization. For such problems convergence can be difficult to obtain in general without expert human intervention. Over the years, powerful codes have been developed to assist beamline designers. The canonical example is MAD (Methodical Accelerator Design) developed at CERN by Christophe Iselin. MAD, through a specialized command language, allows one to solve a wide variety of problems, including matching problems. Although in principle, the MAD command interpreter canmore » be run interactively, in practice the solution of a matching problem involves a sequence of independent trial runs. Unfortunately, but perhaps not surprisingly, there still exists relatively few tools exploiting the resources offered by modern environments to assist lattice designer with this routine and repetitive task. In this paper, we describe a fully interactive lattice matching program, written in C++ and assembled using freely available software components. An important feature of the code is that the evolution of the lattice functions during the nonlinear iterative process can be graphically monitored in real time; the user can dynamically interrupt the iterations at will to introduce new variables, freeze existing ones into their current state and/or modify constraints. The program runs under both UNIX and Windows NT.« less

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection.

PubMed

Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A

2016-01-15

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated "CiHHV-6A/B". These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections.

Complete Genome Sequence of Germline Chromosomally Integrated Human Herpesvirus 6A and Analyses Integration Sites Define a New Human Endogenous Virus with Potential to Reactivate as an Emerging Infection

PubMed Central

Tweedy, Joshua; Spyrou, Maria Alexandra; Pearson, Max; Lassner, Dirk; Kuhl, Uwe; Gompels, Ursula A.

2016-01-01

Human herpesvirus-6A and B (HHV-6A, HHV-6B) have recently defined endogenous genomes, resulting from integration into the germline: chromosomally-integrated “CiHHV-6A/B”. These affect approximately 1.0% of human populations, giving potential for virus gene expression in every cell. We previously showed that CiHHV-6A was more divergent than CiHHV-6B by examining four genes in 44 European CiHHV-6A/B cardiac/haematology patients. There was evidence for gene expression/reactivation, implying functional non-defective genomes. To further define the relationship between HHV-6A and CiHHV-6A we used next-generation sequencing to characterize genomes from three CiHHV-6A cardiac patients. Comparisons to known exogenous HHV-6A showed CiHHV-6A genomes formed a separate clade; including all 85 non-interrupted genes and necessary cis-acting signals for reactivation as infectious virus. Greater single nucleotide polymorphism (SNP) density was defined in 16 genes and the direct repeats (DR) terminal regions. Using these SNPs, deep sequencing analyses demonstrated superinfection with exogenous HHV-6A in two of the CiHHV-6A patients with recurrent cardiac disease. Characterisation of the integration sites in twelve patients identified the human chromosome 17p subtelomere as a prevalent site, which had specific repeat structures and phylogenetically related CiHHV-6A coding sequences indicating common ancestral origins. Overall CiHHV-6A genomes were similar, but distinct from known exogenous HHV-6A virus, and have the capacity to reactivate as emerging virus infections. PMID:26784220

Digenic Inheritance of PROKR2 and WDR11 Mutations in Pituitary Stalk Interruption Syndrome.

PubMed

McCormack, Shana E; Li, Dong; Kim, Yeon Joo; Lee, Ji Young; Kim, Soo-Hyun; Rapaport, Robert; Levine, Michael A

2017-07-01

Pituitary stalk interruption syndrome (PSIS, ORPHA95496) is a congenital defect of the pituitary gland characterized by the triad of a very thin/interrupted pituitary stalk, an ectopic (or absent) posterior pituitary gland, and hypoplasia or aplasia of the anterior pituitary gland. Complex genetic patterns of inheritance of this disorder are increasingly recognized. The objective of this study was to identify a genetic cause of PSIS in an affected child. Whole exome sequencing (WES) was performed by using standard techniques, with prioritized genetic variants confirmed via Sanger sequencing. To investigate the effects of one candidate variant on mutant WDR11 function, Western blotting and coimmunofluorescence were used to assess binding capacity, and leptomycin B exposure along with immunofluorescence was used to assess nuclear localization. We describe a child who presented in infancy with combined pituitary hormone deficiencies and whose brain imaging demonstrated a small anterior pituitary, ectopic posterior pituitary, and a thin, interrupted stalk. WES demonstrated heterozygous missense mutations in two genes required for pituitary development, a known loss-of-function mutation in PROKR2 (c.253C>T;p.R85C) inherited from an unaffected mother, and a WDR11 (c.1306A>G;p.I436V) mutation inherited from an unaffected father. Mutant WDR11 loses its capacity to bind to its functional partner, EMX1, and to localize to the nucleus. WES in a child with PSIS and his unaffected family implicates a digenic mechanism of inheritance. In cases of hypopituitarism in which there is incomplete segregation of a monogenic genotype with the phenotype, the possibility that a second genetic locus is involved should be considered. Copyright © 2017 Endocrine Society

Caregiver person-centeredness and behavioral symptoms during mealtime interactions: development and feasibility of a coding scheme.

PubMed

Gilmore-Bykovskyi, Andrea L

2015-01-01

Mealtime behavioral symptoms are distressing and frequently interrupt eating for the individual experiencing them and others in the environment. A computer-assisted coding scheme was developed to measure caregiver person-centeredness and behavioral symptoms for nursing home residents with dementia during mealtime interactions. The purpose of this pilot study was to determine the feasibility, ease of use, and inter-observer reliability of the coding scheme, and to explore the clinical utility of the coding scheme. Trained observers coded 22 observations. Data collection procedures were acceptable to participants. Overall, the coding scheme proved to be feasible, easy to execute and yielded good to very good inter-observer agreement following observer re-training. The coding scheme captured clinically relevant, modifiable antecedents to mealtime behavioral symptoms, but would be enhanced by the inclusion of measures for resident engagement and consolidation of items for measuring caregiver person-centeredness that co-occurred and were difficult for observers to distinguish. Published by Elsevier Inc.

Origin and evolution of spliceosomal introns

PubMed Central

2012-01-01

Evolution of exon-intron structure of eukaryotic genes has been a matter of long-standing, intensive debate. The introns-early concept, later rebranded ‘introns first’ held that protein-coding genes were interrupted by numerous introns even at the earliest stages of life's evolution and that introns played a major role in the origin of proteins by facilitating recombination of sequences coding for small protein/peptide modules. The introns-late concept held that introns emerged only in eukaryotes and new introns have been accumulating continuously throughout eukaryotic evolution. Analysis of orthologous genes from completely sequenced eukaryotic genomes revealed numerous shared intron positions in orthologous genes from animals and plants and even between animals, plants and protists, suggesting that many ancestral introns have persisted since the last eukaryotic common ancestor (LECA). Reconstructions of intron gain and loss using the growing collection of genomes of diverse eukaryotes and increasingly advanced probabilistic models convincingly show that the LECA and the ancestors of each eukaryotic supergroup had intron-rich genes, with intron densities comparable to those in the most intron-rich modern genomes such as those of vertebrates. The subsequent evolution in most lineages of eukaryotes involved primarily loss of introns, with only a few episodes of substantial intron gain that might have accompanied major evolutionary innovations such as the origin of metazoa. The original invasion of self-splicing Group II introns, presumably originating from the mitochondrial endosymbiont, into the genome of the emerging eukaryote might have been a key factor of eukaryogenesis that in particular triggered the origin of endomembranes and the nucleus. Conversely, splicing errors gave rise to alternative splicing, a major contribution to the biological complexity of multicellular eukaryotes. There is no indication that any prokaryote has ever possessed a spliceosome or introns in protein-coding genes, other than relatively rare mobile self-splicing introns. Thus, the introns-first scenario is not supported by any evidence but exon-intron structure of protein-coding genes appears to have evolved concomitantly with the eukaryotic cell, and introns were a major factor of evolution throughout the history of eukaryotes. This article was reviewed by I. King Jordan, Manuel Irimia (nominated by Anthony Poole), Tobias Mourier (nominated by Anthony Poole), and Fyodor Kondrashov. For the complete reports, see the Reviewers’ Reports section. PMID:22507701

Android Protection Mechanism: A Signed Code Security Mechanism for Smartphone Applications

DTIC Science & Technology

2011-03-01

status registers, exceptions, endian support, unaligned access support, synchronization primitives , the Jazelle Extension, and saturated integer...supports comprehensive non-blocking shared-memory synchronization primitives that scale for multiple-processor system designs. This is an improvement... synchronization . Memory semaphores can be loaded and altered without interruption because the load and store operations are atomic. Processor

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

DNA barcode goes two-dimensions: DNA QR code web server.

PubMed

Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

Lichenase and coding sequences

DOEpatents

Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

2000-08-15

The present invention provides a fungal lichenase, i.e., an endo-1,3-1,4-.beta.-D-glucanohydrolase, its coding sequence, recombinant DNA molecules comprising the lichenase coding sequences, recombinant host cells and methods for producing same. The present lichenase is from Orpinomyces PC-2.

The human serotonin 5-HT{sub 2C} receptor: Complete cDNA, genomic structure, and alternatively spliced variant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun

1996-08-01

The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less

Cloning and characterization of an inulinase gene from the marine yeast Candida membranifaciens subsp. flavinogenie W14-3 and its expression in Saccharomyces sp. W0 for ethanol production.

PubMed

Zhang, Lin-Lin; Tan, Mei-Juan; Liu, Guang-Lei; Chi, Zhe; Wang, Guang-Yuan; Chi, Zhen-Ming

2015-04-01

The INU1 gene encoding an exo-inulinase from the marine-derived yeast Candida membranifaciens subsp. flavinogenie W14-3 was cloned and characterized. It had an open reading frame of 1,536 bp long encoding an inulinase. The coding region of it was not interrupted by any intron. The cloned gene encoded 512 amino acid residues of a protein with a putative signal peptide of 23 amino acids and a calculated molecular mass of 57.8 kDa. The protein sequence deduced from the inulinase gene contained the inulinase consensus sequences (WMNDPNGL), (RDP), ECP FS and Q. The protein also had six conserved putative N-glycosylation sites. The deduced inulinase from the yeast strain W14-3 was found to be closely related to that from Candida kutaonensis sp. nov. KRF1, Kluyveromyces marxianus, and Cryptococcus aureus G7a. The inulinase gene with its signal peptide encoding sequence was subcloned into the pMIRSC11 expression vector and expressed in Saccharomyces sp. W0. The recombinant yeast strain W14-3-INU-112 obtained could produce 16.8 U/ml of inulinase activity and 12.5 % (v/v) ethanol from 250 g/l of inulin within 168 h. The monosaccharides were detected after the hydrolysis of inulin with the crude inulinase (the yeast culture). All the results indicated that the cloned gene and the recombinant yeast strain W14-3-INU-112 had potential applications in biotechnology.

FRAGS: estimation of coding sequence substitution rates from fragmentary data

PubMed Central

Swart, Estienne C; Hide, Winston A; Seoighe, Cathal

2004-01-01

Background Rates of substitution in protein-coding sequences can provide important insights into evolutionary processes that are of biomedical and theoretical interest. Increased availability of coding sequence data has enabled researchers to estimate more accurately the coding sequence divergence of pairs of organisms. However the use of different data sources, alignment protocols and methods to estimate substitution rates leads to widely varying estimates of key parameters that define the coding sequence divergence of orthologous genes. Although complete genome sequence data are not available for all organisms, fragmentary sequence data can provide accurate estimates of substitution rates provided that an appropriate and consistent methodology is used and that differences in the estimates obtainable from different data sources are taken into account. Results We have developed FRAGS, an application framework that uses existing, freely available software components to construct in-frame alignments and estimate coding substitution rates from fragmentary sequence data. Coding sequence substitution estimates for human and chimpanzee sequences, generated by FRAGS, reveal that methodological differences can give rise to significantly different estimates of important substitution parameters. The estimated substitution rates were also used to infer upper-bounds on the amount of sequencing error in the datasets that we have analysed. Conclusion We have developed a system that performs robust estimation of substitution rates for orthologous sequences from a pair of organisms. Our system can be used when fragmentary genomic or transcript data is available from one of the organisms and the other is a completely sequenced genome within the Ensembl database. As well as estimating substitution statistics our system enables the user to manage and query alignment and substitution data. PMID:15005802

Quasi-Static Indentation Analysis of Carbon-Fiber Laminates.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Briggs, Timothy; English, Shawn Allen; Nelson, Stacy Michelle

2015-12-01

A series of quasi - static indentation experiments are conducted on carbon fiber reinforced polymer laminates with a systematic variation of thicknesses and fixture boundary conditions. Different deformation mechanisms and their resulting damage mechanisms are activated b y changing the thickn ess and boundary conditions. The quasi - static indentation experiments have been shown to achieve damage mechanisms similar to impact and penetration, however without strain rate effects. The low rate allows for the detailed analysis on the load response. Moreover, interrupted tests allow for the incremental analysis of various damage mechanisms and pr ogressions. The experimentally tested specimens aremore » non - destructively evaluated (NDE) with optical imaging, ultrasonics and computed tomography. The load displacement responses and the NDE are then utilized in numerical simulations for the purpose of model validation and vetting. The accompanying numerical simulation work serves two purposes. First, the results further reveal the time sequence of events and the meaning behind load dro ps not clear from NDE . Second, the simulations demonstrate insufficiencies in the code and can then direct future efforts for development.« less

RNA editing makes mistakes in plant mitochondria: editing loses sense in transcripts of a rps19 pseudogene and in creating stop codons in coxI and rps3 mRNAs of Oenothera.

PubMed Central

Schuster, W; Brennicke, A

1991-01-01

An intact gene for the ribosomal protein S19 (rps19) is absent from Oenothera mitochondria. The conserved rps19 reading frame found in the mitochondrial genome is interrupted by a termination codon. This rps19 pseudogene is cotranscribed with the downstream rps3 gene and is edited on both sides of the translational stop. Editing, however, changes the amino acid sequence at positions that were well conserved before editing. Other strange editings create translational stops in open reading frames coding for functional proteins. In coxI and rps3 mRNAs CGA codons are edited to UGA stop codons only five and three codons, respectively, downstream to the initiation codon. These aberrant editings in essential open reading frames and in the rps19 pseudogene appear to have been shifted to these positions from other editing sites. These observations suggest a requirement for a continuous evolutionary constraint on the editing specificities in plant mitochondria. Images PMID:1762921

Microbial and Natural Metabolites That Inhibit Splicing: A Powerful Alternative for Cancer Treatment.

PubMed

Martínez-Montiel, Nancy; Rosas-Murrieta, Nora Hilda; Martínez-Montiel, Mónica; Gaspariano-Cholula, Mayra Patricia; Martínez-Contreras, Rebeca D

2016-01-01

In eukaryotes, genes are frequently interrupted with noncoding sequences named introns. Alternative splicing is a nuclear mechanism by which these introns are removed and flanking coding regions named exons are joined together to generate a message that will be translated in the cytoplasm. This mechanism is catalyzed by a complex machinery known as the spliceosome, which is conformed by more than 300 proteins and ribonucleoproteins that activate and regulate the precision of gene expression when assembled. It has been proposed that several genetic diseases are related to defects in the splicing process, including cancer. For this reason, natural products that show the ability to regulate splicing have attracted enormous attention due to its potential use for cancer treatment. Some microbial metabolites have shown the ability to inhibit gene splicing and the molecular mechanism responsible for this inhibition is being studied for future applications. Here, we summarize the main types of natural products that have been characterized as splicing inhibitors, the recent advances regarding molecular and cellular effects related to these molecules, and the applications reported so far in cancer therapeutics.

Mechanisms responsible for imipenem resistance among Pseudomonas aeruginosa clinical isolates exposed to imipenem concentrations within the mutant selection window.

PubMed

Vassilara, Foula; Galani, Irene; Souli, Maria; Papanikolaou, Konstantinos; Giamarellou, Helen; Papadopoulos, Antonios

2017-07-01

The aim of this study was to determine the propensities of imipenem to select for resistant Pseudomonas aeruginosa mutants by determining the mutant prevention concentrations (MPCs) for 9 unrelated clinical isolates and the accession of any relationship with mechanisms of resistance development. The MPC/MIC ratios ranged from 4 to 16. Detection of resistance mechanisms in the mutant derivatives of the nine isolates mainly revealed inactivating mutations in the gene coding for outer membrane protein OprD. Point mutations leading to premature stop codons or amino acid substitution S278P, ≥1bp deletion leading to frameshift mutations and interruption of the oprD by an insertion sequence, were observed. MPC and mutant selection window (MSW) are unique parameters that may guide the implementation of antimicrobial treatment, providing useful information about the necessary imipenem concentration needed in the infection area, in order to avoid the emergence of resistance, especially in clinical situations with high bacterial load. Copyright © 2017 Elsevier Inc. All rights reserved.

Visual pattern image sequence coding

NASA Technical Reports Server (NTRS)

Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

1990-01-01

The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

Learning time-dependent noise to reduce logical errors: real time error rate estimation in quantum error correction

NASA Astrophysics Data System (ADS)

Huo, Ming-Xia; Li, Ying

2017-12-01

Quantum error correction is important to quantum information processing, which allows us to reliably process information encoded in quantum error correction codes. Efficient quantum error correction benefits from the knowledge of error rates. We propose a protocol for monitoring error rates in real time without interrupting the quantum error correction. Any adaptation of the quantum error correction code or its implementation circuit is not required. The protocol can be directly applied to the most advanced quantum error correction techniques, e.g. surface code. A Gaussian processes algorithm is used to estimate and predict error rates based on error correction data in the past. We find that using these estimated error rates, the probability of error correction failures can be significantly reduced by a factor increasing with the code distance.

BplI, a new BcgI-like restriction endonuclease, which recognizes a symmetric sequence.

PubMed Central

Vitkute, J; Maneliene, Z; Petrusyte, M; Janulaitis, A

1997-01-01

Bcg I and Bcg I-like restriction endonucleases cleave double stranded DNA specifically on both sides of their asymmetric recognition sequences which are interrupted by several ambiguous base pairs. Their heterosubunit structure, bifunctionality and stimulation by AdoMet make them different from other classified restriction enzymes. Here we report on a new Bcg I-like restriction endonuclease, Bpl I from Bacillus pumilus , which in contrast to all other Bcg I-like enzymes, recognizes a symmetric interrupted sequence, and which, like Bcg I, cleaves double stranded DNA upstream and downstream of its recognition sequence (8/13)GAGN5CTC(13/8). Like Bcg I, Bpl I is a bifunctional enzyme revealing both DNA cleavage and methyltransferase activities. There are two polypeptides in the homogeneous preparation of Bpl I with molecular masses of approximately 74 and 37 kDa. The sizes of the Bpl I subunits are close to those of Bcg I, but the proportion 1:1 in the final preparation is different from that of 2:1 in Bcg I. Low activity observed with Mg2+increases >100-fold in the presence of AdoMet. Even with AdoMet though, specific cleavage is incomplete. S -adenosylhomocysteine (AdoHcy) or sinefungin can replace AdoMet in the cleavage reaction. AdoHcy activated Bpl I yields complete cleavage of DNA. PMID:9358150

[Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

PubMed

Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

2011-01-01

The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

Suppression of type I interferon production by porcine epidemic diarrhea virus and degradation of CREB-binding protein by nsp1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Qingzhan; Shi, Kaichuang; Yoo, Dongwan, E-mail: dyoo@illinois.edu

Type I interferons (IFN-α/β) are the major components of the innate immune response of hosts, and in turn many viruses have evolved to modulate the host response during infection. We found that the IFN-β production was significantly suppressed during PEDV infection in cells. To identify viral IFN antagonists and to study their suppressive function, viral coding sequences for the entire structural and nonstructural proteins were cloned and expressed. Of 16 PEDV nonstructural proteins (nsps), nsp1, nsp3, nsp7, nsp14, nsp15 and nsp16 were found to inhibit the IFN-β and IRF3 promoter activities. The sole accessory protein ORF3, structure protein envelope (E),more » membrane (M), and nucleocapsid (N) protein were also shown to inhibit such activities. PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP) by degrading CBP. A further study showed that the CBP degradation by nsp1 was proteasome-dependent. Our data demonstrate that PEDV modulates the host innate immune responses by degrading CBP and suppressing ISGs expression. - Highlights: • PEDV modulates the host innate immune system by suppressing the type I interferon production and ISGs expression. • Ten viral proteins were identified as IFN antagonists, and nsp1 was the most potent viral IFN antagonist. • PEDV nsp1 did not interfere the IRF3 phosphorylation and nuclear translocation but interrupted the enhanceosome assembly of IRF3 and CREB-binding protein (CBP). • PEDV nsp1 caused the CBP degradation in the nucleus, which may be the key mechanism for PEDV-mediated IFN downregulation.« less

TRAC-PF1/MOD1 support calculations for the MIST/OTIS program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fujita, R.K.; Knight, T.D.

1984-01-01

We are using the Transient Reactor Analysis Code (TRAC), specifically version TRAC-PF1/MOD1, to perform analyses in support of the MultiLoop Integral-System Test (MIST) and the Once-Through Integral-System (OTIS) experiment program. We have analyzed Geradrohr Dampferzeuger Anlage (GERDA) Test 1605AA to benchmark the TRAC-PF1/MOD1 code against phenomena expected to occur in a raised-loop B and W plant during a small-break loss-of-coolant accident (SBLOCA). These results show that the code can calculate both single- and two-phase natural circulation, flow interruption, boiler-condenser-mode (BCM) heat transfer, and primary-system refill in a B and W-type geometry with low-elevation auxiliary feedwater. 19 figures, 7 tables.

Discrete Cosine Transform Image Coding With Sliding Block Codes

NASA Astrophysics Data System (ADS)

Divakaran, Ajay; Pearlman, William A.

1989-11-01

A transform trellis coding scheme for images is presented. A two dimensional discrete cosine transform is applied to the image followed by a search on a trellis structured code. This code is a sliding block code that utilizes a constrained size reproduction alphabet. The image is divided into blocks by the transform coding. The non-stationarity of the image is counteracted by grouping these blocks in clusters through a clustering algorithm, and then encoding the clusters separately. Mandela ordered sequences are formed from each cluster i.e identically indexed coefficients from each block are grouped together to form one dimensional sequences. A separate search ensues on each of these Mandela ordered sequences. Padding sequences are used to improve the trellis search fidelity. The padding sequences absorb the error caused by the building up of the trellis to full size. The simulations were carried out on a 256x256 image ('LENA'). The results are comparable to any existing scheme. The visual quality of the image is enhanced considerably by the padding and clustering.

DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

PubMed Central

Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

2012-01-01

The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.

PubMed

Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L

1988-04-01

The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.

CRITICA: coding region identification tool invoking comparative analysis

NASA Technical Reports Server (NTRS)

Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

1999-01-01

Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

Flexible manipulation of terahertz wave reflection using polarization insensitive coding metasurfaces.

PubMed

Jiu-Sheng, Li; Ze-Jiang, Zhao; Jian-Quan, Yao

2017-11-27

In order to extend to 3-bit encoding, we propose notched-wheel structures as polarization insensitive coding metasurfaces to control terahertz wave reflection and suppress backward scattering. By using a coding sequence of "00110011…" along x-axis direction and 16 × 16 random coding sequence, we investigate the polarization insensitive properties of the coding metasurfaces. By designing the coding sequences of the basic coding elements, the terahertz wave reflection can be flexibly manipulated. Additionally, radar cross section (RCS) reduction in the backward direction is less than -10dB in a wide band. The present approach can offer application for novel terahertz manipulation devices.

Noncoding sequence classification based on wavelet transform analysis: part I

NASA Astrophysics Data System (ADS)

Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

2017-09-01

DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

PubMed

Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

2017-07-01

In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical basis for the development of a quality traceability system of traditional Chinese medicine based on a two-dimensional code.

Recent shifts in Himalayan vegetation activity trends in response to climatic change and environmental drivers

NASA Astrophysics Data System (ADS)

Mishra, N. B.; Mainali, K. P.

2016-12-01

Climatic changes along with anthropogenic disturbances are causing dramatic ecological impacts in mid to high latitude mountain vegetation including in the Himalayas which are ecologically sensitive environments. Given the challenges associated with in situ vegetation monitoring in the Himalayas, remote sensing based quantification of vegetation dynamics can provide essential ecological information on changes in vegetation activity that may consist of alternative sequence of greening and/or browning periods. This study utilized a trend break analysis procedure for detection of monotonic as well as abrupt (either interruption or reversal) trend changes in smoothed normalized difference vegetation index satellite time-series data over the Himalayas. Overall, trend breaks in vegetation greenness showed high spatio-temporal variability in distribution considering elevation, ecoregion and land cover/use stratifications. Interrupted greening was spatially most dominant in all Himalayan ecoregions followed by abrupt browning. Areas showing trend reversal and monotonic trends appeared minority. Trend type distribution was strongly dependent on elevation as majority of greening (with or without interruption) occurred at lower elevation areas at higher elevation were dominantly. Ecoregion based stratification of trend types highlighted some exception to this elevational dependence as high altitude ecoregions of western Himalayas showed significantly less browning compared to the ecoregions in eastern Himalaya. Land cover/use based analysis of trend distribution showed that interrupted greening was most dominant in closed needleleafed forest following by rainfed cropland and mosaic croplands while interrupted browning most dominant in closed to open herbaceous vegetation found at higher elevation areas followed by closed needleleafed forest and closed to open broad leafed evergreen forests. Spatial analysis of trend break timing showed that for majority of areas experiencing interrupted greening, break in trend occurred later compared to areas with interrupted browning where break trend was observed much earlier. These results have significant implications for environmental management in the context of climate change and ecosystem dynamics in the Himalayas.

Is a Genome a Codeword of an Error-Correcting Code?

PubMed Central

Kleinschmidt, João H.; Silva-Filho, Márcio C.; Bim, Edson; Herai, Roberto H.; Yamagishi, Michel E. B.; Palazzo, Reginaldo

2012-01-01

Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction. PMID:22649495

Effect of analytical treatment interruption and reinitiation of antiretroviral therapy on HIV reservoirs and immunologic parameters in infected individuals.

PubMed

Clarridge, Katherine E; Blazkova, Jana; Einkauf, Kevin; Petrone, Mary; Refsland, Eric W; Justement, J Shawn; Shi, Victoria; Huiting, Erin D; Seamon, Catherine A; Lee, Guinevere Q; Yu, Xu G; Moir, Susan; Sneller, Michael C; Lichterfeld, Mathias; Chun, Tae-Wook

2018-01-01

Therapeutic strategies aimed at achieving antiretroviral therapy (ART)-free HIV remission in infected individuals are under active investigation. Considering the vast majority of HIV-infected individuals experience plasma viral rebound upon cessation of therapy, clinical trials evaluating the efficacy of curative strategies would likely require inclusion of ART interruption. However, it is unclear what impact short-term analytical treatment interruption (ATI) and subsequent reinitiation of ART have on immunologic and virologic parameters of HIV-infected individuals. Here, we show a significant increase of HIV burden in the CD4+ T cells of infected individuals during ATI that was correlated with the level of plasma viral rebound. However, the size of the HIV reservoirs as well as immune parameters, including markers of exhaustion and activation, returned to pre-ATI levels 6-12 months after the study participants resumed ART. Of note, the proportions of near full-length, genome-intact and structurally defective HIV proviral DNA sequences were similar prior to ATI and following reinitiation of ART. In addition, there was no evidence of emergence of antiretroviral drug resistance mutations within intact HIV proviral DNA sequences following reinitiation of ART. These data demonstrate that short-term ATI does not necessarily lead to expansion of the persistent HIV reservoir nor irreparable damages to the immune system in the peripheral blood, warranting the inclusion of ATI in future clinical trials evaluating curative strategies.

Effect of analytical treatment interruption and reinitiation of antiretroviral therapy on HIV reservoirs and immunologic parameters in infected individuals

PubMed Central

Petrone, Mary; Justement, J. Shawn; Shi, Victoria; Huiting, Erin D.; Yu, Xu G.; Moir, Susan; Sneller, Michael C.; Lichterfeld, Mathias

2018-01-01

Therapeutic strategies aimed at achieving antiretroviral therapy (ART)-free HIV remission in infected individuals are under active investigation. Considering the vast majority of HIV-infected individuals experience plasma viral rebound upon cessation of therapy, clinical trials evaluating the efficacy of curative strategies would likely require inclusion of ART interruption. However, it is unclear what impact short-term analytical treatment interruption (ATI) and subsequent reinitiation of ART have on immunologic and virologic parameters of HIV-infected individuals. Here, we show a significant increase of HIV burden in the CD4+ T cells of infected individuals during ATI that was correlated with the level of plasma viral rebound. However, the size of the HIV reservoirs as well as immune parameters, including markers of exhaustion and activation, returned to pre-ATI levels 6–12 months after the study participants resumed ART. Of note, the proportions of near full-length, genome-intact and structurally defective HIV proviral DNA sequences were similar prior to ATI and following reinitiation of ART. In addition, there was no evidence of emergence of antiretroviral drug resistance mutations within intact HIV proviral DNA sequences following reinitiation of ART. These data demonstrate that short-term ATI does not necessarily lead to expansion of the persistent HIV reservoir nor irreparable damages to the immune system in the peripheral blood, warranting the inclusion of ATI in future clinical trials evaluating curative strategies. PMID:29324842

Repairing the sickle cell mutation. I. Specific covalent binding of a photoreactive third strand to the mutated base pair.

PubMed

Broitman, S; Amosova, O; Dolinnaya, N G; Fresco, J R

1999-07-30

A DNA third strand with a 3'-psoralen substituent was designed to form a triplex with the sequence downstream of the T.A mutant base pair of the human sickle cell beta-globin gene. Triplex-mediated psoralen modification of the mutant T residue was sought as an approach to gene repair. The 24-nucleotide purine-rich target sequence switches from one strand to the other and has four pyrimidine interruptions. Therefore, a third strand sequence favorable to two triplex motifs was used, one parallel and the other antiparallel to it. To cope with the pyrimidine interruptions, which weaken third strand binding, 5-methylcytosine and 5-propynyluracil were used in the third strand. Further, a six residue "hook" complementary to an overhang of a linear duplex target was added to the 5'-end of the third strand via a T(4) linker. In binding to the overhang by Watson-Crick pairing, the hook facilitates triplex formation. This third strand also binds specifically to the target within a supercoiled plasmid. The psoralen moiety at the 3'-end of the third strand forms photoadducts to the targeted T with high efficiency. Such monoadducts are known to preferentially trigger reversion of the mutation by DNA repair enzymes.

Accommodating interruptions: A grounded theory of young people with asthma.

PubMed

Hughes, Mary; Savage, Eileen; Andrews, Tom

2018-01-01

The aim of this study was to develop an explanatory theory on the lives of young people with asthma, issues affecting them and the impact of asthma on their day-to-day lives. Accommodating Interruptions is a theory that explains young people's concerns about living with asthma. Although national and international asthma management guidelines exist, it is accepted that the symptom control of asthma among the young people population is poor. This study was undertaken using Classic Grounded Theory. Data were collected through in-depth interviews and clinic consultations with young people aged 11-16 years who had asthma for over 1 year. Data were also collected from participant diaries. Constant comparative analysis, theoretical coding and memo writing were used to develop the substantive theory. The theory explains how young people resolve their main concern of being restricted by Accommodating Interruptions in their lives. They do this by assimilating behaviours in balance finding, moderating influence, fitting in and assuming control minimising the effects of asthma on their everyday lives. The theory of Accommodating Interruptions explains young people's asthma management behaviours in a new way. It allows us to understand how and why young people behave the way they do because they want to participate and be included in everyday activities, events and relationships. The theory adds to the body of knowledge on how young people with asthma live their day-to-day lives and it challenges some existing viewpoints in the literature regarding their behaviours. The findings have implications for developing services to support young people in a more meaningful way as they accommodate the interruptions associated with asthma in their lives. © 2017 John Wiley & Sons Ltd.

Pattern recognition of electronic bit-sequences using a semiconductor mode-locked laser and spatial light modulators

NASA Astrophysics Data System (ADS)

Bhooplapur, Sharad; Akbulut, Mehmetkan; Quinlan, Franklyn; Delfyett, Peter J.

2010-04-01

A novel scheme for recognition of electronic bit-sequences is demonstrated. Two electronic bit-sequences that are to be compared are each mapped to a unique code from a set of Walsh-Hadamard codes. The codes are then encoded in parallel on the spectral phase of the frequency comb lines from a frequency-stabilized mode-locked semiconductor laser. Phase encoding is achieved by using two independent spatial light modulators based on liquid crystal arrays. Encoded pulses are compared using interferometric pulse detection and differential balanced photodetection. Orthogonal codes eight bits long are compared, and matched codes are successfully distinguished from mismatched codes with very low error rates, of around 10-18. This technique has potential for high-speed, high accuracy recognition of bit-sequences, with applications in keyword searches and internet protocol packet routing.

Two Perspectives on the Origin of the Standard Genetic Code

NASA Astrophysics Data System (ADS)

Sengupta, Supratim; Aggarwal, Neha; Bandhu, Ashutosh Vishwa

2014-12-01

The origin of a genetic code made it possible to create ordered sequences of amino acids. In this article we provide two perspectives on code origin by carrying out simulations of code-sequence coevolution in finite populations with the aim of examining how the standard genetic code may have evolved from more primitive code(s) encoding a small number of amino acids. We determine the efficacy of the physico-chemical hypothesis of code origin in the absence and presence of horizontal gene transfer (HGT) by allowing a diverse collection of code-sequence sets to compete with each other. We find that in the absence of horizontal gene transfer, natural selection between competing codes distinguished by differences in the degree of physico-chemical optimization is unable to explain the structure of the standard genetic code. However, for certain probabilities of the horizontal transfer events, a universal code emerges having a structure that is consistent with the standard genetic code.

An algebraic hypothesis about the primeval genetic code architecture.

PubMed

Sánchez, Robersy; Grau, Ricardo

2009-09-01

A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

NASA Astrophysics Data System (ADS)

Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

2017-07-01

DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

Research on Secure Systems and Automatic Programming. Volume I

DTIC Science & Technology

1977-10-14

for the enforcement of adherence to authorization; they include physical limitations, legal codes, social pressures, and the psychological makeup of...systems job statistics and possibly indications of an support instructions. The criteria for their abnormal termination. * inclusion were high execution...interrupt processes, for the output data page. Jobs may also terminate however, use the standard SWI TCH PROCESS instruc- abnormally by executing an

Circular codes revisited: a statistical approach.

PubMed

Gonzalez, D L; Giannerini, S; Rosa, R

2011-04-21

In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

PubMed Central

Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

2013-01-01

Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

PubMed

Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

2014-08-01

The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

Effectiveness of Immediate Verbal Feedback on Trainer Behaviour During Communication Training with Individuals with Intellectual Disability

ERIC Educational Resources Information Center

van Vonderen, A.

2004-01-01

The effect of immediate verbal feedback on trainer behaviour during communication training sessions with individuals with intellectual disability (ID) was assessed. Trainers were six undergraduate university students majoring in psychology. The procedure consisted of interrupting the sequence of trials of training by the supervisor and then giving…

Correlation between Question Intonation and Focus of Interrogation--Evidence from French Dislocated Questions.

ERIC Educational Resources Information Center

Shen, Xiao-nan

This study explores the relationship between question intonation patterns in French using dislocated questions and question-focus (Q- focus). A dislocated question is defined as an interrogative sentence whose sequence is interrupted by the topicalization of a constituent at the left ("Toi, tu viens?"), at the right (Tu viens,…

Evaluation of a Decentralized Wastewater Treatment Technology. INTERNATIONAL WASTEWATER SYSTEMS, INC. MODEL 6000 SEQUENCING BATCH REACTOR SYSTEM

EPA Science Inventory

Evaluation of the IWS Model 6000 SBR began in April 2004 when one SBR was taken off line and cleaned. The verification testing started July 1, 2004 and proceeded without interruption through June 30, 2005. All sixteen four-day sampling events were completed as scheduled, yielding...

Effective Identification of Similar Patients Through Sequential Matching over ICD Code Embedding.

PubMed

Nguyen, Dang; Luo, Wei; Venkatesh, Svetha; Phung, Dinh

2018-04-11

Evidence-based medicine often involves the identification of patients with similar conditions, which are often captured in ICD (International Classification of Diseases (World Health Organization 2013)) code sequences. With no satisfying prior solutions for matching ICD-10 code sequences, this paper presents a method which effectively captures the clinical similarity among routine patients who have multiple comorbidities and complex care needs. Our method leverages the recent progress in representation learning of individual ICD-10 codes, and it explicitly uses the sequential order of codes for matching. Empirical evaluation on a state-wide cancer data collection shows that our proposed method achieves significantly higher matching performance compared with state-of-the-art methods ignoring the sequential order. Our method better identifies similar patients in a number of clinical outcomes including readmission and mortality outlook. Although this paper focuses on ICD-10 diagnosis code sequences, our method can be adapted to work with other codified sequence data.

Representation of DNA sequences with virtual potentials and their processing by (SEQREP) Kohonen self-organizing maps.

PubMed

Aires-de-Sousa, João; Aires-de-Sousa, Luisa

2003-01-01

We propose representing individual positions in DNA sequences by virtual potentials generated by other bases of the same sequence. This is a compact representation of the neighbourhood of a base. The distribution of the virtual potentials over the whole sequence can be used as a representation of the entire sequence (SEQREP code). It is a flexible code, with a length independent of the sequence size, does not require previous alignment, and is convenient for processing by neural networks or statistical techniques. To evaluate its biological significance, the SEQREP code was used for training Kohonen self-organizing maps (SOMs) in two applications: (a) detection of Alu sequences, and (b) classification of sequences encoding for HIV-1 envelope glycoprotein (env) into subtypes A-G. It was demonstrated that SOMs clustered sequences belonging to different classes into distinct regions. For independent test sets, very high rates of correct predictions were obtained (97% in the first application, 91% in the second). Possible areas of application of SEQREP codes include functional genomics, phylogenetic analysis, detection of repetitions, database retrieval, and automatic alignment. Software for representing sequences by SEQREP code, and for training Kohonen SOMs is made freely available from http://www.dq.fct.unl.pt/qoa/jas/seqrep. Supplementary material is available at http://www.dq.fct.unl.pt/qoa/jas/seqrep/bioinf2002

CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

PubMed

Zhou, Carol L Ecale

2015-01-01

In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

Complete Coding Genome Sequence for Mogiana Tick Virus, a Jingmenvirus Isolated from Ticks in Brazil

DTIC Science & Technology

2017-05-04

and capable of infecting a wide range of animal hosts (1–5). Here, we report the complete coding genome sequence (i.e., only missing portions of...segmented nature of the genome was not under- stood. Therefore, only the two genome segments with detectable sequence homolo- gies to flaviviruses were...originally reported (2). We revisited the data set of Maruyama et al. (2) and assembled the complete coding sequences for all four genome segments. We

Series and parallel arc-fault circuit interrupter tests.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Jay Dean; Fresquez, Armando J.; Gudgel, Bob

2013-07-01

While the 2011 National Electrical Codeª (NEC) only requires series arc-fault protection, some arc-fault circuit interrupter (AFCI) manufacturers are designing products to detect and mitigate both series and parallel arc-faults. Sandia National Laboratories (SNL) has extensively investigated the electrical differences of series and parallel arc-faults and has offered possible classification and mitigation solutions. As part of this effort, Sandia National Laboratories has collaborated with MidNite Solar to create and test a 24-string combiner box with an AFCI which detects, differentiates, and de-energizes series and parallel arc-faults. In the case of the MidNite AFCI prototype, series arc-faults are mitigated by openingmore » the PV strings, whereas parallel arc-faults are mitigated by shorting the array. A range of different experimental series and parallel arc-fault tests with the MidNite combiner box were performed at the Distributed Energy Technologies Laboratory (DETL) at SNL in Albuquerque, NM. In all the tests, the prototype de-energized the arc-faults in the time period required by the arc-fault circuit interrupt testing standard, UL 1699B. The experimental tests confirm series and parallel arc-faults can be successfully mitigated with a combiner box-integrated solution.« less

Quantized phase coding and connected region labeling for absolute phase retrieval.

PubMed

Chen, Xiangcheng; Wang, Yuwei; Wang, Yajun; Ma, Mengchao; Zeng, Chunnian

2016-12-12

This paper proposes an absolute phase retrieval method for complex object measurement based on quantized phase-coding and connected region labeling. A specific code sequence is embedded into quantized phase of three coded fringes. Connected regions of different codes are labeled and assigned with 3-digit-codes combining the current period and its neighbors. Wrapped phase, more than 36 periods, can be restored with reference to the code sequence. Experimental results verify the capability of the proposed method to measure multiple isolated objects.

Functional interrogation of non-coding DNA through CRISPR genome editing

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

2017-01-01

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

Memorization of Sequences of Movements of the Right or the Left Hand by Right- and Left-Handers: Vector Coding.

PubMed

Bobrova, E V; Bogacheva, I N; Lyakhovetskii, V A; Fabinskaja, A A; Fomina, E V

2017-01-01

In order to test the hypothesis of hemisphere specialization for different types of information coding (the right hemisphere, for positional coding; the left one, for vector coding), we analyzed the errors of right and left-handers during a task involving the memorization of sequences of movements by the left or the right hand, which activates vector coding by changing the order of movements in memorized sequences. The task was first performed by the right or the left hand, then by the opposite hand. It was found that both'right- and left-handers use the information about the previous movements of the dominant hand, but not of the non-dom" inant one. After changing the hand, right-handers use the information about previous movements of the second hand, while left-handers do not. We compared our results with the data of previous experiments, in which positional coding was activated, and concluded that both right- and left-handers use vector coding for memorizing the sequences of their dominant hands and positional coding for memorizing the sequences of non-dominant hand. No similar patterns of errors were found between right- and left-handers after changing the hand, which suggests that in right- and left-handersthe skills are transferred in different ways depending on the type of coding.

Posttest analysis of MIST Test 320201 using TRAC-PF1/MOD1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siebe, D.A.; Steiner, J.L.; Boyack, B.E.

A posttest calculation and analysis of Multi-Loop Integral System Test 320201, a small-break loss-of-coolant accident (SBLOCA) test with a scaled 50-cm{sup 2} cold-leg pump discharge leak, has been completed and is reported herein. It was one in a series of tests, with leak size varied parametrically. Scaled leak sizes included 5, 10, (the nominal, Test 3109AA), and 50 cm{sub 2}. The test exhibited the major post-SBLOCA phenomena, as expected, including depressurization to saturation, interruption of loop flow, boiler-condenser mode cooling, refill, and postrefill cooldown. Full high-pressure injection and auxiliary feedwater were available, reactor coolant pumps were not available, and reactor-vesselmore » vent valves and guard heaters were automatically controlled. Constant level control in the steam-generator (SG) secondaries was used after SG-secondary refill; and symmetric SG pressure control was also used. The sequence of events seen in this test was similar to the sequence of events for much of the nominal test except that events occurred in a shorter time frame as the system inventory was reduced and the system depressurized at a faster rate. The calculation was performed using TRAC-PFL/MOD 1. Agreement between test data and the calculation was generally reasonable. All major trends and phenomena were correctly predicted. We believe that the correct conclusions about trends and phenomena will be reached if the code is used in similar applications.« less

Posttest analysis of MIST Test 320201 using TRAC-PF1/MOD1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siebe, D.A.; Steiner, J.L.; Boyack, B.E.

A posttest calculation and analysis of Multi-Loop Integral System Test 320201, a small-break loss-of-coolant accident (SBLOCA) test with a scaled 50-cm[sup 2] cold-leg pump discharge leak, has been completed and is reported herein. It was one in a series of tests, with leak size varied parametrically. Scaled leak sizes included 5, 10, (the nominal, Test 3109AA), and 50 cm[sub 2]. The test exhibited the major post-SBLOCA phenomena, as expected, including depressurization to saturation, interruption of loop flow, boiler-condenser mode cooling, refill, and postrefill cooldown. Full high-pressure injection and auxiliary feedwater were available, reactor coolant pumps were not available, and reactor-vesselmore » vent valves and guard heaters were automatically controlled. Constant level control in the steam-generator (SG) secondaries was used after SG-secondary refill; and symmetric SG pressure control was also used. The sequence of events seen in this test was similar to the sequence of events for much of the nominal test except that events occurred in a shorter time frame as the system inventory was reduced and the system depressurized at a faster rate. The calculation was performed using TRAC-PFL/MOD 1. Agreement between test data and the calculation was generally reasonable. All major trends and phenomena were correctly predicted. We believe that the correct conclusions about trends and phenomena will be reached if the code is used in similar applications.« less

Demyelinating and ischemic brain diseases: detection algorithm through regular magnetic resonance images

NASA Astrophysics Data System (ADS)

Castillo, D.; Samaniego, René; Jiménez, Y.; Cuenca, L.; Vivanco, O.; Rodríguez-Álvarez, M. J.

2017-09-01

This work presents the advance to development of an algorithm for automatic detection of demyelinating lesions and cerebral ischemia through magnetic resonance images, which have contributed in paramount importance in the diagnosis of brain diseases. The sequences of images to be used are T1, T2, and FLAIR. Brain demyelination lesions occur due to damage of the myelin layer of nerve fibers; and therefore this deterioration is the cause of serious pathologies such as multiple sclerosis (MS), leukodystrophy, disseminated acute encephalomyelitis. Cerebral or cerebrovascular ischemia is the interruption of the blood supply to the brain, thus interrupting; the flow of oxygen and nutrients needed to maintain the functioning of brain cells. The algorithm allows the differentiation between these lesions.

CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

PubMed Central

Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

2004-01-01

The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

GATA: A graphic alignment tool for comparative sequenceanalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nix, David A.; Eisen, Michael B.

2005-01-01

Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

PubMed

Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

2012-01-01

In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

PubMed

Suyama, Mikita; Lathe, Warren C; Bork, Peer

2005-10-10

We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

Injury and Compensation Claims Module Maintenance Manual

DTIC Science & Technology

1989-01-01

DUTY* 15. IF INTERRUPTED, SHOW DATES RESUMED HEALTH BENEFIT OPTIONAL INSURANCE 16. IF HEALTH BENEFITS 6oPTION HAS CHANGED FEHB NUMBER DATE 17. *Press...INCLUSIVE DATES OF COP, FROM: .......... TO: 24. HEALTH BENEFIT (HBS) CODE, IF ENROLLED 25. SHOW DATE THROUGH WHICH HBS LAST MADE 26. ATTENDING...TO INJURY? 24. DUTY AFFORDED 11 MONTHS WORK? 25. TOTAL LENGTH FEDERAL CIVIL SERVICE, YRS. MOS. HEALTH BENEFITS AND OPTIONAL LIFE INSURANCE 26

Design of the Bus Interface Unit for the Distributed Processor/Memory System.

DTIC Science & Technology

1976-12-01

microroutine flowchart developed. Once this had been done , a high-speed, flexible microprocessor that would be adapt- able to a hardware...routine) was translated Into microcode and provide the mnemonic code and flowchart , Chapter V summarizes and discusses actual system construction...Fig. 11. This diagram shows that the BIU is driven by Interrupt stimuli which select the beginn ing address of the appropriate microroutine rather

Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function.

PubMed

Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee

2013-08-01

Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

Functional interrogation of non-coding DNA through CRISPR genome editing.

PubMed

Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

2017-05-15

Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Caregiver Person-Centeredness and Behavioral Symptoms during Mealtime Interactions: Development and Feasibility of a Coding Scheme

PubMed Central

Gilmore-Bykovskyi, Andrea L.

2015-01-01

Mealtime behavioral symptoms are distressing and frequently interrupt eating for the individual experiencing them and others in the environment. In order to enable identification of potential antecedents to mealtime behavioral symptoms, a computer-assisted coding scheme was developed to measure caregiver person-centeredness and behavioral symptoms for nursing home residents with dementia during mealtime interactions. The purpose of this pilot study was to determine the acceptability and feasibility of procedures for video-capturing naturally-occurring mealtime interactions between caregivers and residents with dementia, to assess the feasibility, ease of use, and inter-observer reliability of the coding scheme, and to explore the clinical utility of the coding scheme. Trained observers coded 22 observations. Data collection procedures were feasible and acceptable to caregivers, residents and their legally authorized representatives. Overall, the coding scheme proved to be feasible, easy to execute and yielded good to very good inter-observer agreement following observer re-training. The coding scheme captured clinically relevant, modifiable antecedents to mealtime behavioral symptoms, but would be enhanced by the inclusion of measures for resident engagement and consolidation of items for measuring caregiver person-centeredness that co-occurred and were difficult for observers to distinguish. PMID:25784080

A Code Division Multiple Access Communication System for the Low Frequency Band.

DTIC Science & Technology

1983-04-01

frequency channels spread-spectrum communication / complex sequences, orthogonal codes impulsive noise 20. ABSTRACT (Continue an reverse side It...their transmissions with signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal ...signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal sequences and thus log 2 M

Users guide for EASI graphics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sasser, D.W.

1978-03-01

EASI (Estimate of Adversary Sequence Interruption) is an analytical technique for measuring the effectiveness of physical protection systems. EASI Graphics is a computer graphics extension of EASI which provides a capability for performing sensitivity and trade-off analyses of the parameters of a physical protection system. This document reports on the implementation of EASI Graphics and illustrates its application with some examples.

A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

PubMed

Kress, W John; Erickson, David L

2007-06-06

A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

Streamlined Genome Sequence Compression using Distributed Source Coding

PubMed Central

Wang, Shuang; Jiang, Xiaoqian; Chen, Feng; Cui, Lijuan; Cheng, Samuel

2014-01-01

We aim at developing a streamlined genome sequence compression algorithm to support alternative miniaturized sequencing devices, which have limited communication, storage, and computation power. Existing techniques that require heavy client (encoder side) cannot be applied. To tackle this challenge, we carefully examined distributed source coding theory and developed a customized reference-based genome compression protocol to meet the low-complexity need at the client side. Based on the variation between source and reference, our protocol will pick adaptively either syndrome coding or hash coding to compress subsequences of changing code length. Our experimental results showed promising performance of the proposed method when compared with the state-of-the-art algorithm (GRS). PMID:25520552

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

PubMed

Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced.

Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing

PubMed Central

Dasenko, Mark A.

2015-01-01

In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced. PMID:26716693

Intelligent behavior generator for autonomous mobile robots using planning-based AI decision making and supervisory control logic

NASA Astrophysics Data System (ADS)

Shah, Hitesh K.; Bahl, Vikas; Martin, Jason; Flann, Nicholas S.; Moore, Kevin L.

2002-07-01

In earlier research the Center for Self-Organizing and Intelligent Systems (CSOIS) at Utah State University (USU) have been funded by the US Army Tank-Automotive and Armaments Command's (TACOM) Intelligent Mobility Program to develop and demonstrate enhanced mobility concepts for unmanned ground vehicles (UGVs). One among the several out growths of this work has been the development of a grammar-based approach to intelligent behavior generation for commanding autonomous robotic vehicles. In this paper we describe the use of this grammar for enabling autonomous behaviors. A supervisory task controller (STC) sequences high-level action commands (taken from the grammar) to be executed by the robot. It takes as input a set of goals and a partial (static) map of the environment and produces, from the grammar, a flexible script (or sequence) of the high-level commands that are to be executed by the robot. The sequence is derived by a planning function that uses a graph-based heuristic search (A* -algorithm). Each action command has specific exit conditions that are evaluated by the STC following each task completion or interruption (in the case of disturbances or new operator requests). Depending on the system's state at task completion or interruption (including updated environmental and robot sensor information), the STC invokes a reactive response. This can include sequencing the pending tasks or initiating a re-planning event, if necessary. Though applicable to a wide variety of autonomous robots, an application of this approach is demonstrated via simulations of ODIS, an omni-directional inspection system developed for security applications.

The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

PubMed Central

Pietan, Lucas L.; Spradling, Theresa A.

2016-01-01

In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

PubMed

2004-12-09

We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

PubMed

Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

2015-01-01

The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

A Constant-Field Interrupted Resonance System for Percutaneous Electromagnetic Measurement of Blood Flow

PubMed Central

Kolin, Alexander; Steele, James R.; Imai, James S.; Macalpin, Rex N.

1974-01-01

A combination of deformable flow probes of negligible lateral dimensions with an electronic circuit capable of providing a prolonged plateau of dB/dt = 0 and of sampling the flow signal at the end of this interval permits electromagnetic measurement of blood flow with a reliable zero base line secured by switching off the magnet. An extracorporeal magnet provides the magnetic field. The flow transducer is introduced into the vascular system percutaneously through a standard angiographic catheter by conventional technique. The idea of the current generator can be described as “principle of interrupted resonance.” The current wave form can be described as a sequence of disconnected bisected sine waves joined at the apices by horizontal current plateaus where di/dt is strictly zero. Images PMID:4275395

Golay sequences coded coherent optical OFDM for long-haul transmission

NASA Astrophysics Data System (ADS)

Qin, Cui; Ma, Xiangrong; Hua, Tao; Zhao, Jing; Yu, Huilong; Zhang, Jian

2017-09-01

We propose to use binary Golay sequences in coherent optical orthogonal frequency division multiplexing (CO-OFDM) to improve the long-haul transmission performance. The Golay sequences are generated by binary Reed-Muller codes, which have low peak-to-average power ratio and certain error correction capability. A low-complexity decoding algorithm for the Golay sequences is then proposed to recover the signal. Under same spectral efficiency, the QPSK modulated OFDM with binary Golay sequences coding with and without discrete Fourier transform (DFT) spreading (DFTS-QPSK-GOFDM and QPSK-GOFDM) are compared with the normal BPSK modulated OFDM with and without DFT spreading (DFTS-BPSK-OFDM and BPSK-OFDM) after long-haul transmission. At a 7% forward error correction code threshold (Q2 factor of 8.5 dB), it is shown that DFTS-QPSK-GOFDM outperforms DFTS-BPSK-OFDM by extending the transmission distance by 29% and 18%, in non-dispersion managed and dispersion managed links, respectively.

Interruption of Neural Function.

DTIC Science & Technology

1987-05-01

applcbse) University of Colorado I Be. ADDRESS (City. Stele and ZIP Code) 10. SOURCE OF FUNDING NOS. Campus Box B-19 PROGRAM PROJECT TASK WORK UNIT Boulder...rectification, frequency-sensitive phenomena, safety, and some effects on bio - logical systems," invited review, Charles Polk, Ed., CRC Handbook of Biological...experimental test", Mathematical Bio - Sciences, Vol. 29, pp. 235-253, 1978. [131 Kuf1er. S. WV., J. G. Nicholls, and A. R. Martin, "From Nettron to Brain

BASiNET-BiologicAl Sequences NETwork: a case study on coding and non-coding RNAs identification.

PubMed

Ito, Eric Augusto; Katahira, Isaque; Vicente, Fábio Fernandes da Rocha; Pereira, Luiz Filipe Protasio; Lopes, Fabrício Martins

2018-06-05

With the emergence of Next Generation Sequencing (NGS) technologies, a large volume of sequence data in particular de novo sequencing was rapidly produced at relatively low costs. In this context, computational tools are increasingly important to assist in the identification of relevant information to understand the functioning of organisms. This work introduces BASiNET, an alignment-free tool for classifying biological sequences based on the feature extraction from complex network measurements. The method initially transform the sequences and represents them as complex networks. Then it extracts topological measures and constructs a feature vector that is used to classify the sequences. The method was evaluated in the classification of coding and non-coding RNAs of 13 species and compared to the CNCI, PLEK and CPC2 methods. BASiNET outperformed all compared methods in all adopted organisms and datasets. BASiNET have classified sequences in all organisms with high accuracy and low standard deviation, showing that the method is robust and non-biased by the organism. The proposed methodology is implemented in open source in R language and freely available for download at https://cran.r-project.org/package=BASiNET.

The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

PubMed

Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

2016-01-01

Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region

PubMed Central

Kress, W. John; Erickson, David L.

2007-01-01

Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588

A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

PubMed

Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

2017-03-01

Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

A DS-UWB Cognitive Radio System Based on Bridge Function Smart Codes

NASA Astrophysics Data System (ADS)

Xu, Yafei; Hong, Sheng; Zhao, Guodong; Zhang, Fengyuan; di, Jinshan; Zhang, Qishan

This paper proposes a direct-sequence UWB Gaussian pulse of cognitive radio systems based on bridge function smart sequence matrix and the Gaussian pulse. As the system uses the spreading sequence code, that is the bridge function smart code sequence, the zero correlation zones (ZCZs) which the bridge function sequences' auto-correlation functions had, could reduce multipath fading of the pulse interference. The Modulated channel signal was sent into the IEEE 802.15.3a UWB channel. We analysis the ZCZs's inhibition to the interference multipath interference (MPI), as one of the main system sources interferences. The simulation in SIMULINK/MATLAB is described in detail. The result shows the system has better performance by comparison with that employing Walsh sequence square matrix, and it was verified by the formula in principle.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes.

PubMed Central

Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J

2002-01-01

Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388

Operation CeaseFire-New Orleans: an infectious disease model for addressing community recidivism from penetrating trauma.

PubMed

McVey, Erin; Duchesne, Juan C; Sarlati, Siavash; O'Neal, Michael; Johnson, Kelly; Avegno, Jennifer

2014-07-01

CeaseFire, using an infectious disease approach, addresses violence by partnering hospital resources with the community by providing violence interruption and community-based services for an area roughly composed of a single city zip code (70113). Community-based violence interrupters start in the trauma center from the moment penetrating trauma occurs, through hospital stay, and in the community after release. This study interprets statistics from this pilot program, begun May 2012. We hypothesize a decrease in penetrating trauma rates in the target area compared with others after program implementation. This was a 3-year prospective data collection of trauma registry from May 2010 to May 2013. All intentional, target area, penetrating trauma treated at our Level I trauma center received immediate activation of CeaseFire personnel. Incidences of violent trauma and rates of change, by zip code, were compared with the same period for 2 years before implementation. During this period, the yearly incidence of penetrating trauma in Orleans Parish increased. Four of the highest rates were found in adjacent zip codes: 70112, 70113, 70119, and 70125. Average rates per 100,000 were 722.7, 523.6, 286.4, and 248, respectively. These areas represent four of the six zip codes citywide that saw year-to-year increases in violent trauma during this period. Zip 70113 saw a lower rate of rise in trauma compared with 70112 and a higher but comparable rise compared with that of 70119 and 70125. Hospital-based intervention programs that partner with culturally appropriate personnel and resources outside the institution walls have potential to have meaningful impact over the long term. While few conclusions of the effect of such a program can be drawn in a 12-month period, we anticipate long-term changes in the numbers of penetrating injuries in the target area and in the rest of the city as this program expands. Therapeutic study, level IV.

Sensory Coding by Cerebellar Mossy Fibres through Inhibition-Driven Phase Resetting and Synchronisation

PubMed Central

Holtzman, Tahl; Jörntell, Henrik

2011-01-01

Temporal coding of spike-times using oscillatory mechanisms allied to spike-time dependent plasticity could represent a powerful mechanism for neuronal communication. However, it is unclear how temporal coding is constructed at the single neuronal level. Here we investigate a novel class of highly regular, metronome-like neurones in the rat brainstem which form a major source of cerebellar afferents. Stimulation of sensory inputs evoked brief periods of inhibition that interrupted the regular firing of these cells leading to phase-shifted spike-time advancements and delays. Alongside phase-shifting, metronome cells also behaved as band-pass filters during rhythmic sensory stimulation, with maximal spike-stimulus synchronisation at frequencies close to the idiosyncratic firing frequency of each neurone. Phase-shifting and band-pass filtering serve to temporally align ensembles of metronome cells, leading to sustained volleys of near-coincident spike-times, thereby transmitting synchronised sensory information to downstream targets in the cerebellar cortex. PMID:22046297

Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

PubMed Central

2012-01-01

Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

Nonspatial Sequence Coding in CA1 Neurons

PubMed Central

Allen, Timothy A.; Salz, Daniel M.; McKenzie, Sam

2016-01-01

The hippocampus is critical to the memory for sequences of events, a defining feature of episodic memory. However, the fundamental neuronal mechanisms underlying this capacity remain elusive. While considerable research indicates hippocampal neurons can represent sequences of locations, direct evidence of coding for the memory of sequential relationships among nonspatial events remains lacking. To address this important issue, we recorded neural activity in CA1 as rats performed a hippocampus-dependent sequence-memory task. Briefly, the task involves the presentation of repeated sequences of odors at a single port and requires rats to identify each item as “in sequence” or “out of sequence”. We report that, while the animals' location and behavior remained constant, hippocampal activity differed depending on the temporal context of items—in this case, whether they were presented in or out of sequence. Some neurons showed this effect across items or sequence positions (general sequence cells), while others exhibited selectivity for specific conjunctions of item and sequence position information (conjunctive sequence cells) or for specific probe types (probe-specific sequence cells). We also found that the temporal context of individual trials could be accurately decoded from the activity of neuronal ensembles, that sequence coding at the single-cell and ensemble level was linked to sequence memory performance, and that slow-gamma oscillations (20–40 Hz) were more strongly modulated by temporal context and performance than theta oscillations (4–12 Hz). These findings provide compelling evidence that sequence coding extends beyond the domain of spatial trajectories and is thus a fundamental function of the hippocampus. SIGNIFICANCE STATEMENT The ability to remember the order of life events depends on the hippocampus, but the underlying neural mechanisms remain poorly understood. Here we addressed this issue by recording neural activity in hippocampal region CA1 while rats performed a nonspatial sequence memory task. We found that hippocampal neurons code for the temporal context of items (whether odors were presented in the correct or incorrect sequential position) and that this activity is linked with memory performance. The discovery of this novel form of temporal coding in hippocampal neurons advances our fundamental understanding of the neurobiology of episodic memory and will serve as a foundation for our cross-species, multitechnique approach aimed at elucidating the neural mechanisms underlying memory impairments in aging and dementia. PMID:26843637

Repeats of base oligomers as the primordial coding sequences of the primeval earth and their vestiges in modern genes.

PubMed

Ohno, S

1984-01-01

Three outstanding properties uniquely qualify repeats of base oligomers as the primordial coding sequences of all polypeptide chains. First, when compared with randomly generated base sequences in general, they are more likely to have long open reading frames. Second, periodical polypeptide chains specified by such repeats are more likely to assume either alpha-helical or beta-sheet secondary structures than are polypeptide chains of random sequence. Third, provided that the number of bases in the oligomeric unit is not a multiple of 3, these internally repetitious coding sequences are impervious to randomly sustained base substitutions, deletions, and insertions. This is because the recurring periodicity of their polypeptide chains is given by three consecutive copies of the oligomeric unit translated in three different reading frames. Accordingly, when one reading frame is open, the other two are automatically open as well, all three being capable of coding for polypeptide chains of identical periodicity. Under this circumstance, a frame shift due to the deletion or insertion of a number of bases that is not a multiple of 3 fails to alter the down-stream amino acid sequence, and even a base change causing premature chain-termination can silence only one of the three potential coding units. Newly arisen coding sequences in modern organisms are oligomeric repeats, and most of the older genes retain various vestiges of their original internal repetitions. Some of the genes (e.g., oncogenes) have even inherited the property of being impervious to randomly sustained base changes.

Comparison of simple sequence repeats in 19 Archaea.

PubMed

Trivedi, S

2006-12-05

All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

PubMed

Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

2016-03-01

Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

Coherent direct sequence optical code multiple access encoding-decoding efficiency versus wavelength detuning.

PubMed

Pastor, D; Amaya, W; García-Olcina, R; Sales, S

2007-07-01

We present a simple theoretical model of and the experimental verification for vanishing of the autocorrelation peak due to wavelength detuning on the coding-decoding process of coherent direct sequence optical code multiple access systems based on a superstructured fiber Bragg grating. Moreover, the detuning vanishing effect has been explored to take advantage of this effect and to provide an additional degree of multiplexing and/or optical code tuning.

Molecular Characterization of the Calvin Cycle Enzyme Phosphoribulokinase in the Stramenopile Alga Vaucheria litorea and the Plastid Hosting Mollusc Elysia chlorotica

PubMed Central

Rumpho, Mary E.; Pochareddy, Sirisha; Worful, Jared M.; Summer, Elizabeth J.; Bhattacharya, Debashish; Pelletreau, Karen N.; Tyler, Mary S.; Lee, Jungho; Manhart, James R.; Soule, Kara M.

2009-01-01

Phosphoribulokinase (PRK), a nuclear-encoded plastid-localized enzyme unique to the photosynthetic carbon reduction (Calvin) cycle, was cloned and characterized from the stramenopile alga Vaucheria litorea. This alga is the source of plastids for the mollusc (sea slug) Elysia chlorotica which enable the animal to survive for months solely by photoautotrophic CO2 fixation. The 1633-bp V. litorea prk gene was cloned and the coding region, found to be interrupted by four introns, encodes a 405-amino acid protein. This protein contains the typical bipartite target sequence expected of nuclear-encoded proteins that are directed to complex (i.e. four membrane-bound) algal plastids. De novo synthesis of PRK and enzyme activity were detected in E. chlorotica in spite of having been starved of V. litorea for several months. Unlike the algal enzyme, PRK in the sea slug did not exhibit redox regulation. Two copies of partial PRK-encoding genes were isolated from both sea slug and aposymbiotic sea slug egg DNA using PCR. Each copy contains the nucleotide region spanning exon 1 and part of exon 2 of V. litorea prk, including the bipartite targeting peptide. However, the larger prk fragment also includes intron 1. The exon and intron sequences of prk in E. chlorotica and V. litorea are nearly identical. These data suggest that PRK is differentially regulated in V. litorea and E. chlorotica and at least a portion of the V. litorea nuclear PRK gene is present in sea slugs that have been starved for several months. PMID:19995736

TICK: Transparent Incremental Checkpointing at Kernel Level

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrini, Fabrizio; Gioiosa, Roberto

2004-10-25

TICK is a software package implemented in Linux 2.6 that allows the save and restore of user processes, without any change to the user code or binary. With TICK a process can be suspended by the Linux kernel upon receiving an interrupt and saved in a file. This file can be later thawed in another computer running Linux (potentially the same computer). TICK is implemented as a Linux kernel module, in the Linux version 2.6.5

Verified OS Interface Code Synthesis

DTIC Science & Technology

2016-12-01

in this case we are using the ARMv7 processor architecture ). The application accomplishes this task by issuing the swi (“software interrupt...manual version 4.0.0) on the ARM architecture . To alleviate this problem,we developed an XML-based domain specific language (DSL) in which each...Untyped Retype Table 2.1: seL4 Architecture Independent System Calls. of r2, r3, r4 and r5 into the message registers of the thread’s IPC buffer and

FOURTH SEMINAR TO THE MEMORY OF D.N. KLYSHKO: Algebraic solution of the synthesis problem for coded sequences

NASA Astrophysics Data System (ADS)

Leukhin, Anatolii N.

2005-08-01

The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups.

Treatment interruptions and non-adherence with imatinib and associated healthcare costs: a retrospective analysis among managed care patients with chronic myelogenous leukaemia.

PubMed

Darkow, Theodore; Henk, Henry J; Thomas, Simu K; Feng, Weiwei; Baladi, Jean-Francois; Goldberg, George A; Hatfield, Alan; Cortes, Jorge

2007-01-01

Identify treatment interruptions and non-adherence with imatinib; examine the clinical and patient characteristics related to treatment interruptions and non-adherence; and estimate the association between treatment interruptions and non-adherence with imatinib and healthcare costs for US managed care patients with chronic myeloid leukaemia (CML). This retrospective analysis utilised electronic healthcare claims data from a US managed care provider. Adult patients with CML (as determined by International Classification of Diseases, ninth revision, Clinical Modification [ICD-9-CM] diagnosis code) were identified who began treatment with imatinib from 1 June 2001 through 31 March 2004. Treatment interruptions (i.e. failure to refill imatinib within 30 days from the run-out date of the prior prescription) were identified during the 12-month follow-up period. Medication possession ratio (MPR), calculated as total days' supply of imatinib divided by 365, was also examined. Healthcare costs (i.e. paid amounts for all prescription medications and medical services received, including health plan and patient liability) were examined in three ways: (i) total healthcare costs; (ii) total healthcare costs exclusive of imatinib costs; and (iii) total medical costs. All costs were converted to US dollars (2004 values) using the medical component of the Consumer Price Index. MPR was modelled using ordinary least squares regression. Presence of treatment interruptions was modelled using logistic regression. The association between MPR and healthcare costs was estimated using a generalised linear model specified with a gamma error distribution and a log link. All models included adjustment for age, gender, number of concomitant medications, starting dose of imatinib and cancer complexity. A total of 267 patients were identified. Average age was approximately 50 years, and 43% were women. Mean MPR was 77.7%, with 31% of patients having a treatment interruption. However, all of these patients resumed imatinib within the study period. In this population, MPR decreased as the number of concomitant medications increased (p = 0.002), and was lower among women (p = 0.003), patients with high cancer complexity (p = 0.003) and patients with a higher starting dose of imatinib (p = 0.04). Women were approximately twice as likely as men to have a treatment interruption (p = 0.009), as were patients with a high cancer complexity (p = 0.03). After adjusting for the aforementioned covariates, MPR was found to be inversely associated with healthcare costs excluding imatinib (p < 0.001) and medical costs (p < 0.001). A 10% point difference in MPR was associated with a 14% difference in healthcare costs excluding imatinib and a 15% difference in medical costs. For example, patients with an MPR of 75% incur an additional 4072 US dollars in medical costs annually compared with patients with an MPR of 85%. Treatment interruptions and non-adherence with imatinib, both of which could lead to undesired clinical and economic outcomes, appear to be prevalent. Physicians and pharmacists should educate patients and closely monitor adherence to therapy, as improving adherence and limiting treatment interruptions may not only optimise clinical outcomes but also reduce the economic burden of CML.

Evaluating the protein coding potential of exonized transposable element sequences

PubMed Central

Piriyapongsa, Jittima; Rutledge, Mark T; Patel, Sanil; Borodovsky, Mark; Jordan, I King

2007-01-01

Background Transposable element (TE) sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS) and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM) approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently exonized but unlikely to encode protein sequences. Conclusion The exaptation of the numerous TE sequences found in exons as bona fide protein coding sequences may prove to be far less common than has been suggested by the analysis of complete genomes. We hypothesize that many exonized TE sequences actually function as post-transcriptional regulators of gene expression, rather than coding sequences, which may act through a variety of double stranded RNA related regulatory pathways. Indeed, their relatively high copy numbers and similarity to sequences dispersed throughout the genome suggests that exonized TE sequences could serve as master regulators with a wide scope of regulatory influence. Reviewers: This article was reviewed by Itai Yanai, Kateryna D. Makova, Melissa Wilson (nominated by Kateryna D. Makova) and Cedric Feschotte (nominated by John M. Logsdon Jr.). PMID:18036258

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA

PubMed Central

Wright, Imogen A.; Travers, Simon A.

2014-01-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. PMID:24861618

Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

PubMed Central

Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia

2011-01-01

Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358

Speech processing using conditional observable maximum likelihood continuity mapping

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hogden, John; Nix, David

A computer implemented method enables the recognition of speech and speech characteristics. Parameters are initialized of first probability density functions that map between the symbols in the vocabulary of one or more sequences of speech codes that represent speech sounds and a continuity map. Parameters are also initialized of second probability density functions that map between the elements in the vocabulary of one or more desired sequences of speech transcription symbols and the continuity map. The parameters of the probability density functions are then trained to maximize the probabilities of the desired sequences of speech-transcription symbols. A new sequence ofmore » speech codes is then input to the continuity map having the trained first and second probability function parameters. A smooth path is identified on the continuity map that has the maximum probability for the new sequence of speech codes. The probability of each speech transcription symbol for each input speech code can then be output.« less

SequenceL: Automated Parallel Algorithms Derived from CSP-NT Computational Laws

NASA Technical Reports Server (NTRS)

Cooke, Daniel; Rushton, Nelson

2013-01-01

With the introduction of new parallel architectures like the cell and multicore chips from IBM, Intel, AMD, and ARM, as well as the petascale processing available for highend computing, a larger number of programmers will need to write parallel codes. Adding the parallel control structure to the sequence, selection, and iterative control constructs increases the complexity of code development, which often results in increased development costs and decreased reliability. SequenceL is a high-level programming language that is, a programming language that is closer to a human s way of thinking than to a machine s. Historically, high-level languages have resulted in decreased development costs and increased reliability, at the expense of performance. In recent applications at JSC and in industry, SequenceL has demonstrated the usual advantages of high-level programming in terms of low cost and high reliability. SequenceL programs, however, have run at speeds typically comparable with, and in many cases faster than, their counterparts written in C and C++ when run on single-core processors. Moreover, SequenceL is able to generate parallel executables automatically for multicore hardware, gaining parallel speedups without any extra effort from the programmer beyond what is required to write the sequen tial/singlecore code. A SequenceL-to-C++ translator has been developed that automatically renders readable multithreaded C++ from a combination of a SequenceL program and sample data input. The SequenceL language is based on two fundamental computational laws, Consume-Simplify- Produce (CSP) and Normalize-Trans - pose (NT), which enable it to automate the creation of parallel algorithms from high-level code that has no annotations of parallelism whatsoever. In our anecdotal experience, SequenceL development has been in every case less costly than development of the same algorithm in sequential (that is, single-core, single process) C or C++, and an order of magnitude less costly than development of comparable parallel code. Moreover, SequenceL not only automatically parallelizes the code, but since it is based on CSP-NT, it is provably race free, thus eliminating the largest quality challenge the parallelized software developer faces.

ANN modeling of DNA sequences: new strategies using DNA shape code.

PubMed

Parbhane, R V; Tambe, S S; Kulkarni, B D

2000-09-01

Two new encoding strategies, namely, wedge and twist codes, which are based on the DNA helical parameters, are introduced to represent DNA sequences in artificial neural network (ANN)-based modeling of biological systems. The performance of the new coding strategies has been evaluated by conducting three case studies involving mapping (modeling) and classification applications of ANNs. The proposed coding schemes have been compared rigorously and shown to outperform the existing coding strategies especially in situations wherein limited data are available for building the ANN models.

The primitive code and repeats of base oligomers as the primordial protein-encoding sequence.

PubMed Central

Ohno, S; Epplen, J T

1983-01-01

Even if the prebiotic self-replication of nucleic acids and the subsequent emergence of primitive, enzyme-independent tRNAs are accepted as plausible, the origin of life by spontaneous generation still appears improbable. This is because the just-emerged primitive translational machinery had to cope with base sequences that were not preselected for their coding potentials. Particularly if the primitive mitochondria-like code with four chain-terminating base triplets preceded the universal code, the translation of long, randomly generated, base sequences at this critical stage would have merely resulted in the production of short oligopeptides instead of long polypeptide chains. We present the base sequence of a mouse transcript containing tetranucleotide repeats conserved during evolution. Even if translated in accordance with the primitive mitochondria-like code, this transcript in its three reading frames can yield 245-, 246-, and 251-residue-long tetrapeptidic periodical polypeptides that are already acquiring longer periodicities. We contend that the first set of base sequences translated at the beginning of life were such oligonucleotide repeats. By quickly acquiring longer periodicities, their products must have soon gained characteristic secondary structures--alpha-helical or beta-sheet or both. PMID:6574491

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Using a Counterfactual Process to Identify the Applicability of Emerging Technology

DTIC Science & Technology

2014-09-01

conditions that must exist for the antecedent to happen.129 Crafting a 126 Michael W. Morris and...opportunities of interrupting the sequence of events. For example, if the bombers were identified on Monday then the events that unfold on Tuesday ...www.telegraph.co.uk/news/worldnews/northamerica/usa/10006491/Boston- marathon-bombings-Dzhokhar-Tsarnaev-pictured-behind-eight-year-old- victim.html Morris , Michael

Telemetry Standards, RCC Standard 106-17, Chapter 27, RF Network Access Layer

DTIC Science & Technology

2017-07-01

27-13 27.5.5 Frame Check Sequence Field........................................................................... 27-13 27.6 Power Transients...to the physical media (i.e., the wireless RF network). On the transmission side, it is responsible for framing IP packets for physical transmission...parameters of a radio shall be stored to maintain communications with RF link management after a power interruption or software-initiated reset

Genomics dataset of unidentified disclosed isolates.

PubMed

Rekadwad, Bhagwan N

2016-09-01

Analysis of DNA sequences is necessary for higher hierarchical classification of the organisms. It gives clues about the characteristics of organisms and their taxonomic position. This dataset is chosen to find complexities in the unidentified DNA in the disclosed patents. A total of 17 unidentified DNA sequences were thoroughly analyzed. The quick response codes were generated. AT/GC content of the DNA sequences analysis was carried out. The QR is helpful for quick identification of isolates. AT/GC content is helpful for studying their stability at different temperatures. Additionally, a dataset on cleavage code and enzyme code studied under the restriction digestion study, which helpful for performing studies using short DNA sequences was reported. The dataset disclosed here is the new revelatory data for exploration of unique DNA sequences for evaluation, identification, comparison and analysis.

CDSbank: taxonomy-aware extraction, selection, renaming and formatting of protein-coding DNA or amino acid sequences.

PubMed

Hazes, Bart

2014-02-28

Protein-coding DNA sequences and their corresponding amino acid sequences are routinely used to study relationships between sequence, structure, function, and evolution. The rapidly growing size of sequence databases increases the power of such comparative analyses but it makes it more challenging to prepare high quality sequence data sets with control over redundancy, quality, completeness, formatting, and labeling. Software tools for some individual steps in this process exist but manual intervention remains a common and time consuming necessity. CDSbank is a database that stores both the protein-coding DNA sequence (CDS) and amino acid sequence for each protein annotated in Genbank. CDSbank also stores Genbank feature annotation, a flag to indicate incomplete 5' and 3' ends, full taxonomic data, and a heuristic to rank the scientific interest of each species. This rich information allows fully automated data set preparation with a level of sophistication that aims to meet or exceed manual processing. Defaults ensure ease of use for typical scenarios while allowing great flexibility when needed. Access is via a free web server at http://hazeslab.med.ualberta.ca/CDSbank/. CDSbank presents a user-friendly web server to download, filter, format, and name large sequence data sets. Common usage scenarios can be accessed via pre-programmed default choices, while optional sections give full control over the processing pipeline. Particular strengths are: extract protein-coding DNA sequences just as easily as amino acid sequences, full access to taxonomy for labeling and filtering, awareness of incomplete sequences, and the ability to take one protein sequence and extract all synonymous CDS or identical protein sequences in other species. Finally, CDSbank can also create labeled property files to, for instance, annotate or re-label phylogenetic trees.

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

PubMed

Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

2003-10-01

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

Closed Genome Sequence of Chryseobacterium piperi Strain CTMT/ATCC BAA-1782, a Gram-Negative Bacterium with Clostridial Neurotoxin-Like Coding Sequences

PubMed Central

Wentz, Travis G.; Muruvanda, Tim; Thirunavukkarasu, Nagarajan; Hoffmann, Maria; Allard, Marc W.; Hodge, David R.; Pillai, Segaran P.; Hammack, Thomas S.; Brown, Eric W.

2017-01-01

ABSTRACT Clostridial neurotoxins, including botulinum and tetanus neurotoxins, are among the deadliest known bacterial toxins. Until recently, the horizontal mobility of this toxin gene family appeared to be limited to the genus Clostridium. We report here the closed genome sequence of Chryseobacterium piperi, a Gram-negative bacterium containing coding sequences with homology to clostridial neurotoxin family proteins. PMID:29192076

Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

PubMed

Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

2014-11-20

Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

Motion Detection in Ultrasound Image-Sequences Using Tensor Voting

NASA Astrophysics Data System (ADS)

Inba, Masafumi; Yanagida, Hirotaka; Tamura, Yasutaka

2008-05-01

Motion detection in ultrasound image sequences using tensor voting is described. We have been developing an ultrasound imaging system adopting a combination of coded excitation and synthetic aperture focusing techniques. In our method, frame rate of the system at distance of 150 mm reaches 5000 frame/s. Sparse array and short duration coded ultrasound signals are used for high-speed data acquisition. However, many artifacts appear in the reconstructed image sequences because of the incompleteness of the transmitted code. To reduce the artifacts, we have examined the application of tensor voting to the imaging method which adopts both coded excitation and synthetic aperture techniques. In this study, the basis of applying tensor voting and the motion detection method to ultrasound images is derived. It was confirmed that velocity detection and feature enhancement are possible using tensor voting in the time and space of simulated ultrasound three-dimensional image sequences.

The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

PubMed Central

Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

1982-01-01

The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

NASA Technical Reports Server (NTRS)

Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

PubMed

Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

1995-05-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

NASA Technical Reports Server (NTRS)

Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

Sequence data and association statistics from 12,940 type 2 diabetes cases and controls.

PubMed

Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M; Agarwala, Vineeta; Gaulton, Kyle J; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J; Rivas, Manuel A; Perry, John R B; Sim, Xueling; Blackwell, Thomas W; Robertson, Neil R; Rayner, N William; Cingolani, Pablo; Locke, Adam E; Tajes, Juan Fernandez; Highland, Heather M; Dupuis, Josee; Chines, Peter S; Lindgren, Cecilia M; Hartl, Christopher; Jackson, Anne U; Chen, Han; Huyghe, Jeroen R; van de Bunt, Martijn; Pearson, Richard D; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M; Gamazon, Eric R; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A; Below, Jennifer E; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L; Pasko, Dorota; Parker, Stephen C J; Varga, Tibor V; Green, Todd; Beer, Nicola L; Day-Williams, Aaron G; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F; Han, Bok-Ghee; Jenkinson, Christopher P; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C Y; Palmer, Nicholette D; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D; Neale, Benjamin M; Purcell, Shaun; Butterworth, Adam S; Howson, Joanna M M; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K L; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H T; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E; Rybin, Dennis; Farook, Vidya S; Fowler, Sharon P; Freedman, Barry I; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K; Puppala, Sobha; Scott, William R; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C; Mangino, Massimo; Bonnycastle, Lori L; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L; Herder, Christian; Groves, Christopher J; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A; Doney, Alex S F; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H; Stirrups, Kathleen; Wood, Andrew R; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N A; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M; Syvänen, Ann-Christine; Bergman, Richard N; Bharadwaj, Dwaipayan; Bottinger, Erwin P; Cho, Yoon Shin; Chandak, Giriraj R; Chan, Juliana Cn; Chia, Kee Seng; Daly, Mark J; Ebrahim, Shah B; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A; Lehman, Donna M; Jia, Weiping; Ma, Ronald C W; Pollin, Toni I; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J F; Small, Kerrin S; Ried, Janina S; DeFronzo, Ralph A; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R; Gloyn, Anna L; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D; Hattersley, Andrew T; Bowden, Donald W; Collins, Francis S; Atzmon, Gil; Chambers, John C; Spector, Timothy D; Laakso, Markku; Strom, Tim M; Bell, Graeme I; Blangero, John; Duggirala, Ravindranath; Tai, E Shyong; McVean, Gilean; Hanis, Craig L; Wilson, James G; Seielstad, Mark; Frayling, Timothy M; Meigs, James B; Cox, Nancy J; Sladek, Rob; Lander, Eric S; Gabriel, Stacey; Mohlke, Karen L; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J; Morris, Andrew P; Kang, Hyun Min; Altshuler, David; Burtt, Noël P; Florez, Jose C; Boehnke, Michael; McCarthy, Mark I

2017-12-19

To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D.

Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

PubMed Central

Jason, Flannick; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M.; Agarwala, Vineeta; Gaulton, Kyle J.; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J.; Rivas, Manuel A.; Perry, John R. B.; Sim, Xueling; Blackwell, Thomas W.; Robertson, Neil R.; Rayner, N William; Cingolani, Pablo; Locke, Adam E.; Tajes, Juan Fernandez; Highland, Heather M.; Dupuis, Josee; Chines, Peter S.; Lindgren, Cecilia M.; Hartl, Christopher; Jackson, Anne U.; Chen, Han; Huyghe, Jeroen R.; van de Bunt, Martijn; Pearson, Richard D.; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M.; Gamazon, Eric R.; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A.; Below, Jennifer E.; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L.; Pasko, Dorota; Parker, Stephen C. J.; Varga, Tibor V.; Green, Todd; Beer, Nicola L.; Day-Williams, Aaron G.; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J.; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P.; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F.; Han, Bok-Ghee; Jenkinson, Christopher P.; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C. Y.; Palmer, Nicholette D.; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E.; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D.; Neale, Benjamin M.; Purcell, Shaun; Butterworth, Adam S.; Howson, Joanna M. M.; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K. L.; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H. T.; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E.; Rybin, Dennis; Farook, Vidya S.; Fowler, Sharon P.; Freedman, Barry I.; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J.; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K.; Puppala, Sobha; Scott, William R.; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A.; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C.; Mangino, Massimo; Bonnycastle, Lori L.; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L.; Herder, Christian; Groves, Christopher J.; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A.; Doney, Alex S. F.; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J.; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E.; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H.; Stirrups, Kathleen; Wood, Andrew R.; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O.; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P.; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B.; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N. A.; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M.; Syvänen, Ann-Christine; Bergman, Richard N.; Bharadwaj, Dwaipayan; Bottinger, Erwin P.; Cho, Yoon Shin; Chandak, Giriraj R.; Chan, Juliana CN; Chia, Kee Seng; Daly, Mark J.; Ebrahim, Shah B.; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A.; Lehman, Donna M.; Jia, Weiping; Ma, Ronald C. W.; Pollin, Toni I.; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J. F.; Small, Kerrin S.; Ried, Janina S.; DeFronzo, Ralph A.; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J.; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W.; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R.; Gloyn, Anna L.; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D.; Hattersley, Andrew T.; Bowden, Donald W.; Collins, Francis S.; Atzmon, Gil; Chambers, John C.; Spector, Timothy D.; Laakso, Markku; Strom, Tim M.; Bell, Graeme I.; Blangero, John; Duggirala, Ravindranath; Tai, E. Shyong; McVean, Gilean; Hanis, Craig L.; Wilson, James G.; Seielstad, Mark; Frayling, Timothy M.; Meigs, James B.; Cox, Nancy J.; Sladek, Rob; Lander, Eric S.; Gabriel, Stacey; Mohlke, Karen L.; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J.; Morris, Andrew P.; Kang, Hyun Min; Altshuler, David; Burtt, Noël P.; Florez, Jose C.; Boehnke, Michael; McCarthy, Mark I.

2017-01-01

To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1–5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D. PMID:29257133

Not All Order Memory Is Equal: Test Demands Reveal Dissociations in Memory for Sequence Information

ERIC Educational Resources Information Center

Jonker, Tanya R.; MacLeod, Colin M.

2017-01-01

Remembering the order of a sequence of events is a fundamental feature of episodic memory. Indeed, a number of formal models represent temporal context as part of the memory system, and memory for order has been researched extensively. Yet, the nature of the code(s) underlying sequence memory is still relatively unknown. Across 4 experiments that…

Complete mitochondrial genome sequence of the heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus).

PubMed

Hu, Bo; Liu, Dong-Xing; Zhang, Yu-Qing; Song, Jian-Tao; Ji, Xian-Fei; Hou, Zhi-Qiang; Zhang, Zhen-Hai

2016-05-01

In this study we sequenced the complete mitochondrial genome sequencing of a heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus) for the first time. The total length of the mitogenome was 16,267 bp. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region.

Code-Switching to Know a TL Equivalent of an L1 Word: Request-Provision-Acknowledgement (RPA) Sequence

ERIC Educational Resources Information Center

Lucero, Edgar

2011-01-01

This article focuses on the learner's use of Code-switching to learn the TL (Target Language) equivalent of an L1 word. The interactional pattern that this situation creates defines the Request-Provision-Acknowledgement (RPA) sequence. The article explains each of the turns of the sequence under the combination of the Ethnomethodological…

Quantitative analysis of the anti-noise performance of an m-sequence in an electromagnetic method

NASA Astrophysics Data System (ADS)

Yuan, Zhe; Zhang, Yiming; Zheng, Qijia

2018-02-01

An electromagnetic method with a transmitted waveform coded by an m-sequence achieved better anti-noise performance compared to the conventional manner with a square-wave. The anti-noise performance of the m-sequence varied with multiple coding parameters; hence, a quantitative analysis of the anti-noise performance for m-sequences with different coding parameters was required to optimize them. This paper proposes the concept of an identification system, with the identified Earth impulse response obtained by measuring the system output with the input of the voltage response. A quantitative analysis of the anti-noise performance of the m-sequence was achieved by analyzing the amplitude-frequency response of the corresponding identification system. The effects of the coding parameters on the anti-noise performance are summarized by numerical simulation, and their optimization is further discussed in our conclusions; the validity of the conclusions is further verified by field experiment. The quantitative analysis method proposed in this paper provides a new insight into the anti-noise mechanism of the m-sequence, and could be used to evaluate the anti-noise performance of artificial sources in other time-domain exploration methods, such as the seismic method.

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA.

PubMed

Wright, Imogen A; Travers, Simon A

2014-07-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genomics dataset on unclassified published organism (patent US 7547531).

PubMed

Khan Shawan, Mohammad Mahfuz Ali; Hasan, Md Ashraful; Hossain, Md Mozammel; Hasan, Md Mahmudul; Parvin, Afroza; Akter, Salina; Uddin, Kazi Rasel; Banik, Subrata; Morshed, Mahbubul; Rahman, Md Nazibur; Rahman, S M Badier

2016-12-01

Nucleotide (DNA) sequence analysis provides important clues regarding the characteristics and taxonomic position of an organism. With the intention that, DNA sequence analysis is very crucial to learn about hierarchical classification of that particular organism. This dataset (patent US 7547531) is chosen to simplify all the complex raw data buried in undisclosed DNA sequences which help to open doors for new collaborations. In this data, a total of 48 unidentified DNA sequences from patent US 7547531 were selected and their complete sequences were retrieved from NCBI BioSample database. Quick response (QR) code of those DNA sequences was constructed by DNA BarID tool. QR code is useful for the identification and comparison of isolates with other organisms. AT/GC content of the DNA sequences was determined using ENDMEMO GC Content Calculator, which indicates their stability at different temperature. The highest GC content was observed in GP445188 (62.5%) which was followed by GP445198 (61.8%) and GP445189 (59.44%), while lowest was in GP445178 (24.39%). In addition, New England BioLabs (NEB) database was used to identify cleavage code indicating the 5, 3 and blunt end and enzyme code indicating the methylation site of the DNA sequences was also shown. These data will be helpful for the construction of the organisms' hierarchical classification, determination of their phylogenetic and taxonomic position and revelation of their molecular characteristics.

RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

PubMed Central

Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

2011-01-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

PubMed

Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

2011-04-01

With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

High compression image and image sequence coding

NASA Technical Reports Server (NTRS)

Kunt, Murat

1989-01-01

The digital representation of an image requires a very large number of bits. This number is even larger for an image sequence. The goal of image coding is to reduce this number, as much as possible, and reconstruct a faithful duplicate of the original picture or image sequence. Early efforts in image coding, solely guided by information theory, led to a plethora of methods. The compression ratio reached a plateau around 10:1 a couple of years ago. Recent progress in the study of the brain mechanism of vision and scene analysis has opened new vistas in picture coding. Directional sensitivity of the neurones in the visual pathway combined with the separate processing of contours and textures has led to a new class of coding methods capable of achieving compression ratios as high as 100:1 for images and around 300:1 for image sequences. Recent progress on some of the main avenues of object-based methods is presented. These second generation techniques make use of contour-texture modeling, new results in neurophysiology and psychophysics and scene analysis.

A novel non prophage(-like) gene-intervening element within gerE that is reconstituted during sporulation in Bacillus cereus ATCC10987.

PubMed

Abe, Kimihiro; Shimizu, Shin-Ya; Tsuda, Shuhei; Sato, Tsutomu

2017-09-12

Gene rearrangement is a widely-shared phenomenon in spore forming bacteria, in which prophage(-like) elements interrupting sporulation-specific genes are excised from the host genome to reconstitute the intact gene. Here, we report a novel class of gene-intervening elements, named gin, inserted in the 225 bp gerE-coding region of the B. cereus ATCC10987 genome, which generates a sporulation-specific rearrangement. gin has no phage-related genes and possesses three site-specific recombinase genes; girA, girB, and girC. We demonstrated that the gerE rearrangement occurs at the middle stage of sporulation, in which site-specific DNA recombination took place within the 9 bp consensus sequence flanking the disrupted gerE segments. Deletion analysis of gin uncovered that GirC and an additional factor, GirX, are responsible for gerE reconstitution. Involvement of GirC and GirX in DNA recombination was confirmed by an in vitro recombination assay. These results broaden the definition of the sporulation-specific gene rearrangement phenomenon: gene-intervening elements are not limited to phage DNA but may include non-viral genetic elements that carry a developmentally-regulated site-specific recombination system.

SFT: Scalable Fault Tolerance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrini, Fabrizio; Nieplocha, Jarek; Tipparaju, Vinod

2006-04-15

In this paper we will present a new technology that we are currently developing within the SFT: Scalable Fault Tolerance FastOS project which seeks to implement fault tolerance at the operating system level. Major design goals include dynamic reallocation of resources to allow continuing execution in the presence of hardware failures, very high scalability, high efficiency (low overhead), and transparency—requiring no changes to user applications. Our technology is based on a global coordination mechanism, that enforces transparent recovery lines in the system, and TICK, a lightweight, incremental checkpointing software architecture implemented as a Linux kernel module. TICK is completely user-transparentmore » and does not require any changes to user code or system libraries; it is highly responsive: an interrupt, such as a timer interrupt, can trigger a checkpoint in as little as 2.5μs; and it supports incremental and full checkpoints with minimal overhead—less than 6% with full checkpointing to disk performed as frequently as once per minute.« less

ECCM Scheme against Interrupted Sampling Repeater Jammer Based on Parameter-Adjusted Waveform Design

PubMed Central

Wei, Zhenhua; Peng, Bo; Shen, Rui

2018-01-01

Interrupted sampling repeater jamming (ISRJ) is an effective way of deceiving coherent radar sensors, especially for linear frequency modulated (LFM) radar. In this paper, for a simplified scenario with a single jammer, we propose a dynamic electronic counter-counter measure (ECCM) scheme based on jammer parameter estimation and transmitted signal design. Firstly, the LFM waveform is transmitted to estimate the main jamming parameters by investigating the discontinuousness of the ISRJ’s time-frequency (TF) characteristics. Then, a parameter-adjusted intra-pulse frequency coded signal, whose ISRJ signal after matched filtering only forms a single false target, is designed adaptively according to the estimated parameters, i.e., sampling interval, sampling duration and repeater times. Ultimately, for typical jamming scenes with different jamming signal ratio (JSR) and duty cycle, we propose two particular ISRJ suppression approaches. Simulation results validate the effective performance of the proposed scheme for countering the ISRJ, and the trade-off relationship between the two approaches is demonstrated. PMID:29642508

Secondary structural analyses of ITS1 in Paramecium.

PubMed

Hoshina, Ryo

2010-01-01

The nuclear ribosomal RNA gene operon is interrupted by internal transcribed spacer (ITS) 1 and ITS2. Although the secondary structure of ITS2 has been widely investigated, less is known about ITS1 and its structure. In this study, the secondary structure of ITS1 sequences for Paramecium and other ciliates was predicted. Each Paramecium ITS1 forms an open loop with three helices, A through C. Helix B was highly conserved among Paramecium, and similar helices were found in other ciliates. A phylogenetic analysis using the ITS1 sequences showed high-resolution, implying that ITS1 is a good tool for species-level analyses.

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae).

PubMed

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-04-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

PubMed Central

Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

2016-01-01

Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans. PMID:27180575

SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

PubMed

Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

2016-06-15

Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

Physical structure and chromosomal localization of a gene encoding human p58[sup clk-1], a cell division control related protein kinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eipers, P.G.

1992-01-01

The gene for the human p58[sup clk[minus]1] protein kinase, a cell division control-related gene, has been mapped by somatic cell hybrid analyses, in situ localization with the chromosomal gene, and nested polymerase chain reaction amplification of microdissected chromosomes. These studies indicate that the expressed p58[sup clk[minus]1] chromosomal gene maps to 1p36, while a highly related p58[sup clk[minus]1] sequence of unknown nature maps to chromosome 15. Assignment of a p34[sup cdc2]-related gene to 1p36 region, including neuroblastoma, ductal carcinoma of the breast, malignant melanoma, Merkel cell carcinoma and endocrine neoplasia among others. Aberrant expression of this protein kinase negatively regulates normalmore » cellular growth. The p58[sup clk[minus]1] protein contains a central domain of 299 amino acids that is 46% identical to human p34[sup cdc2], the master mitotic protein kinase. This dissertation details the complete structure of the p58[sup clk[minus]1] chromosomal gene, including its putative promoter region, transcriptional start sites, exonic sequences, and intron/exon boundary sequences. The gene is 10 kb in size and contains 12 exons and 11 introns. Interestingly, the rather large 2.0 kb 3[prime] untranslated region is interrupted by an intron that separates a region containing numerous AUUUA destabilization motifs from the coding region. Furthermore, the expression of this gene in normal human tissues, as well as several human tumor cell samples and lines, is examined. The origin of multiple human transcripts from the same chromosomal gene, and the possible differential stability of these various transcripts, is discussed with regard to the transcriptional and post-transcriptional regulation of this gene. This is the first report of the chromosomal gene structure of a member of the p34[sup cdc2] supergene family.« less

Efficient analysis of mouse genome sequences reveal many nonsense variants

PubMed Central

Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude

2016-01-01

Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

VaDiR: an integrated approach to Variant Detection in RNA.

PubMed

Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

2018-02-01

Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

Importance of low-range CAG expansion and CAA interruption in SCA2 Parkinsonism.

PubMed

Kim, Jong-Min; Hong, Susie; Kim, Gyoung Pyoung; Choi, Yoon Jae; Kim, Yu Kyeong; Park, Sung Sup; Kim, Sang Eun; Jeon, Beom S

2007-10-01

To examine the presence of an ATXN2 mutation in patients with parkinsonism in the Korean population and to find the difference in the ATXN2 mutation between ataxic and parkinsonian phenotypes. Survey. Seoul National University Hospital (a referral center). Patients Patients with Parkinson disease (PD) (n = 468) and the Parkinson variant of multiple system atrophy (MSA-P) (n = 135) who were seen at our Department of Neurology during the past 3 years. CAG expansion in spinocerebellar ataxia type 2 (SCA2) alleles was assessed by polymerase chain reaction amplification and fragment analysis, and its size and interruption were verified by cloning and sequencing. SCA2 was tested also in the family members of the probands. Striatal dopamine transporter (DAT) and D(2) receptor status were evaluated in the probands and their SCA2-positive family members using iodine I 123 [(123)I]-radiolabeled fluoropropyl (FP) 2-carbomethoxy-3-(4-iodophenyl) tropane (CIT) with single-photon emission computed tomography (SPECT) and carbon C 11 [(11)C]-radiolabeled raclopride positron emission tomography (PET). We found 3 patients with apparently sporadic disease with expanded CAG repeats in the ATXN2 locus. Two patients had a PD phenotype. The third patient showed an MSA-P phenotype. The CAG repeats in the ATXN2 locus of the patients were 35/22, 34/22, and 32/22, respectively (range in normal population, 19-27). The size of repeats was lower than the CAG repeats (38-51) in ataxic SCA2 in our population. The sequence of expanded CAG repeats was interrupted by CAA as (CAG)(n)(CAA)(CAG)(8) in all the patients. DNA analyses in 2 families showed 2 asymptomatic carriers in each family. In the patient with the PD phenotype, striatal DAT loss was more severe in the putamen than the caudate, and [(11)C]raclopride PET showed an increased relative putamen-caudate binding ratio. The patient with the MSA-P phenotype had severe DAT loss throughout the striatum. Two of 3 asymptomatic carriers had striatal DAT loss. This study demonstrates that SCA2 is one of the genetic causes of PD and MSA-P. All 3 patients had apparently sporadic disease, emphasizing the need to screen even in patients with nonfamilial disease. CAG repeats were in the low expansion range and interrupted by CAA in all patients in the low-range expansion. Therefore, accurate determination of CAG expansion and ATXN2 sequencing are warranted. [(123)I]FP-CIT SPECT and [(11)C]raclopride PET provide a useful way to evaluate the degree of nigrostriatal dopaminergic damage in SCA2-related parkinsonism and gene carriers.

Functional expression of SCL/TAL1 interrupting locus (Stil) protects retinal dopaminergic cells from neurotoxin-induced degeneration.

PubMed

Li, Jingling; Li, Ping; Carr, Aprell; Wang, Xiaokai; DeLaPaz, April; Sun, Lei; Lee, Eric; Tomei, Erika; Li, Lei

2013-01-11

We previously isolated a dominant mutation, night blindness b (nbb), which causes a late onset of retinal dopaminergic cell degeneration in zebrafish. In this study, we cloned the zebrafish nbb locus. Sequencing results revealed that nbb is a homolog of the vertebrate SCL/TAL1 interrupting locus (Stil). The Stil gene has been shown to play important roles in the regulation of vertebrate embryonic neural development and human cancer cell proliferation. In this study, we demonstrate that functional expression of Stil is also required for neural survival. In zebrafish, decreased expression of Stil resulted in increased toxic susceptibility of retinal dopaminergic cells to 6-hydroxydopamine. Increases in Stil-mediated Shh signaling transduction (i.e. by knocking down the Shh repressor Sufu) prevented dopaminergic cell death induced by neurotoxic insult. The data suggest that the oncogene Stil also plays important roles in neural protection.

Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina

PubMed Central

Ghio, Silvina; Martinez Cáceres, Alfredo I.; Talia, Paola; Grasso, Daniel H.

2015-01-01

Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. PMID:26494679

Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity

NASA Astrophysics Data System (ADS)

Mukherjee, Shashi Bajaj; Sen, Pradip Kumar

2010-10-01

Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.

Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

PubMed

Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

2010-01-01

In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

Genetic code, hamming distance and stochastic matrices.

PubMed

He, Matthew X; Petoukhov, Sergei V; Ricci, Paolo E

2004-09-01

In this paper we use the Gray code representation of the genetic code C=00, U=10, G=11 and A=01 (C pairs with G, A pairs with U) to generate a sequence of genetic code-based matrices. In connection with these code-based matrices, we use the Hamming distance to generate a sequence of numerical matrices. We then further investigate the properties of the numerical matrices and show that they are doubly stochastic and symmetric. We determine the frequency distributions of the Hamming distances, building blocks of the matrices, decomposition and iterations of matrices. We present an explicit decomposition formula for the genetic code-based matrix in terms of permutation matrices, which provides a hypercube representation of the genetic code. It is also observed that there is a Hamiltonian cycle in a genetic code-based hypercube.

Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

PubMed

Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

2016-07-01

The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins.

PubMed

Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka

2018-01-01

Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

Exploring Asynchronous Many-Task Runtime Systems toward Extreme Scales

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knight, Samuel; Baker, Gavin Matthew; Gamell, Marc

2015-10-01

Major exascale computing reports indicate a number of software challenges to meet the dramatic change of system architectures in near future. While several-orders-of-magnitude increase in parallelism is the most commonly cited of those, hurdles also include performance heterogeneity of compute nodes across the system, increased imbalance between computational capacity and I/O capabilities, frequent system interrupts, and complex hardware architectures. Asynchronous task-parallel programming models show a great promise in addressing these issues, but are not yet fully understood nor developed su ciently for computational science and engineering application codes. We address these knowledge gaps through quantitative and qualitative exploration of leadingmore » candidate solutions in the context of engineering applications at Sandia. In this poster, we evaluate MiniAero code ported to three leading candidate programming models (Charm++, Legion and UINTAH) to examine the feasibility of these models that permits insertion of new programming model elements into an existing code base.« less

Complete genome sequencing of the luminescent bacterium, Vibrio qinghaiensis sp. Q67 using PacBio technology

NASA Astrophysics Data System (ADS)

Gong, Liang; Wu, Yu; Jian, Qijie; Yin, Chunxiao; Li, Taotao; Gupta, Vijai Kumar; Duan, Xuewu; Jiang, Yueming

2018-01-01

Vibrio qinghaiensis sp.-Q67 (Vqin-Q67) is a freshwater luminescent bacterium that continuously emits blue-green light (485 nm). The bacterium has been widely used for detecting toxic contaminants. Here, we report the complete genome sequence of Vqin-Q67, obtained using third-generation PacBio sequencing technology. Continuous long reads were attained from three PacBio sequencing runs and reads >500 bp with a quality value of >0.75 were merged together into a single dataset. This resultant highly-contiguous de novo assembly has no genome gaps, and comprises two chromosomes with substantial genetic information, including protein-coding genes, non-coding RNA, transposon and gene islands. Our dataset can be useful as a comparative genome for evolution and speciation studies, as well as for the analysis of protein-coding gene families, the pathogenicity of different Vibrio species in fish, the evolution of non-coding RNA and transposon, and the regulation of gene expression in relation to the bioluminescence of Vqin-Q67.

Weight distributions for turbo codes using random and nonrandom permutations

NASA Technical Reports Server (NTRS)

Dolinar, S.; Divsalar, D.

1995-01-01

This article takes a preliminary look at the weight distributions achievable for turbo codes using random, nonrandom, and semirandom permutations. Due to the recursiveness of the encoders, it is important to distinguish between self-terminating and non-self-terminating input sequences. The non-self-terminating sequences have little effect on decoder performance, because they accumulate high encoded weight until they are artificially terminated at the end of the block. From probabilistic arguments based on selecting the permutations randomly, it is concluded that the self-terminating weight-2 data sequences are the most important consideration in the design of constituent codes; higher-weight self-terminating sequences have successively decreasing importance. Also, increasing the number of codes and, correspondingly, the number of permutations makes it more and more likely that the bad input sequences will be broken up by one or more of the permuters. It is possible to design nonrandom permutations that ensure that the minimum distance due to weight-2 input sequences grows roughly as the square root of (2N), where N is the block length. However, these nonrandom permutations amplify the bad effects of higher-weight inputs, and as a result they are inferior in performance to randomly selected permutations. But there are 'semirandom' permutations that perform nearly as well as the designed nonrandom permutations with respect to weight-2 input sequences and are not as susceptible to being foiled by higher-weight inputs.

Next-generation sequencing of the Trichinella murrelli mitochondrial genome allows comprehensive comparison of its divergence from the principal agent of human trichinellosis, Trichinella spiralis.

PubMed

Webb, Kristen M; Rosenthal, Benjamin M

2011-01-01

The mitochondrial genome's non-recombinant mode of inheritance and relatively rapid rate of evolution has promoted its use as a marker for studying the biogeographic history and evolutionary interrelationships among many metazoan species. A modest portion of the mitochondrial genome has been defined for 12 species and genotypes of parasites in the genus Trichinella, but its adequacy in representing the mitochondrial genome as a whole remains unclear, as the complete coding sequence has been characterized only for Trichinella spiralis. Here, we sought to comprehensively describe the extent and nature of divergence between the mitochondrial genomes of T. spiralis (which poses the most appreciable zoonotic risk owing to its capacity to establish persistent infections in domestic pigs) and Trichinella murrelli (which is the most prevalent species in North American wildlife hosts, but which poses relatively little risk to the safety of pork). Next generation sequencing methodologies and scaffold and de novo assembly strategies were employed. The entire protein-coding region was sequenced (13,917 bp), along with a portion of the highly repetitive non-coding region (1524 bp) of the mitochondrial genome of T. murrelli with a combined average read depth of 250 reads. The accuracy of base calling, estimated from coding region sequence was found to exceed 99.3%. Genome content and gene order was not found to be significantly different from that of T. spiralis. An overall inter-species sequence divergence of 9.5% was estimated. Significant variation was identified when the amount of variation between species at each gene is compared to the average amount of variation between species across the coding region. Next generation sequencing is a highly effective means to obtain previously unknown mitochondrial genome sequence. Particular to parasites, the extremely deep coverage achieved through this method allows for the detection of sequence heterogeneity between the multiple individuals that necessarily comprise such templates. Copyright © 2010 Elsevier B.V. All rights reserved.

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina.

PubMed

Ghio, Silvina; Martinez Cáceres, Alfredo I; Talia, Paola; Grasso, Daniel H; Campos, Eleonora

2015-10-22

Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. Copyright © 2015 Ghio et al.

Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

PubMed Central

Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren

2015-01-01

There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098

The mitochondrial genomes of the acoelomorph worms Paratomella rubra, Isodiametra pulchra and Archaphanostoma ylvae.

PubMed

Robertson, Helen E; Lapraz, François; Egger, Bernhard; Telford, Maximilian J; Schiffer, Philipp H

2017-05-12

Acoels are small, ubiquitous - but understudied - marine worms with a very simple body plan. Their internal phylogeny is still not fully resolved, and the position of their proposed phylum Xenacoelomorpha remains debated. Here we describe mitochondrial genome sequences from the acoels Paratomella rubra and Isodiametra pulchra, and the complete mitochondrial genome of the acoel Archaphanostoma ylvae. The P. rubra and A. ylvae sequences are typical for metazoans in size and gene content. The larger I. pulchra  mitochondrial genome contains both ribosomal genes, 21 tRNAs, but only 11 protein-coding genes. We find evidence suggesting a duplicated sequence in the I. pulchra mitochondrial genome. The P. rubra, I. pulchra and A. ylvae mitochondria have a unique genome organisation in comparison to other metazoan mitochondrial genomes. We found a large degree of protein-coding gene and tRNA overlap with little non-coding sequence in the compact P. rubra genome. Conversely, the A. ylvae and I. pulchra genomes have many long non-coding sequences between genes, likely driving genome size expansion in the latter. Phylogenetic trees inferred from mitochondrial genes retrieve Xenacoelomorpha as an early branching taxon in the deuterostomes. Sequence divergence analysis between P. rubra sampled in England and Spain indicates cryptic diversity.

Metal resistance sequences and transgenic plants

DOEpatents

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

PubMed

Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

2014-06-01

Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

EDGE 2017 R&D 100 Entry with Appendix

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chain, Patrick Sam Guy; Davenport, Karen Walston; Li, Po-E

Diabetes, infertility, cancer, and Alzheimer’s disease—the key to one day preventing or even curing such afflictions and diseases (both infectious and genetically driven) may be locked in our own genetic code and the code of microorganisms that inhabit our bodies. The study of this code, known as genomics, has recently become much more promising as a result of two things: (1) vast improvements in high-throughput, nextgeneration sequencing (NSG), and (2) an exponential decrease in the cost of such sequencing. For example, it originally cost approximately $3 billion to sequence the human genome; today, this genome could be resequenced for lessmore » than $1,000.« less

Servicing a globally broadcast interrupt signal in a multi-threaded computer

DOEpatents

Attinella, John E.; Davis, Kristan D.; Musselman, Roy G.; Satterfield, David L.

2015-12-29

Methods, apparatuses, and computer program products for servicing a globally broadcast interrupt signal in a multi-threaded computer comprising a plurality of processor threads. Embodiments include an interrupt controller indicating in a plurality of local interrupt status locations that a globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include a thread determining that a local interrupt status location corresponding to the thread indicates that the globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include the thread processing one or more entries in a global interrupt status bit queue based on whether global interrupt status bits associated with the globally broadcast interrupt signal are locked. Each entry in the global interrupt status bit queue corresponds to a queued global interrupt.

Palindromic Sequence Artifacts Generated during Next Generation Sequencing Library Preparation from Historic and Ancient DNA

PubMed Central

Star, Bastiaan; Nederbragt, Alexander J.; Hansen, Marianne H. S.; Skage, Morten; Gilfillan, Gregor D.; Bradbury, Ian R.; Pampoulie, Christophe; Stenseth, Nils Chr; Jakobsen, Kjetill S.; Jentoft, Sissel

2014-01-01

Degradation-specific processes and variation in laboratory protocols can bias the DNA sequence composition from samples of ancient or historic origin. Here, we identify a novel artifact in sequences from historic samples of Atlantic cod (Gadus morhua), which forms interrupted palindromes consisting of reverse complementary sequence at the 5′ and 3′-ends of sequencing reads. The palindromic sequences themselves have specific properties – the bases at the 5′-end align well to the reference genome, whereas extensive misalignments exists among the bases at the terminal 3′-end. The terminal 3′ bases are artificial extensions likely caused by the occurrence of hairpin loops in single stranded DNA (ssDNA), which can be ligated and amplified in particular library creation protocols. We propose that such hairpin loops allow the inclusion of erroneous nucleotides, specifically at the 3′-end of DNA strands, with the 5′-end of the same strand providing the template. We also find these palindromes in previously published ancient DNA (aDNA) datasets, albeit at varying and substantially lower frequencies. This artifact can negatively affect the yield of endogenous DNA in these types of samples and introduces sequence bias. PMID:24608104

Scaling features of noncoding DNA

NASA Technical Reports Server (NTRS)

Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

1999-01-01

We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

Sedimentary facies and depositional history of the Swan Islands, Honduras

NASA Astrophysics Data System (ADS)

Ivey, Marvin L.; Breyer, John A.; Britton, Joseph C.

1980-10-01

Swan Island is a Honduran possession in the western Caribbean, located on the southeastern side of the Cayman Trench. Two sedimentary assemblages are found on the island: an older bedded sequence of mid-Tertiary age (Aquitanian or Burdigalian) and a younger sedimentary sequence of Late Pleistocene age. The older sequence is composed of a series of calcarenites, calcilutites, and siliciclastic mudstones; capping these are cliff-forming reefal carbonates of the younger sequence. The rocks of the older bedded sequence accumulated in deep water. Sedimentation consisted of a constant rain of pyroclastic debris interrupted by the episodic introduction of upslope carbonate material by turbidity currents. Uplift and deformation of this sequence was initiated sometime after the Early Miocene. By the Late Pleistocene, uplift had brought the rocks into water depths conducive to coral growth. Pleistocene sedimentation on the island was controlled by the interaction between tectonic uplift and eustatic sea-level changes. The primary controlling force on the tectonic history of the island is its proximity to the boundary between the North American and Caribbean plates.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

[Learning and Repetive Reproduction of Memorized Sequences by the Right and the Left Hand].

PubMed

Bobrova, E V; Lyakhovetskii, V A; Bogacheva, I N

2015-01-01

An important stage of learning a new skill is repetitive reproduction of one and the same sequence of movements, which plays a significant role in forming of the movement stereotypes. Two groups of right-handers repeatedly memorized (6-10 repetitions) the sequences of their hand transitions by experimenter in 6 positions, firstly by the right hand (RH), and then--by the left hand (LH) or vice versa. Random sequences previously unknown to the volunteers were reproduced in the 11 series. Modified sequences were tested in the 2nd and 3rd series, where the same elements' positions were presented in different order. The processes of repetitive sequence reproduction were similar for RH and LH. However, the learning of the modified sequences differed: Information about elements' position disregarding the reproduction order was used only when LH initiated task performing. This information was not used when LH followed RH and when RH performed the task. Consequently, the type of information coding activated by LH helped learn the positions of sequence elements, while the type of information coding activated by RH prevented learning. It is supposedly connected with the predominant role of right hemisphere in the processes of positional coding and motor learning.

Sequence Polishing Library (SPL) v10.0

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oberortner, Ernst

The Sequence Polishing Library (SPL) is a suite of software tools in order to automate "Design for Synthesis and Assembly" workflows. Specifically: The SPL "Converter" tool converts files among the following sequence data exchange formats: CSV, FASTA, GenBank, and Synthetic Biology Open Language (SBOL); The SPL "Juggler" tool optimizes the codon usages of DNA coding sequences according to an optimization strategy, a user-specific codon usage table and genetic code. In addition, the SPL "Juggler" can translate amino acid sequences into DNA sequences.:The SPL "Polisher" verifies NA sequences against DNA synthesis constraints, such as GC content, repeating k-mers, and restriction sites.more » In case of violations, the "Polisher" reports the violations in a comprehensive manner. The "Polisher" tool can also modify the violating regions according to an optimization strategy, a user-specific codon usage table and genetic code;The SPL "Partitioner" decomposes large DNA sequences into smaller building blocks with partial overlaps that enable an efficient assembly. The "Partitioner" enables the user to configure the characteristics of the overlaps, which are mostly determined by the utilized assembly protocol, such as length, GC content, or melting temperature.« less

Multiple Access Interference Reduction Using Received Response Code Sequence for DS-CDMA UWB System

NASA Astrophysics Data System (ADS)

Toh, Keat Beng; Tachikawa, Shin'ichi

This paper proposes a combination of novel Received Response (RR) sequence at the transmitter and a Matched Filter-RAKE (MF-RAKE) combining scheme receiver system for the Direct Sequence-Code Division Multiple Access Ultra Wideband (DS-CDMA UWB) multipath channel model. This paper also demonstrates the effectiveness of the RR sequence in Multiple Access Interference (MAI) reduction for the DS-CDMA UWB system. It suggests that by using conventional binary code sequence such as the M sequence or the Gold sequence, there is a possibility of generating extra MAI in the UWB system. Therefore, it is quite difficult to collect the energy efficiently although the RAKE reception method is applied at the receiver. The main purpose of the proposed system is to overcome the performance degradation for UWB transmission due to the occurrence of MAI during multiple accessing in the DS-CDMA UWB system. The proposed system improves the system performance by improving the RAKE reception performance using the RR sequence which can reduce the MAI effect significantly. Simulation results verify that significant improvement can be obtained by the proposed system in the UWB multipath channel models.

Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV)

PubMed Central

Martin, Andrew C. R.

2014-01-01

The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and ’dotifying’ repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/. PMID:25653836

Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV).

PubMed

Martin, Andrew C R

2014-01-01

The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and 'dotifying' repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Attinella, John E.; Davis, Kristan D.; Musselman, Roy G.

Methods, apparatuses, and computer program products for servicing a globally broadcast interrupt signal in a multi-threaded computer comprising a plurality of processor threads. Embodiments include an interrupt controller indicating in a plurality of local interrupt status locations that a globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include a thread determining that a local interrupt status location corresponding to the thread indicates that the globally broadcast interrupt signal has been received by the interrupt controller. Embodiments also include the thread processing one or more entries in a global interrupt status bit queue based on whethermore » global interrupt status bits associated with the globally broadcast interrupt signal are locked. Each entry in the global interrupt status bit queue corresponds to a queued global interrupt.« less

RNAcentral: an international database of ncRNA sequences

DOE PAGES

Williams, Kelly Porter

2014-10-28

The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.

The complete validated mitochondrial genome of the silver gemfish Rexea solandri (Cuvier, 1832) (Perciformes, Gempylidae).

PubMed

Bustamante, Carlos; Ovenden, Jennifer R

2016-01-01

The silver gemfish Rexea solandri is an important economic resource but Vulnerable to overfishing in Australian waters. The complete mitochondrial genome sequence is described from 1.6 million reads obtained via next generation sequencing. The total length of the mitogenome is 16,350 bp comprising 2 rRNA, 13 protein-coding genes, 22 tRNA and 2 non-coding regions. The mitogenome sequence was validated against sequences of PCR fragments and BLAST queries of Genbank. Gene order was equivalent to that found in marine fishes.

High rate concatenated coding systems using bandwidth efficient trellis inner codes

NASA Technical Reports Server (NTRS)

Deng, Robert H.; Costello, Daniel J., Jr.

1989-01-01

High-rate concatenated coding systems with bandwidth-efficient trellis inner codes and Reed-Solomon (RS) outer codes are investigated for application in high-speed satellite communication systems. Two concatenated coding schemes are proposed. In one the inner code is decoded with soft-decision Viterbi decoding, and the outer RS code performs error-correction-only decoding (decoding without side information). In the other, the inner code is decoded with a modified Viterbi algorithm, which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, whereas branch metrics are used to provide reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. The two schemes have been proposed for high-speed data communication on NASA satellite channels. The rates considered are at least double those used in current NASA systems, and the results indicate that high system reliability can still be achieved.

Executing application function calls in response to an interrupt

DOEpatents

Almasi, Gheorghe; Archer, Charles J.; Giampapa, Mark E.; Gooding, Thomas M.; Heidelberger, Philip; Parker, Jeffrey J.

2010-05-11

Executing application function calls in response to an interrupt including creating a thread; receiving an interrupt having an interrupt type; determining whether a value of a semaphore represents that interrupts are disabled; if the value of the semaphore represents that interrupts are not disabled: calling, by the thread, one or more preconfigured functions in dependence upon the interrupt type of the interrupt; yielding the thread; and if the value of the semaphore represents that interrupts are disabled: setting the value of the semaphore to represent to a kernel that interrupts are hard-disabled; and hard-disabling interrupts at the kernel.

Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altemus, M.; Murphy, D.L.; Greenberg, B.

1996-07-26

Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt.

PubMed

AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

2014-10-07

The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact "nanogenome."

Gene and genon concept: coding versus regulation

PubMed Central

2007-01-01

We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various pieces, as steered by the genon. It emerges finally as an uninterrupted nucleic acid sequence at mRNA level just prior to translation, in faithful correspondence with the amino acid sequence to be produced as a polypeptide. After translation, the genon has fulfilled its role and expires. The distinction between the protein coding information as materialised in the final polypeptide and the processing information represented by the genon allows us to set up a new information theoretic scheme. The standard sequence information determined by the genetic code expresses the relation between coding sequence and product. Backward analysis asks from which coding region in the DNA a given polypeptide originates. The (more interesting) forward analysis asks in how many polypeptides of how many different types a given DNA segment is expressed. This concerns the control of the expression process for which we have introduced the genon concept. Thus, the information theoretic analysis can capture the complementary aspects of coding and regulation, of gene and genon. PMID:18087760

The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

PubMed Central

Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

2015-01-01

Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

Flexible and polarization-controllable diffusion metasurface with optical transparency

NASA Astrophysics Data System (ADS)

Zhuang, Yaqiang; Wang, Guangming; Liang, Jiangang; Cai, Tong; Guo, Wenlong; Zhang, Qingfeng

2017-11-01

In this paper, a novel coding metasurface is proposed to realize polarization-controllable diffusion scattering. The anisotropic Jerusalem-cross unit cell is employed as the basic coding element due to its polarization-dependent phase response. The isotropic random coding sequence is firstly designed to obtain diffusion scattering, and the anisotropic random coding sequence is subsequently realized by adding different periodic coding sequences to the original isotropic one along different directions. For demonstration, we designed and fabricated a flexible polarization-controllable diffusion metasurface (PCDM) with both chessboard diffusion and hedge diffusion under different polarizations. The specular scattering reduction performance of the anisotropic metasurface is better than the isotropic one because the scattered energies are redirected away from the specular reflection direction. For potential applications, the flexible PCDM wrapped around a cylinder structure is investigated and tested for polarization-controllable diffusion scattering. The numerical and experimental results coincide well, indicating anisotropic low scatterings with comparable performances. This paper provides an alternative approach for designing high-performance, flexible, low-scattering platforms.

HIV-1 Transmission During Recent Infection and During Treatment Interruptions as Major Drivers of New Infections in the Swiss HIV Cohort Study.

PubMed

Marzel, Alex; Shilaih, Mohaned; Yang, Wan-Lin; Böni, Jürg; Yerly, Sabine; Klimkait, Thomas; Aubert, Vincent; Braun, Dominique L; Calmy, Alexandra; Furrer, Hansjakob; Cavassini, Matthias; Battegay, Manuel; Vernazza, Pietro L; Bernasconi, Enos; Günthard, Huldrych F; Kouyos, Roger D; Aubert, V; Battegay, M; Bernasconi, E; Böni, J; Bucher, H C; Burton-Jeangros, C; Calmy, A; Cavassini, M; Dollenmaier, G; Egger, M; Elzi, L; Fehr, J; Fellay, J; Furrer, H; Fux, C A; Gorgievski, M; Günthard, H F; Haerry, D; Hasse, B; Hirsch, H H; Hoffmann, M; Hösli, I; Kahlert, C; Kaiser, L; Keiser, O; Klimkait, T; Kouyos, R D; Kovari, H; Ledergerber, B; Martinetti, G; de Tejada, B Martinez; Metzner, K; Müller, N; Nadal, D; Nicca, D; Pantaleo, G; Rauch, A; Regenass, S; Rickenbach, M; Rudin, C; Schöni-Affolter, F; Schmid, P; Schüpbach, J; Speck, R; Tarr, P; Trkola, A; Vernazza, P L; Weber, R; Yerly, S

2016-01-01

Reducing the fraction of transmissions during recent human immunodeficiency virus (HIV) infection is essential for the population-level success of "treatment as prevention". A phylogenetic tree was constructed with 19 604 Swiss sequences and 90 994 non-Swiss background sequences. Swiss transmission pairs were identified using 104 combinations of genetic distance (1%-2.5%) and bootstrap (50%-100%) thresholds, to examine the effect of those criteria. Monophyletic pairs were classified as recent or chronic transmission based on the time interval between estimated seroconversion dates. Logistic regression with adjustment for clinical and demographic characteristics was used to identify risk factors associated with transmission during recent or chronic infection. Seroconversion dates were estimated for 4079 patients on the phylogeny, and comprised between 71 (distance, 1%; bootstrap, 100%) to 378 transmission pairs (distance, 2.5%; bootstrap, 50%). We found that 43.7% (range, 41%-56%) of the transmissions occurred during the first year of infection. Stricter phylogenetic definition of transmission pairs was associated with higher recent-phase transmission fraction. Chronic-phase viral load area under the curve (adjusted odds ratio, 3; 95% confidence interval, 1.64-5.48) and time to antiretroviral therapy (ART) start (adjusted odds ratio 1.4/y; 1.11-1.77) were associated with chronic-phase transmission as opposed to recent transmission. Importantly, at least 14% of the chronic-phase transmission events occurred after the transmitter had interrupted ART. We demonstrate a high fraction of transmission during recent HIV infection but also chronic transmissions after interruption of ART in Switzerland. Both represent key issues for treatment as prevention and underline the importance of early diagnosis and of early and continuous treatment. © The Author 2015. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Object-oriented millisecond timers for the PC.

PubMed

Hamm, J P

2001-11-01

Object-oriented programming provides a useful structure for designing reusable code. Accurate millisecond timing is essential for many areas of research. With this in mind, this paper provides a Turbo Pascal unit containing an object-oriented millisecond timer. This approach allows for multiple timers to be running independently. The timers may also be set at different levels of temporal precision, such as 10(-3) (milliseconds) or 10(-5) sec. The object also is able to store the time of a flagged event for later examination without interrupting the ongoing timing operation.

Coding visual features extracted from video sequences.

PubMed

Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

2014-05-01

Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

Progress toward poliomyelitis eradication--Nigeria, January 2013-September 2014.

PubMed

Etsano, Andrew; Gunnala, Rajni; Shuaib, Faisal; Damisa, Eunice; Mkanda, Pascal; Banda, Richard; Korir, Charles; Enemaku, Ogu; Corkum, Melissa; Usman, Samuel; Davis, Lora B; Nganda, Gatei wa; Burns, Cara C; Mahoney, Frank; Vertefeuille, John F

2014-11-21

In 1988, the World Health Assembly resolved to interrupt wild poliovirus (WPV) transmission worldwide. By 2013, only three countries remained that had never interrupted WPV transmission: Afghanistan, Nigeria, and Pakistan. Since 2003, northern Nigeria has been a reservoir for WPV reintroduction into 26 previously polio-free countries. In May 2014, the World Health Organization declared the international spread of polio a Public Health Emergency of International Concern. Nigeria's main strategic goal is to interrupt WPV type 1 (WPV1) transmission by the end of 2014, which is also a main objective of the Global Polio Eradication Initiative's Polio Eradication and Endgame Strategic Plan for 2013-2018. This report updates previous reports (4-6) and describes polio eradication activities and progress in Nigeria during January 2013-September 30, 2014. Only six WPV cases had been reported in 2014 through September 30 compared with 49 reported cases during the same period in 2013. The quality of supplemental immunization activities (SIAs) improved during this period; the proportion of local government areas (LGAs) within 11 high-risk states with estimated oral poliovirus vaccine (OPV) campaign coverage at or above the 90% threshold increased from 36% to 67%. However, the number of reported circulating vaccine-derived poliovirus type 2 (cVDPV2) cases increased from four in 2013 to 21 to date in 2014, and surveillance gaps are suggested by genomic sequence analysis and continued detection of WPV1 by environmental surveillance. Interrupting all poliovirus circulation in Nigeria is achievable with continued attention to stopping cVDPV2 transmission, improving the quality of acute flaccid paralysis (AFP) surveillance, increasing vaccination coverage by strengthened routine immunization services, continuing support from all levels of government, and undertaking special initiatives to provide vaccination to children in conflict-affected areas in northeastern Nigeria.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

PubMed

Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

2010-02-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

PubMed Central

Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

2010-01-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

Understanding Emergency Medicine Physicians Multitasking Behaviors Around Interruptions.

PubMed

Fong, Allan; Ratwani, Raj M

2018-06-11

Interruptions can adversely impact human performance, particularly in fast-paced and high-risk environments such as the emergency department (ED). Understanding physician behaviors before, during, and after interruptions is important to the design and promotion of safe and effective workflow solutions. However, traditional human factors based interruption models do not accurately reflect the complexities of real-world environments like the ED and may not capture multiple interruptions and multitasking. We present a more comprehensive framework for understanding interruptions that is composed of three phases, each with multiple levels: Interruption Start Transition, Interruption Engagement, and Interruption End Transition. This three-phase framework is not constrained to discrete task transitions, providing a robust method to categorize multitasking behaviors around interruptions. We apply this framework in categorizing 457 interruption episodes. 457 interruption episodes were captured during 36 hours of observation. The interrupted task was immediately suspended 348 (76.1%) times. Participants engaged in new self-initiated tasks during the interrupting task 164 (35.9%) times and did not directly resume the interrupted task in 284 (62.1%) interruption episodes. Using this framework provides a more detailed description of the types of physician behaviors in complex environments. Understanding the different types of interruption and resumption patterns, which may have a different impact on performance, can support the design of interruption mitigation strategies. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

PubMed Central

Tramontano, A; Macchiato, M F

1986-01-01

An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

PubMed

Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

2013-08-15

Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

PubMed

Cao, Yinhe; Tung, Wen-Wen; Gao, J B

2004-01-01

With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

A candidate gene for choanal atresia in alpaca.

PubMed

Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

2010-03-01

Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

PubMed

Pang, Erli; Wu, Xiaomei; Lin, Kui

2016-06-01

Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

Translational resistivity/conductivity of coding sequences during exponential growth of Escherichia coli.

PubMed

Takai, Kazuyuki

2017-01-21

Codon adaptation index (CAI) has been widely used for prediction of expression of recombinant genes in Escherichia coli and other organisms. However, CAI has no mechanistic basis that rationalizes its application to estimation of translational efficiency. Here, I propose a model based on which we could consider how codon usage is related to the level of expression during exponential growth of bacteria. In this model, translation of a gene is considered as an analog of electric current, and an analog of electric resistance corresponding to each gene is considered. "Translational resistance" is dependent on the steady-state concentration and the sequence of the mRNA species, and "translational resistivity" is dependent only on the mRNA sequence. The latter is the sum of two parts: one is the resistivity for the elongation reaction (coding sequence resistivity), and the other comes from all of the other steps of the decoding reaction. This electric circuit model clearly shows that some conditions should be met for codon composition of a coding sequence to correlate well with its expression level. On the other hand, I calculated relative frequency of each of the 61 sense codon triplets translated during exponential growth of E. coli from a proteomic dataset covering over 2600 proteins. A tentative method for estimating relative coding sequence resistivity based on the data is presented. Copyright © 2016. Published by Elsevier Ltd.

Origins of Genes: "Big Bang" or Continuous Creation?

NASA Astrophysics Data System (ADS)

Kesse, Paul K.; Gibbs, Adrian

1992-10-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes.

Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

PubMed

Brunak, S; Engelbrecht, J

1996-06-01

A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

Evolution and Diversity of the Human Hepatitis D Virus Genome

PubMed Central

Huang, Chi-Ruei; Lo, Szecheng J.

2010-01-01

Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073

Novel methodologies for spectral classification of exon and intron sequences

NASA Astrophysics Data System (ADS)

Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

2012-12-01

Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

Random digital encryption secure communication system

NASA Technical Reports Server (NTRS)

Doland, G. D. (Inventor)

1982-01-01

The design of a secure communication system is described. A product code, formed from two pseudorandom sequences of digital bits, is used to encipher or scramble data prior to transmission. The two pseudorandom sequences are periodically changed at intervals before they have had time to repeat. One of the two sequences is transmitted continuously with the scrambled data for synchronization. In the receiver portion of the system, the incoming signal is compared with one of two locally generated pseudorandom sequences until correspondence between the sequences is obtained. At this time, the two locally generated sequences are formed into a product code which deciphers the data from the incoming signal. Provision is made to ensure synchronization of the transmitting and receiving portions of the system.

Expressed gene sequence of the IFN-gamma-response chemokine CXCL9 of cattle, horses, and swine

USDA-ARS?s Scientific Manuscript database

This report describes the cloning and characterization of expressed gene sequences of bovine, equine, and swine CXCL9 from RNA obtained from peripheral blood mononuclear cell (PBMC) or other tissues. The bovine coding region was 378 nucleotides in length, while the equine and swine coding regions w...

ISSYS: An integrated synergistic Synthesis System

NASA Technical Reports Server (NTRS)

Dovi, A. R.

1980-01-01

Integrated Synergistic Synthesis System (ISSYS), an integrated system of computer codes in which the sequence of program execution and data flow is controlled by the user, is discussed. The commands available to exert such control, the ISSYS major function and rules, and the computer codes currently available in the system are described. Computational sequences frequently used in the aircraft structural analysis and synthesis are defined. External computer codes utilized by the ISSYS system are documented. A bibliography on the programs is included.

Connection anonymity analysis in coded-WDM PONs

NASA Astrophysics Data System (ADS)

Sue, Chuan-Ching

2008-04-01

A coded wavelength division multiplexing passive optical network (WDM PON) is presented for fiber to the home (FTTH) systems to protect against eavesdropping. The proposed scheme applies spectral amplitude coding (SAC) with a unipolar maximal-length sequence (M-sequence) code matrix to generate a specific signature address (coding) and to retrieve its matching address codeword (decoding) by exploiting the cyclic properties inherent in array waveguide grating (AWG) routers. In addition to ensuring the confidentiality of user data, the proposed coded-WDM scheme is also a suitable candidate for the physical layer with connection anonymity. Under the assumption that the eavesdropper applies a photo-detection strategy, it is shown that the coded WDM PON outperforms the conventional TDM PON and WDM PON schemes in terms of a higher degree of connection anonymity. Additionally, the proposed scheme allows the system operator to partition the optical network units (ONUs) into appropriate groups so as to achieve a better degree of anonymity.

Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt

PubMed Central

AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

2014-01-01

The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact “nanogenome.” PMID:25253891

Trellises and Trellis-Based Decoding Algorithms for Linear Block Codes. Part 3; The Map and Related Decoding Algirithms

NASA Technical Reports Server (NTRS)

Lin, Shu; Fossorier, Marc

1998-01-01

In a coded communication system with equiprobable signaling, MLD minimizes the word error probability and delivers the most likely codeword associated with the corresponding received sequence. This decoding has two drawbacks. First, minimization of the word error probability is not equivalent to minimization of the bit error probability. Therefore, MLD becomes suboptimum with respect to the bit error probability. Second, MLD delivers a hard-decision estimate of the received sequence, so that information is lost between the input and output of the ML decoder. This information is important in coded schemes where the decoded sequence is further processed, such as concatenated coding schemes, multi-stage and iterative decoding schemes. In this chapter, we first present a decoding algorithm which both minimizes bit error probability, and provides the corresponding soft information at the output of the decoder. This algorithm is referred to as the MAP (maximum aposteriori probability) decoding algorithm.

Automatic vehicle location system

NASA Technical Reports Server (NTRS)

Hansen, G. R., Jr. (Inventor)

1973-01-01

An automatic vehicle detection system is disclosed, in which each vehicle whose location is to be detected carries active means which interact with passive elements at each location to be identified. The passive elements comprise a plurality of passive loops arranged in a sequence along the travel direction. Each of the loops is tuned to a chosen frequency so that the sequence of the frequencies defines the location code. As the vehicle traverses the sequence of the loops as it passes over each loop, signals only at the frequency of the loop being passed over are coupled from a vehicle transmitter to a vehicle receiver. The frequencies of the received signals in the receiver produce outputs which together represent a code of the traversed location. The code location is defined by a painted pattern which reflects light to a vehicle carried detector whose output is used to derive the code defined by the pattern.

Digital data for quick response (QR) codes of alkalophilic Bacillus pumilus to identify and to compare bacilli isolated from Lonar Crator Lake, India.

PubMed

Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

2016-06-01

Microbiologists are routinely engaged isolation, identification and comparison of isolated bacteria for their novelty. 16S rRNA sequences of Bacillus pumilus were retrieved from NCBI repository and generated QR codes for sequences (FASTA format and full Gene Bank information). 16SrRNA were used to generate quick response (QR) codes of Bacillus pumilus isolated from Lonar Crator Lake (19° 58' N; 76° 31' E), India. Bacillus pumilus 16S rRNA gene sequences were used to generate CGR, FCGR and PCA. These can be used for visual comparison and evaluation respectively. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. This generated digital data helps to evaluate and compare any Bacillus pumilus strain, minimizes laboratory efforts and avoid misinterpretation of the species.

Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

PubMed

Sun, Zichen; Stack, Colin; Šlapeta, Jan

2012-05-25

In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

PubMed

Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

2003-07-01

EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification

PubMed Central

Brewer, Bonita J.; Payen, Celia; Di Rienzi, Sara C.; Higgins, Megan M.; Ong, Giang; Dunham, Maitreya J.; Raghuraman, M. K.

2015-01-01

DNA replication errors are a major driver of evolution—from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model—Origin-Dependent Inverted-Repeat Amplification (ODIRA)—proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error—the ligation of leading and lagging nascent strands to create “closed” forks—can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent—a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial, inverted CNVs pivotal in human health and evolution. PMID:26700858

Origin-Dependent Inverted-Repeat Amplification: Tests of a Model for Inverted DNA Amplification.

PubMed

Brewer, Bonita J; Payen, Celia; Di Rienzi, Sara C; Higgins, Megan M; Ong, Giang; Dunham, Maitreya J; Raghuraman, M K

2015-12-01

DNA replication errors are a major driver of evolution--from single nucleotide polymorphisms to large-scale copy number variations (CNVs). Here we test a specific replication-based model to explain the generation of interstitial, inverted triplications. While no genetic information is lost, the novel inversion junctions and increased copy number of the included sequences create the potential for adaptive phenotypes. The model--Origin-Dependent Inverted-Repeat Amplification (ODIRA)-proposes that a replication error at pre-existing short, interrupted, inverted repeats in genomic sequences generates an extrachromosomal, inverted dimeric, autonomously replicating intermediate; subsequent genomic integration of the dimer yields this class of CNV without loss of distal chromosomal sequences. We used a combination of in vitro and in vivo approaches to test the feasibility of the proposed replication error and its downstream consequences on chromosome structure in the yeast Saccharomyces cerevisiae. We show that the proposed replication error-the ligation of leading and lagging nascent strands to create "closed" forks-can occur in vitro at short, interrupted inverted repeats. The removal of molecules with two closed forks results in a hairpin-capped linear duplex that we show replicates in vivo to create an inverted, dimeric plasmid that subsequently integrates into the genome by homologous recombination, creating an inverted triplication. While other models have been proposed to explain inverted triplications and their derivatives, our model can also explain the generation of human, de novo, inverted amplicons that have a 2:1 mixture of sequences from both homologues of a single parent--a feature readily explained by a plasmid intermediate that arises from one homologue and integrates into the other homologue prior to meiosis. Our tests of key features of ODIRA lend support to this mechanism and suggest further avenues of enquiry to unravel the origins of interstitial, inverted CNVs pivotal in human health and evolution.

Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

PubMed

Lathe, R

1985-05-05

Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

NASA Astrophysics Data System (ADS)

Liebovitch, Larry

1998-03-01

The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

PubMed

Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

2017-01-01

Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

Evolutionary Dynamics of Microsatellite Distribution in Plants: Insight from the Comparison of Sequenced Brassica, Arabidopsis and Other Angiosperm Species

PubMed Central

Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

2013-01-01

Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with respect to motif length, type and repeat number. Interestingly, several microsatellite characteristics seemed to be constant in plant evolution, which can be well explained by the general biological rules. PMID:23555856

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE PAGES

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

2015-05-12

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

A socio-technical systems approach to studying interruptions: understanding the interrupter's perspective.

PubMed

Rivera, A Joy

2014-05-01

The purpose of this study was to understand the cognitive processes underlying nurses' decision to interrupt other nurses. The Institute of Medicine (2000) reported that interruptions are likely contributors to medical errors. Unfortunately, the research to date has been quite homogenous, focusing only on the healthcare provider being interrupted, ignoring the true complexities of interruptions. This study took a socio-technical approach being the first to examine interruptions from the viewpoint of the interrupting nurse. Over 15 h of observations and 10 open-ended interviews with expert nurses in a Neuroscience Surgical Intensive Care Unit were conducted. It was found that nurses conduct a quick cost-benefit assessment to determine the interruptibility of other nurses and whether an interruption is value-added vs. non-value added. To complete the assessment, nurses consider several conditional factors related to the interruptee, the interrupter, and the nature of the interruption content, and different potential consequences of the interruption. Published by Elsevier Ltd.

NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

PubMed

Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

2016-11-01

The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE PAGES

Williams, Kelly Porter; Lau, Britney Yan

2016-10-28

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

RNAcentral: A comprehensive database of non-coding RNA sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, Kelly Porter; Lau, Britney Yan

RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

PubMed

Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

2015-07-01

In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

Integrative structural annotation of de novo RNA-Seq provides an accurate reference gene set of the enormous genome of the onion (Allium cepa L.)

PubMed Central

Kim, Seungill; Kim, Myung-Shin; Kim, Yong-Min; Yeom, Seon-In; Cheong, Kyeongchae; Kim, Ki-Tae; Jeon, Jongbum; Kim, Sunggil; Kim, Do-Sun; Sohn, Seong-Han; Lee, Yong-Hwan; Choi, Doil

2015-01-01

The onion (Allium cepa L.) is one of the most widely cultivated and consumed vegetable crops in the world. Although a considerable amount of onion transcriptome data has been deposited into public databases, the sequences of the protein-coding genes are not accurate enough to be used, owing to non-coding sequences intermixed with the coding sequences. We generated a high-quality, annotated onion transcriptome from de novo sequence assembly and intensive structural annotation using the integrated structural gene annotation pipeline (ISGAP), which identified 54,165 protein-coding genes among 165,179 assembled transcripts totalling 203.0 Mb by eliminating the intron sequences. ISGAP performed reliable annotation, recognizing accurate gene structures based on reference proteins, and ab initio gene models of the assembled transcripts. Integrative functional annotation and gene-based SNP analysis revealed a whole biological repertoire of genes and transcriptomic variation in the onion. The method developed in this study provides a powerful tool for the construction of reference gene sets for organisms based solely on de novo transcriptome data. Furthermore, the reference genes and their variation described here for the onion represent essential tools for molecular breeding and gene cloning in Allium spp. PMID:25362073

Code-modulated visual evoked potentials using fast stimulus presentation and spatiotemporal beamformer decoding.

PubMed

Wittevrongel, Benjamin; Van Wolputte, Elia; Van Hulle, Marc M

2017-11-08

When encoding visual targets using various lagged versions of a pseudorandom binary sequence of luminance changes, the EEG signal recorded over the viewer's occipital pole exhibits so-called code-modulated visual evoked potentials (cVEPs), the phase lags of which can be tied to these targets. The cVEP paradigm has enjoyed interest in the brain-computer interfacing (BCI) community for the reported high information transfer rates (ITR, in bits/min). In this study, we introduce a novel decoding algorithm based on spatiotemporal beamforming, and show that this algorithm is able to accurately identify the gazed target. Especially for a small number of repetitions of the coding sequence, our beamforming approach significantly outperforms an optimised support vector machine (SVM)-based classifier, which is considered state-of-the-art in cVEP-based BCI. In addition to the traditional 60 Hz stimulus presentation rate for the coding sequence, we also explore the 120 Hz rate, and show that the latter enables faster communication, with a maximal median ITR of 172.87 bits/min. Finally, we also report on a transition effect in the EEG signal following the onset of the stimulus sequence, and recommend to exclude the first 150 ms of the trials from decoding when relying on a single presentation of the stimulus sequence.

Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

PubMed

Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

2014-06-01

It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

PubMed

Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

2015-01-01

Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

Applications of statistical physics and information theory to the analysis of DNA sequences

NASA Astrophysics Data System (ADS)

Grosse, Ivo

2000-10-01

DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

PubMed

Galián, José A; Rosato, Marcela; Rosselló, Josep A

2014-03-01

Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

Shared prefetching to reduce execution skew in multi-threaded systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eichenberger, Alexandre E; Gunnels, John A

Mechanisms are provided for optimizing code to perform prefetching of data into a shared memory of a computing device that is shared by a plurality of threads that execute on the computing device. A memory stream of a portion of code that is shared by the plurality of threads is identified. A set of prefetch instructions is distributed across the plurality of threads. Prefetch instructions are inserted into the instruction sequences of the plurality of threads such that each instruction sequence has a separate sub-portion of the set of prefetch instructions, thereby generating optimized code. Executable code is generated basedmore » on the optimized code and stored in a storage device. The executable code, when executed, performs the prefetches associated with the distributed set of prefetch instructions in a shared manner across the plurality of threads.« less

The evolution of transcriptional regulation in eukaryotes

NASA Technical Reports Server (NTRS)

Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

2003-01-01

Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

Convolutional encoding of self-dual codes

NASA Technical Reports Server (NTRS)

Solomon, G.

1994-01-01

There exist almost complete convolutional encodings of self-dual codes, i.e., block codes of rate 1/2 with weights w, w = 0 mod 4. The codes are of length 8m with the convolutional portion of length 8m-2 and the nonsystematic information of length 4m-1. The last two bits are parity checks on the two (4m-1) length parity sequences. The final information bit complements one of the extended parity sequences of length 4m. Solomon and van Tilborg have developed algorithms to generate these for the Quadratic Residue (QR) Codes of lengths 48 and beyond. For these codes and reasonable constraint lengths, there are sequential decodings for both hard and soft decisions. There are also possible Viterbi-type decodings that may be simple, as in a convolutional encoding/decoding of the extended Golay Code. In addition, the previously found constraint length K = 9 for the QR (48, 24;12) Code is lowered here to K = 8.

Gene and translation initiation site prediction in metagenomic sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John

2012-01-01

Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less

Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

PubMed

Hua, Wei; Wang, Jiasong; Zhao, Jian

2014-01-01

Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

PubMed

Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

2015-08-06

Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

USDA-ARS?s Scientific Manuscript database

Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

Improved Atomistic Monte Carlo Simulations Demonstrate that Poly-L-Proline Adopts Heterogeneous Ensembles of Conformations of Semi-Rigid Segments Interrupted by Kinks

PubMed Central

Radhakrishnan, Aditya; Vitalis, Andreas; Mao, Albert H.; Steffen, Adam T.; Pappu, Rohit V.

2012-01-01

Poly-L-proline (PLP) polymers are useful mimics of biologically relevant proline-rich sequences. Biophysical and computational studies of PLP polymers in aqueous solutions are challenging because of the diversity of length scales and the slow time scales for conformational conversions. We describe an atomistic simulation approach that combines an improved ABSINTH implicit solvation model, with conformational sampling based on standard and novel Metropolis Monte Carlo moves. Refinements to forcefield parameters were guided by published experimental data for proline-rich systems. We assessed the validity of our simulation results through quantitative comparisons to experimental data that were not used in refining the forcefield parameters. Our analysis shows that PLP polymers form heterogeneous ensembles of conformations characterized by semi-rigid, rod-like segments interrupted by kinks, which result from a combination of internal cis peptide bonds, flexible backbone ψ-angles, and the coupling between ring puckering and backbone degrees of freedom. PMID:22329658

Specific and Modular Binding Code for Cytosine Recognition in Pumilio/FBF (PUF) RNA-binding Domains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Shuyun; Wang, Yang; Cassidy-Amstutz, Caleb

2011-10-28

Pumilio/fem-3 mRNA-binding factor (PUF) proteins possess a recognition code for bases A, U, and G, allowing designed RNA sequence specificity of their modular Pumilio (PUM) repeats. However, recognition side chains in a PUM repeat for cytosine are unknown. Here we report identification of a cytosine-recognition code by screening random amino acid combinations at conserved RNA recognition positions using a yeast three-hybrid system. This C-recognition code is specific and modular as specificity can be transferred to different positions in the RNA recognition sequence. A crystal structure of a modified PUF domain reveals specific contacts between an arginine side chain and themore » cytosine base. We applied the C-recognition code to design PUF domains that recognize targets with multiple cytosines and to generate engineered splicing factors that modulate alternative splicing. Finally, we identified a divergent yeast PUF protein, Nop9p, that may recognize natural target RNAs with cytosine. This work deepens our understanding of natural PUF protein target recognition and expands the ability to engineer PUF domains to recognize any RNA sequence.« less

Novel numerical and graphical representation of DNA sequences and proteins.

PubMed

Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

2006-12-01

We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

PubMed

Miller, Andrew D

2015-02-01

A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

A chromosome inversion near the KIT gene and the Tobiano spotting pattern in horses.

PubMed

Brooks, S A; Lear, T L; Adelson, D L; Bailey, E

2007-01-01

Tobiano is a white spotting pattern in horses caused by a dominant gene, Tobiano(TO). Here, we report TO associated with a large paracentric chromosome inversion on horse chromosome 3. DNA sequences flanking the inversion were identified and a PCR test was developed to detect the inversion. The inversion was only found in horses with the tobiano pattern, including horses with diverse genetic backgrounds, which indicated a common genetic origin thousands of years ago. The inversion does not interrupt any annotated genes, but begins approximately 100 kb downstream of the KIT gene. This inversion may disrupt regulatory sequences for the KIT gene and cause the white spotting pattern. Copyright (c) 2008 S. Karger AG, Basel.

An eye movement analysis of the effect of interruption modality on primary task resumption.

PubMed

Ratwani, Raj; Trafton, J Gregory

2010-06-01

We examined the effect of interruption modality (visual or auditory) on primary task (visual) resumption to determine which modality was the least disruptive. Theories examining interruption modality have focused on specific periods of the interruption timeline. Preemption theory has focused on the switch from the primary task to the interrupting task. Multiple resource theory has focused on interrupting tasks that are to be performed concurrently with the primary task. Our focus was on examining how interruption modality influences task resumption.We leverage the memory-for-goals theory, which suggests that maintaining an associative link between environmental cues and the suspended primary task goal is important for resumption. Three interruption modality conditions were examined: auditory interruption with the primary task visible, auditory interruption with a blank screen occluding the primary task, and a visual interruption occluding the primary task. Reaction time and eye movement data were collected. The auditory condition with the primary task visible was the least disruptive. Eye movement data suggest that participants in this condition were actively maintaining an associative link between relevant environmental cues on the primary task interface and the suspended primary task goal during the interruption. These data suggest that maintaining cue association is the important factor for reducing the disruptiveness of interruptions, not interruption modality. Interruption-prone computing environments should be designed to allow for the user to have access to relevant primary task cues during an interruption to minimize disruptiveness.

Developmental rearrangement of cyanobacterial nif genes: nucleotide sequence, open reading frames, and cytochrome P-450 homology of the Anabaena sp. strain PCC 7120 nifD element.

PubMed Central

Lammers, P J; McLaughlin, S; Papin, S; Trujillo-Provencio, C; Ryncarz, A J

1990-01-01

An 11-kbp DNA element of unknown function interrupts the nifD gene in vegetative cells of Anabaena sp. strain PCC 7120. In developing heterocysts the nifD element excises from the chromosome via site-specific recombination between short repeat sequences that flank the element. The nucleotide sequence of the nifH-proximal half of the element was determined to elucidate the genetic potential of the element. Four open reading frames with the same relative orientation as the nifD element-encoded xisA gene were identified in the sequenced region. Each of the open reading frames was preceded by a reasonable ribosome-binding site and had biased codon utilization preferences consistent with low levels of expression. Open reading frame 3 was highly homologous with three cytochrome P-450 omega-hydroxylase proteins and showed regional homology to functionally significant domains common to the cytochrome P-450 superfamily. The sequence encoding open reading frame 2 was the most highly conserved portion of the sequenced region based on heterologous hybridization experiments with three genera of heterocystous cyanobacteria. Images PMID:2123860

Origins of genes: "big bang" or continuous creation?

PubMed Central

Keese, P K; Gibbs, A

1992-01-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes. PMID:1329098

Abstract feature codes: The building blocks of the implicit learning system.

PubMed

Eberhardt, Katharina; Esser, Sarah; Haider, Hilde

2017-07-01

According to the Theory of Event Coding (TEC; Hommel, Müsseler, Aschersleben, & Prinz, 2001), action and perception are represented in a shared format in the cognitive system by means of feature codes. In implicit sequence learning research, it is still common to make a conceptual difference between independent motor and perceptual sequences. This supposedly independent learning takes place in encapsulated modules (Keele, Ivry, Mayr, Hazeltine, & Heuer 2003) that process information along single dimensions. These dimensions have remained underspecified so far. It is especially not clear whether stimulus and response characteristics are processed in separate modules. Here, we suggest that feature dimensions as they are described in the TEC should be viewed as the basic content of modules of implicit learning. This means that the modules process all stimulus and response information related to certain feature dimensions of the perceptual environment. In 3 experiments, we investigated by means of a serial reaction time task the nature of the basic units of implicit learning. As a test case, we used stimulus location sequence learning. The results show that a stimulus location sequence and a response location sequence cannot be learned without interference (Experiment 2) unless one of the sequences can be coded via an alternative, nonspatial dimension (Experiment 3). These results support the notion that spatial location is one module of the implicit learning system and, consequently, that there are no separate processing units for stimulus versus response locations. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

Multiplexed pyrosequencing of nine sea anemone (Cnidaria: Anthozoa: Hexacorallia: Actiniaria) mitochondrial genomes.

PubMed

Foox, Jonathan; Brugler, Mercer; Siddall, Mark Edward; Rodríguez, Estefanía

2016-07-01

Six complete and three partial actiniarian mitochondrial genomes were amplified in two semi-circles using long-range PCR and pyrosequenced in a single run on a 454 GS Junior, doubling the number of complete mitogenomes available within the order. Typical metazoan mtDNA features included circularity, 13 protein-coding genes, 2 ribosomal RNA genes, and length ranging from 17,498 to 19,727 bp. Several typical anthozoan mitochondrial genome features were also observed including the presence of only two transfer RNA genes, elevated A + T richness ranging from 54.9 to 62.4%, large intergenic regions, and group 1 introns interrupting NADH dehydrogenase subunit 5 and cytochrome c oxidase subunit I, the latter of which possesses a homing endonuclease gene. Within the sea anemone Alicia sansibarensis, we report the first mitochondrial gene order rearrangement within the Actiniaria, as well as putative novel non-canonical protein-coding genes. Phylogenetic analyses of all 13 protein-coding and 2 ribosomal genes largely corroborated current hypotheses of sea anemone interrelatedness, with a few lower-level differences.

Adaptive decoding of convolutional codes

NASA Astrophysics Data System (ADS)

Hueske, K.; Geldmacher, J.; Götze, J.

2007-06-01

Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

Optimization of algorithm of coding of genetic information of Chlamydia

NASA Astrophysics Data System (ADS)

Feodorova, Valentina A.; Ulyanov, Sergey S.; Zaytsev, Sergey S.; Saltykov, Yury V.; Ulianova, Onega V.

2018-04-01

New method of coding of genetic information using coherent optical fields is developed. Universal technique of transformation of nucleotide sequences of bacterial gene into laser speckle pattern is suggested. Reference speckle patterns of the nucleotide sequences of omp1 gene of typical wild strains of Chlamydia trachomatis of genovars D, E, F, G, J and K and Chlamydia psittaci serovar I as well are generated. Algorithm of coding of gene information into speckle pattern is optimized. Fully developed speckles with Gaussian statistics for gene-based speckles have been used as criterion of optimization.

Simulated Assessment of Interference Effects in Direct Sequence Spread Spectrum (DSSS) QPSK Receiver

DTIC Science & Technology

2014-03-27

bit error rate BPSK binary phase shift keying CDMA code division multiple access CSI comb spectrum interference CW continuous wave DPSK differential... CDMA ) and GPS systems which is a Gold code. This code is generated by a modulo-2 operation between two different preferred m-sequences. The preferred m...10 SNR Sim (dB) S N R O ut ( dB ) SNR RF SNR DS Figure 3.26: Comparison of input S NRS im and S NROut of the band-pass RF filter (S NRRF) and

Hiding message into DNA sequence through DNA coding and chaotic maps.

PubMed

Liu, Guoyan; Liu, Hongjun; Kadir, Abdurahman

2014-09-01

The paper proposes an improved reversible substitution method to hide data into deoxyribonucleic acid (DNA) sequence, and four measures have been taken to enhance the robustness and enlarge the hiding capacity, such as encode the secret message by DNA coding, encrypt it by pseudo-random sequence, generate the relative hiding locations by piecewise linear chaotic map, and embed the encoded and encrypted message into a randomly selected DNA sequence using the complementary rule. The key space and the hiding capacity are analyzed. Experimental results indicate that the proposed method has a better performance compared with the competing methods with respect to robustness and capacity.

Physics behind the mechanical nucleosome positioning code

NASA Astrophysics Data System (ADS)

Zuiddam, Martijn; Everaers, Ralf; Schiessel, Helmut

2017-11-01

The positions along DNA molecules of nucleosomes, the most abundant DNA-protein complexes in cells, are influenced by the sequence-dependent DNA mechanics and geometry. This leads to the "nucleosome positioning code", a preference of nucleosomes for certain sequence motives. Here we introduce a simplified model of the nucleosome where a coarse-grained DNA molecule is frozen into an idealized superhelical shape. We calculate the exact sequence preferences of our nucleosome model and find it to reproduce qualitatively all the main features known to influence nucleosome positions. Moreover, using well-controlled approximations to this model allows us to come to a detailed understanding of the physics behind the sequence preferences of nucleosomes.

EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences

PubMed Central

Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

2003-01-01

EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408

An integrated PCR colony hybridization approach to screen cDNA libraries for full-length coding sequences.

PubMed

Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain

2011-01-01

cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.

PubMed Central

Gustafson, G; Armour, S L

1986-01-01

The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962

Colour cyclic code for Brillouin distributed sensors

NASA Astrophysics Data System (ADS)

Le Floch, Sébastien; Sauser, Florian; Llera, Miguel; Rochat, Etienne

2015-09-01

For the first time, a colour cyclic coding (CCC) is theoretically and experimentally demonstrated for Brillouin optical time-domain analysis (BOTDA) distributed sensors. Compared to traditional intensity-modulated cyclic codes, the code presents an additional gain of √2 while keeping the same number of sequences as for a colour coding. A comparison with a standard BOTDA sensor is realized and validates the theoretical coding gain.

Improving the effectiveness of an interruption lag by inducing a memory-based strategy.

PubMed

Morgan, Phillip L; Patrick, John; Tiley, Leyanne

2013-01-01

The memory for goals model (Altmann & Trafton, 2002) posits the importance of a short delay (the 'interruption lag') before an interrupting task to encode suspended goals for retrieval post-interruption. Two experiments used the theory of soft constraints (Gray, Simms, Fu & Schoelles, 2006) to investigate whether the efficacy of an interruption lag could be improved by increasing goal-state access cost to induce a more memory-based encoding strategy. Both experiments used a copying task with three access cost conditions (Low, Medium, and High) and a 5-s interruption lag with a no lag control condition. Experiment 1 found that the participants in the High access cost condition resumed more interrupted trials and executed more actions correctly from memory when coupled with an interruption lag. Experiment 2 used a prospective memory test post-interruption and an eyetracker recorded gaze activity during the interruption lag. The participants in the High access cost condition with an interruption lag were best at encoding target information during the interruption lag, evidenced by higher scores on the prospective memory measure and more gaze activity on the goal-state during the interruption lag. Theoretical and practical issues regarding the use of goal-state access cost and an interruption lag are discussed. Copyright © 2012. Published by Elsevier B.V.

Do interruptions affect quality of work?

PubMed

Foroughi, Cyrus K; Werner, Nicole E; Nelson, Erik T; Boehm-Davis, Deborah A

2014-11-01

The aim of this study was to determine if interruptions affect the quality of work. Interruptions are commonplace at home and in the office. Previous research in this area has traditionally involved time and errors as the primary measures of disruption. Little is known about the effect interruptions have on quality of work. Fifty-four students outlined and wrote three essays using a within-subjects design. During Condition 1, interruptions occurred while participants were outlining. During Condition 2, interruptions occurred while they were writing. No interruptions occurred in Condition 3. Quality of work was significantly reduced in both interruption conditions when compared to the non-interruption condition. The number of words produced was significantly reduced when participants were interrupted while writing the essay but not when outlining the essay. This research represents a crucial first step in understanding the effect interruptions have on quality of work. Our research suggests that interruptions negatively impact quality of work during a complex, creative writing task. Since interruptions are such a prevalent part of daily life, more research needs to be conducted to determine what other tasks are negatively impacted. Moreover, the underlying mechanism(s) causing these decrements needs to be identified. Finally, strategies and systems need to be designed and put in place to help counteract the decline in quality of work caused by interruptions.

Delineating slowly and rapidly evolving fractions of the Drosophila genome.

PubMed

Keith, Jonathan M; Adams, Peter; Stephen, Stuart; Mattick, John S

2008-05-01

Evolutionary conservation is an important indicator of function and a major component of bioinformatic methods to identify non-protein-coding genes. We present a new Bayesian method for segmenting pairwise alignments of eukaryotic genomes while simultaneously classifying segments into slowly and rapidly evolving fractions. We also describe an information criterion similar to the Akaike Information Criterion (AIC) for determining the number of classes. Working with pairwise alignments enables detection of differences in conservation patterns among closely related species. We analyzed three whole-genome and three partial-genome pairwise alignments among eight Drosophila species. Three distinct classes of conservation level were detected. Sequences comprising the most slowly evolving component were consistent across a range of species pairs, and constituted approximately 62-66% of the D. melanogaster genome. Almost all (>90%) of the aligned protein-coding sequence is in this fraction, suggesting much of it (comprising the majority of the Drosophila genome, including approximately 56% of non-protein-coding sequences) is functional. The size and content of the most rapidly evolving component was species dependent, and varied from 1.6% to 4.8%. This fraction is also enriched for protein-coding sequence (while containing significant amounts of non-protein-coding sequence), suggesting it is under positive selection. We also classified segments according to conservation and GC content simultaneously. This analysis identified numerous sub-classes of those identified on the basis of conservation alone, but was nevertheless consistent with that classification. Software, data, and results available at www.maths.qut.edu.au/-keithj/. Genomic segments comprising the conservation classes available in BED format.

Gene encoding the human. beta. -hexosaminidase. beta. chain: Extensive homology of intron placement in the. alpha. - and. beta. -chain genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Proia, R.L.

1988-03-01

Lysosomal {beta}-hexosaminidase is composed of two structurally similar chains, {alpha} and {beta}, that are the products of different genes. Mutations in either gene causing {beta}-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the {alpha} and {beta} chains, the {beta}-chain gene was isolated, and its organization was characterized. The {beta}-chain coding region is divided into 14 exons distributed over {approx}40 kilobases of DNA. Comparison with the {alpha}-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions.more » This extensive sharing of intron placement demonstrates that the {alpha} and {beta} chains evolved by way of the duplication of a common ancestor.« less

New encoded single-indicator sequences based on physico-chemical parameters for efficient exon identification.

PubMed

Meher, J K; Meher, P K; Dash, G N; Raval, M K

2012-01-01

The first step in gene identification problem based on genomic signal processing is to convert character strings into numerical sequences. These numerical sequences are then analysed spectrally or using digital filtering techniques for the period-3 peaks, which are present in exons (coding areas) and absent in introns (non-coding areas). In this paper, we have shown that single-indicator sequences can be generated by encoding schemes based on physico-chemical properties. Two new methods are proposed for generating single-indicator sequences based on hydration energy and dipole moments. The proposed methods produce high peak at exon locations and effectively suppress false exons (intron regions having greater peak than exon regions) resulting in high discriminating factor, sensitivity and specificity.

TANDEM: matching proteins with tandem mass spectra.

PubMed

Craig, Robertson; Beavis, Ronald C

2004-06-12

Tandem mass spectra obtained from fragmenting peptide ions contain some peptide sequence specific information, but often there is not enough information to sequence the original peptide completely. Several proprietary software applications have been developed to attempt to match the spectra with a list of protein sequences that may contain the sequence of the peptide. The application TANDEM was written to provide the proteomics research community with a set of components that can be used to test new methods and algorithms for performing this type of sequence-to-data matching. The source code and binaries for this software are available at http://www.proteome.ca/opensource.html, for Windows, Linux and Macintosh OSX. The source code is made available under the Artistic License, from the authors.

Investigating Interruptions: Implications for Flightdeck Performance

NASA Technical Reports Server (NTRS)

Latorella, Kara A.

1999-01-01

A fundamental aspect of multiple task management is attending to new stimuli and integrating associated task requirements into an ongoing task set; this is "interruption management" (IM). Anecdotal evidence and field studies indicate the frequency and consequences of interruptions, however experimental investigations of mechanisms influencing IM are scarce. Interruptions on commercial flightdecks are numerous, of various forms, and have been cited as contributing factors in many aviation incident and accident reports. This research grounds an experimental investigation of flightdeck interruptions in a proposed IM stage model. This model organizes basic research, identifies influencing mechanisms, and suggests appropriate dependent measures for IM. Fourteen airline pilots participated in a flightdeck simulation experiment to investigate the general effects of performing an interrupting task and interrupted procedure, and the effects of specific task factors: (1) modality; (2) embeddedness, or goal-level, of an interruption; (3) strength of association, or coupling-strength, between interrupted tasks; (4) semantic similarity; and (5) environmental stress. General effects of interruptions were extremely robust. All individual task factors significantly affected interruption management, except "similarity." Results extend the Interruption Management model, and are interpreted for their implications for interrupted flightdeck performance and intervention strategies for mitigating their effects on the flightdeck.

Draft Genome Sequence of the Deinococcus-Thermus Bacterium Meiothermus ruber Strain A

DOE PAGES

Thiel, Vera; Tomsho, Lynn P.; Burhans, Richard; ...

2015-03-26

The draft genome sequence of the Deinococcus-Thermus group bacterium Meiothermus ruber strain A, isolated from a cyanobacterial enrichment culture obtained from Octopus Spring (Yellowstone National Park, WY), comprises 2,968,099 bp in 170 contigs. It is predicted to contain 2,895 protein-coding genes, 44 tRNA-coding genes, and 2 rRNA operons.

Draft Genome Sequence of Staphylococcus cohnii subsp. urealyticus Isolated from a Healthy Dog

PubMed Central

Wigmore, Sarah M.; Wareham, David W.

2017-01-01

ABSTRACT   Staphylococcus cohnii subsp. urealyticus strain SW120 was isolated from the ear swab of a healthy dog. The isolate is resistant to methicillin and fusidic acid. The SW120 draft genome is 2,805,064 bp and contains 2,667 coding sequences, including 58 tRNAs and nine complete rRNA coding regions. PMID:28209829

Draft Genome Sequence of a Canine Isolate of Methicillin-Resistant Staphylococcus haemolyticus

PubMed Central

Wigmore, Sarah M.; Wareham, David W.

2017-01-01

ABSTRACT Staphylococcus haemolyticus strain SW007 was isolated from a nasal swab taken from a healthy dog. The isolate is resistant to methicillin, mupirocin, macrolides, and sulfonamides. The SW007 draft genome is 2,325,410 bp and contains 2,277 coding sequences, including 60 tRNAs and nine complete rRNA-coding regions. PMID:28385855

Association of low-frequency and rare coding-sequence variants with blood lipids and Coronary Heart Disease in 56,000 whites and blacks

USDA-ARS?s Scientific Manuscript database

Low-frequency coding DNA sequence variants in the proprotein convertase subtilisin/kexin type 9 gene (PCSK9) lower plasma low-density lipoprotein cholesterol (LDL-C), protect against risk of coronary heart disease (CHD), and have prompted the development of a new class of therapeutics. It is uncerta...

Sequencing and comparative genomic analysis of 1227 Felis catus cDNA sequences enriched for developmental, clinical and nutritional phenotypes

PubMed Central

2012-01-01

Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742

Identification of a Conserved Non-Protein-Coding Genomic Element that Plays an Essential Role in Alphabaculovirus Pathogenesis

PubMed Central

Kikhno, Irina

2014-01-01

Highly homologous sequences 154–157 bp in length grouped under the name of “conserved non-protein-coding element” (CNE) were revealed in all of the sequenced genomes of baculoviruses belonging to the genus Alphabaculovirus. A CNE alignment led to the detection of a set of highly conserved nucleotide clusters that occupy strictly conserved positions in the CNE sequence. The significant length of the CNE and conservation of both its length and cluster architecture were identified as a combination of characteristics that make this CNE different from known viral non-coding functional sequences. The essential role of the CNE in the Alphabaculovirus life cycle was demonstrated through the use of a CNE-knockout Autographa californica multiple nucleopolyhedrovirus (AcMNPV) bacmid. It was shown that the essential function of the CNE was not mediated by the presumed expression activities of the protein- and non-protein-coding genes that overlap the AcMNPV CNE. On the basis of the presented data, the AcMNPV CNE was categorized as a complex-structured, polyfunctional genomic element involved in an essential DNA transaction that is associated with an undefined function of the baculovirus genome. PMID:24740153

Characterization of the complete mitochondrial genome of Marshallagia marshalli and phylogenetic implications for the superfamily Trichostrongyloidea.

PubMed

Sun, Miao-Miao; Han, Liang; Zhang, Fu-Kai; Zhou, Dong-Hui; Wang, Shu-Qing; Ma, Jun; Zhu, Xing-Quan; Liu, Guo-Hua

2018-01-01

Marshallagia marshalli (Nematoda: Trichostrongylidae) infection can lead to serious parasitic gastroenteritis in sheep, goat, and wild ruminant, causing significant socioeconomic losses worldwide. Up to now, the study concerning the molecular biology of M. marshalli is limited. Herein, we sequenced the complete mitochondrial (mt) genome of M. marshalli and examined its phylogenetic relationship with selected members of the superfamily Trichostrongyloidea using Bayesian inference (BI) based on concatenated mt amino acid sequence datasets. The complete mt genome sequence of M. marshalli is 13,891 bp, including 12 protein-coding genes, 22 transfer RNA genes, and 2 ribosomal RNA genes. All protein-coding genes are transcribed in the same direction. Phylogenetic analyses based on concatenated amino acid sequences of the 12 protein-coding genes supported the monophylies of the families Haemonchidae, Molineidae, and Dictyocaulidae with strong statistical support, but rejected the monophyly of the family Trichostrongylidae. The determination of the complete mt genome sequence of M. marshalli provides novel genetic markers for studying the systematics, population genetics, and molecular epidemiology of M. marshalli and its congeners.

The mitochondrial genome of the multicolored Asian lady beetle Harmonia axyridis (Pallas) and a phylogenetic analysis of the Polyphaga (Insecta: Coleoptera).

PubMed

Niu, Fang-Fang; Zhu, Liang; Wang, Su; Wei, Shu-Jun

2016-07-01

Here, we report the mitochondrial genome sequence of the multicolored Asian lady beetle Harmonia axyridis (Pallas, 1773) (Coleoptera: Coccinellidae) (GenBank accession No. KR108208). This is the first species with sequenced mitochondrial genome from the genus Harmonia. The current length with partitial A + T-rich region of this mitochondrial genome is 16,387 bp. All the typical genes were sequenced except the trnI and trnQ. As in most other sequenced mitochondrial genomes of Coleoptera, there is no re-arrangement in the sequenced region compared with the pupative ancestral arrangement of insects. All protein-coding genes start with ATN codons. Five, five and three protein-coding genes stop with termination codon TAA, TA and T, respectively. Phylogenetic analysis using Bayesian method based on the first and second codon positions of the protein-coding genes supported that the Scirtidae is a basal lineage of Polyphaga. The Harmonia and the Coccinella form a sister lineage. The monophyly of Staphyliniformia, Scarabaeiformia and Cucujiformia was supported. The Buprestidae was found to be a sister group to the Bostrichiformia.

A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

PubMed

Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

2010-02-01

A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

Chimeric mitochondrial minichromosomes of the human body louse, Pediculus humanus: evidence for homologous and non-homologous recombination.

PubMed

Shao, Renfu; Barker, Stephen C

2011-02-15

The mitochondrial (mt) genome of the human body louse, Pediculus humanus, consists of 18 minichromosomes. Each minichromosome is 3 to 4 kb long and has 1 to 3 genes. There is unequivocal evidence for recombination between different mt minichromosomes in P. humanus. It is not known, however, how these minichromosomes recombine. Here, we report the discovery of eight chimeric mt minichromosomes in P. humanus. We classify these chimeric mt minichromosomes into two groups: Group I and Group II. Group I chimeric minichromosomes contain parts of two different protein-coding genes that are from different minichromosomes. The two parts of protein-coding genes in each Group I chimeric minichromosome are joined at a microhomologous nucleotide sequence; microhomologous nucleotide sequences are hallmarks of non-homologous recombination. Group II chimeric minichromosomes contain all of the genes and the non-coding regions of two different minichromosomes. The conserved sequence blocks in the non-coding regions of Group II chimeric minichromosomes resemble the "recombination repeats" in the non-coding regions of the mt genomes of higher plants. These repeats are essential to homologous recombination in higher plants. Our analyses of the nucleotide sequences of chimeric mt minichromosomes indicate both homologous and non-homologous recombination between minichromosomes in the mitochondria of the human body louse. Copyright © 2010 Elsevier B.V. All rights reserved.

RESCUE - Reduction of MRI SNR Degradation by Using an MR-Synchronous Low-Interference PET Acquisition Technique

NASA Astrophysics Data System (ADS)

Gebhardt, Pierre; Wehner, Jakob; Weissler, Bjoern; Frach, Thomas; Marsden, Paul K.; Schulz, Volkmar

2015-06-01

Devices aiming at combined Positron Emission Tomography (PET) and Magnetic Resonance Imaging (MRI) to enable simultaneous PET/MR image acquisition have to fulfill demanding requirements to avoid mutual magneticas well as electromagnetic-field-related interferences which lead to image quality degradation. Particularly Radio-Frequency (RF)-field-related interferences between PET and MRI may lead to MRI SNR reduction, thereby deteriorating MR image quality. RF shielding of PET electronics is therefore commonly applied to reduce RF emission and lower the potential coupling into MRI RF coil(s). However, shields introduce eddy-current-induced MRI field distortions and should thus be minimized or ideally omitted. Although the MRI noise floor increase caused by a PET system might be acceptable for many MRI applications, some MRI protocols, such as fast or high-resolution MRI scans, typically suffer from low SNR and might need more attention regarding RF silence to preserve the intrinsic MRI SNR. For such cases, we propose RESCUE, an MRI-synchronously-gated PET data acquisition technique: By interrupting the PET acquisition during MR signal receive phases, PET-related RF emission may be minimized, leading to MRI SNR preservation. Our PET insert Hyperion IID using Philips Digital Photon Counting (DPC) sensors serves as the platform to demonstrate RESCUE. To make the DPC sensor suitable for RESCUE to be applied for many MRI sequences with acquisition time windows in the range of a few milliseconds, we present in this paper a new technique which enables rapid DPC sensor operation interruption by dramatically lowering the overhead time to interrupt and restart the sensor operation. Procedures to enter and leave gated PET data acquisition may imply sensitivity losses which add to the ones occurring during MRI RF acquisition. For the case of our PET insert, the new DPC quick-interruption technique yields a PET sensitivity loss reduction by a factor of 78 when compared to the loss introduced with the standard start/stop procedure. For instance, PET sensitivity losses related to overhead time are 2.9% in addition to the loss related to PET gating being equal to the MRI RF acquisition duty cycle (14.7%) for an exemplary T1-weighted 3D-FFE MRI sequence. MRI SNR measurement results obtained with one Singles Detection Module (SDM) using no RF shield demonstrate a noise floor reduction by a factor of 2.1, getting close to the noise floor level of the SNR reference scan (SDM off-powered) when RESCUE was active.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Progressive Care Nurses Improving Patient Safety by Limiting Interruptions During Medication Administration.

PubMed

Flynn, Fran; Evanish, Julie Q; Fernald, Josephine M; Hutchinson, Dawn E; Lefaiver, Cheryl

2016-08-01

Because of the high frequency of interruptions during medication administration, the effectiveness of strategies to limit interruptions during medication administration has been evaluated in numerous quality improvement initiatives in an effort to reduce medication administration errors. To evaluate the effectiveness of evidence-based strategies to limit interruptions during scheduled, peak medication administration times in 3 progressive cardiac care units (PCCUs). A secondary aim of the project was to evaluate the impact of limiting interruptions on medication errors. The percentages of interruptions and medication errors before and after implementation of evidence-based strategies to limit interruptions were measured by using direct observations of nurses on 2 PCCUs. Nurses in a third PCCU served as a comparison group. Interruptions (P < .001) and medication errors (P = .02) decreased significantly in 1 PCCU after implementation of evidence-based strategies to limit interruptions. Avoidable interruptions decreased 83% in PCCU1 and 53% in PCCU2 after implementation of the evidence-based strategies. Implementation of evidence-based strategies to limit interruptions in PCCUs decreases avoidable interruptions and promotes patient safety. ©2016 American Association of Critical-Care Nurses.

[Abortion and fetal non-viability: the Brazilian debate].

PubMed

Diniz, Debora

2005-01-01

The Case Against Non-Compliance with the Fundamental Principle concerning Anencephaly, under review by the Brazilian Supreme Court, is a milestone in the debate on abortion in Latin America. Since the currently prevailing version of the Brazilian Penal Code was enacted in 1940, there has been fierce resistance to any change in the country's abortion policy. This article discusses the arguments and political strategies used in the anencephaly suit brought before the Supreme Court, particularly the ethical and legal position that interruption of pregnancy in cases of anencephaly does not constitute abortion, but should be considered a therapeutic anticipation of delivery.

Digital data for Quick Response (QR) codes of thermophiles to identify and compare the bacterial species isolated from Unkeshwar hot springs (India).

PubMed

Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

2016-03-01

16S rRNA sequences of morphologically and biochemically identified 21 thermophilic bacteria isolated from Unkeshwar hot springs (19°85'N and 78°25'E), Dist. Nanded (India) has been deposited in NCBI repository. The 16S rRNA gene sequences were used to generate QR codes for sequences (FASTA format and full Gene Bank information). Diversity among the isolates is compared with known isolates and evaluated using CGR, FCGR and PCA i.e. visual comparison and evaluation respectively. Considerable biodiversity was observed among the identified bacteria isolated from Unkeshwar hot springs. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/.

On Asymptotically Good Ramp Secret Sharing Schemes

NASA Astrophysics Data System (ADS)

Geil, Olav; Martin, Stefano; Martínez-Peñas, Umberto; Matsumoto, Ryutaroh; Ruano, Diego

Asymptotically good sequences of linear ramp secret sharing schemes have been intensively studied by Cramer et al. in terms of sequences of pairs of nested algebraic geometric codes. In those works the focus is on full privacy and full reconstruction. In this paper we analyze additional parameters describing the asymptotic behavior of partial information leakage and possibly also partial reconstruction giving a more complete picture of the access structure for sequences of linear ramp secret sharing schemes. Our study involves a detailed treatment of the (relative) generalized Hamming weights of the considered codes.

Statistical and linguistic features of DNA sequences

NASA Technical Reports Server (NTRS)

Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

1995-01-01

We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

Integrative structural annotation of de novo RNA-Seq provides an accurate reference gene set of the enormous genome of the onion (Allium cepa L.).

PubMed

Kim, Seungill; Kim, Myung-Shin; Kim, Yong-Min; Yeom, Seon-In; Cheong, Kyeongchae; Kim, Ki-Tae; Jeon, Jongbum; Kim, Sunggil; Kim, Do-Sun; Sohn, Seong-Han; Lee, Yong-Hwan; Choi, Doil

2015-02-01

The onion (Allium cepa L.) is one of the most widely cultivated and consumed vegetable crops in the world. Although a considerable amount of onion transcriptome data has been deposited into public databases, the sequences of the protein-coding genes are not accurate enough to be used, owing to non-coding sequences intermixed with the coding sequences. We generated a high-quality, annotated onion transcriptome from de novo sequence assembly and intensive structural annotation using the integrated structural gene annotation pipeline (ISGAP), which identified 54,165 protein-coding genes among 165,179 assembled transcripts totalling 203.0 Mb by eliminating the intron sequences. ISGAP performed reliable annotation, recognizing accurate gene structures based on reference proteins, and ab initio gene models of the assembled transcripts. Integrative functional annotation and gene-based SNP analysis revealed a whole biological repertoire of genes and transcriptomic variation in the onion. The method developed in this study provides a powerful tool for the construction of reference gene sets for organisms based solely on de novo transcriptome data. Furthermore, the reference genes and their variation described here for the onion represent essential tools for molecular breeding and gene cloning in Allium spp. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Kangaroo – A pattern-matching program for biological sequences

PubMed Central

2002-01-01

Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats. PMID:12150718

Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

PubMed

Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

2010-12-15

Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

The complete mitochondrial genome of Papilio glaucus and its phylogenetic implications.

PubMed

Shen, Jinhui; Cong, Qian; Grishin, Nick V

2015-09-01

Due to the intriguing morphology, lifecycle, and diversity of butterflies and moths, Lepidoptera are emerging as model organisms for the study of genetics, evolution and speciation. The progress of these studies relies on decoding Lepidoptera genomes, both nuclear and mitochondrial. Here we describe a protocol to obtain mitogenomes from Next Generation Sequencing reads performed for whole-genome sequencing and report the complete mitogenome of Papilio (Pterourus) glaucus. The circular mitogenome is 15,306 bp in length and rich in A and T. It contains 13 protein-coding genes (PCGs), 22 transfer-RNA-coding genes (tRNA), and 2 ribosomal-RNA-coding genes (rRNA), with a gene order typical for mitogenomes of Lepidoptera. We performed phylogenetic analyses based on PCG and RNA-coding genes or protein sequences using Bayesian Inference and Maximum Likelihood methods. The phylogenetic trees consistently show that among species with available mitogenomes Papilio glaucus is the closest to Papilio (Agehana) maraho from Asia.

Digital data for quick response (QR) codes of alkalophilic Bacillus pumilus to identify and to compare bacilli isolated from Lonar Crator Lake, India

PubMed Central

Rekadwad, Bhagwan N.; Khobragade, Chandrahasya N.

2016-01-01

Microbiologists are routinely engaged isolation, identification and comparison of isolated bacteria for their novelty. 16S rRNA sequences of Bacillus pumilus were retrieved from NCBI repository and generated QR codes for sequences (FASTA format and full Gene Bank information). 16SrRNA were used to generate quick response (QR) codes of Bacillus pumilus isolated from Lonar Crator Lake (19° 58′ N; 76° 31′ E), India. Bacillus pumilus 16S rRNA gene sequences were used to generate CGR, FCGR and PCA. These can be used for visual comparison and evaluation respectively. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. This generated digital data helps to evaluate and compare any Bacillus pumilus strain, minimizes laboratory efforts and avoid misinterpretation of the species. PMID:27141529

Detection of non-coding RNA in bacteria and archaea using the DETR'PROK Galaxy pipeline.

PubMed

Toffano-Nioche, Claire; Luo, Yufei; Kuchly, Claire; Wallon, Claire; Steinbach, Delphine; Zytnicki, Matthias; Jacq, Annick; Gautheret, Daniel

2013-09-01

RNA-seq experiments are now routinely used for the large scale sequencing of transcripts. In bacteria or archaea, such deep sequencing experiments typically produce 10-50 million fragments that cover most of the genome, including intergenic regions. In this context, the precise delineation of the non-coding elements is challenging. Non-coding elements include untranslated regions (UTRs) of mRNAs, independent small RNA genes (sRNAs) and transcripts produced from the antisense strand of genes (asRNA). Here we present a computational pipeline (DETR'PROK: detection of ncRNAs in prokaryotes) based on the Galaxy framework that takes as input a mapping of deep sequencing reads and performs successive steps of clustering, comparison with existing annotation and identification of transcribed non-coding fragments classified into putative 5' UTRs, sRNAs and asRNAs. We provide a step-by-step description of the protocol using real-life example data sets from Vibrio splendidus and Escherichia coli. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

PubMed

Yin, Changchuan

2015-04-01

To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

Efficient burst image compression using H.265/HEVC

NASA Astrophysics Data System (ADS)

Roodaki-Lavasani, Hoda; Lainema, Jani

2014-02-01

New imaging use cases are emerging as more powerful camera hardware is entering consumer markets. One family of such use cases is based on capturing multiple pictures instead of just one when taking a photograph. That kind of a camera operation allows e.g. selecting the most successful shot from a sequence of images, showing what happened right before or after the shot was taken or combining the shots by computational means to improve either visible characteristics of the picture (such as dynamic range or focus) or the artistic aspects of the photo (e.g. by superimposing pictures on top of each other). Considering that photographic images are typically of high resolution and quality and the fact that these kind of image bursts can consist of at least tens of individual pictures, an efficient compression algorithm is desired. However, traditional video coding approaches fail to provide the random access properties these use cases require to achieve near-instantaneous access to the pictures in the coded sequence. That feature is critical to allow users to browse the pictures in an arbitrary order or imaging algorithms to extract desired pictures from the sequence quickly. This paper proposes coding structures that provide such random access properties while achieving coding efficiency superior to existing image coders. The results indicate that using HEVC video codec with a single reference picture fixed for the whole sequence can achieve nearly as good compression as traditional IPPP coding structures. It is also shown that the selection of the reference frame can further improve the coding efficiency.

DNA as a Binary Code: How the Physical Structure of Nucleotide Bases Carries Information

ERIC Educational Resources Information Center

McCallister, Gary

2005-01-01

The DNA triplet code also functions as a binary code. Because double-ring compounds cannot bind to double-ring compounds in the DNA code, the sequence of bases classified simply as purines or pyrimidines can encode for smaller groups of possible amino acids. This is an intuitive approach to teaching the DNA code. (Contains 6 figures.)

The time-course of recovery from interruption during reading: eye movement evidence for the role of interruption lag and spatial memory.

PubMed

Cane, James E; Cauchard, Fabrice; Weger, Ulrich W

2012-01-01

Two experiments examined how interruptions impact reading and how interruption lags and the reader's spatial memory affect the recovery from such interruptions. Participants read paragraphs of text and were interrupted unpredictably by a spoken news story while their eye movements were monitored. Time made available for consolidation prior to responding to the interruption did not aid reading resumption. However, providing readers with a visual cue that indicated the interruption location did aid task resumption substantially in Experiment 2. Taken together, the findings show that the recovery from interruptions during reading draws on spatial memory resources and can be aided by processes that support spatial memory. Practical implications are discussed.

High-Content Optical Codes for Protecting Rapid Diagnostic Tests from Counterfeiting.

PubMed

Gökçe, Onur; Mercandetti, Cristina; Delamarche, Emmanuel

2018-06-19

Warnings and reports on counterfeit diagnostic devices are released several times a year by regulators and public health agencies. Unfortunately, mishandling, altering, and counterfeiting point-of-care diagnostics (POCDs) and rapid diagnostic tests (RDTs) is lucrative, relatively simple and can lead to devastating consequences. Here, we demonstrate how to implement optical security codes in silicon- and nitrocellulose-based flow paths for device authentication using a smartphone. The codes are created by inkjet spotting inks directly on nitrocellulose or on micropillars. Codes containing up to 32 elements per mm 2 and 8 colors can encode as many as 10 45 combinations. Codes on silicon micropillars can be erased by setting a continuous flow path across the entire array of code elements or for nitrocellulose by simply wicking a liquid across the code. Static or labile code elements can further be formed on nitrocellulose to create a hidden code using poly(ethylene glycol) (PEG) or glycerol additives to the inks. More advanced codes having a specific deletion sequence can also be created in silicon microfluidic devices using an array of passive routing nodes, which activate in a particular, programmable sequence. Such codes are simple to fabricate, easy to view, and efficient in coding information; they can be ideally used in combination with information on a package to protect diagnostic devices from counterfeiting.

Error control techniques for satellite and space communications

NASA Technical Reports Server (NTRS)

Costello, D. J., Jr.

1986-01-01

High rate concatenated coding systems with trellis inner codes and Reed-Solomon (RS) outer codes for application in satellite communication systems are considered. Two types of inner codes are studied: high rate punctured binary convolutional codes which result in overall effective information rates between 1/2 and 1 bit per channel use; and bandwidth efficient signal space trellis codes which can achieve overall effective information rates greater than 1 bit per channel use. Channel capacity calculations with and without side information performed for the concatenated coding system. Concatenated coding schemes are investigated. In Scheme 1, the inner code is decoded with the Viterbi algorithm and the outer RS code performs error-correction only (decoding without side information). In scheme 2, the inner code is decoded with a modified Viterbi algorithm which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, while branch metrics are used to provide the reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. These two schemes are proposed for use on NASA satellite channels. Results indicate that high system reliability can be achieved with little or no bandwidth expansion.

DNA-based watermarks using the DNA-Crypt algorithm.

PubMed

Heider, Dominik; Barnekow, Angelika

2007-05-29

The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

DNA-based watermarks using the DNA-Crypt algorithm

PubMed Central

Heider, Dominik; Barnekow, Angelika

2007-01-01

Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

Subjective quality evaluation of low-bit-rate video

NASA Astrophysics Data System (ADS)

Masry, Mark; Hemami, Sheila S.; Osberger, Wilfried M.; Rohaly, Ann M.

2001-06-01

A subjective quality evaluation was performed to qualify vie4wre responses to visual defects that appear in low bit rate video at full and reduced frame rates. The stimuli were eight sequences compressed by three motion compensated encoders - Sorenson Video, H.263+ and a Wavelet based coder - operating at five bit/frame rate combinations. The stimulus sequences exhibited obvious coding artifacts whose nature differed across the three coders. The subjective evaluation was performed using the Single Stimulus Continuos Quality Evaluation method of UTI-R Rec. BT.500-8. Viewers watched concatenated coded test sequences and continuously registered the perceived quality using a slider device. Data form 19 viewers was colleted. An analysis of their responses to the presence of various artifacts across the range of possible coding conditions and content is presented. The effects of blockiness and blurriness on perceived quality are examined. The effects of changes in frame rate on perceived quality are found to be related to the nature of the motion in the sequence.

Interruption as a test of the user-computer interface

NASA Technical Reports Server (NTRS)

Kreifeldt, J. G.; Mccarthy, M. E.

1981-01-01

In order to study the effects different logic systems might have on interrupted operation, an algebraic calculator and a reverse polish notation calculator were compared when trained users were interrupted during problem entry. The RPN calculator showed markedly superior resistance to interruption effects compared to the AN calculator although no significant differences were found when the users were not interrupted. Causes and possible remedies for interruption effects are speculated. It is proposed that because interruption is such a common occurrence, it be incorporated into comparative evaluation tests of different logic system and control/display system and that interruption resistance be adopted as a specific design criteria for such design.

Draft Genome Sequence of a Canine Isolate of Methicillin-Resistant Staphylococcus haemolyticus.

PubMed

Bean, David C; Wigmore, Sarah M; Wareham, David W

2017-04-06

Staphylococcus haemolyticus strain SW007 was isolated from a nasal swab taken from a healthy dog. The isolate is resistant to methicillin, mupirocin, macrolides, and sulfonamides. The SW007 draft genome is 2,325,410 bp and contains 2,277 coding sequences, including 60 tRNAs and nine complete rRNA-coding regions. Copyright © 2017 Bean et al.

The complete chloroplast genome sequence of strawberry (Fragaria  × ananassa Duch.) and comparison with related species of Rosaceae

PubMed Central

Cheng, Hui; Li, Jinfeng; Zhang, Hong; Cai, Binhua; Gao, Zhihong

2017-01-01

Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F. × ananassa ‘Benihoppe’ using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp) separated by large (LSC, 85,531 bp) and small (SSC, 18,146 bp) single-copy (SC) regions. The length of the F. × ananassa ‘Benihoppe’ chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria, particularly among three octoploid strawberries which were F. × ananassa ‘Benihoppe’, F. chiloensis (GP33) and F. virginiana (O477). However, when the sequences of the coding and non-coding regions of F. × ananassa ‘Benihoppe’ were compared in detail with those of F. chiloensis (GP33) and F. virginiana (O477), a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions (trnK-matK, trnS-trnG, atpF-atpH, trnC-petN, trnT-psbD and trnP-psaJ) with a percentage of variable sites greater than 1% and no less than five parsimony-informative sites were identified and may be useful for phylogenetic analysis of the genus Fragaria. PMID:29038765

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Rapid Quantification of Mutant Fitness in Diverse Bacteria by Sequencing Randomly Bar-Coded Transposons

PubMed Central

Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; Lamson, Jacob S.; He, Jennifer; Hoover, Cindi A.; Blow, Matthew J.; Bristow, James; Butland, Gareth

2015-01-01

ABSTRACT Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with any transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative d-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. PMID:25968644

Decoding DNA labels by melting curve analysis using real-time PCR.

PubMed

Balog, József A; Fehér, Liliána Z; Puskás, László G

2017-12-01

Synthetic DNA has been used as an authentication code for a diverse number of applications. However, existing decoding approaches are based on either DNA sequencing or the determination of DNA length variations. Here, we present a simple alternative protocol for labeling different objects using a small number of short DNA sequences that differ in their melting points. Code amplification and decoding can be done in two steps using quantitative PCR (qPCR). To obtain a DNA barcode with high complexity, we defined 8 template groups, each having 4 different DNA templates, yielding 158 (>2.5 billion) combinations of different individual melting temperature (Tm) values and corresponding ID codes. The reproducibility and specificity of the decoding was confirmed by using the most complex template mixture, which had 32 different products in 8 groups with different Tm values. The industrial applicability of our protocol was also demonstrated by labeling a drone with an oil-based paint containing a predefined DNA code, which was then successfully decoded. The method presented here consists of a simple code system based on a small number of synthetic DNA sequences and a cost-effective, rapid decoding protocol using a few qPCR reactions, enabling a wide range of authentication applications.

Using hidden Markov models and observed evolution to annotate viral genomes.

PubMed

McCauley, Stephen; Hein, Jotun

2006-06-01

ssRNA (single stranded) viral genomes are generally constrained in length and utilize overlapping reading frames to maximally exploit the coding potential within the genome length restrictions. This overlapping coding phenomenon leads to complex evolutionary constraints operating on the genome. In regions which code for more than one protein, silent mutations in one reading frame generally have a protein coding effect in another. To maximize coding flexibility in all reading frames, overlapping regions are often compositionally biased towards amino acids which are 6-fold degenerate with respect to the 64 codon alphabet. Previous methodologies have used this fact in an ad hoc manner to look for overlapping genes by motif matching. In this paper differentiated nucleotide compositional patterns in overlapping regions are incorporated into a probabilistic hidden Markov model (HMM) framework which is used to annotate ssRNA viral genomes. This work focuses on single sequence annotation and applies an HMM framework to ssRNA viral annotation. A description of how the HMM is parameterized, whilst annotating within a missing data framework is given. A Phylogenetic HMM (Phylo-HMM) extension, as applied to 14 aligned HIV2 sequences is also presented. This evolutionary extension serves as an illustration of the potential of the Phylo-HMM framework for ssRNA viral genomic annotation. The single sequence annotation procedure (SSA) is applied to 14 different strains of the HIV2 virus. Further results on alternative ssRNA viral genomes are presented to illustrate more generally the performance of the method. The results of the SSA method are encouraging however there is still room for improvement, and since there is overwhelming evidence to indicate that comparative methods can improve coding sequence (CDS) annotation, the SSA method is extended to a Phylo-HMM to incorporate evolutionary information. The Phylo-HMM extension is applied to the same set of 14 HIV2 sequences which are pre-aligned. The performance improvement that results from including the evolutionary information in the analysis is illustrated.

Comparative analysis of the 5{prime} genomic and promoter regions between the mouse (Hdh) and human Huntington disease (HD) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalchman, M.; Lin, B.; Nasir, J.

1994-09-01

The mouse homologue of the Huntington disease gene (Hdh) has recently been cloned and mapped to a region of synteny with the human, on mouse chromosome 5. The two genes share a high degree of both coding (90% amino acid) and nucleotide (86.2%) identity. We have subsequently performed a detailed comparison of the genomic organization of the 5{prime} region of the two genes encompassing the promoter region and first five exons of both the human and mouse genes. The comparative sequence analysis of the promoter region between HD and Hdh reveals two highly conserved regions. One region (-56 to -118)more » (+1 is the ATG start codon), shared 84% nucleotide identity and another region (-130 to -206) had 81% nucleotide identity. Nine putative Sp1 sites appear in the human promoter region contrasted with only 3 in a similar region in the mouse. Furthermore, 17 and 20 base pair direct repeats present in the HD 5{prime} region are absent in the similar Hdh region. Although both the mouse and human intron/exon boundaries conform to the GT/AG rule, the intron sizes between HD and Hdh are markedly different. The first four introns in Hdh are 15, 7, 5 and 0.5 kb compared to sizes of 10, 15, 7 and 0.5 kb, respectively. Comparison between the mouse and human intronic sequences immediately adjacent to the first five exons (excluding exon 1) reveals only about 46 to 50% identity within the first 60 bp of intronic sequence. Furthermore, we have identified novel polymorphic di-, tri- and tetra-nucleotide repeats in Hdh introns of various mouse strains that are not present in the human. For example, polymorphic CT repeats are present in introns 2 and 4 of Hdh and a novel mouse 56 AAG trinucleotide repeat (interrupted by an AAGG) is also located within intron 2. This information concerning the promoter and genomic organization of both HD and Hdh is critical for designing appropriate gene targetting vectors for studying the normal function of the HD and Hdh genes in model systems.« less

TDRSS telecommunications system, PN code analysis

NASA Technical Reports Server (NTRS)

Dixon, R.; Gold, R.; Kaiser, F.

1976-01-01

The pseudo noise (PN) codes required to support the TDRSS telecommunications services are analyzed and the impact of alternate coding techniques on the user transponder equipment, the TDRSS equipment, and all factors that contribute to the acquisition and performance of these telecommunication services is assessed. Possible alternatives to the currently proposed hybrid FH/direct sequence acquisition procedures are considered and compared relative to acquisition time, implementation complexity, operational reliability, and cost. The hybrid FH/direct sequence technique is analyzed and rejected in favor of a recommended approach which minimizes acquisition time and user transponder complexity while maximizing probability of acquisition and overall link reliability.

The effect of an exogenous magnetic field on neural coding in deep spiking neural networks.

PubMed

Guo, Lei; Zhang, Wei; Zhang, Jialei

2018-01-01

A ten-layer feed forward network is constructed in the presence of an exogenous alternating magnetic field. Specifically, our results indicate that for rate coding, the firing rate is significantly increased in the presence of an exogenous alternating magnetic field and particularly with increasing enhancement of the alternating magnetic field amplitude. For temporal coding, the interspike intervals of the spiking sequence are decreased and the distribution of the interspike intervals of the spiking sequence tends to be uniform in the presence of alternating magnetic field.

Virological and immunological outcome of treatment interruption in HIV-1-infected subjects vaccinated with MVA-B

PubMed Central

Noguera-Julian, Marc; Bellido, Rocío; Puertas, Maria C.; Carrillo, Jorge; Rodriguez, C.; Perez-Alvarez, Núria; Cobarsí, Patricia; Gomez, Carmen E.; Esteban, Mariano; Jímenez, Jose Luis; García, Felipe; Blanco, Julià; Martinez-Picado, Javier; Paredes, Roger

2017-01-01

The most relevant endpoint in therapeutic HIV vaccination is the assessment of time to viral rebound or duration of sustained control of low-level viremia upon cART treatment cessation. Structured treatment interruptions (STI) are however not without risk to the patient and reliable predictors of viral rebound/control after therapeutic HIV-1 vaccination are urgently needed to ensure patient safety and guide therapeutic vaccine development. Here, we integrated immunological and virological parameters together with viral rebound dynamics after STI in a phase I therapeutic vaccine trial of a polyvalent MVA-B vaccine candidate to define predictors of viral control. Clinical parameters, proviral DNA, host HLA genetics and measures of humoral and cellular immunity were evaluated. A sieve effect analysis was conducted comparing pre-treatment viral sequences to breakthrough viruses after STI. Our results show that a reduced proviral HIV-1 DNA at study entry was independently associated with two virological parameters, delayed HIV-1 RNA rebound (p = 0.029) and lower peak viremia after treatment cessation (p = 0.019). Reduced peak viremia was also positively correlated with a decreased number of HLA class I allele associated polymorphisms in Gag sequences in the rebounding virus population (p = 0.012). Our findings suggest that proviral DNA levels and the number of HLA-associated Gag polymorphisms may have an impact on the clinical outcome of STI. Incorporation of these parameters in future therapeutic vaccine trials may guide refined immunogen design and help conduct safer STI approaches. PMID:28953921

Study on multiple-hops performance of MOOC sequences-based optical labels for OPS networks

NASA Astrophysics Data System (ADS)

Zhang, Chongfu; Qiu, Kun; Ma, Chunli

2009-11-01

In this paper, we utilize a new study method that is under independent case of multiple optical orthogonal codes to derive the probability function of MOOCS-OPS networks, discuss the performance characteristics for a variety of parameters, and compare some characteristics of the system employed by single optical orthogonal code or multiple optical orthogonal codes sequences-based optical labels. The performance of the system is also calculated, and our results verify that the method is effective. Additionally it is found that performance of MOOCS-OPS networks would, negatively, be worsened, compared with single optical orthogonal code-based optical label for optical packet switching (SOOC-OPS); however, MOOCS-OPS networks can greatly enlarge the scalability of optical packet switching networks.

Causes and occurrences of interruptions during ED triage.

PubMed

Johnson, Kimberly D; Motavalli, Michele; Gray, Dean; Kuehn, Connie

2014-09-01

Interruptions have been shown to cause errors and delays in the treatment of emergency patients and pose a real threat during the triage process. Missteps during the triage assessment can send a patient down the wrong treatment path and lead to delays. The purpose of this project was to identify the types and frequency of interruptions during the ED triage interview process. A focus group of emergency nurses was organized to identify the types of interruptions that commonly occur during the triage interview. These interruptions would be validated through observations in triage. A tally sheet was developed and implemented to determine how often each interruption occurred during an 8-hour shift. Triage nurses completed the tally sheets while working the first shift (7 am to 3 pm). This shift was selected because patient intake in the US Department of Veterans Affairs Emergency Department is highest during this time. The categories of interruptions identified included provision of conveniences to visitors, coworker-related interruptions, patient care-related interruptions, locating of family members in the emergency department, and other miscellaneous interruptions. Tally sheets were completed by the triage nurses during 10 shifts. On average, triage nurses were interrupted 48.2 times during an 8-hour shift (7 interruptions per hour). After reviewing the data, we found that only 22% of interruptions were related to patient care. More frequently, the causes of interruptions were not related to patient care: opening the door (33%), providing conveniences to visitors (21%), waiting patients or family members asking "How much longer?" (14%), and other causes (10%). Frequent interruptions can interfere with concentration and may affect patient care. Non-patient care-related interruptions not only can be frustrating to the triage nurse but also can be offensive to triage patients; they ultimately delay care and may even affect the quality of care. However, because scarce research is available regarding interruptions during ED triage, the effects on patient outcomes are unclear. Additional research needs to be conducted to explore the causes and effects of interruptions to the triage process. Copyright © 2014 Emergency Nurses Association. Published by Elsevier Inc. All rights reserved.

Exome sequencing-driven discovery of coding polymorphisms associated with common metabolic phenotypes.

PubMed

Albrechtsen, A; Grarup, N; Li, Y; Sparsø, T; Tian, G; Cao, H; Jiang, T; Kim, S Y; Korneliussen, T; Li, Q; Nie, C; Wu, R; Skotte, L; Morris, A P; Ladenvall, C; Cauchi, S; Stančáková, A; Andersen, G; Astrup, A; Banasik, K; Bennett, A J; Bolund, L; Charpentier, G; Chen, Y; Dekker, J M; Doney, A S F; Dorkhan, M; Forsen, T; Frayling, T M; Groves, C J; Gui, Y; Hallmans, G; Hattersley, A T; He, K; Hitman, G A; Holmkvist, J; Huang, S; Jiang, H; Jin, X; Justesen, J M; Kristiansen, K; Kuusisto, J; Lajer, M; Lantieri, O; Li, W; Liang, H; Liao, Q; Liu, X; Ma, T; Ma, X; Manijak, M P; Marre, M; Mokrosiński, J; Morris, A D; Mu, B; Nielsen, A A; Nijpels, G; Nilsson, P; Palmer, C N A; Rayner, N W; Renström, F; Ribel-Madsen, R; Robertson, N; Rolandsson, O; Rossing, P; Schwartz, T W; Slagboom, P E; Sterner, M; Tang, M; Tarnow, L; Tuomi, T; van't Riet, E; van Leeuwen, N; Varga, T V; Vestmar, M A; Walker, M; Wang, B; Wang, Y; Wu, H; Xi, F; Yengo, L; Yu, C; Zhang, X; Zhang, J; Zhang, Q; Zhang, W; Zheng, H; Zhou, Y; Altshuler, D; 't Hart, L M; Franks, P W; Balkau, B; Froguel, P; McCarthy, M I; Laakso, M; Groop, L; Christensen, C; Brandslund, I; Lauritzen, T; Witte, D R; Linneberg, A; Jørgensen, T; Hansen, T; Wang, J; Nielsen, R; Pedersen, O

2013-02-01

Human complex metabolic traits are in part regulated by genetic determinants. Here we applied exome sequencing to identify novel associations of coding polymorphisms at minor allele frequencies (MAFs) >1% with common metabolic phenotypes. The study comprised three stages. We performed medium-depth (8×) whole exome sequencing in 1,000 cases with type 2 diabetes, BMI >27.5 kg/m(2) and hypertension and in 1,000 controls (stage 1). We selected 16,192 polymorphisms nominally associated (p < 0.05) with case-control status, from four selected annotation categories or from loci reported to associate with metabolic traits. These variants were genotyped in 15,989 Danes to search for association with 12 metabolic phenotypes (stage 2). In stage 3, polymorphisms showing potential associations were genotyped in a further 63,896 Europeans. Exome sequencing identified 70,182 polymorphisms with MAF >1%. In stage 2 we identified 51 potential associations with one or more of eight metabolic phenotypes covered by 45 unique polymorphisms. In meta-analyses of stage 2 and stage 3 results, we demonstrated robust associations for coding polymorphisms in CD300LG (fasting HDL-cholesterol: MAF 3.5%, p = 8.5 × 10(-14)), COBLL1 (type 2 diabetes: MAF 12.5%, OR 0.88, p = 1.2 × 10(-11)) and MACF1 (type 2 diabetes: MAF 23.4%, OR 1.10, p = 8.2 × 10(-10)). We applied exome sequencing as a basis for finding genetic determinants of metabolic traits and show the existence of low-frequency and common coding polymorphisms with impact on common metabolic traits. Based on our study, coding polymorphisms with MAF above 1% do not seem to have particularly high effect sizes on the measured metabolic traits.

Program Synthesizes UML Sequence Diagrams

NASA Technical Reports Server (NTRS)

Barry, Matthew R.; Osborne, Richard N.

2006-01-01

A computer program called "Rational Sequence" generates Universal Modeling Language (UML) sequence diagrams of a target Java program running on a Java virtual machine (JVM). Rational Sequence thereby performs a reverse engineering function that aids in the design documentation of the target Java program. Whereas previously, the construction of sequence diagrams was a tedious manual process, Rational Sequence generates UML sequence diagrams automatically from the running Java code.

The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

PubMed

Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

2018-05-17

Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

Partial Shotgun Sequencing of the Boechera stricta Genome Reveals Extensive Microsynteny and Promoter Conservation with Arabidopsis1[W

PubMed Central

Windsor, Aaron J.; Schranz, M. Eric; Formanová, Nataša; Gebauer-Jung, Steffi; Bishop, John G.; Schnabelrauch, Domenica; Kroymann, Juergen; Mitchell-Olds, Thomas

2006-01-01

Comparative genomics provides insight into the evolutionary dynamics that shape discrete sequences as well as whole genomes. To advance comparative genomics within the Brassicaceae, we have end sequenced 23,136 medium-sized insert clones from Boechera stricta, a wild relative of Arabidopsis (Arabidopsis thaliana). A significant proportion of these sequences, 18,797, are nonredundant and display highly significant similarity (BLASTn e-value ≤ 10−30) to low copy number Arabidopsis genomic regions, including more than 9,000 annotated coding sequences. We have used this dataset to identify orthologous gene pairs in the two species and to perform a global comparison of DNA regions 5′ to annotated coding regions. On average, the 500 nucleotides upstream to coding sequences display 71.4% identity between the two species. In a similar analysis, 61.4% identity was observed between 5′ noncoding sequences of Brassica oleracea and Arabidopsis, indicating that regulatory regions are not as diverged among these lineages as previously anticipated. By mapping the B. stricta end sequences onto the Arabidopsis genome, we have identified nearly 2,000 conserved blocks of microsynteny (bracketing 26% of the Arabidopsis genome). A comparison of fully sequenced B. stricta inserts to their homologous Arabidopsis genomic regions indicates that indel polymorphisms >5 kb contribute substantially to the genome size difference observed between the two species. Further, we demonstrate that microsynteny inferred from end-sequence data can be applied to the rapid identification and cloning of genomic regions of interest from nonmodel species. These results suggest that among diploid relatives of Arabidopsis, small- to medium-scale shotgun sequencing approaches can provide rapid and cost-effective benefits to evolutionary and/or functional comparative genomic frameworks. PMID:16607030

Amino- and carboxyl-terminal amino acid sequences of proteins coded by gag gene of murine leukemia virus

PubMed Central

Oroszlan, Stephen; Henderson, Louis E.; Stephenson, John R.; Copeland, Terry D.; Long, Cedric W.; Ihle, James N.; Gilden, Raymond V.

1978-01-01

The amino- and carboxyl-terminal amino acid sequences of proteins (p10, p12, p15, and p30) coded by the gag gene of Rauscher and AKR murine leukemia viruses were determined. Among these proteins, p15 from both viruses appears to have a blocked amino end. Proline was found to be the common NH2 terminus of both p30s and both p12s, and alanine of both p10s. The amino-terminal sequences of p30s are identical, as are those of p10s, while the p12 sequences are clearly distinctive but also show substantial homology. The carboxyl-terminal amino acids of both viral p30s and p12s are leucine and phenylalanine, respectively. Rauscher leukemia virus p15 has tyrosine as the carboxyl terminus while AKR virus p15 has phenylalanine in this position. The compositional and sequence data provide definite chemical criteria for the identification of analogous gag gene products and for the comparison of viral proteins isolated in different laboratories. On the basis of amino acid sequences and the previously proposed H-p15-p12-p30-p10-COOH peptide sequence in the precursor polyprotein, a model for cleavage sites involved in the post-translational processing of the precursor coded for by the gag gene is proposed. PMID:206897

Marks of Change in Sequences

NASA Astrophysics Data System (ADS)

Jürgensen, H.

2011-12-01

Given a sequence of events, how does one recognize that a change has occurred? We explore potential definitions of the concept of change in a sequence and propose that words in relativized solid codes might serve as indicators of change.

Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

PubMed

Kanai, T H; Ueda, S; Nakamura, T

2000-01-31

Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

Analysis of CHRNA7 rare variants in autism spectrum disorder susceptibility.

PubMed

Bacchelli, Elena; Battaglia, Agatino; Cameli, Cinzia; Lomartire, Silvia; Tancredi, Raffaella; Thomson, Susanne; Sutcliffe, James S; Maestrini, Elena

2015-04-01

Chromosome 15q13.3 recurrent microdeletions are causally associated with a wide range of phenotypes, including autism spectrum disorder (ASD), seizures, intellectual disability, and other psychiatric conditions. Whether the reciprocal microduplication is pathogenic is less certain. CHRNA7, encoding for the alpha7 subunit of the neuronal nicotinic acetylcholine receptor, is considered the likely culprit gene in mediating neurological phenotypes in 15q13.3 deletion cases. To assess if CHRNA7 rare variants confer risk to ASD, we performed copy number variant analysis and Sanger sequencing of the CHRNA7 coding sequence in a sample of 135 ASD cases. Sequence variation in this gene remains largely unexplored, given the existence of a fusion gene, CHRFAM7A, which includes a nearly identical partial duplication of CHRNA7. Hence, attempts to sequence coding exons must distinguish between CHRNA7 and CHRFAM7A, making next-generation sequencing approaches unreliable for this purpose. A CHRNA7 microduplication was detected in a patient with autism and moderate cognitive impairment; while no rare damaging variants were identified in the coding region, we detected rare variants in the promoter region, previously described to functionally reduce transcription. This study represents the first sequence variant analysis of CHRNA7 in a sample of idiopathic autism. © 2015 Wiley Periodicals, Inc.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes).

PubMed

Dessimoz, Christophe; Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-09-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references.

Comparative genomics approach to detecting split-coding regions in a low-coverage genome: lessons from the chimaera Callorhinchus milii (Holocephali, Chondrichthyes)

PubMed Central

Zoller, Stefan; Manousaki, Tereza; Qiu, Huan; Meyer, Axel; Kuraku, Shigehiro

2011-01-01

Recent development of deep sequencing technologies has facilitated de novo genome sequencing projects, now conducted even by individual laboratories. However, this will yield more and more genome sequences that are not well assembled, and will hinder thorough annotation when no closely related reference genome is available. One of the challenging issues is the identification of protein-coding sequences split into multiple unassembled genomic segments, which can confound orthology assignment and various laboratory experiments requiring the identification of individual genes. In this study, using the genome of a cartilaginous fish, Callorhinchus milii, as test case, we performed gene prediction using a model specifically trained for this genome. We implemented an algorithm, designated ESPRIT, to identify possible linkages between multiple protein-coding portions derived from a single genomic locus split into multiple unassembled genomic segments. We developed a validation framework based on an artificially fragmented human genome, improvements between early and recent mouse genome assemblies, comparison with experimentally validated sequences from GenBank, and phylogenetic analyses. Our strategy provided insights into practical solutions for efficient annotation of only partially sequenced (low-coverage) genomes. To our knowledge, our study is the first formulation of a method to link unassembled genomic segments based on proteomes of relatively distantly related species as references. PMID:21712341

Application of 2D graphic representation of protein sequence based on Huffman tree method.

PubMed

Qi, Zhao-Hui; Feng, Jun; Qi, Xiao-Qin; Li, Ling

2012-05-01

Based on Huffman tree method, we propose a new 2D graphic representation of protein sequence. This representation can completely avoid loss of information in the transfer of data from a protein sequence to its graphic representation. The method consists of two parts. One is about the 0-1 codes of 20 amino acids by Huffman tree with amino acid frequency. The amino acid frequency is defined as the statistical number of an amino acid in the analyzed protein sequences. The other is about the 2D graphic representation of protein sequence based on the 0-1 codes. Then the applications of the method on ten ND5 genes and seven Escherichia coli strains are presented in detail. The results show that the proposed model may provide us with some new sights to understand the evolution patterns determined from protein sequences and complete genomes. Copyright © 2012 Elsevier Ltd. All rights reserved.

Digital data for Quick Response (QR) codes of thermophiles to identify and compare the bacterial species isolated from Unkeshwar hot springs (India)

PubMed Central

Rekadwad, Bhagwan N.; Khobragade, Chandrahasya N.

2015-01-01

16S rRNA sequences of morphologically and biochemically identified 21 thermophilic bacteria isolated from Unkeshwar hot springs (19°85′N and 78°25′E), Dist. Nanded (India) has been deposited in NCBI repository. The 16S rRNA gene sequences were used to generate QR codes for sequences (FASTA format and full Gene Bank information). Diversity among the isolates is compared with known isolates and evaluated using CGR, FCGR and PCA i.e. visual comparison and evaluation respectively. Considerable biodiversity was observed among the identified bacteria isolated from Unkeshwar hot springs. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. PMID:26793757

Prevalence and resistance mutations of non-B HIV-1 subtypes among immigrants in Southern Spain along the decade 2000-2010

PubMed Central

2011-01-01

Background Most of the non-B HIV-1 subtypes are predominant in Sub-Saharan Africa and India although they have been found worldwide. In the last decade, immigration from these areas has increased considerably in Spain. The objective of this study was to evaluate the prevalence of non-B subtypes circulating in a cohort of HIV-1-infected immigrants in Seville, Southern Spain and to identify drug resistance-associated mutations. Methods Complete protease and first 220 codons of the reverse transcriptase coding regions were amplified and sequenced by population sequencing. HIV-1 subtypes were determined using Stanford University Drug Resistance Database, and phylogenetic analysis was performed comparing multiple reported sequences. Drug resistance mutations were defined according to the International AIDS Society-USA. Results From 2000 to 2010 a total of 1,089 newly diagnosed HIV-1-infected patients were enrolled in our cohort. Of these, 121 were immigrants, of which 98 had ethical approval and informed consent to include in our study. Twenty-nine immigrants (29/98, 29.6%) were infected with non-B subtypes, of which 15/29 (51.7%) were CRF02-AG, mostly from Sub-Saharan Africa, and 2/29 (6.9%) were CRF01-AE from Eastern Europe. A, C, F, J and G subtypes from Eastern Europe, Central-South America and Sub-Saharan Africa were also present. Some others harboured recombinant forms CRF02-AG/CRF01-AE, CRF2-AG/G and F/B, B/C, and K/G, in PR and RT-coding regions. Patients infected with non-B subtypes showed a high frequency of minor protease inhibitor resistance mutations, M36I, L63P, and K20R/I. Only one patient, CRF02_AG, showed major resistance mutation L90M. Major RT inhibitor resistance mutations K70R and A98G were present in one patient with subtype G, L100I in one patient with CRF01_AE, and K103N in another patient with CRF01_AE. Three patients had other mutations such as V118I, E138A and V90I. Conclusions The circulation of non-B subtypes has significantly increased in Southern Spain during the last decade, with 29.6% prevalence, in association with demographic changes among immigrants. This could be an issue in the treatment and management of these patients. Resistance mutations have been detected in these patients with a prevalence of 7% among treatment-naïve patients compared with the 21% detected among patients under HAART or during treatment interruption. PMID:21871090

Evaluation and Impact of Workflow Interruptions During Robot-assisted Surgery.

PubMed

Allers, Jenna C; Hussein, Ahmed A; Ahmad, Nabeeha; Cavuoto, Lora; Wing, Joseph F; Hayes, Robin M; Hinata, Nobuyuki; Bisantz, Ann M; Guru, Khurshid A

2016-06-01

To analyze and categorize causes for interruptions during robot-assisted surgery. We analyzed 10 robot-assisted prostatectomies that were performed by 3 surgeons from October 2014 to June 2015. Interruptions to surgery were defined in terms of duration, stage of surgery, personnel involved, reasons, and impact of the interruption on the surgical workflow. The main reasons for interruptions included the following: console surgeons switching (29%); preparation of the surgical equipment, such as cleaning or changing the camera (29%) or an instrument (27%); or when a suture, stapler, or clip was needed (12%). The most common interruption duration was 10-29 seconds (47.6%), and the least common interruption duration was greater than 90 seconds (3.6%). Additionally, about 14% of the interruptions were considered avoidable, whereas the remaining 86% of interruptions were necessary for surgery. By identifying and analyzing interruptions, we can develop evidence-based strategies to improve operating room efficiency, lower costs, and advance patient safety. Copyright © 2016 Elsevier Inc. All rights reserved.

Eddy current-nulled convex optimized diffusion encoding (EN-CODE) for distortion-free diffusion tensor imaging with short echo times.

PubMed

Aliotta, Eric; Moulin, Kévin; Ennis, Daniel B

2018-02-01

To design and evaluate eddy current-nulled convex optimized diffusion encoding (EN-CODE) gradient waveforms for efficient diffusion tensor imaging (DTI) that is free of eddy current-induced image distortions. The EN-CODE framework was used to generate diffusion-encoding waveforms that are eddy current-compensated. The EN-CODE DTI waveform was compared with the existing eddy current-nulled twice refocused spin echo (TRSE) sequence as well as monopolar (MONO) and non-eddy current-compensated CODE in terms of echo time (TE) and image distortions. Comparisons were made in simulations, phantom experiments, and neuro imaging in 10 healthy volunteers. The EN-CODE sequence achieved eddy current compensation with a significantly shorter TE than TRSE (78 versus 96 ms) and a slightly shorter TE than MONO (78 versus 80 ms). Intravoxel signal variance was lower in phantoms with EN-CODE than with MONO (13.6 ± 11.6 versus 37.4 ± 25.8) and not different from TRSE (15.1 ± 11.6), indicating good robustness to eddy current-induced image distortions. Mean fractional anisotropy values in brain edges were also significantly lower with EN-CODE than with MONO (0.16 ± 0.01 versus 0.24 ± 0.02, P < 1 x 10 -5 ) and not different from TRSE (0.16 ± 0.01 versus 0.16 ± 0.01, P = nonsignificant). The EN-CODE sequence eliminated eddy current-induced image distortions in DTI with a TE comparable to MONO and substantially shorter than TRSE. Magn Reson Med 79:663-672, 2018. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.

Comparative analysis of complete chloroplast genome sequence and inversion variation in Lasthenia burkei (Madieae, Asteraceae).

PubMed

Walker, Joseph F; Zanis, Michael J; Emery, Nancy C

2014-04-01

Complete chloroplast genome studies can help resolve relationships among large, complex plant lineages such as Asteraceae. We present the first whole plastome from the Madieae tribe and compare its sequence variation to other chloroplast genomes in Asteraceae. We used high throughput sequencing to obtain the Lasthenia burkei chloroplast genome. We compared sequence structure and rates of molecular evolution in the small single copy (SSC), large single copy (LSC), and inverted repeat (IR) regions to those for eight Asteraceae accessions and one Solanaceae accession. The chloroplast sequence of L. burkei is 150 746 bp and contains 81 unique protein coding genes and 4 coding ribosomal RNA sequences. We identified three major inversions in the L. burkei chloroplast, all of which have been found in other Asteraceae lineages, and a previously unreported inversion in Lactuca sativa. Regions flanking inversions contained tRNA sequences, but did not have particularly high G + C content. Substitution rates varied among the SSC, LSC, and IR regions, and rates of evolution within each region varied among species. Some observed differences in rates of molecular evolution may be explained by the relative proportion of coding to noncoding sequence within regions. Rates of molecular evolution vary substantially within and among chloroplast genomes, and major inversion events may be promoted by the presence of tRNAs. Collectively, these results provide insight into different mechanisms that may promote intramolecular recombination and the inversion of large genomic regions in the plastome.

Sedimentary petrography of the Early Proterozoic Pretoria Group, Transvaal Sequence, South Africa: implications for tectonic setting

NASA Astrophysics Data System (ADS)

Schreiber, U. M.; Eriksson, P. G.; van der Neut, M.; Snyman, C. P.

1992-11-01

Sandstone petrography, geochemistry and petrotectonic assemblages of the predominantly clastic sedimentary rocks of the Early Proterozoic Pretoria Group, Transvaal Sequence, point to relatively stable cratonic conditions at the beginning of sedimentation, interrupted by minor rifting events. Basement uplift and a second period of rifting occurred towards the end of Pretoria Group deposition, which was followed by the intrusion of mafic sill swarms and the emplacement of the Bushveld Complex in the Kaapvaal Craton at about 2050 Ma, the latter indicating increased extensional tectonism, and incipient continental rifting. An overall intracratonic lacustrine tectonic setting for the Pretoria Group is supported by periods of subaerial volcanic activity and palaeosol formation, rapid sedimentary facies changes, significant arkosic sandstones, the presence of non-glacial varves and a highly variable mudrock geochemistry.

Assessment of teacher interruptions on learners during oral case presentations.

PubMed

Yang, Glen; Chin, Rachel

2007-06-01

Studies have only recently begun to investigate the effects of interruptions on physicians in the emergency department (ED). To determine the frequency and nature of interruptions by the training physician that occur when medical trainees do oral case presentations (OCPs) in the ED. This was an observational study. Learner OCPs to attending emergency physicians were observed in the ED of an urban Level 1 trauma center at a major teaching hospital. A single investigator followed attending physicians blinded to the study objective in a nonrandomized convenience sampling of all ED shifts, recording information regarding teacher interruptions during new patient presentations. Learners completed a brief questionnaire after each OCP. A total of 196 OCPs were observed. The mean (+/-SD) duration of OCPs was 3.30 (+/-1.85) minutes, and the mean (+/-SD) number of interruptions was 0.75 (+/-0.60) per minute and 2.49 (+/-1.95) per OCP. The number of interruptions (per OCP) and duration of OCP varied by learner level of training, with more experienced learners giving shorter presentations and being interrupted less often. Frequency (per minute) of interruptions did not vary by learner level. In 40.3% of OCPs, attending physicians interrupted to give an assessment and/or a plan before the learner had done so, but 8.3% of interrupted learners believed that teacher interruptions were "disruptive" to their OCP. Attending emergency physicians frequently interrupt learners during new patient OCPs, with the number of interruptions varying by learner level of training. Teacher interruptions appear to have minimal, if any, detrimental effect on the perceived effectiveness of OCPs as a learning experience.

Remembering Plurals: Unit of Coding and Form of Coding during Serial Recall.

ERIC Educational Resources Information Center

Van Der Molen, Hugo; Morton, John

1979-01-01

Adult females recalled lists of six words, including some plural nouns, presented visually in sequence. A frequent error was to detach the plural from its root. This supports a morpheme-based as opposed to a unitary word code. Evidence for a primarily phonological coding of the plural morpheme was obtained. (Author/RD)

The HayWired earthquake scenario—Engineering implications

USGS Publications Warehouse

Detweiler, Shane T.; Wein, Anne M.

2018-04-18

The HayWired Earthquake Scenario—Engineering Implications is the second volume of U.S. Geological Survey (USGS) Scientific Investigations Report 2017–5013, which describes the HayWired scenario, developed by USGS and its partners. The scenario is a hypothetical yet scientifically realistic earthquake sequence that is being used to better understand hazards for the San Francisco Bay region during and after a magnitude-7 earthquake (mainshock) on the Hayward Fault and its aftershocks.Analyses in this volume suggest that (1) 800 deaths and 16,000 nonfatal injuries result from shaking alone, plus property and direct business interruption losses of more than $82 billion from shaking, liquefaction, and landslides; (2) the building code is designed to protect lives, but even if all buildings in the region complied with current building codes, 0.4 percent could collapse, 5 percent could be unsafe to occupy, and 19 percent could have restricted use; (3) people expect, prefer, and would be willing to pay for greater resilience of buildings; (4) more than 22,000 people could require extrication from stalled elevators, and more than 2,400 people could require rescue from collapsed buildings; (5) the average east-bay resident could lose water service for 6 weeks, some for as long as 6 months; (6) older steel-frame high-rise office buildings and new reinforced-concrete residential buildings in downtown San Francisco and Oakland could be unusable for as long as 10 months; (7) about 450 large fires could result in a loss of residential and commercial building floor area equivalent to more than 52,000 single-family homes and cause property (building and content) losses approaching $30 billion; and (8) combining earthquake early warning (ShakeAlert) with “drop, cover, and hold on” actions could prevent as many as 1,500 nonfatal injuries out of 18,000 total estimated nonfatal injuries from shaking and liquefaction hazards.

Coordination analysis of players' distribution in football using cross-correlation and vector coding techniques.

PubMed

Moura, Felipe Arruda; van Emmerik, Richard E A; Santana, Juliana Exel; Martins, Luiz Eduardo Barreto; Barros, Ricardo Machado Leite de; Cunha, Sergio Augusto

2016-12-01

The purpose of this study was to investigate the coordination between teams spread during football matches using cross-correlation and vector coding techniques. Using a video-based tracking system, we obtained the trajectories of 257 players during 10 matches. Team spread was calculated as functions of time. For a general coordination description, we calculated the cross-correlation between the signals. Vector coding was used to identify the coordination patterns between teams during offensive sequences that ended in shots on goal or defensive tackles. Cross-correlation showed that opponent teams have a tendency to present in-phase coordination, with a short time lag. During offensive sequences, vector coding results showed that, although in-phase coordination dominated, other patterns were observed. We verified that during the early stages, offensive sequences ending in shots on goal present greater anti-phase and attacking team phase periods, compared to sequences ending in tackles. Results suggest that the attacking team may seek to present a contrary behaviour of its opponent (or may lead the adversary behaviour) in the beginning of the attacking play, regarding to the distribution strategy, to increase the chances of a shot on goal. The techniques allowed detecting the coordination patterns between teams, providing additional information about football dynamics and players' interaction.

Images multiplexing by code division technique

NASA Astrophysics Data System (ADS)

Kuo, Chung J.; Rigas, Harriett

Spread Spectrum System (SSS) or Code Division Multiple Access System (CDMAS) has been studied for a long time, but most of the attention was focused on the transmission problems. In this paper, we study the results when the code division technique is applied to the image at the source stage. The idea is to convolve the N different images with the corresponding m-sequence to obtain the encrypted image. The superimposed image (summation of the encrypted images) is then stored or transmitted. The benefit of this is that no one knows what is stored or transmitted unless the m-sequence is known. The recovery of the original image is recovered by correlating the superimposed image with corresponding m-sequence. Two cases are studied in this paper. First, the two-dimensional image is treated as a long one-dimensional vector and the m-sequence is employed to obtain the results. Secondly, the two-dimensional quasi m-array is proposed and used for the code division multiplexing. It is shown that quasi m-array is faster when the image size is 256 x 256. The important features of the proposed technique are not only the image security but also the data compactness. The compression ratio depends on how many images are superimposed.

Images Multiplexing By Code Division Technique

NASA Astrophysics Data System (ADS)

Kuo, Chung Jung; Rigas, Harriett B.

1990-01-01

Spread Spectrum System (SSS) or Code Division Multiple Access System (CDMAS) has been studied for a long time, but most of the attention was focused on the transmission problems. In this paper, we study the results when the code division technique is applied to the image at the source stage. The idea is to convolve the N different images with the corresponding m-sequence to obtain the encrypted image. The superimposed image (summation of the encrypted images) is then stored or transmitted. The benefit of this is that no one knows what is stored or transmitted unless the m-sequence is known. The recovery of the original image is recovered by correlating the superimposed image with corresponding m-sequence. Two cases are studied in this paper. First, the 2-D image is treated as a long 1-D vector and the m-sequence is employed to obtained the results. Secondly, the 2-D quasi m-array is proposed and used for the code division multiplexing. It is showed that quasi m-array is faster when the image size is 256x256. The important features of the proposed technique are not only the image security but also the data compactness. The compression ratio depends on how many images are superimposed.

Complete chloroplast genome sequence of MD-2 pineapple and its comparative analysis among nine other plants from the subclass Commelinidae.

PubMed

Redwan, R M; Saidin, A; Kumar, S V

2015-08-12

Pineapple (Ananas comosus var. comosus) is known as the king of fruits for its crown and is the third most important tropical fruit after banana and citrus. The plant, which is indigenous to South America, is the most important species in the Bromeliaceae family and is largely traded for fresh fruit consumption. Here, we report the complete chloroplast sequence of the MD-2 pineapple that was sequenced using the PacBio sequencing technology. In this study, the high error rate of PacBio long sequence reads of A. comosus's total genomic DNA were improved by leveraging on the high accuracy but short Illumina reads for error-correction via the latest error correction module from Novocraft. Error corrected long PacBio reads were assembled by using a single tool to produce a contig representing the pineapple chloroplast genome. The genome of 159,636 bp in length is featured with the conserved quadripartite structure of chloroplast containing a large single copy region (LSC) with a size of 87,482 bp, a small single copy region (SSC) with a size of 18,622 bp and two inverted repeat regions (IRA and IRB) each with the size of 26,766 bp. Overall, the genome contained 117 unique coding regions and 30 were repeated in the IR region with its genes contents, structure and arrangement similar to its sister taxon, Typha latifolia. A total of 35 repeats structure were detected in both the coding and non-coding regions with a majority being tandem repeats. In addition, 205 SSRs were detected in the genome with six protein-coding genes contained more than two SSRs. Comparative chloroplast genomes from the subclass Commelinidae revealed a conservative protein coding gene albeit located in a highly divergence region. Analysis of selection pressure on protein-coding genes using Ka/Ks ratio showed significant positive selection exerted on the rps7 gene of the pineapple chloroplast with P less than 0.05. Phylogenetic analysis confirmed the recent taxonomical relation among the member of commelinids which support the monophyly relationship between Arecales and Dasypogonaceae and between Zingiberales to the Poales, which includes the A. comosus. The complete sequence of the chloroplast of pineapple provides insights to the divergence of genic chloroplast sequences from the members of the subclass Commelinidae. The complete pineapple chloroplast will serve as a reference for in-depth taxonomical studies in the Bromeliaceae family when more species under the family are sequenced in the future. The genetic sequence information will also make feasible other molecular applications of the pineapple chloroplast for plant genetic improvement.

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Cross-species inference of long non-coding RNAs greatly expands the ruminant transcriptome.

PubMed

Bush, Stephen J; Muriuki, Charity; McCulloch, Mary E B; Farquhar, Iseabail L; Clark, Emily L; Hume, David A

2018-04-24

mRNA-like long non-coding RNAs (lncRNAs) are a significant component of mammalian transcriptomes, although most are expressed only at low levels, with high tissue-specificity and/or at specific developmental stages. Thus, in many cases lncRNA detection by RNA-sequencing (RNA-seq) is compromised by stochastic sampling. To account for this and create a catalogue of ruminant lncRNAs, we compared de novo assembled lncRNAs derived from large RNA-seq datasets in transcriptional atlas projects for sheep and goats with previous lncRNAs assembled in cattle and human. We then combined the novel lncRNAs with the sheep transcriptional atlas to identify co-regulated sets of protein-coding and non-coding loci. Few lncRNAs could be reproducibly assembled from a single dataset, even with deep sequencing of the same tissues from multiple animals. Furthermore, there was little sequence overlap between lncRNAs that were assembled from pooled RNA-seq data. We combined positional conservation (synteny) with cross-species mapping of candidate lncRNAs to identify a consensus set of ruminant lncRNAs and then used the RNA-seq data to demonstrate detectable and reproducible expression in each species. In sheep, 20 to 30% of lncRNAs were located close to protein-coding genes with which they are strongly co-expressed, which is consistent with the evolutionary origin of some ncRNAs in enhancer sequences. Nevertheless, most of the lncRNAs are not co-expressed with neighbouring protein-coding genes. Alongside substantially expanding the ruminant lncRNA repertoire, the outcomes of our analysis demonstrate that stochastic sampling can be partly overcome by combining RNA-seq datasets from related species. This has practical implications for the future discovery of lncRNAs in other species.

Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling

PubMed Central

Lareo, Angel; Forlim, Caroline G.; Pinto, Reynaldo D.; Varona, Pablo; Rodriguez, Francisco de Borja

2016-01-01

Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox. PMID:27766078

Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling.

PubMed

Lareo, Angel; Forlim, Caroline G; Pinto, Reynaldo D; Varona, Pablo; Rodriguez, Francisco de Borja

2016-01-01

Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox.

Glutamate cysteine ligase (GCL) in the freshwater bivalve Unio tumidus: impact of storage conditions and seasons on activity and identification of partial coding sequence of the catalytic subunit.

PubMed

Coffinet, Stéphanie; Cossu-Leguille, Carole; Rodius, François; Vasseur, Paule

2008-09-01

Glutamate cysteine ligase (GCL; EC 6.3.2.2) is the first enzyme involved in the synthesis of glutathione. A HPLC method with fluorimetric detection was used to measure GCL activity in the gills and the digestive gland of the freshwater bivalve, Unio tumidus. Storage conditions were optimized in order to prevent decrease of GCL activity and consisted in freezing the cytosolic fraction in the presence of protease (1 mM phenylmethylsulfonic fluoric acid) and gamma-glutamyltranspeptidase (1 mM L-serine borate mixture and 0.5 mM acivicin) inhibitors. Seasonal variations of activity in the digestive gland and to a lesser extent in the gills were found with activity increasing in spring compared to winter. No sex differences were revealed. The GCL coding sequence was identified using degenerated primers designed in the highly conserved regions of the catalytic subunit of GCL. The partial sequence identified encoded for 121 amino acids. The comparison of the identified partial coding sequence of U. tumidus with those available from vertebrates and invertebrates indicated that GCL sequence was highly conserved.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Reading the Second Code: Mapping Epigenomes to Understand Plant Growth, Development, and Adaptation to the Environment[OA

PubMed Central

2012-01-01

We have entered a new era in agricultural and biomedical science made possible by remarkable advances in DNA sequencing technologies. The complete sequence of an individual’s set of chromosomes (collectively, its genome) provides a primary genetic code for what makes that individual unique, just as the contents of every personal computer reflect the unique attributes of its owner. But a second code, composed of “epigenetic” layers of information, affects the accessibility of the stored information and the execution of specific tasks. Nature’s second code is enigmatic and must be deciphered if we are to fully understand and optimize the genetic potential of crop plants. The goal of the Epigenomics of Plants International Consortium is to crack this second code, and ultimately master its control, to help catalyze a new green revolution. PMID:22751210

Iterative Code-Aided ML Phase Estimation and Phase Ambiguity Resolution

NASA Astrophysics Data System (ADS)

Wymeersch, Henk; Moeneclaey, Marc

2005-12-01

As many coded systems operate at very low signal-to-noise ratios, synchronization becomes a very difficult task. In many cases, conventional algorithms will either require long training sequences or result in large BER degradations. By exploiting code properties, these problems can be avoided. In this contribution, we present several iterative maximum-likelihood (ML) algorithms for joint carrier phase estimation and ambiguity resolution. These algorithms operate on coded signals by accepting soft information from the MAP decoder. Issues of convergence and initialization are addressed in detail. Simulation results are presented for turbo codes, and are compared to performance results of conventional algorithms. Performance comparisons are carried out in terms of BER performance and mean square estimation error (MSEE). We show that the proposed algorithm reduces the MSEE and, more importantly, the BER degradation. Additionally, phase ambiguity resolution can be performed without resorting to a pilot sequence, thus improving the spectral efficiency.

Testing Of Choiced Ceramics Cutting Tools At Irregular Interrupted Cut

NASA Astrophysics Data System (ADS)

Kyncl, Ladislav; Malotová, Šárka; Nováček, Pavel; Nicielnik, Henryk; Šoková, Dagmar; Hemžský, Pavel; Pitela, David; Holubjak, Jozef

2015-12-01

This article discusses the test of removable ceramic cutting inserts during machining irregular interrupted cut. Tests were performed on a lathe, with the preparation which simulated us the interrupted cut. By changing the number of plates mounted in a preparation it simulate us a regular or irregular interrupted cut. When with four plates it was regular interrupted cut, the remaining three variants were already irregular cut. It was examined whether it will have the irregular interrupted cutting effect on the insert and possibly how it will change life of inserts during irregular interrupted cut (variable delay between shocks).

Improvement of Thermal Interruption Capability in Self-blast Interrupting Chamber for New 245kV-50kA GCB

NASA Astrophysics Data System (ADS)

Shinkai, Takeshi; Koshiduka, Tadashi; Mori, Tadashi; Uchii, Toshiyuki; Tanaka, Tsutomu; Ikeda, Hisatoshi

Current zero measurements are performed for 245kV-50kA-60Hz short line fault (L90) interruption tests with a self-blast interrupting chamber (double volume system) which has the interrupting capability up to 245kV-50kA-50Hz L90. Lower L90 interruption capability is observed for longer arcing time although very high pressure rise is obtained. It may be caused by higher blowing temperature and lower blowing density for longer arcing time. Interruption criteria and a optimization method of the chamber design are discussed to improve L90 interruption capability with it. The new chambers are designed at 245kV-50kA-60Hz to improve gas density in thermal volume for long arcing time. 245kV-50kA-60Hz L90 interruptions are performed with the new chamber. The suggested optimization method is an efficient tool for the self-blast interrupting chamber design although study of computing methods is required to calculate arc conductance around current zero as a direct criterion for L90 interruption capability with higher accuracy.

Identification of coding and non-coding mutational hotspots in cancer genomes.

PubMed

Piraino, Scott W; Furney, Simon J

2017-01-05

The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from likely passenger regions susceptible to somatic mutation.

Investigation of the mechanism of meiotic DNA cleavage by VMA1-derived endonuclease uncovers a meiotic alteration in chromatin structure around the target site.

PubMed

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-06-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.

Investigation of the Mechanism of Meiotic DNA Cleavage by VMA1-Derived Endonuclease Uncovers a Meiotic Alteration in Chromatin Structure around the Target Site

PubMed Central

Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

2006-01-01

VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746

Both coding exons of the c-myc gene contribute to its posttranscriptional regulation in the quiescent liver and regenerating liver and after protein synthesis inhibition.

PubMed Central

Lavenu, A; Pistoi, S; Pournin, S; Babinet, C; Morello, D

1995-01-01

In vivo, the steady-state level of c-myc mRNA is mainly controlled by posttranscriptional mechanisms. Using a panel of transgenic mice in which various versions of the human c-myc proto-oncogene were under the control of major histocompatibility complex H-2Kb class I regulatory sequences, we have shown that the 5' and the 3' noncoding sequences are dispensable for obtaining a regulated expression of the transgene in adult quiescent tissues, at the start of liver regeneration, and after inhibition of protein synthesis. These results indicated that the coding sequences were sufficient to ensure a regulated c-myc expression. In the present study, we have pursued this analysis with transgenes containing one or the other of the two c-myc coding exons either alone or in association with the c-myc 3' untranslated region. We demonstrate that each of the exons contains determinants which control c-myc mRNA expression. Moreover, we show that in the liver, c-myc exon 2 sequences are able to down-regulate an otherwise stable H-2K mRNA when embedded within it and to induce its transient accumulation after cycloheximide treatment and soon after liver ablation. Finally, the use of transgenes with different coding capacities has allowed us to postulate that the primary mRNA sequence itself and not c-Myc peptides is an important component of c-myc posttranscriptional regulation. PMID:7623834

Description of real-time Ada software implementation of a power system monitor for the Space Station Freedom PMAD DC testbed

NASA Technical Reports Server (NTRS)

Ludwig, Kimberly; Mackin, Michael; Wright, Theodore

1991-01-01

The authors describe the Ada language software developed to perform the electrical power system monitoring functions for the NASA Lewis Research Center's Power Management and Distribution (PMAD) DC testbed. The results of the effort to implement this monitor are presented. The PMAD DC testbed is a reduced-scale prototype of the electric power system to be used in Space Station Freedom. The power is controlled by smart switches known as power control components (or switchgear). The power control components are currently coordinated by five Compaq 386/20e computers connected through an 802.4 local area network. The power system monitor algorithm comprises several functions, including periodic data acquisition, data smoothing, system performance analysis, and status reporting. Data are collected from the switchgear sensors every 100 ms, then passed through a 2-Hz digital filter. System performance analysis includes power interruption and overcurrent detection. The system monitor required a hardware timer interrupt to activate the data acquisition function. The execution time of the code was optimized by using an assembly language routine. The routine allows direct vectoring of the processor to Ada language procedures that perform periodic control activities.

Why barcode? High-throughput multiplex sequencing of mitochondrial genomes for molecular systematics.

PubMed

Timmermans, M J T N; Dodsworth, S; Culverwell, C L; Bocak, L; Ahrens, D; Littlewood, D T J; Pons, J; Vogler, A P

2010-11-01

Mitochondrial genome sequences are important markers for phylogenetics but taxon sampling remains sporadic because of the great effort and cost required to acquire full-length sequences. Here, we demonstrate a simple, cost-effective way to sequence the full complement of protein coding mitochondrial genes from pooled samples using the 454/Roche platform. Multiplexing was achieved without the need for expensive indexing tags ('barcodes'). The method was trialled with a set of long-range polymerase chain reaction (PCR) fragments from 30 species of Coleoptera (beetles) sequenced in a 1/16th sector of a sequencing plate. Long contigs were produced from the pooled sequences with sequencing depths ranging from ∼10 to 100× per contig. Species identity of individual contigs was established via three 'bait' sequences matching disparate parts of the mitochondrial genome obtained by conventional PCR and Sanger sequencing. This proved that assembly of contigs from the sequencing pool was correct. Our study produced sequences for 21 nearly complete and seven partial sets of protein coding mitochondrial genes. Combined with existing sequences for 25 taxa, an improved estimate of basal relationships in Coleoptera was obtained. The procedure could be employed routinely for mitochondrial genome sequencing at the species level, to provide improved species 'barcodes' that currently use the cox1 gene only.

The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).

PubMed

Liang, Jian-Ying; Lin, Rui-Qing

2016-11-01

In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.

Linear and Nonlinear Statistical Characterization of DNA

NASA Astrophysics Data System (ADS)

Norio Oiwa, Nestor; Goldman, Carla; Glazier, James

2002-03-01

We find spatial order in the distribution of protein-coding (including RNAs) and control segments of GenBank genomic sequences, irrespective of ATCG content. This is achieved by correlations, histograms, fractal dimensions and singularity spectra. Estimates of these quantities in complete nuclear genome indicate that coding sequences are long-range correlated and their disposition are self-similar (multifractal) for eukaryotes. These characteristics are absent in prokaryotes, where there are few noncoding sequences, suggesting the `junk' DNA play a relevant role to the genome structure and function. Concerning the genetic message of ATCG sequences, we build a random walk (Levy flight), using DNA symmetry arguments, where we associate A, T, C and G as left, right, down and up steps, respectively. Nonlinear analysis of mitochondrial DNA walks reveal multifractal pattern based on palindromic sequences, which fold in hairpins and loops.

Driven to distraction: The nature and apparent purpose of interruptions in critical care and implications for HIT.

PubMed

Mamykina, Lena; Carter, Eileen J; Sheehan, Barbara; Stanley Hum, R; Twohig, Bridget C; Kaufman, David R

2017-05-01

To examine the apparent purpose of interruptions in a Pediatric Intensive Care Unit and opportunities to reduce their burden with informatics solutions. In this prospective observational study, researchers shadowed clinicians in the unit for one hour at a time, recording all interruptions participating clinicians experienced or initiated, their starting time, duration, and a short description that could help to infer their apparent purpose. All captured interruptions were classified inductively on their source and apparent purpose and on the optimal representational media for fulfilling their apparent purpose. The researchers observed thirty-four one-hour sessions with clinicians in the unit, including 21 nurses and 13 residents and house physicians. The physicians were interrupted on average 11.9 times per hour and interrupted others 8.8 times per hour. Nurses were interrupted 8.6 times per hour and interrupted others 5.1 times per hour. The apparent purpose of interruptions included Information Seeking and Sharing (n=259, 46.3%), Directives and Requests (n=70, 12%), Shared Decision-Making (n=49, 8.8%), Direct Patient Care (n=36, 6.4%), Social (n=71, 12.7%), Device Alarms (n=28, 5%), and Non-Clinical (n=10, 1.8%); 6.6% were not classified due to insufficient description. Of all captured interruptions, 29.5% were classified as being better served with informational displays or computer-mediated communication. Deeper understanding of the purpose of interruptions in critical care can help to distinguish between interruptions that require face-to-face conversation and those that can be eliminated with informatics solutions. The proposed taxonomy of interruptions and representational analysis can be used to further advance the science of interruptions in clinical care. Copyright © 2017 Elsevier Inc. All rights reserved.

Coping with interruptions in clinical nursing-A qualitative study.

PubMed

Laustsen, Sussie; Brahe, Liselotte

2018-04-01

To gain knowledge on how nurses' cope with interruptions in clinical practice. Interruptions may delay work routines and result in wasted time, disorganised planning and ineffective working procedures, affecting nurses' focus and overview in different ways. Research has identified a growing problem linking errors or adverse events with interruptions. It may affect patient safety if nurses are not paying attention to interruptions. Little is known about how nurses cope with interruptions DESIGN: The study was inspired by ethnographic fieldwork with a hermeneutical phenomenological approach. Observations were performed combined with semi-structured qualitative interviews. Managing interruptions depend on level of competence, working environment, dialogue and matching of expectations, collegial roles and implicit rules. Working procedures impact on how nurses are exposed to unnecessary interruptions. The latter affects overview and the ability to put the foot down and decline being interrupted. Professional competencies for example prioritising, keeping focus and collaborating across disciplines are needed to cope with interruptions. Culture work and matching of expectations are important to reflect on and discuss personal- and group behaviour caused by interruptions. We need to focus on the role of each nurse in the professional team, types of personality and unspoken rules. Professional competencies for example prioritising, keeping focus and cooperating across disciplines are needed to cope with interruptions. Coping with interruptions is important for the nursing profession, quality of care and patient safety. Changing practice requires multidisciplinary cooperation accepting different agendas at personal, group and organisational levels. Nurses must understand the meaning and nature of different types of interruptions to develop coping strategies and maintain quality in care and patient safety in multidisciplinary teamwork. © 2018 John Wiley & Sons Ltd.

Sequences of 95 human MHC haplotypes reveal extreme coding variation in genes other than highly polymorphic HLA class I and II

PubMed Central

Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter

2017-01-01

The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230

Preparation of next-generation sequencing libraries using Nextera™ technology: simultaneous DNA fragmentation and adaptor tagging by in vitro transposition.

PubMed

Caruccio, Nicholas

2011-01-01

DNA library preparation is a common entry point and bottleneck for next-generation sequencing. Current methods generally consist of distinct steps that often involve significant sample loss and hands-on time: DNA fragmentation, end-polishing, and adaptor-ligation. In vitro transposition with Nextera™ Transposomes simultaneously fragments and covalently tags the target DNA, thereby combining these three distinct steps into a single reaction. Platform-specific sequencing adaptors can be added, and the sample can be enriched and bar-coded using limited-cycle PCR to prepare di-tagged DNA fragment libraries. Nextera technology offers a streamlined, efficient, and high-throughput method for generating bar-coded libraries compatible with multiple next-generation sequencing platforms.

1-deoxy-d-xylulose-5-phosphate reductoisomerases and method of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2001-01-01

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

1-deoxy-D-xylulose-5-phosphate reductoisomerases, and methods of use

DOEpatents

Croteau, Rodney B.; Lange, Bernd M.

2002-07-16

The present invention relates to isolated DNA sequences which code for the expression of plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein, such as the sequence presented in SEQ ID NO:1 which encodes a 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein from peppermint (Mentha x piperita). Additionally, the present invention relates to isolated plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase protein. In other aspects, the present invention is directed to replicable recombinant cloning vehicles comprising a nucleic acid sequence which codes for a plant 1-deoxy-D-xylulose-5-phosphate reductoisomerase, to modified host cells transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence of the invention.

Gene discovery in Eimeria tenella by immunoscreening cDNA expression libraries of sporozoites and schizonts with chicken intestinal antibodies.

PubMed

Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie

2003-04-02

Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.

Next generation sequencing yields the complete mitochondrial genome of the Endangered Chilean silverside Basilichthys microlepidotus (Jenyns, 1841) (Teleostei, Atherinopsidae), validated with RNA-seq.

PubMed

Véliz, David; Vega-Retter, Caren; Quezada-Romegialli, Claudio

2016-01-01

The complete sequence of the mitochondrial genome for the Chilean silverside Basilichthys microlepidotus is reported for the first time. The entire mitochondrial genome was 16,544 bp in length (GenBank accession no. KM245937); gene composition and arrangement was conformed to that reported for most fishes and contained the typical structure of 2 rRNAs, 13 protein-coding genes, 22 tRNAs and a non-coding region. The assembled mitogenome was validated against sequences of COI and Control Region previously sequenced in our lab, functional genes from RNA-Seq data for the same species and the mitogenome of two other atherinopsid species available in Genbank.

Numerical classification of coding sequences

NASA Technical Reports Server (NTRS)

Collins, D. W.; Liu, C. C.; Jukes, T. H.

1992-01-01

DNA sequences coding for protein may be represented by counts of nucleotides or codons. A complete reading frame may be abbreviated by its base count, e.g. A76C158G121T74, or with the corresponding codon table, e.g. (AAA)0(AAC)1(AAG)9 ... (TTT)0. We propose that these numerical designations be used to augment current methods of sequence annotation. Because base counts and codon tables do not require revision as knowledge of function evolves, they are well-suited to act as cross-references, for example to identify redundant GenBank entries. These descriptors may be compared, in place of DNA sequences, to extract homologous genes from large databases. This approach permits rapid searching with good selectivity.

First draft genome sequencing of indole acetic acid producing and plant growth promoting fungus Preussia sp. BSL10.

PubMed

Khan, Abdul Latif; Asaf, Sajjad; Khan, Abdur Rahim; Al-Harrasi, Ahmed; Al-Rawahi, Ahmed; Lee, In-Jung

2016-05-10

Preussia sp. BSL10, family Sporormiaceae, was actively producing phytohormone (indole-3-acetic acid) and extra-cellular enzymes (phosphatases and glucosidases). The fungus was also promoting the growth of arid-land tree-Boswellia sacra. Looking at such prospects of this fungus, we sequenced its draft genome for the first time. The Illumina based sequence analysis reveals an approximate genome size of 31.4Mbp for Preussia sp. BSL10. Based on ab initio gene prediction, total 32,312 coding sequences were annotated consisting of 11,967 coding genes, pseudogenes, and 221 tRNA genes. Furthermore, 321 carbohydrate-active enzymes were predicted and classified into many functional families. Copyright © 2016 Elsevier B.V. All rights reserved.

The Effect of Interruption Duration and Demand on Resuming Suspended Goals

ERIC Educational Resources Information Center

Monk, Christopher A.; Trafton, J. Gregory; Boehm-Davis, Deborah A.

2008-01-01

The time to resume task goals after an interruption varied depending on the duration and cognitive demand of interruptions, as predicted by the memory for goals model (Altmann & Trafton, 2002). Three experiments using an interleaved tasks interruption paradigm showed that longer and more demanding interruptions led to longer resumption times in a…

Prevalence of transcription promoters within archaeal operons and coding sequences

PubMed Central

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208

Prevalence of transcription promoters within archaeal operons and coding sequences.

PubMed

Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

2009-01-01

Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

MIMO Radar System for Respiratory Monitoring Using Tx and Rx Modulation with M-Sequence Codes

NASA Astrophysics Data System (ADS)

Miwa, Takashi; Ogiwara, Shun; Yamakoshi, Yoshiki

The importance of respiratory monitoring systems during sleep have increased due to early diagnosis of sleep apnea syndrome (SAS) in the home. This paper presents a simple respiratory monitoring system suitable for home use having 3D ranging of targets. The range resolution and azimuth resolution are obtained by a stepped frequency transmitting signal and MIMO arrays with preferred pair M-sequence codes doubly modulating in transmission and reception, respectively. Due to the use of these codes, Gold sequence codes corresponding to all the antenna combinations are equivalently modulated in receiver. The signal to interchannel interference ratio of the reconstructed image is evaluated by numerical simulations. The results of experiments on a developed prototype 3D-MIMO radar system show that this system can extract only the motion of respiration of a human subject 2m apart from a metallic rotatable reflector. Moreover, it is found that this system can successfully measure the respiration information of sleeping human subjects for 96.6 percent of the whole measurement time except for instances of large posture change.

Recursive Directional Ligation Approach for Cloning Recombinant Spider Silks.

PubMed

Dinjaski, Nina; Huang, Wenwen; Kaplan, David L

2018-01-01

Recent advances in genetic engineering have provided a route to produce various types of recombinant spider silks. Different cloning strategies have been applied to achieve this goal (e.g., concatemerization, step-by-step ligation, recursive directional ligation). Here we describe recursive directional ligation as an approach that allows for facile modularity and control over the size of the genetic cassettes. This approach is based on sequential ligation of genetic cassettes (monomers) where the junctions between them are formed without interrupting key gene sequences with additional base pairs.

Assessing the sustainability of daily chlorhexidine bathing in the intensive care unit of a Veteran's Hospital by examining nurses' perspectives and experiences.

PubMed

Musuuza, Jackson S; Roberts, Tonya J; Carayon, Pascale; Safdar, Nasia

2017-01-14

Daily bathing with chlorhexidine gluconate (CHG) of intensive care unit (ICU) patients has been shown to reduce healthcare-associated infections and colonization by multidrug resistant organisms. The objective of this project was to describe the process of daily CHG bathing and identify the barriers and facilitators that can influence its successful adoption and sustainability in an ICU of a Veterans Administration Hospital. We conducted 26 semi-structured interviews with a convenience sample of 4 nurse managers (NMs), 13 registered nurses (RNs) and 9 health care technicians (HCTs) working in the ICU. We used qualitative content analysis to code and analyze the data. Dedoose software was used to facilitate data management and coding. Trustworthiness and scientific integrity of the data were ensured by having two authors corroborate the coding process, conducting member checks and keeping an audit trail of all the decisions made. Duration of the interviews was 15 to 39 min (average = 26 min). Five steps of bathing were identified: 1) decision to give a bath; 2) ability to give a bath; 3) decision about which soap to use; 4) delegation of a bath; and 5) getting assistance to do a bath. The bathing process resulted in one of the following three outcomes: 1) complete bath; 2) interrupted bath; and 3) bath not done. The outcome was influenced by a combination of barriers and facilitators at each step. Most barriers were related to perceived workload, patient factors, and scheduling. Facilitators were mainly organizational factors such as the policy of daily CHG bathing, the consistent supply of CHG soap, and support such as reminders to conduct CHG baths by nurse managers. Patient bathing in ICUs is a complex process that can be hindered and interrupted by numerous factors. The decision to use CHG soap for bathing was only one of 5 steps of bathing and was largely influenced by scheduling/workload and patient factors such as clinical stability, hypersensitivity to CHG, patient refusal, presence of IV lines and general hygiene. Interventions that address the organizational, provider, and patient barriers to bathing could improve adherence to a daily CHG bathing protocol.

Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

PubMed Central

Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

1988-01-01

In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

Opioid interruptions, pain, and withdrawal symptoms in nursing home residents.

PubMed

Redding, Sarah E; Liu, Sophia; Hung, William W; Boockvar, Kenneth S

2014-11-01

Interruptions in opioid use have the potential to cause pain relapse and withdrawal symptoms. The objectives of this study were to observe patterns of opioid interruption during acute illness in nursing home residents and examine associations between interruptions and pain and withdrawal symptoms. Patients from 3 nursing homes in a metropolitan area who were prescribed opioids were assessed for symptoms of pain and withdrawal by researchers blinded to opioid dosage received, using the Brief Pain Inventory Scale and the Clinical Opioid Withdrawal Scale, respectively, during prespecified time periods. The prespecified time periods were 2 weeks after onset of acute illness (eg, urinary tract infection), and 2 weeks after hospital admission and nursing home readmission, if they occurred. Opioid dosing was recorded and a significant interruption was defined as a complete discontinuation or a reduction in dose of >50% for ≥1 day. The covariates age, sex, race, comorbid conditions, initial opioid dose, and initial pain level were recorded. Symptoms pre- and post-opioid interruptions were compared and contrasted with those in a group without opioid interruptions. Sixty-six patients receiving opioids were followed for a mean of 10.9 months and experienced a total of 104 acute illnesses. During 64 (62%) illnesses, patients experienced any reduction in opioid dosing, with a mean (SD) dose reduction of 63.9% (29.9%). During 39 (38%) illnesses, patients experienced a significant opioid interruption. In a multivariable model, residence at 1 of the 3 nursing homes was associated with a lower risk of interruption (odds ratio = 0.073; 95% CI, 0.009 to 0.597; P < 0.015). In patients with interruptions, there were statistically insignificant changes in mean (SD) pain score (difference -0.50 [2.66]; 95% CI, -3.16 to 2.16) and withdrawal score (difference -0.91 [3.12]; 95% CI, -4.03 to 2.21) after the interruption as compared with before interruption. However, when compared with patients without interruptions, patients with interruptions experienced larger increases in pain scores during the follow-up periods (difference 0.09 points per day; 95% CI, -0.01 to 0.019; P = 0.08). In particular, patients who received the highest quartile of opioid dose before interruption experienced increases in pain scores over time that were 0.22 points per day larger (95% CI, 0.02 to 0.41; P = 0.03) than those without interruption. Withdrawal scores were not associated with opioid interruption regardless of dose before interruption. Nursing home patients often experience interruptions in opioid dosing, which can be associated with worse pain, but not withdrawal symptoms, during acute illnesses. Clinicians should be aware of the potential risks and effects of opioid interruptions during acute illnesses in this patient group. Published by Elsevier Inc.

Supporting interruption management and multimodal interface design: three meta-analyses of task performance as a function of interrupting task modality.

PubMed

Lu, Sara A; Wickens, Christopher D; Prinet, Julie C; Hutchins, Shaun D; Sarter, Nadine; Sebok, Angelia

2013-08-01

The aim of this study was to integrate empirical data showing the effects of interrupting task modality on the performance of an ongoing visual-manual task and the interrupting task itself. The goal is to support interruption management and the design of multimodal interfaces. Multimodal interfaces have been proposed as a promising means to support interruption management.To ensure the effectiveness of this approach, their design needs to be based on an analysis of empirical data concerning the effectiveness of individual and redundant channels of information presentation. Three meta-analyses were conducted to contrast performance on an ongoing visual task and interrupting tasks as a function of interrupting task modality (auditory vs. tactile, auditory vs. visual, and single modality vs. redundant auditory-visual). In total, 68 studies were included and six moderator variables were considered. The main findings from the meta-analyses are that response times are faster for tactile interrupting tasks in case of low-urgency messages.Accuracy is higher with tactile interrupting tasks for low-complexity signals but higher with auditory interrupting tasks for high-complexity signals. Redundant auditory-visual combinations are preferable for communication tasks during high workload and with a small visual angle of separation. The three meta-analyses contribute to the knowledge base in multimodal information processing and design. They highlight the importance of moderator variables in predicting the effects of interruption task modality on ongoing and interrupting task performance. The findings from this research will help inform the design of multimodal interfaces in data-rich, event-driven domains.

File compression and encryption based on LLS and arithmetic coding

NASA Astrophysics Data System (ADS)

Yu, Changzhi; Li, Hengjian; Wang, Xiyu

2018-03-01

e propose a file compression model based on arithmetic coding. Firstly, the original symbols, to be encoded, are input to the encoder one by one, we produce a set of chaotic sequences by using the Logistic and sine chaos system(LLS), and the values of this chaotic sequences are randomly modified the Upper and lower limits of current symbols probability. In order to achieve the purpose of encryption, we modify the upper and lower limits of all character probabilities when encoding each symbols. Experimental results show that the proposed model can achieve the purpose of data encryption while achieving almost the same compression efficiency as the arithmetic coding.

Intrapatient Evolutionary Dynamics of Human Immunodeficiency Virus Type 1 in Individuals Undergoing Alternative Treatment Strategies with Reverse Transcriptase Inhibitors.

PubMed

Kayondo, Jonathan K; Ndembi, Nicaise; Parry, Chris M; Cane, Patricia A; Hué, Stephane; Goodall, Ruth; Dunn, David T; Kaleebu, Pontiano; Pillay, Deenan; Mbisa, Jean L

2015-07-01

Structured treatment interruption (STI) has been trialed as an alternative to lifelong antiretroviral therapy (ART). We retrospectively performed single genome sequencing of the HIV-1 pol region from three patients representing different scenarios. They were either failing on continuous therapy (CT-F), failing STI (STI-F), or suppressing on STI (STI-S). Over 460 genomes were generated from three to five different time points over a 2-year period. We found multiple-linked-resistant mutations in both treatment failures. However, the CT-F patient showed a stepwise accumulation of diverse, linked mutations whereas the STI-F patient had lineage turnover between treatment periods with recirculation of wild-type and resistant variants from reservoirs. The STI-F patient showed a 7-fold increase in the third codon position substitution rate relative to the first and second positions compared to a 2-fold increase for CT-F and increased purifying selection in the pol gene (62 vs. 22 sites, respectively). An understanding of intrapatient viral dynamics could guide the future direction of treatment interruption strategies.

Compressive Sensing for Radar and Radar Sensor Networks

DTIC Science & Technology

2013-12-02

Zero Correlation Zone Sequence Pair Sets for MIMO Radar Inspired by recent advances in MIMO radar, we apply orthogonal phase coded waveforms to MIMO ...radar system in order to gain better range resolution and target direction finding performance [2]. We provide and investigate a generalized MIMO radar...ZCZ) sequence-Pair Set (ZCZPS). We also study the MIMO radar ambiguity function of the system using phase coded waveforms, based on which we analyze

The complete mitochondrial genome and phylogenetic analysis of the giant panda (Ailuropoda melanoleuca).

PubMed

Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong

2007-08-01

The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.

Compression of computer generated phase-shifting hologram sequence using AVC and HEVC

NASA Astrophysics Data System (ADS)

Xing, Yafei; Pesquet-Popescu, Béatrice; Dufaux, Frederic

2013-09-01

With the capability of achieving twice the compression ratio of Advanced Video Coding (AVC) with similar reconstruction quality, High Efficiency Video Coding (HEVC) is expected to become the newleading technique of video coding. In order to reduce the storage and transmission burden of digital holograms, in this paper we propose to use HEVC for compressing the phase-shifting digital hologram sequences (PSDHS). By simulating phase-shifting digital holography (PSDH) interferometry, interference patterns between illuminated three dimensional( 3D) virtual objects and the stepwise phase changed reference wave are generated as digital holograms. The hologram sequences are obtained by the movement of the virtual objects and compressed by AVC and HEVC. The experimental results show that AVC and HEVC are efficient to compress PSDHS, with HEVC giving better performance. Good compression rate and reconstruction quality can be obtained with bitrate above 15000kbps.

Performance evaluation of the intra compression in the video coding standards

NASA Astrophysics Data System (ADS)

Abramowski, Andrzej

2015-09-01

The article presents a comparison of the Intra prediction algorithms in the current state-of-the-art video coding standards, including MJPEG 2000, VP8, VP9, H.264/AVC and H.265/HEVC. The effectiveness of techniques employed by each standard is evaluated in terms of compression efficiency and average encoding time. The compression efficiency is measured using BD-PSNR and BD-RATE metrics with H.265/HEVC results as an anchor. Tests are performed on a set of video sequences, composed of sequences gathered by Joint Collaborative Team on Video Coding during the development of the H.265/HEVC standard and 4K sequences provided by Ultra Video Group. According to results, H.265/HEVC provides significant bit-rate savings at the expense of computational complexity, while VP9 may be regarded as a compromise between the efficiency and required encoding time.

Avoidable interruptions during drug administration in an intensive rehabilitation ward: improvement project.

PubMed

Buchini, Sara; Quattrin, Rosanna

2012-04-01

To record the frequency of interruptions and their causes, to identify 'avoidable' interruptions and to build an improvement project to reduce 'avoidable' interruptions. In Italy each year 30,000-35,000 deaths per year are attributed to health-care system errors, of which 19% are caused by medication errors. The factors that contribute to drug management error also include interruptions and carelessness during treatment administration. A descriptive study design was used to record the frequency of interruptions and their causes and to identify 'avoidable' interruptions in an intensive rehabilitation ward in Northern Italy. A data collection grid was used to record the data over a 6-month period. A total of 3000 work hours were observed. During the study period 1170 interruptions were observed. The study identified 14 causes of interruption. The study shows that of the 14 cases of interruptions at least nine can be defined as 'avoidable'. An improvement project has been proposed to reduce unnecessary interruptions and distractions to avoid making errors. An additional useful step to reduce the incidence of treatment errors would be to implement the use of a single patient medication sheet for the recording of drug prescription, preparation and administration and also the incident reporting. © 2011 Blackwell Publishing Ltd.

Dealing with task interruptions in complex dynamic environments: are two heads better than one?

PubMed

Tremblay, Sébastien; Vachon, François; Lafond, Daniel; Kramer, Chelsea

2012-02-01

This study examined whether teaming up mitigates individual vulnerability to task interruptions in complex dynamic situations. Omnipresent in everyday multitasking environments, task interruptions are usually detrimental to individual performance. This is particularly crucial in dynamic command and control (C2) safety-critical contexts because of the additional challenge imposed by the continually evolving situation during the interruption. We employed a firefighting microworld to simulate C2 in the context of supervisory control to examine the relative impact of interruptions on participants working in a functional dyad versus operators working alone. Although task interruption was detrimental to participants' efficacy of monitoring resources, the negative impact of interruption was reduced for those working in teams. Teaming up translated into faster resumption time, but only if both teammates were interrupted simultaneously. Interrupting only one team member was associated with increased postinterruption communications and slower resumption time. These findings suggest that in complex dynamic situations working in a small team confers more resistance to task interruption than working alone by virtue of the reduced individual workload typical of teamwork. The benefit of collaborative work seems nevertheless mediated by the coordination and communication overhead associated with teamwork. The present findings have practical implications for operators dealing with unexpected events such as task interruptions in C2 environments.

Analysis of Smartphone Interruptions on Academic General Internal Medicine Wards. Frequent Interruptions may cause a 'Crisis Mode' Work Climate.

PubMed

Vaisman, Alon; Wu, Robert C

2017-01-04

Hospital-based medical services are increasingly utilizing team-based pagers and smartphones to streamline communications. However, an unintended consequence may be higher volumes of interruptions potentially leading to medical error. There is likely a level at which interruptions are excessive and cause a 'crisis mode' climate. We retrospectively collected phone, text messaging, and email interruptions directed to hospital-assigned smartphones on eight General Internal Medicine (GIM) teams at two tertiary care centres in Toronto, Ontario from April 2013 to September 2014. We also calculated the number of times these interruptions exceeded a pre-specified threshold per hour, termed 'crisis mode', defined as at least five interruptions in 30 minutes. We analyzed the correlation between interruptions and date, site, and patient volumes. A total of 187,049 interruptions were collected over an 18-month period. Daily weekday interruptions rose sharply in the morning, peaking between 11 AM to 12 PM and measuring 4.8 and 3.7 mean interruptions/hour at each site, respectively. Mean daily interruptions per team totaled 46.2 ± 3.6 at Site 1 and 39.2 ± 4.2 at Site 2. The 'crisis mode' threshold was exceeded, on average, 2.3 times/day per GIM team during weekdays. In a multivariable linear regression analysis, site (β6.43 CI95% 5.44 - 7.42, p<0.001), day of the week (with Friday having the most interruptions) (β0.481 CI95% 0.236 - 0.730, p<0.05) and patient census (β1.55 CI95% 1.42 - 1.67, p<0.05) were all predictive of daily interruption volume although there was a significant interaction effect between site and patient census (β-0.941 CI95% -1.18 - -0.703, p<0.05). Interruptions were related to site-specific features, including volume, suggesting that future interventions should target the culture of individual hospitals. Excessive interruptions may have implications for patient safety especially when exceeding a maximal threshold over short periods of time.

Syndrome source coding and its universal generalization

NASA Technical Reports Server (NTRS)

Ancheta, T. C., Jr.

1975-01-01

A method of using error-correcting codes to obtain data compression, called syndrome-source-coding, is described in which the source sequence is treated as an error pattern whose syndrome forms the compressed data. It is shown that syndrome-source-coding can achieve arbitrarily small distortion with the number of compressed digits per source digit arbitrarily close to the entropy of a binary memoryless source. A universal generalization of syndrome-source-coding is formulated which provides robustly-effective, distortionless, coding of source ensembles.

Interface requirements to couple thermal hydraulics codes to severe accident codes: ICARE/CATHARE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camous, F.; Jacq, F.; Chatelard, P.

1997-07-01

In order to describe with the same code the whole sequence of severe LWR accidents, up to the vessel failure, the Institute of Protection and Nuclear Safety has performed a coupling of the severe accident code ICARE2 to the thermalhydraulics code CATHARE2. The resulting code, ICARE/CATHARE, is designed to be as pertinent as possible in all the phases of the accident. This paper is mainly devoted to the description of the ICARE2-CATHARE2 coupling.

The Effects of Career Interruptions on Young Men and Women.

ERIC Educational Resources Information Center

Shorten, Brett; Lewis, Donald E.

1991-01-01

Data from a sample of 5,837 Australians showed that (1) women had longer career interruptions; (2) regardless of number of interruptions, men had higher wages; (3) longer interruptions had a negative effect on reentry wages; and (4) 1985-88 growth in wages for males was enhanced by increased numbers and length of interruptions, with the opposite…

The first genome sequences of human bocaviruses from Vietnam

PubMed Central

Thanh, Tran Tan; Van, Hoang Minh Tu; Hong, Nguyen Thi Thu; Nhu, Le Nguyen Truc; Anh, Nguyen To; Tuan, Ha Manh; Hien, Ho Van; Tuong, Nguyen Manh; Kien, Trinh Trung; Khanh, Truong Huu; Nhan, Le Nguyen Thanh; Hung, Nguyen Thanh; Chau, Nguyen Van Vinh; Thwaites, Guy; van Doorn, H. Rogier; Tan, Le Van

2017-01-01

As part of an ongoing effort to generate complete genome sequences of hand, foot and mouth disease-causing enteroviruses directly from clinical specimens, two complete coding sequences and two partial genomic sequences of human bocavirus 1 (n=3) and 2 (n=1) were co-amplified and sequenced, representing the first genome sequences of human bocaviruses from Vietnam. The sequences may aid future study aiming at understanding the evolution of the virus. PMID:28090592

Molecular cloning and evolutionary analysis of the calcium-modulated contractile protein, centrin, in green algae and land plants.

PubMed

Bhattacharya, D; Steinkötter, J; Melkonian, M

1993-12-01

Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.

Application of MELCOR Code to a French PWR 900 MWe Severe Accident Sequence and Evaluation of Models Performance Focusing on In-Vessel Thermal Hydraulic Results

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Rosa, Felice

2006-07-01

In the ambit of the Severe Accident Network of Excellence Project (SARNET), funded by the European Union, 6. FISA (Fission Safety) Programme, one of the main tasks is the development and validation of the European Accident Source Term Evaluation Code (ASTEC Code). One of the reference codes used to compare ASTEC results, coming from experimental and Reactor Plant applications, is MELCOR. ENEA is a SARNET member and also an ASTEC and MELCOR user. During the first 18 months of this project, we performed a series of MELCOR and ASTEC calculations referring to a French PWR 900 MWe and to themore » accident sequence of 'Loss of Steam Generator (SG) Feedwater' (known as H2 sequence in the French classification). H2 is an accident sequence substantially equivalent to a Station Blackout scenario, like a TMLB accident, with the only difference that in H2 sequence the scram is forced to occur with a delay of 28 seconds. The main events during the accident sequence are a loss of normal and auxiliary SG feedwater (0 s), followed by a scram when the water level in SG is equal or less than 0.7 m (after 28 seconds). There is also a main coolant pumps trip when {delta}Tsat < 10 deg. C, a total opening of the three relief valves when Tric (core maximal outlet temperature) is above 603 K (330 deg. C) and accumulators isolation when primary pressure goes below 1.5 MPa (15 bar). Among many other points, it is worth noting that this was the first time that a MELCOR 1.8.5 input deck was available for a French PWR 900. The main ENEA effort in this period was devoted to prepare the MELCOR input deck using the code version v.1.8.5 (build QZ Oct 2000 with the latest patch 185003 Oct 2001). The input deck, completely new, was prepared taking into account structure, data and same conditions as those found inside ASTEC input decks. The main goal of the work presented in this paper is to put in evidence where and when MELCOR provides good enough results and why, in some cases mainly referring to its specific models (candling, corium pool behaviour, etc.) they were less good. A future work will be the preparation of an input deck for the new MELCOR 1.8.6. and to perform a code-to-code comparison with ASTEC v1.2 rev. 1. (author)« less

PAs reduce rounding interruptions in the pediatric intensive care unit.

PubMed

Hascall, Rebecca L; Perkins, R Serene; Kmiecik, Lauren; Gupta, Priya R; Shelak, Carolyn F; Demirel, Shaban; Buchholz, Mark T

2018-06-01

We investigated the proportion of encounters that were interrupted during family-centered rounds in the pediatric intensive care unit (PICU) to determine whether the use of a physician assistant (PA) significantly affected the proportion of interrupted encounters. We evaluated 2,657 rounding encounters in our 24-bed regional referral unit. The duration of each rounding encounter and total rounding duration were recorded. The presence or absence of a PA during each rounding encounter, the occurrence of an interruption, and other potential predictors of interruptions were recorded. The presence of a PA during PICU rounds was significantly associated (P < .001) with a 35.4% lower likelihood of an interruption. Family-centered rounds in the PICU are less likely to be interrupted when a PA is present. PAs help physicians and improve rounding efficiency by safely and effectively handling certain interruptions.

A systematic review of the psychological literature on interruption and its patient safety implications.

PubMed

Li, Simon Y W; Magrabi, Farah; Coiera, Enrico

2012-01-01

To understand the complex effects of interruption in healthcare. As interruptions have been well studied in other domains, the authors undertook a systematic review of experimental studies in psychology and human-computer interaction to identify the task types and variables influencing interruption effects. 63 studies were identified from 812 articles retrieved by systematic searches. On the basis of interruption profiles for generic tasks, it was found that clinical tasks can be distinguished into three broad types: procedural, problem-solving, and decision-making. Twelve experimental variables that influence interruption effects were identified. Of these, six are the most important, based on the number of studies and because of their centrality to interruption effects, including working memory load, interruption position, similarity, modality, handling strategies, and practice effect. The variables are explained by three main theoretical frameworks: the activation-based goal memory model, prospective memory, and multiple resource theory. This review provides a useful starting point for a more comprehensive examination of interruptions potentially leading to an improved understanding about the impact of this phenomenon on patient safety and task efficiency. The authors provide some recommendations to counter interruption effects. The effects of interruption are the outcome of a complex set of variables and should not be considered as uniformly predictable or bad. The task types, variables, and theories should help us better to identify which clinical tasks and contexts are most susceptible and assist in the design of information systems and processes that are resilient to interruption.

Functional Testing of SLC26A4 Variants—Clinical and Molecular Analysis of a Cohort with Enlarged Vestibular Aqueduct from Austria

PubMed Central

Bernardinelli, Emanuele; Nofziger, Charity; Patsch, Wolfgang; Rasp, Gerd; Paulmichl, Markus; Dossena, Silvia

2018-01-01

The prevalence and spectrum of sequence alterations in the SLC26A4 gene, which codes for the anion exchanger pendrin, are population-specific and account for at least 50% of cases of non-syndromic hearing loss associated with an enlarged vestibular aqueduct. A cohort of nineteen patients from Austria with hearing loss and a radiological alteration of the vestibular aqueduct underwent Sanger sequencing of SLC26A4 and GJB2, coding for connexin 26. The pathogenicity of sequence alterations detected was assessed by determining ion transport and molecular features of the corresponding SLC26A4 protein variants. In this group, four uncharacterized sequence alterations within the SLC26A4 coding region were found. Three of these lead to protein variants with abnormal functional and molecular features, while one should be considered with no pathogenic potential. Pathogenic SLC26A4 sequence alterations were only found in 12% of patients. SLC26A4 sequence alterations commonly found in other Caucasian populations were not detected. This survey represents the first study on the prevalence and spectrum of SLC26A4 sequence alterations in an Austrian cohort and further suggests that genetic testing should always be integrated with functional characterization and determination of the molecular features of protein variants in order to unequivocally identify or exclude a causal link between genotype and phenotype. PMID:29320412

Genetically Engineered Virulent Phage Banks in the Detection and Control of Emergent Pathogenic Bacteria

PubMed Central

Blois, Hélène; Iris, François

2010-01-01

Natural outbreaks of multidrug-resistant microorganisms can cause widespread devastation, and several can be used or engineered as agents of bioterrorism. From a biosecurity standpoint, the capacity to detect and then efficiently control, within hours, the spread and the potential pathological effects of an emergent outbreak, for which there may be no effective antibiotics or vaccines, become key challenges that must be met. We turned to phage engineering as a potentially highly flexible and effective means to both detect and eradicate threats originating from emergent (uncharacterized) bacterial strains. To this end, we developed technologies allowing us to (1) concurrently modify multiple regions within the coding sequence of a gene while conserving intact the remainder of the gene, (2) reversibly interrupt the lytic cycle of an obligate virulent phage (T4) within its host, (3) carry out efficient insertion, by homologous recombination, of any number of engineered genes into the deactivated genomes of a T4 wild-type phage population, and (4) reactivate the lytic cycle, leading to the production of engineered infective virulent recombinant progeny. This allows the production of very large, genetically engineered lytic phage banks containing, in an E. coli host, a very wide spectrum of variants for any chosen phage-associated function, including phage host-range. Screening of such a bank should allow the rapid isolation of recombinant T4 particles capable of detecting (ie, diagnosing), infecting, and destroying hosts belonging to gram-negative bacterial species far removed from the original E. coli host. PMID:20569057

DNA Barcoding through Quaternary LDPC Codes

PubMed Central

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10−2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10−9 at the expense of a rate of read losses just in the order of 10−6. PMID:26492348

DNA Barcoding through Quaternary LDPC Codes.

PubMed

Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

2015-01-01

For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

Genetic susceptibility to type 1 diabetes in the intracellular pathway of antigen processing - a subject review and cross-study comparison.

PubMed

Sia, Charles; Weinem, Michael

2005-01-01

Ligand binding grooves of MHC class I molecules are able to load a panel of endogenous peptides of varying length and sequence derived from self or foreign origin to activate or deactivate cytotoxic CD8(+) T cells. Peptides are assembled with class I molecules by pathways that are either dependent or independent of transport by ABC proteins (TAP) and degradation in the immunoproteasome by its subunits LMP2 and LMP7. Those peptides that require TAP and LMP treatment appear to be subject to control and optimization by TAP for proper customizing and efficient presentation. Therefore, allelic variations in the coding sequences of TAP and LMP were suspected for a long time to be responsible for improper antigen processing, interruption of self-peptide presentation and reduced cell surface expression of MHC class I molecules resulting in the activation of autoreactive CD8(+) T cells. In this article we reviewed the controversial findings regarding the role of TAP and LMP genes in autoimmune diabetes and reevaluated data of eleven separate studies in a cross-study analysis by genotype and HLA haplotype matching. We could confirm previous results by showing that TAP2*651-A/F and TAP2*687-A/A are significantly associated with disease, independently of linkage disequilibrium (LD). LMP2-R/H surprisingly seems to be primarily disease-conferring although a weak association with DR4 serotypes can be observed. Our analysis also suggests that LMP7-B/B, TAP1-A/A and TAP2*687-A/B are the protective genotypes and that these associations are not secondary to LD with DRB1. Consequently, intracellular antigen processing associated with TAP- and proteasome-dependent pathways seems to be a critical element in T cell selection for the retention of a balanced immunity.

Genomic Organization and Molecular Analysis of Virulent Bacteriophage 2972 Infecting an Exopolysaccharide-Producing Streptococcus thermophilus Strain

PubMed Central

Lévesque, Céline; Duplessis, Martin; Labonté, Jessica; Labrie, Steve; Fremaux, Christophe; Tremblay, Denise; Moineau, Sylvain

2005-01-01

The Streptococcus thermophilus virulent pac-type phage 2972 was isolated from a yogurt made in France in 1999. It is a representative of several phages that have emerged with the industrial use of the exopolysaccharide-producing S. thermophilus strain RD534. The genome of phage 2972 has 34,704 bp with an overall G+C content of 40.15%, making it the shortest S. thermophilus phage genome analyzed so far. Forty-four open reading frames (ORFs) encoding putative proteins of 40 or more amino acids were identified, and bioinformatic analyses led to the assignment of putative functions to 23 ORFs. Comparative genomic analysis of phage 2972 with the six other sequenced S. thermophilus phage genomes confirmed that the replication module is conserved and that cos- and pac-type phages have distinct structural and packaging genes. Two group I introns were identified in the genome of 2972. They interrupted the genes coding for the putative endolysin and the terminase large subunit. Phage mRNA splicing was demonstrated for both introns, and the secondary structures were predicted. Eight structural proteins were also identified by N-terminal sequencing and/or matrix-assisted laser desorption ionization—time-of-flight mass spectrometry. Detailed analysis of the putative minor tail proteins ORF19 and ORF21 as well as the putative receptor-binding protein ORF20 showed the following interesting features: (i) ORF19 is a hybrid protein, because it displays significant identity with both pac- and cos-type phages; (ii) ORF20 is unique; and (iii) a protein similar to ORF21 of 2972 was also found in the structure of the cos-type phage DT1, indicating that this structural protein is present in both S. thermophilus phage groups. The implications of these findings for phage classification are discussed. PMID:16000821

MpSaci is a widespread gypsy-Ty3 retrotransposon highly represented by non-autonomous copies in the Moniliophthora perniciosa genome.

PubMed

Pereira, Jorge F; Araújo, Elza F; Brommonschenkel, Sérgio H; Queiroz, Casley B; Costa, Gustavo G L; Carazzolle, Marcelo F; Pereira, Gonçalo A G; Queiroz, Marisa V

2015-05-01

Transposons are an important source of genetic variation. The phytopathogen Moniliophthora perniciosa shows high level of variability but little is known about the role of class I elements in shaping its genome. In this work, we aimed the characterization of a new gypsy/Ty3 retrotransposon species, named MpSaci, in the M. perniciosa genome. These elements are largely variable in size, ranging from 4 to 15 kb, and harbor direct long terminal repeats (LTRs) with varying degrees of similarity. Approximately, all of the copies are non-autonomous as shifts in the reading frame and stop codons were detected. Only two elements (MpSaci6 and MpSaci9) code for GAG and POL proteins that possess functional domains. Conserved domains that are typically not found in retrotransposons were detected and could potentially impact the expression of neighbor genes. Solo LTRs and several LARDs (large retrotransposon derivative) were detected. Unusual elements containing small sequences with or without interruptions that are similar to gag or different pol domains and presenting LTRs with different levels of similarities were identified. Methylation was observed in MpSaci reverse transcriptase sequences. Distribution analysis indicates that MpSaci elements are present in high copy number in the genomes of C-, S- and L-biotypes of M. perniciosa. In addition, C-biotype isolates originating from the state of Bahia have fragments in common with isolates from the Amazon region and two hybridization profiles related to two chromosomal groups. RT-PCR analysis reveals that the gag gene is constitutively expressed and that the expression is increased at least three-fold with nutrient depravation even though no new insertion were observed. These findings point out that MpSaci collaborated and, even though is primarily represented by non-autonomous elements, still might contribute to the generation of genetic variability in the most important cacao pathogen in Brazil.

Unique nuclear localization of Nile tilapia (Oreochromis niloticus) Neu4 sialidase is regulated by nuclear transport receptor importin α/β.

PubMed

Honda, Akinobu; Chigwechokha, Petros Kingstone; Kamada-Futagami, Yuko; Komatsu, Masaharu; Shiozaki, Kazuhiro

2018-06-01

Sialidase catalyzes the removal of sialic acids from glycoconjugates. Different from Neu1 and Neu3 sialidases, Neu4 enzymatic properties such as substrate specificity and subcellular localization are not well-conserved among vertebrates. In fish only zebrafish and medaka neu4 genes have been cloned and their polypeptides have been characterized so far. Thus, characterization of Neu4 from other fish species is necessary to evaluate Neu4 physiological functions. Here, Nile tilapia was chosen for the characterization of Neu4 polypeptide considering that it is one of the major cultured fish all over the world and that its genomic sequences are now available. Coding DNA sequence of tilapia Neu4 was identified as 1,497 bp and its recombinant protein showed broad substrate specificity and optimal sialidase enzyme activity pH at 4.0. Neu4 activity was sustained even in neutral and alkali pH. Interestingly, immunofluorescence analysis revealed that major subcellular localization of tilapia Neu4 was nuclear, quite distinct from zebrafish (ER) and medaka Neu4 (lysosome). Bioinformatic analysis showed the existence of putative nuclear localization signal (NLS) in tilapia Neu4. In general, it is known that importin families bind to several proteins via NLS and transfer them into nucleus. Therefore, to determine the involvement of putative NLS in Neu4 nuclear localization, Neu4 mutant deleting NLS was constructed and expressed in cultured cells. As a result, NLS deletion significantly diminished the nuclear localization. Furthermore, treatment of importazole, interrupter of binding importin β and RanGTP, significantly suppressed Neu4 nuclear localization. In summary, tilapia Neu4 is a unique sialidase localized at nucleus and its transport system into nucleus is regulated by importin. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

A System to Automatically Classify and Name Any Individual Genome-Sequenced Organism Independently of Current Biological Classification and Nomenclature

PubMed Central

Song, Yuhyun; Leman, Scotland; Monteil, Caroline L.; Heath, Lenwood S.; Vinatzer, Boris A.

2014-01-01

A broadly accepted and stable biological classification system is a prerequisite for biological sciences. It provides the means to describe and communicate about life without ambiguity. Current biological classification and nomenclature use the species as the basic unit and require lengthy and laborious species descriptions before newly discovered organisms can be assigned to a species and be named. The current system is thus inadequate to classify and name the immense genetic diversity within species that is now being revealed by genome sequencing on a daily basis. To address this lack of a general intra-species classification and naming system adequate for today’s speed of discovery of new diversity, we propose a classification and naming system that is exclusively based on genome similarity and that is suitable for automatic assignment of codes to any genome-sequenced organism without requiring any phenotypic or phylogenetic analysis. We provide examples demonstrating that genome similarity-based codes largely align with current taxonomic groups at many different levels in bacteria, animals, humans, plants, and viruses. Importantly, the proposed approach is only slightly affected by the order of code assignment and can thus provide codes that reflect similarity between organisms and that do not need to be revised upon discovery of new diversity. We envision genome similarity-based codes to complement current biological nomenclature and to provide a universal means to communicate unambiguously about any genome-sequenced organism in fields as diverse as biodiversity research, infectious disease control, human and microbial forensics, animal breed and plant cultivar certification, and human ancestry research. PMID:24586551

Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

PubMed Central

Wang, Pei; Song, Fan; Cai, Wanzhi

2014-01-01

Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

Draft genome sequence for virulent and avirulent strains of Xanthomonas arboricola isolated from Prunus spp. in Spain.

PubMed

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M; Cubero, Jaime

2016-01-01

Xanthomonas arboricola is a species in genus Xanthomonas which is mainly comprised of plant pathogens. Among the members of this taxon, X. arboricola pv. pruni, the causal agent of bacterial spot disease of stone fruits and almond, is distributed worldwide although it is considered a quarantine pathogen in the European Union. Herein, we report the draft genome sequence, the classification, the annotation and the sequence analyses of a virulent strain, IVIA 2626.1, and an avirulent strain, CITA 44, of X. arboricola associated with Prunus spp. The draft genome sequence of IVIA 2626.1 consists of 5,027,671 bp, 4,720 protein coding genes and 50 RNA encoding genes. The draft genome sequence of strain CITA 44 consists of 4,760,482 bp, 4,250 protein coding genes and 56 RNA coding genes. Initial comparative analyses reveals differences in the presence of structural and regulatory components of the type IV pilus, the type III secretion system, the type III effectors as well as variations in the number of the type IV secretion systems. The genome sequence data for these strains will facilitate the development of molecular diagnostics protocols that differentiate virulent and avirulent strains. In addition, comparative genome analysis will provide insights into the plant-pathogen interaction during the bacterial spot disease process.

Barley whole exome capture: a tool for genomic research in the genus Hordeum and beyond

PubMed Central

Mascher, Martin; Richmond, Todd A; Gerhardt, Daniel J; Himmelbach, Axel; Clissold, Leah; Sampath, Dharanya; Ayling, Sarah; Steuernagel, Burkhard; Pfeifer, Matthias; D'Ascenzo, Mark; Akhunov, Eduard D; Hedley, Pete E; Gonzales, Ana M; Morrell, Peter L; Kilian, Benjamin; Blattner, Frank R; Scholz, Uwe; Mayer, Klaus FX; Flavell, Andrew J; Muehlbauer, Gary J; Waugh, Robbie; Jeddeloh, Jeffrey A; Stein, Nils

2013-01-01

Advanced resources for genome-assisted research in barley (Hordeum vulgare) including a whole-genome shotgun assembly and an integrated physical map have recently become available. These have made possible studies that aim to assess genetic diversity or to isolate single genes by whole-genome resequencing and in silico variant detection. However such an approach remains expensive given the 5 Gb size of the barley genome. Targeted sequencing of the mRNA-coding exome reduces barley genomic complexity more than 50-fold, thus dramatically reducing this heavy sequencing and analysis load. We have developed and employed an in-solution hybridization-based sequence capture platform to selectively enrich for a 61.6 megabase coding sequence target that includes predicted genes from the genome assembly of the cultivar Morex as well as publicly available full-length cDNAs and de novo assembled RNA-Seq consensus sequence contigs. The platform provides a highly specific capture with substantial and reproducible enrichment of targeted exons, both for cultivated barley and related species. We show that this exome capture platform provides a clear path towards a broader and deeper understanding of the natural variation residing in the mRNA-coding part of the barley genome and will thus constitute a valuable resource for applications such as mapping-by-sequencing and genetic diversity analyzes. PMID:23889683

An architecture for intelligent task interruption

NASA Technical Reports Server (NTRS)

Sharma, D. D.; Narayan, Srini

1990-01-01

In the design of real time systems the capability for task interruption is often considered essential. The problem of task interruption in knowledge-based domains is examined. It is proposed that task interruption can be often avoided by using appropriate functional architectures and knowledge engineering principles. Situations for which task interruption is indispensable, a preliminary architecture based on priority hierarchies is described.

Rare and Coding Region Genetic Variants Associated With Risk of Ischemic Stroke: The NHLBI Exome Sequence Project.

PubMed

Auer, Paul L; Nalls, Mike; Meschia, James F; Worrall, Bradford B; Longstreth, W T; Seshadri, Sudha; Kooperberg, Charles; Burger, Kathleen M; Carlson, Christopher S; Carty, Cara L; Chen, Wei-Min; Cupples, L Adrienne; DeStefano, Anita L; Fornage, Myriam; Hardy, John; Hsu, Li; Jackson, Rebecca D; Jarvik, Gail P; Kim, Daniel S; Lakshminarayan, Kamakshi; Lange, Leslie A; Manichaikul, Ani; Quinlan, Aaron R; Singleton, Andrew B; Thornton, Timothy A; Nickerson, Deborah A; Peters, Ulrike; Rich, Stephen S

2015-07-01

Stroke is the second leading cause of death and the third leading cause of years of life lost. Genetic factors contribute to stroke prevalence, and candidate gene and genome-wide association studies (GWAS) have identified variants associated with ischemic stroke risk. These variants often have small effects without obvious biological significance. Exome sequencing may discover predicted protein-altering variants with a potentially large effect on ischemic stroke risk. To investigate the contribution of rare and common genetic variants to ischemic stroke risk by targeting the protein-coding regions of the human genome. The National Heart, Lung, and Blood Institute (NHLBI) Exome Sequencing Project (ESP) analyzed approximately 6000 participants from numerous cohorts of European and African ancestry. For discovery, 365 cases of ischemic stroke (small-vessel and large-vessel subtypes) and 809 European ancestry controls were sequenced; for replication, 47 affected sibpairs concordant for stroke subtype and an African American case-control series were sequenced, with 1672 cases and 4509 European ancestry controls genotyped. The ESP's exome sequencing and genotyping started on January 1, 2010, and continued through June 30, 2012. Analyses were conducted on the full data set between July 12, 2012, and July 13, 2013. Discovery of new variants or genes contributing to ischemic stroke risk and subtype (primary analysis) and determination of support for protein-coding variants contributing to risk in previously published candidate genes (secondary analysis). We identified 2 novel genes associated with an increased risk of ischemic stroke: a protein-coding variant in PDE4DIP (rs1778155; odds ratio, 2.15; P = 2.63 × 10(-8)) with an intracellular signal transduction mechanism and in ACOT4 (rs35724886; odds ratio, 2.04; P = 1.24 × 10(-7)) with a fatty acid metabolism; confirmation of PDE4DIP was observed in affected sibpair families with large-vessel stroke subtype and in African Americans. Replication of protein-coding variants in candidate genes was observed for 2 previously reported GWAS associations: ZFHX3 (cardioembolic stroke) and ABCA1 (large-vessel stroke). Exome sequencing discovered 2 novel genes and mechanisms, PDE4DIP and ACOT4, associated with increased risk for ischemic stroke. In addition, ZFHX3 and ABCA1 were discovered to have protein-coding variants associated with ischemic stroke. These results suggest that genetic variation in novel pathways contributes to ischemic stroke risk and serves as a target for prediction, prevention, and therapy.

Characteristics of Interruptions During Medication Administration:An Integrative Review of Direct Observational Studies.

PubMed

Schroers, Ginger

2018-06-26

The purpose of this review was to synthesize and summarize data gathered by direct observation of the characteristics of interruptions in the context of nursing medication administration in hospital settings. Interruptions are prevalent during the medication administration process performed by nurses in hospital settings and have been found to be associated with an increase in frequency and severity of nursing medication administration errors. In addition, interruptions decrease task efficiency, leading to longer medication administration completion times. Integrative review. The electronic databases Cumulative Index of Nursing and Allied Health Literature (CINAHL), PubMED, PsyARTICLES, and Google Scholar were searched using the terms "interruptions" AND "medication administration" AND "direct observation". Nine articles met the inclusion criteria. Interruptions are likely to occur at least once during nursing medication administration processes in hospital settings. This finding applies to medication administered to one patient, termed a medication pass, and medication administered to multiple patients, termed a mediation round. Interruptions are most commonly caused by another nurse, staff member, or are self-initiated, and last approximately one minute in length. A raised awareness among staff of the most common sources of interruptions may encourage changes that lead to a decrease in the occurrence of interruptions. In addition, nurse leaders can apply an understanding of the common characteristics of interruptions to guide research, policies, and educational methods aimed at interruption management strategies. The findings from this review can be used to guide the identification and development of targeted interventions and strategies that would have the most substantial impact to reduce and manage interruptions during medication administration. Interruption management strategies have the potential to lead to a decrease in medication errors and an increase in task efficiency. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Initial description of primate-specific cystine-knot Prometheus genes and differential gene expansions of D-dopachrome tautomerase genes

PubMed Central

Premzl, Marko

2015-01-01

Using eutherian comparative genomic analysis protocol and public genomic sequence data sets, the present work attempted to update and revise two gene data sets. The most comprehensive third party annotation gene data sets of eutherian adenohypophysis cystine-knot genes (128 complete coding sequences), and d-dopachrome tautomerases and macrophage migration inhibitory factor genes (30 complete coding sequences) were annotated. For example, the present study first described primate-specific cystine-knot Prometheus genes, as well as differential gene expansions of D-dopachrome tautomerase genes. Furthermore, new frameworks of future experiments of two eutherian gene data sets were proposed. PMID:25941635

Partial genome sequence of the haloalkaliphilic soda lake bacterium Thioalkalivibrio thiocyanoxidans ARh 2 T

DOE PAGES

Berben, Tom; Sorokin, Dimitry Y.; Ivanova, Natalia; ...

2015-10-26

Thioalkalivibrio thiocyanoxidans strain ARh 2 T is a sulfur-oxidizing bacterium isolated from haloalkaline soda lakes. It is a motile, Gram-negative member of the Gammaproteobacteria. Remarkable properties include the ability to grow on thiocyanate as the sole energy, sulfur and nitrogen source, and the capability of growth at salinities of up to 4.3 M total Na +. This draft genome sequence consists of 61 scaffolds comprising 2,765,337 bp, and contains 2616 protein-coding and 61 RNA-coding genes. In conclusion, this organism was sequenced as part of the Community Science Program of the DOE Joint Genome Institute.

Complete mitochondrial genome of Eagle Owl (Bubo bubo, Strigiformes; Strigidae) from China.

PubMed

Hengjiu, Tian; Jianwei, Ji; Shi, Yang; Zhiming, Zhang; Laghari, Muhammad Younis; Narejo, Naeem Tariq; Lashari, Punhal

2016-01-01

In the present study, the complete mitochondrial genome sequence of Bubo bubo using PCR amplification, sequencing and assembling has been obtained for the first time. The total length of the mitochondrial genome was 16,250  bp, with the base composition of 29.88% A, 34.16% C, 14.35% G, and 21.58% T. It contained 37 genes (2 ribosomal RNA genes, 13 protein-coding genes and 22 transfer RNA genes) and a major non-coding control region (D-loop region). The complete mitochondrial genome sequence of Bubo bubo provides an important data set for further investigation on the phylogenetic relationships within Strigiformes.

The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza.

PubMed

Qian, Jun; Song, Jingyuan; Gao, Huanhuan; Zhu, Yingjie; Xu, Jiang; Pang, Xiaohui; Yao, Hui; Sun, Chao; Li, Xian'en; Li, Chuyuan; Liu, Juyan; Xu, Haibin; Chen, Shilin

2013-01-01

Salvia miltiorrhiza is an important medicinal plant with great economic and medicinal value. The complete chloroplast (cp) genome sequence of Salvia miltiorrhiza, the first sequenced member of the Lamiaceae family, is reported here. The genome is 151,328 bp in length and exhibits a typical quadripartite structure of the large (LSC, 82,695 bp) and small (SSC, 17,555 bp) single-copy regions, separated by a pair of inverted repeats (IRs, 25,539 bp). It contains 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. The genome structure, gene order, GC content and codon usage are similar to the typical angiosperm cp genomes. Four forward, three inverted and seven tandem repeats were detected in the Salvia miltiorrhiza cp genome. Simple sequence repeat (SSR) analysis among the 30 asterid cp genomes revealed that most SSRs are AT-rich, which contribute to the overall AT richness of these cp genomes. Additionally, fewer SSRs are distributed in the protein-coding sequences compared to the non-coding regions, indicating an uneven distribution of SSRs within the cp genomes. Entire cp genome comparison of Salvia miltiorrhiza and three other Lamiales cp genomes showed a high degree of sequence similarity and a relatively high divergence of intergenic spacers. Sequence divergence analysis discovered the ten most divergent and ten most conserved genes as well as their length variation, which will be helpful for phylogenetic studies in asterids. Our analysis also supports that both regional and functional constraints affect gene sequence evolution. Further, phylogenetic analysis demonstrated a sister relationship between Salvia miltiorrhiza and Sesamum indicum. The complete cp genome sequence of Salvia miltiorrhiza reported in this paper will facilitate population, phylogenetic and cp genetic engineering studies of this medicinal plant.

Characterization of circulating transfer RNA-derived RNA fragments in cattle

PubMed Central

Casas, Eduardo; Cai, Guohong; Neill, John D.

2015-01-01

The objective was to characterize naturally occurring circulating transfer RNA-derived RNA fragments (tRFs) in cattle1. Serum from eight clinically normal adult dairy cows was collected, and small non-coding RNAs were extracted immediately after collection and sequenced by Illumina MiSeq. Sequences aligned to transfer RNA (tRNA) genes or their flanking sequences were characterized. Sequences aligned to the beginning of 5′ end of the mature tRNA were classified as tRF5; those aligned to the 3′ end of mature tRNA were classified as tRF3; and those aligned to the beginning of the 3′ end flanking sequences were classified as tRF1. There were 3,190,962 sequences that mapped to transfer RNA and small non-coding RNAs in the bovine genome. Of these, 2,323,520 were identified as tRF5s, 562 were tRF3s, and 81 were tRF1s. There were 866,799 sequences identified as other small non-coding RNAs (microRNA, rRNA, snoRNA, etc.) and were excluded from the study. The tRF5s ranged from 28 to 40 nucleotides; and 98.7% ranged from 30 to 34 nucleotides in length. The tRFs with the greatest number of sequences were derived from tRNA of histidine, glutamic acid, lysine, glycine, and valine. There was no association between number of codons for each amino acid and number of tRFs in the samples. The reason for tRF5s being the most abundant can only be explained if these sequences are associated with function within the animal. PMID:26379699

Analysis of codon usage in beta-tubulin sequences of helminths.

PubMed

von Samson-Himmelstjerna, G; Harder, A; Failing, K; Pape, M; Schnieder, T

2003-07-01

Codon usage bias has been shown to be correlated with gene expression levels in many organisms, including the nematode Caenorhabditis elegans. Here, the codon usage (cu) characteristics for a set of currently available beta-tubulin coding sequences of helminths were assessed by calculating several indices, including the effective codon number (Nc), the intrinsic codon deviation index (ICDI), the P2 value and the mutational response index (MRI). The P2 value gives a measure of translational pressure, which has been shown to be correlated to high gene expression levels in some organisms, but it has not yet been analysed in that respect in helminths. For all but two of the C. elegans beta-tubulin coding sequences investigated, the P2 value was the only index that indicated the presence of codon usage bias. Therefore, we propose that in general the helminth beta-tubulin sequences investigated here are not expressed at high levels. Furthermore, we calculated the correlation coefficients for the cu patterns of the helminth beta-tubulin sequences compared with those of highly expressed genes in organisms such as Escherichia coli and C. elegans. It was found that beta-tubulin cu patterns for all sequences of members of the Strongylida were significantly correlated to those for highly expressed C. elegans genes. This approach provides a new measure for comparing the adaptation of cu of a particular coding sequence with that of highly expressed genes in possible expression systems.Finally, using the cu patterns of the sequences studied, a phylogenetic tree was constructed. The topology of this tree was very much in concordance with that of a phylogeny based on small subunit ribosomal DNA sequence alignments.