Portrait of a discovery. Watson, Crick, and the double helix.

PubMed

de Chadarevian, Soraya

2003-03-01

This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Why Clinical Experience and Mentoring Are Replacing Student Teaching on the Best Campuses. A White Paper

ERIC Educational Resources Information Center

Fraser, James W.; Watson, Audra M.

2014-01-01

Woodrow Wilson Senior Fellow James W. Fraser and Audra Watson, the Foundation's Director of Mentoring and Induction Strategy, take a look at emerging trends in clinical preparation for new teachers. This new white paper is based on experience with the Woodrow Wilson Teaching Fellowships, and includes observations from some of the colleges and…

X-Ray Diffraction and the Discovery of the Structure of DNA

ERIC Educational Resources Information Center

Crouse, David T.

2007-01-01

A method is described for teaching the analysis of X-ray diffraction of DNA through a series of steps utilizing the original methods used by James Watson, Francis Crick, Maurice Wilkins and Rosalind Franklin. The X-ray diffraction pattern led to the conclusion of the basic helical structure of DNA and its dimensions while basic chemical principles…

Final Environmental Impact Report/Environmental Impact Statement. Cullinan Ranch Specific Plan. Chapter 13. Comments and Responses.

DTIC Science & Technology

1984-05-01

energy- intensive crop, and agricultural advisors expect alfalfa prices to rise significantly in the future. Sonoma County Dairy Advisor Dr. Richard...Bermon Alfred Heller John Tuteur. Jr James D Hobbs* Volker E#1ee Sonoma County I. Michael Heyman Mrs Robert Watson Alemo County JunO Foote Marilyn...86 ,. Sunnyvale 5 571 Sonoma County 56 21,266 i Class C -- Little or no protection of diked baylands at local level Alameda County 1 228 Alameda 2 71

The Visioceilometer: A Portable Visibility and Cloud Ceiling Height Lidar.

DTIC Science & Technology

1982-01-01

Artillery School ATTN: STEDP-MT-DA-L ATTN: ATSF- CF -R (CPT James M. Watson) Dugway, UT 84022 Fort Sill, OK 73503 Commander Commandant US Army Dugway Proving...Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN: STEDP-MT-DA-T (Mr. John Trethewey) ATTN: ATSF- CF -R Dugway, UT 84022 Fort...Base, VA 23655 Fort !elvoir, VA 22060 Commander Director US Army INSCOM/Quest Research Corporation US Army Night Vision & ATTN: Mr. Donald Wilmot

James Craig Watson, First Director of Washburn Observatory: His Obsession with the Intra-Mercurial Planet Vulcan

NASA Astrophysics Data System (ADS)

Sheehan, William

1996-05-01

The first director of the Washburn Observatory, Watson began his career at the University of Michigan, where he discovered more than a score of asteroids and planned (but did not live to carry out) the first search for a trans-Neptunian planet. He became a strong supporter of Le Verrier's hypothesis that a planet closer to the Sun than Mercury (Vulcan) was causing the anomalous advance of 38" of arc per century of Mercury's perihelion, and mounted a special search for Vulcan at the July 29, 1878 total eclipse, at Separation, Wyoming, recording two strange reddish stars near the Sun which he assumed were intra-Mercurial bodies. With the exception of Lewis Swift at Denver, Colorado, no one else confirmed his observations, and they were sharply criticized by Clinton College (New York) astronomer C. H. F. Peters. Nevertheless, Watson remained absolutely convinced of what he had seen, and his move from Ann Arbor to Madison in 1879 was partly motivated by the prospects of obtaining better instruments with which to further his search for Vulcan, which became the obsession of his later years. He was in the process of constructing an underground solar observatory from which he hoped to see stars near the Sun in broad daylight when he died, unexpectedly, in 1880. Though it is now known that Vulcan does not exist, Watson's observations at the July 1878 eclipse remain problematic; it is probable that he observed at least one and possibly two pygmy comets in the neighborhood of the Sun.

On the centenary of the birth of Francis H. C. Crick - from physics to genetics and neuroscience.

PubMed

Teive, Hélio A G

2016-04-01

The year 2016 marks the centenary of the birth of Francis Crick (1916-2004), who made outstanding contributions to genetics and neuroscience. In 1953, in a collaborative study, Francis Crick and James Watson discovered the DNA double helix, and in 1962 they and Maurice Wilkins were awarded the Noble Prize in Physiology or Medicine. Crick subsequently became very interested in neuroscience, particularly consciousness and its relationship to the claustrum, a small gray matter structure between the insula and putamen.

Cloud Geometry Analysis of the Smoke Week III Obscuration Trials.

DTIC Science & Technology

1982-01-01

GRAPIC 1LJu 4 Cf . .444,44 44- 0. 15, 25, TltME( SErs AOEDET. . **** *HEI HT0F CENTER OP MASS ABOVE DET. PT 42 SMOKE III EVENT # 07 1313 Z 08-12-80 STATION...PORTION OF CLOUD ATMOSPHEdIC SCIENCES LABORATORY WHITE SANDS MISSILE RANGE, N.M. 119 CLI-J000000 ) .0 0 1a 40 M M M MMMMMMMM ul zo w -ZIxJ z z w 0 L- CF ... CF -R (CPT James M. Watson) Dugway, UT 84022 Port Sill, OK 73503 Commander Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN

The Effect of Ionospheric Variability on the Accuracy of High Frequency Position Location

DTIC Science & Technology

1981-08-01

A~~ ~ C~ %. 0 I Cf v. >) LaJ 04) Of T C 4 S- o 0) 0.~ o~~ o V0 Li.. .- 4 U V) (0 .. c-., c X e CO m. Co S.. LC)) C a) 4.0 I~ 0.- 0- CL CJ u W 3 LL X...Field Artillery School ATTN: STEDP-MT-DA-L ATTN: ATSF- CF -R (CPT James M. Watson) Dugway, UT 84022 Fort Sill, OK 73503 Commander Commandant US Army...Commander Commandant US Army Dugway Proving Ground US Army Field Artillery School ATTN: STEDP-MT-DA-T (Mr. John Trethewey) ATTN: ATSF- CF -R Dugway, UT 84022

A History and Overview of the Behavioral Neuroscience of Learning and Memory.

PubMed

Clark, Robert E

2018-01-01

Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.

A History and Overview of the Behavioral Neuroscience of Learning and Memory.

PubMed

Clark, Robert E

2018-01-05

Here, I provide a basic history of important milestones in the development of theories for how the brain accomplishes the phenomenon of learning and memory. Included are the ideas of Plato, René Descartes, Théodule Ribot, William James, Ivan Pavlov, John Watson, Karl Lashley, and others. The modern era of learning and memory research begins with the description of H.M. by Brenda Milner and the gradual discovery that the brain contains multiple learning and memory systems that are supported by anatomically discrete brain structures. Finally, a brief overview is provided for the chapters that are included in current topics in Behavioral Neuroscience-Learning and Memory.

Simplicity and complexity

NASA Astrophysics Data System (ADS)

Crutchfield, James; Wiesner, Karoline

2010-02-01

Is anything ever simple? When confronted with a complicated system, scientists typically strive to identify underlying simplicity, which we articulate as natural laws and fundamental principles. This simplicity is what makes nature appear so organized. Atomic physics, for example, approached a solid theoretical foundation when Niels Bohr uncovered the organization of electronic energy levels, which only later were redescribed as quantum wavefunctions. Charles Darwin's revolutionary idea about the "origin" of species emerged by mapping how species are organized and discovering why they came to be that way. And James Watson and Francis Crick's interpretation of DNA diffraction spectra was a discovery of the structural organization of genetic information - it was neither about the molecule's disorder (thermodynamic entropy) nor about the statistical randomness of its base-pair sequences.

Major Additions to the Linus Pauling Canon

NASA Astrophysics Data System (ADS)

Davenport, Derek A.

2002-08-01

The National Library of Medicine has also just posted a Web site on Linus Pauling in its Profiles of Science series. While by no means as rich as the various Oregon State University sites, it is well worth visiting. There are texts of various speeches (including his Nobel address), many downloadable photographs, correspondence (including a poignant letter to James Watson and Francis Crick concerning their "rival" structures for DNA), and much else besides. There is a certain irony in Linus Pauling being honored by the National Library of Medicine. Ever since his 1949 presidential address to the American Chemical Society, and perhaps earlier, Pauling had been at loggerheads, sometimes acrimoniously so, with the medical establishment. It is easy to imagine him somewhere in the timeless infinitude of the empyrean sporting his characteristic ear-to-ear grin.

Test Review: Watson, G., & Glaser, E. M. (2010), "Watson-Glaser™ II Critical Thinking Appraisal." Washington State University, Pullman, USA

ERIC Educational Resources Information Center

Sternod, Latisha; French, Brian

2016-01-01

The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…

Closure properties of Watson-Crick grammars

NASA Astrophysics Data System (ADS)

Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh

2015-12-01

In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.

Elevation, west portal. Sign on portal reads Watson Mill Bridge, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Elevation, west portal. Sign on portal reads Watson Mill Bridge, est. 1885. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

Different methods and metaphysics in early molecular genetics--a case of disparity of research?

PubMed

Deichmann, Ute

2008-01-01

The encounter between two fundamentally different approaches in seminal research in molecular biology--the problems, aims, methods and metaphysics--is delineated and analyzed. They are exemplified by the microbiologist Oswald T. Avery who, in line with the reductionist mechanistic metaphysics of Jacques Loeb, attempted to explain basic life phenomena through chemistry; and the theoretical physicist Max Delbrück who, influenced by Bohr's antimechanistic views, preferred to explain these phenomena without chemistry. Avery's and Delbrück's most important studies took place concurrently. Thus analysis of their contrasting approaches lends itself to examination of the Weltanschauungen view concerning the role of fundamental (metaphysical) assumptions in scientific change, that is, the view that empirical research cannot be neutral in regard to the worldviews of the researchers. This study shows that the initial ostensible disparity (non-integratibility) of the two approaches lasted for just a short time. Ironically it was a student of Delbrück's school, James Watson, who (with Crick) proposed a chemical model, the DNA double helix, as a solution to Delbrück's problem. The structure of DNA has not been seriously challenged over the past half century Moreover, Watson's and Crick's work did not call into question the validity of Delbrück's research, but opened it up to entirely new approaches. The case of Avery and Delbrück demonstrates that after initial obstacles were overcome the different fundamental attitudes and the resulting research practices were capable of integration.

Weighted Watson-Crick automata

NASA Astrophysics Data System (ADS)

Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

2014-07-01

There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.

Data Discovery with IBM Watson

NASA Astrophysics Data System (ADS)

Fessler, J.

2016-12-01

BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku

There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes andmore » fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.« less

The human genome contracts again.

PubMed

Pavlichin, Dmitri S; Weissman, Tsachy; Yona, Golan

2013-09-01

The number of human genomes that have been sequenced completely for different individuals has increased rapidly in recent years. Storing and transferring complete genomes between computers for the purpose of applying various applications and analysis tools will soon become a major hurdle, hindering the analysis phase. Therefore, there is a growing need to compress these data efficiently. Here, we describe a technique to compress human genomes based on entropy coding, using a reference genome and known Single Nucleotide Polymorphisms (SNPs). Furthermore, we explore several intrinsic features of genomes and information in other genomic databases to further improve the compression attained. Using these methods, we compress James Watson's genome to 2.5 megabytes (MB), improving on recent work by 37%. Similar compression is obtained for most genomes available from the 1000 Genomes Project. Our biologically inspired techniques promise even greater gains for genomes of lower organisms and for human genomes as more genomic data become available. Code is available at sourceforge.net/projects/genomezip/

Social anxiety and the ironic effects of positive interviewer feedback.

PubMed

Budnick, Christopher J; Kowal, Marta; Santuzzi, Alecia M

2015-01-01

Positive interviewer feedback should encourage positive experiences and outcomes for interviewees. Yet, positive feedback is inconsistent with socially anxious interviewees' negative self-views. Socially anxious interviewees might experience increased self-focus while attempting to reconcile the inconsistency between their self-perceptions and that feedback. This could interfere with successful interview performance. This study used a 3 (feedback: positive, negative, no) × 2 (social anxiety: high, low) between-subjects design. Undergraduate students (N = 88) completed a measure of dispositional social anxiety. They then engaged in a simulated interview with a White confederate trained to adhere to a standardized script. Interviewees received positive, negative, or no interviewer feedback. Each interview was video recorded to code anxiety displays, impression management tactics, and interview success. Following positive feedback, socially anxious interviewees displayed more anxiety, less assertiveness, and received lower success ratings. Among anxious interviewees, increased self-focus provided an indirect path between positive feedback and lower success. Consistent with self-verification theory, anxious interviewees had poorer interview performance following positive feedback that contradicted their negative self-views. Thus, socially anxious interviewees might be at a disadvantage when interviewing, especially following positive feedback. Implications for interviewees and interviewers are discussed.

76 FR 55425 - Post Office Closing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-07

... the closing of the Watson, Alabama post office has been filed. It identifies preliminary steps and... Postal Service's determination to close the Watson post office in Watson, Alabama. The petition was filed...

[Under what conditions does G.C Watson-Crick DNA base pair acquire all four configurations characteristic for A.T Watson-Crick DNA base pair?].

PubMed

Brovarets', O O

2013-01-01

At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.

41 CFR 301-75.100 - Must we pay all of the interviewee's pre-employment interview travel expenses?

Code of Federal Regulations, 2010 CFR

2010-07-01

... interviewee's pre-employment interview travel expenses? 301-75.100 Section 301-75.100 Public Contracts and... RESPONSIBILITIES 75-PRE-EMPLOYMENT INTERVIEW TRAVEL Travel Expenses § 301-75.100 Must we pay all of the interviewee's pre-employment interview travel expenses? If you decide to pay the interviewee per diem or common...

41 CFR 301-75.205 - Is the interviewee required to submit a travel claim to us?

Code of Federal Regulations, 2010 CFR

2010-07-01

... 41 Public Contracts and Property Management 4 2010-07-01 2010-07-01 false Is the interviewee required to submit a travel claim to us? 301-75.205 Section 301-75.205 Public Contracts and Property... the interviewee required to submit a travel claim to us? No. Only if the interviewee wants to be...

41 CFR 301-75.205 - Is the interviewee required to submit a travel claim to us?

Code of Federal Regulations, 2011 CFR

2011-07-01

... 41 Public Contracts and Property Management 4 2011-07-01 2011-07-01 false Is the interviewee required to submit a travel claim to us? 301-75.205 Section 301-75.205 Public Contracts and Property... the interviewee required to submit a travel claim to us? No. Only if the interviewee wants to be...

Sleeping under the stars

NASA Astrophysics Data System (ADS)

Zirkel, Jack

Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”

John B. Watson's Legacy: Learning and Environment.

ERIC Educational Resources Information Center

Horowitz, Frances Degen

1992-01-01

Evaluates John B. Watson's contributions to developmental psychology. Watson's insistence on objective methodology in psychology retains its influence, but his extreme environmentalism has been rejected. His concern with the principles of learning is reflected in the work of Hull and Skinner. (BC)

Oblique perspective of portal, due north. Bridge has gable roof ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Oblique perspective of portal, due north. Bridge has gable roof clad with wood shingles and has board and batten siding. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

Oblique perspective, due east by 70 degrees. Note concrete pier, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

Oblique perspective, due east by 70 degrees. Note concrete pier, added CA. 1930's. Other piers and abutments are heavily mortared rubble stone. - Watson Mill Bridge, Spanning South Fork Broad River, Watson Mill Road, Watson Mill Bridge State Park, Comer, Madison County, GA

Some Lady! A Conversation with Dorothy Watson, Outstanding Educator in the Language Arts.

ERIC Educational Resources Information Center

Bishop, Rudine Sims

2002-01-01

Presents a conversation with Dorothy Watson, the 2002 Outstanding Educator in the Language Arts recipient. Hopes that this profile will provide insight into Dorothy Watson and her intellectual foundations, her humaneness, and her passion for teaching and learning. (SG)

Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.

PubMed

Cubero, Elena; Luque, F Javier; Orozco, Modesto

2006-02-01

A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.

Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA

PubMed Central

Cubero, Elena; Luque, F. Javier; Orozco, Modesto

2006-01-01

A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814

The multiple personalities of Watson and Crick strands.

PubMed

Cartwright, Reed A; Graur, Dan

2011-02-08

In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.

78 FR 52230 - Government/Industry Aeronautical Charting Forum Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-22

...: [email protected] . For information relating to the Charting Group, contact Valerie S. Watson...) 427-5155; Email: valerie.s.watson@faa.gov . SUPPLEMENTARY INFORMATION: Pursuant to Sec. 10(a)(2) of... if time permits. Issued in Washington, DC, on August 15, 2013. Valerie S. Watson, Co-Chair...

77 FR 1471 - The Historically Black College and University Capital Financing Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2012-01-10

... INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black College and University Capital...; telephone: (202) 219-7037; fax: (202) 502-7852; email: donald.watson@ed.gov . Individuals who use a..., assistance listening devices, or materials in alternative format) should notify Donald Watson at (202) 219...

78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-03-20

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-10-25

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-13

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-04

... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...

Propagation of Species at Risk Atlantic Pigtoe on Military Installations

DTIC Science & Technology

2010-04-30

adult mussels are constantly being adapted to meet the needs of each species. 6.0. PROCEDURES 6.1. Potential Host Fish Collection In order to...Watson) o VA freshwater mussel web atlas (Watson) o Freshwater gastropod of VA web atlas, Atlantic slope (Watson) 5) Other Issues of Interest

Historical Review of Emergency Tourniquet Use to Stop Bleeding

DTIC Science & Technology

2012-02-01

comment to, “More lives have been lost than were ever saved by the use of the tourniquet.”49 Watson- Jones concluded that the emergency tourniquet was a dan...in major limb trauma. J Trauma 2008;64: S38–50. 21. Kragh JF Jr, Littrel ML, Jones JA, et al. Battle casualty survival with emergency tourniquet use...Watson- Jones . J Bone Joint Surg 1972;54B:569–75. 48. Watson- Jones R. Fractures and Joint Injuries. London: Livingstone; 1955:121–2. 49. Watson- Jones R

Bill Lang's contributions to acoustics at International Business Machines Corporation (IBM), signal processing, international standards, and professionalism in noise control engineering

NASA Astrophysics Data System (ADS)

Maling, George C.

2005-09-01

Bill Lang joined IBM in the late 1950s with a mandate from Thomas Watson Jr. himself to establish an acoustics program at IBM. Bill created the facilities in Poughkeepsie, developed the local program, and was the leader in having other IBM locations with development and manufacturing responsibilities construct facilities and hire staff under the Interdivisional Liaison Program. He also directed IBMs acoustics technology program. In the mid-1960s, he led an IEEE standards group in Audio and Electroacoustics, and, with the help of James Cooley, Peter Welch, and others, introduced the fast Fourier transform to the acoustics community. He was the convenor of ISO TC 43 SC1 WG6 that began writing the 3740 series of standards in the 1970s. It was his suggestion to promote professionalism in noise control engineering, and, through meetings with Leo Beranek and others, led the founding of INCE/USA in 1971. He was also a leader of the team that founded International INCE in 1974, and he served as president from 1988 until 1999.

The multiple personalities of Watson and Crick strands

PubMed Central

2011-01-01

Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin. PMID:21303550

75 FR 42081 - The Historically Black College and University Capital Financing Advisory Board

Federal Register 2010, 2011, 2012, 2013, 2014

2010-07-20

..., DC. 20001. FOR FURTHER INFORMATION CONTACT: Donald E. Watson, Executive Director, Historically Black... 6071, Washington, DC 20006; telephone: (202) 219-7037; fax: (202) 502-7852; e-mail: donald.watson@ed...) should notify Donald Watson at 202 219-7037, no later than July 16, 2010. We will attempt to meet...

76 FR 5424 - Motor Carrier Safety Advisory Committee; Request for Nominations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-01-31

... FURTHER INFORMATION CONTACT: Ms. Shannon L. Watson, MCSAC Liaison, FMCSA, at 202-385-2395 or via e-mail at Shannon.Watson@dot.gov . SUPPLEMENTARY INFORMATION: I. Background Section 4144 of the Safe, Accountable...://mcsac.fmcsa.dot.gov/ , completed on-line, and e-mailed to Shannon L. Watson, MCSAC liaison, at Shannon...

77 FR 40058 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-06

... Affairs Officer) 90 Hennepin Avenue, Minneapolis, Minnesota 55480-0291: 1. Thomas Watson, Grand Forks, North Dakota, as an individual and as trustee, and Thomas Watson and Toby Kommer, Fargo, North Dakota... indirectly acquire control of Bank Forward, Hannaford, North Dakota. In addition, Mr. Watson and Mr. Kommer...

Making IBM's Computer, Watson, Human

ERIC Educational Resources Information Center

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…

77 FR 57068 - Hours of Service of Drivers of Commercial Motor Vehicles; Regulatory Guidance for Oil Field...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-17

... 20590, phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson..., 1200 New Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Ms. Watson...

77 FR 46640 - Hours of Service of Drivers of Commercial Motor Vehicles; Regulatory Guidance for Oil Field...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-06

..., phone (202) 366-4325, email [email protected] . For the listening sessions: Ms. Shannon Watson, Senior... Jersey Avenue SE., Washington, DC 20590, phone (202) 385-2395, email shannon.watson@dot.gov . If you need sign language assistance to participate in a listening session, please contact Shannon Watson at (202...

From theory to practice: caring science according to Watson and Brewer.

PubMed

Clarke, Pamela N; Watson, Jean; Brewer, Barbara B

2009-10-01

Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.

Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.

PubMed

Doyle-Lindrud, Susan

2015-02-01

IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.

"When Do I Knock on the Hotel Room Door?": The MLA Conference Job Interview.

ERIC Educational Resources Information Center

Emmerson, Richard K.

1995-01-01

Offers advice to potential interviewees attending an MLA conference. Cautions the interviewee to arrive for the appointment early, but not to knock until the time of the appointment. Advises interviewees to answer questions briefly and to let the committee set the pace of the interview. (PA)

George C. Comstock: Wisconsin Astronomer, Observatory Director, Graduate School Dean, and AAS Officer

NASA Astrophysics Data System (ADS)

Osterbrock, D. E.

1996-05-01

George C. Comstock, the third director of Washburn Observatory, had a long and interesting career at Wisconsin. Born in Madison, he did his undergraduate work at Michigan under James Watson. From him Comstock learned the classical astronomy of stellar positions and celestial mechanics. He had one year of graduate work at Michigan before going to Madison as Watson's assistant in 1880, and remained after the latter's death as E.S. Holden's assistant. At Wisconsin, Comstock also studied law at the UW Law School in his ``spare time", to have an alternate career path. He was admitted to the bar in 1883 but never practiced. From 1885-7 he was on the Ohio State faculty with a summer working at Lick Observatory; then in 1887 became associate director back at Washburn Observatory. Two years later he succeeded to the full directorship, and kept the post until he retired in 1922 at the age of 67. All Comstock's research was in positional astronomy, and he considered his most important work to be the measurement of stellar aberration and atmospheric refraction. He also measured double stars with the 15-inch Washburn refractor. His main duty at UW was teaching, mostly ``practical astronomy" for civil engineering students. Comstock wrote several text books on astronomy, surveying, and least squares. He was the first head of the UW Graduate School, set up by President Charles R. Van Hise in 1904. Comstock was a highly effective administrator, and did much to build up research at UW. His own most successful students were Sidney D. Townley, Joel Stebbins, and Sebastian Albrecht. Because of his legal training, Comstock was involved as an officer in many scientific societies. He was one of the organizers of the AAS, its first secretary, and later its vice president, then president. He retired in 1922, and was succeeded by Stebbins, whom he helped to bring back to Madison from Illinois. After his retirement, Comstock lived in Beloit until his death in 1934.

John B. Watson's Alleged Sex Research: An Appraisal of the Evidence

ERIC Educational Resources Information Center

Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.

2007-01-01

In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…

[The ethics of ethnography revisited: learning from documentaries].

PubMed

Weber, Florence

2011-01-01

This article offers a comparison of the legal suits filed by the interviewees against the director of the documentary Être et avoir (to have and to be) with the rights of interviewees in ethnographic investigations, focusing particularly on image copyrights and labor law. To say that interviewees contribute to such investigations in anonymity does not solve the main problem - they are crucial to the investigation, marginal to the analysis, and then are assigned no publication credits. While information about the interviewees should remain confidential, this article argues, that contribution and role in the making of a publication should not be ignored.

Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics

PubMed Central

Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.

2015-01-01

Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517

Binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs in the Watson-Crick and Hoogsteen configurations.

PubMed

Morari, Cristian; Bogdan, Diana; Muntean, Cristina M

2012-11-01

The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.

The Thurgood Marshall School of Law Empirical Findings: A Report of the Watson-Glaser for the 2009-2010 Test Takers

ERIC Educational Resources Information Center

Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.

2010-01-01

The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…

How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.

PubMed

Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw

2014-04-02

A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.

Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer

DTIC Science & Technology

2001-10-01

Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES...markers of the invasive phenotype in human breast cancer" Dr Peter H. Watson INTRODUCTION. The acquisition of the ability to invade is the single most

Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.

PubMed

Digdon, Nancy; Powell, Russell A; Harris, Ben

2014-11-01

In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.

A single Watson-Crick G x C base pair in water: aqueous hydrogen bonds in hydrophobic cavities.

PubMed

Sawada, Tomohisa; Fujita, Makoto

2010-05-26

Hydrogen bond (H-bond) formation in water has been a challenging task because water molecules are constant competitors. In biological systems, however, stable H-bonds are formed by shielding the H-bonding sites from the competing water molecules within hydrophobic pockets. Inspired by the nature's elaborated way, we found that even mononucleotides (G and C) can form the minimal G x C Watson-Crick pair in water by simply providing a synthetic cavity that efficiently shields the Watson-Crick H-bonding sites. The minimal Watson-Crick structure in water was elucidated by NMR study and firmly characterized by crystallographic analysis. The crystal structure also displays that, within the cavity, coencapsulated anions and solvents efficiently mediate the minimal G x C Watson-Crick pair formation. Furthermore, the competition experiments with the other nucleobases clearly revealed the evident selectivity for the G x C base pairing in water. These results show the fact that a H-bonded nucleobase pair was effectively induced and stabilized in the local environment of an artificial hydrophobic cavity.

Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression.

PubMed

Chen, Yanguang

2016-01-01

In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson's statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China's regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test.

The development of ensemble theory. A new glimpse at the history of statistical mechanics

NASA Astrophysics Data System (ADS)

Inaba, Hajime

2015-12-01

This paper investigates the history of statistical mechanics from the viewpoint of the development of the ensemble theory from 1871 to 1902. In 1871, Ludwig Boltzmann introduced a prototype model of an ensemble that represents a polyatomic gas. In 1879, James Clerk Maxwell defined an ensemble as copies of systems of the same energy. Inspired by H.W. Watson, he called his approach "statistical". Boltzmann and Maxwell regarded the ensemble theory as a much more general approach than the kinetic theory. In the 1880s, influenced by Hermann von Helmholtz, Boltzmann made use of ensembles to establish thermodynamic relations. In Elementary Principles in Statistical Mechanics of 1902, Josiah Willard Gibbs tried to get his ensemble theory to mirror thermodynamics, including thermodynamic operations in its scope. Thermodynamics played the role of a "blind guide". His theory of ensembles can be characterized as more mathematically oriented than Einstein's theory proposed in the same year. Mechanical, empirical, and statistical approaches to foundations of statistical mechanics are presented. Although it was formulated in classical terms, the ensemble theory provided an infrastructure still valuable in quantum statistics because of its generality.

Volume Estimates in Chronic Hemodialysis Patients by the Watson Equation and Bioimpedance Spectroscopy and the Impact on the Kt/Vurea calculation.

PubMed

Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B

2018-01-01

Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P < .001). Despite the high correlation, the Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist circumference (general and abdominal obesity) were correlated with the greater TBW overestimation by the Watson formula. We created separate equations for men and women based on weight and waist circumference. The main limitation of our study was the lack of an external validation for our novel estimating equation. Furthermore, though BIS has been validated against traditional reference standards, our assumption that it represents the "gold standard" for body compartment assessment may be flawed. The Watson formula generally overestimates TBW in chronic dialysis recipients, particularly in patients with the highest waist circumference. Widespread reliance on the Watson formula for derivation of TBW may lead to the underestimation of Kt/V urea. .

77 FR 13683 - Government/Industry Aeronautical Charting Forum Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-07

.... Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance & Regulatory..., on February 28, 2012. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum. [FR Doc. 2012-5293...

Conformational analysis of a covalently cross-linked Watson-Crick base pair model.

PubMed

Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J

2008-11-15

Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.

Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

DTIC Science & Technology

2008-07-11

Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

Recognition of Watson-Crick base pairs: constraints and limits due to geometric selection and tautomerism

PubMed Central

Yusupov, Marat; Yusupova, Gulnara

2014-01-01

The natural bases of nucleic acids have a strong preference for one tautomer form, guaranteeing fidelity in their hydrogen bonding potential. However, base pairs observed in recent crystal structures of polymerases and ribosomes are best explained by an alternative base tautomer, leading to the formation of base pairs with Watson-Crick-like geometries. These observations set limits to geometric selection in molecular recognition of complementary Watson-Crick pairs for fidelity in replication and translation processes. PMID:24765524

78 FR 12415 - Government/Industry Aeronautical Charting Forum Meeting

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-22

... Valerie S. Watson, FAA, National Aeronautical Navigation Products (AeroNav Products), Quality Assurance.... Issued in Washington, DC, on February 19, 2013. Valerie S. Watson, Co-Chair, Aeronautical Charting Forum...

Genetics Home Reference: Alagille syndrome

MedlinePlus

... my area? Other Names for This Condition Alagille-Watson Syndrome Alagille's syndrome arteriohepatic dysplasia (AHD) cardiovertebral syndrome ... hypoplasia hepatofacioneurocardiovertebral syndrome paucity of interlobular bile ducts Watson-Miller syndrome Related Information How are genetic conditions ...

20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

20. VIEW OF WATSON STILHMAN DISMOUNTING WHEEL PRESS. 600 tons. Gary Stich, operator. - Juniata Shops, Erecting Shop & Machine Shop, East of Fourth Avenue, between Fourth & Fifth Streets, Altoona, Blair County, PA

Replication infidelity via a mismatch with Watson-Crick geometry.

PubMed

Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A

2011-02-01

In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.

IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.

PubMed

Chen, Ying; Elenee Argentinis, J D; Weber, Griff

2016-04-01

Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

27 CFR 9.137 - Grand Valley.

Code of Federal Regulations, 2010 CFR

2010-04-01

... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

76 FR 53924 - Merchant Mariner Medical Advisory Committee

Federal Register 2010, 2011, 2012, 2013, 2014

2011-08-30

... and swearing in of the new members; (3) Remarks from Coast Guard Leadership, Rear Admiral J. A. Watson.../presentations; and (3) Closing remarks/plans for next meeting. Dated: August 24, 2011. J. A. Watson, Rear...

27 CFR 9.137 - Grand Valley.

Code of Federal Regulations, 2013 CFR

2013-04-01

... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

27 CFR 9.137 - Grand Valley.

Code of Federal Regulations, 2011 CFR

2011-04-01

... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

27 CFR 9.137 - Grand Valley.

Code of Federal Regulations, 2014 CFR

2014-04-01

... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

27 CFR 9.137 - Grand Valley.

Code of Federal Regulations, 2012 CFR

2012-04-01

... then a southerly direction along the 5000-foot contour line to its intersection with Watson Creek in section 12, T. 1 S., R. 2 E.; (5) Thence in a southeasterly direction along Watson Creek to its...

77 FR 40947 - Motor Carrier Safety Advisory Committee (MCSAC): Membership Solicitation

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-11

.... Shannon L. Watson, Senior Advisor to the Associate Administrator for Policy, Federal Motor Carrier Safety....fmcsa.dot.gov/ , completed on-line and emailed to Shannon L. Watson, Senior Advisor to the Associate...

75 FR 63509 - Notice of Determinations Regarding Eligibility To Apply for Worker Adjustment Assistance

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-15

.... Products LLC. 74,606 Watson Laboratories, Inc., Carmel, NY September 3, 2009. Watson Pharmaceuticals...--Enterprise Services), Virtual Workers Across the United States. 74,343 JohnsonDiversey Santa Cruz, CA...

Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

DTIC Science & Technology

2008-01-01

C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

Direct NMR Evidence that Transient Tautomeric and Anionic States in dG·dT Form Watson-Crick-like Base Pairs.

PubMed

Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M

2017-03-29

The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.

How Many Cancers Are Linked with HPV Each Year?

MedlinePlus

... 24:1548–1556. 3 Viens LJ, Henley SJ, Watson M, Markowitz LE, Thomas CC, Thompson TD, Razzaghi ... Lynch CF, Hernandez BY, Lyu CW, Steinau M, Watson M, Wilkinson EJ, Hopenhayn C, Copeland G, Cozen ...

Annual Quality Assurance Conference Files by Nicola Watson and Rui Li

EPA Pesticide Factsheets

26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li

21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 049185 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Olney Ave., Cherry Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880...

21 CFR 510.600 - Names, addresses, and drug labeler codes of sponsors of approved applications.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 50704 017139 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000402 Wayne Feed Division... Hill, NJ 08034. 000402 Watson Laboratories, Inc., 311 Bonnie Circle, Corona, CA 92880. 000842 Texas...

Commentary on Malone: Who Founded Behaviorism?

PubMed

Reese, Hayne W

2015-05-01

Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.

Artificial intelligence in neurodegenerative disease research: use of IBM Watson to identify additional RNA-binding proteins altered in amyotrophic lateral sclerosis.

PubMed

Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert

2018-02-01

Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.

77 FR 54577 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-05

..., Dallas, Texas 75201-2272: 1. Rebecca Watson Vizard, St. Joseph Louisiana; Michael Rene Vizard, St. Joseph... William Wade Watson, St. Joseph, Louisiana, (collectively known as the ``Vizard Family Group'') to retain...

Silver(I)-Mediated Base Pairs in DNA Sequences Containing 7-Deazaguanine/Cytosine: towards DNA with Entirely Metallated Watson-Crick Base Pairs.

PubMed

Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A

2018-03-26

DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Exploring the experiences of EU qualified doctors working in the United Kingdom: a qualitative study.

PubMed

Legido-Quigley, Helena; Saliba, Vanessa; McKee, Martin

2015-04-01

This qualitative study of 23 doctors from other EU member states working in the UK highlights that, contrary to media reports, doctors from other member states working in the UK were well prepared and their main motivation to migrate was to learn new skills and experience a new health care system. Interviewees highlighted some aspects of their employment that work well and others that need improving. Some interviewees reported initially having language problems, but most noted that this was resolved after a few months. These doctors overwhelmingly reported having very positive experiences with patients, enjoying a NHS structure that was less hierarchical structure than in their home systems, and appreciating the emphasis on evidence-based medicine. Interviewees mostly complained about the lack of cleanliness of hospitals and gave some examples of risk to patient safety. Interviewees did not experience discrimination other than some instances of patronising and snobbish behaviour. However, a few believed that their nationality was a block to achieving senior positions. Overall, interviewees reported having enjoyable experiences with patients and appreciating what the NHS had to offer. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

'This is ordinary behaviour': categorization and culpability in Hamas leaders' accounts of the Palestinian/Israeli conflict.

PubMed

McKinlay, Andy; McVittie, Chris; Sambaraju, Rahul

2012-12-01

The present paper examines the talk of three senior figures from the Palestinian Hamas political movement. Data are drawn from a series of journalistic interviews that were conducted in the months leading up to the invasion of Gaza by Israel in December 2007. Using membership categorization analysis, we explore the membership categories and category-bound attributes that interviewers use in questions about responsibility for potentially culpable actions and the ways that these are taken up, challenged, or reworked by interviewees in presenting their own versions. The analytic findings show that interviewers deploy categories bound up with terrorism while interviewees develop alternative categorizations of resistance. Interviewers construct Palestinians as victims of Hamas' actions while interviewees construct them as victims of Israeli aggression and international indifference. In warranting these alternative constructions, the interviewees contrast current behaviours of the international community with those of the past and align current Palestinian actions with those previously taken by Western nations in resisting illegitimate occupations. Through these descriptions of categories and actions, the interviewees attribute to the wider international community responsibility for addressing the events of the ongoing conflict. ©2011 The British Psychological Society.

Oncologists partner with Watson on genomics.

PubMed

2015-08-01

A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.

Algebraic Methods to Design Signals

DTIC Science & Technology

2015-08-27

sequence pairs with optimal correlation values. 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially balanced incomplete block designs with two...IEEE Transactions Information Theory, Volume: 58, Issue: 11, Nov 2012, Page(s): 6968 – 6978 5. K.T. Arasu, Pradeep Bansal , Cody Watson, Partially

Role of Physical Attractiveness in Peer Attribution of Psychological Disturbance

ERIC Educational Resources Information Center

Cash, Thomas F.; And Others

1977-01-01

The physical attractiveness stereotype was examined as it pertains to the attribution of psychological disturbance among peers. Consistent with the stereotype, attractive interviewees were judged as less disturbed with better prognosis than unattractive interviewees. (Author)

Managing and creating an image in the interview: the role of interviewee initial impressions.

PubMed

Swider, Brian W; Barrick, Murray R; Harris, T Brad; Stoverink, Adam C

2011-11-01

In employment interviews, individuals use impression management tactics to present themselves as suitable candidates to interviewers. However, not all impression management tactics, or the interviewees who employ them, are effective at positively influencing interview scores. Results of this study indicate that the relationship between impression management tactic usage and interview success is contingent on the type of tactic employed. Specifically, self-promotion was found to have a positive relationship (r = .20) and slight (r = -.11) and extensive (r = -.19) image creation were found to have negative relationships with end-of-interview scores. Further, the relationships between these 3 impression management tactics were moderated by interviewees' initial impressions of the interview (ΔR² ranged from .04 to .10). Interviewees who perceived they were seen as less suitable during rapport building were more effective when using any of the 3 impression management tactics. (c) 2011 APA, all rights reserved.

Riemann tensor of motion vision revisited.

PubMed

Brill, M

2001-07-02

This note shows that the Riemann-space interpretation of motion vision developed by Barth and Watson is neither necessary for their results, nor sufficient to handle an intrinsic coordinate problem. Recasting the Barth-Watson framework as a classical velocity-solver (as in computer vision) solves these problems.

Making IBM's Computer, Watson, Human

PubMed Central

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial “self,” are all incidental to its humanity. PMID:22942530

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geltman, S.

Recent measurements on CO{sub 2}-laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for {ital E}{sub 0}/2{omega}{sup 2}{lt}1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations inmore » perturbation theory shows that use of the {open_quote}{open_quote}outgoing{close_quote}{close_quote} wave final state gives much better agreement with experiment than does the {open_quote}{open_quote}ingoing{close_quote}{close_quote} wave final state, which is different from the choice made in early bremsstrahlung theory. {copyright} {ital 1996 The American Physical Society.}« less

On how Watson and Crick discovered what Watson and Crick had suggested: the "folk" concept of discovery rediscovered.

PubMed

Charpa, Ulrich

2008-01-01

This article opens with general and historical remarks on philosophy of science's problems with the concept of discovery. Then, drawing upon simple examples of Watson's and Crick's non-philosophical usage, I characterize phrases of the type "x discovers y" semantically. It will subsequently be shown how widespread philosophical discussion on discovery violates the semantic constraints of phrases of the type "x discovers y." Then I provide a philosophical reconstruction of "x discovers y" that is in keeping with the "folk" notion of discovery. The philosophical ingredients of this approach are taken from a certain aspect of action theory and from epistemological reliabilism. The approach draws upon the concept of superior action and connects this concept to progressive research. In contrast to normal actions, superior actions are primarily explained by competencies. This perspective includes reminders of what some nineteenth-century philosopher-scientists had advocated as a competence-oriented view on scientific research. Finally, this approach is applied to the case of Watson's and Crick's discovery.

Comparable stability of Hoogsteen and Watson-Crick base pairs in ionic liquid choline dihydrogen phosphate.

PubMed

Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki

2014-01-08

The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.

Making IBM's Computer, Watson, Human.

PubMed

Rachlin, Howard

2012-01-01

This essay uses the recent victory of an IBM computer (Watson) in the TV game, Jeopardy, to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered and rejected. The viewpoint of the essay is that of teleological behaviorism. Mental states are defined as temporally extended patterns of overt behavior. From this viewpoint (although Watson does not currently have them), essential human attributes such as consciousness, the ability to love, to feel pain, to sense, to perceive, and to imagine may all be possessed by a computer. Most crucially, a computer may possess self-control and may act altruistically. However, the computer's appearance, its ability to make specific movements, its possession of particular internal structures (e.g., whether those structures are organic or inorganic), and the presence of any nonmaterial "self," are all incidental to its humanity.

Morphology, antigenicity, and nucleic acid content of the Bacteroides sp. used in the culture of Entamoeba histolytica.

PubMed

Albach, R A; Shaffer, J G; Watson, R H

1965-10-01

Albach, Richard A. (Lutheran General Hospital, Park Ridge, Ill.), James G. Shaffer, and Robert H. Watson. Morphology, antigenicity, and nucleic acid content of the Bacteroides sp. used in the culture of Entamoeba histolytica. J. Bacteriol. 90:1045-1053. 1965.-Certain changes in morphology, antigenicity, and nucleic acid content that occur in a culture of Bacteroides sp. in the presence of penicillin G in CLG medium are described. This "variant" is one of seven recovered in several laboratories, all of which are descendants of the original Bacteroides isolated by Shaffer and Frye. Penicillin-inhibited cells of this culture are currently being used in the routine propagation of Entamoeba histolytica in CLG medium. Evidence is presented for the loss of ability to react with antibody in these penicillin-inhibited bacteria in CLG medium, when studied by fluorescent-antibody techniques. The implications of the antigenic changes observed as they pertain to similar antigenic studies of the amoebas are discussed. A pronounced reduction in the ribonucleic acid (RNA) content of such penicillin-inhibited cells was also observed. The potential importance of the changes that occur in the RNA of these cells with respect to considerations of the growth requirements of the amoebas is also discussed.

Crystal structure of an intermolecular 2:1 complex between adenine and thymine. Evidence for both Hoogsteen and 'quasi-Watson-Crick' interactions.

PubMed

Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru

2010-06-15

The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.

Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.

PubMed

Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika

2017-07-01

The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.

Critical Thinking in Adulthood.

ERIC Educational Resources Information Center

Fulton, Rodney D.

Critical thinking is often defined as that which a particular instrument measures. The most prominent tests are the Watson-Glaser Critical Thinking Appraisal, the Ennis-Weir Critical Thinking Essay Test, and the Cornell Critical Thinking Tests. Watson and Glaser's (1980) view of critical thinking is "a composite of attitudes, knowledge, and…

Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York

EPA Pesticide Factsheets

IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti

[From humanism to nihilism: dialectics on Jean Watson's caring theory].

PubMed

Krol, Pawel J; Lavoie, Mireille

2015-09-01

nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.

The role of the body in end-stage kidney disease in young adults: Gender, peer and intimate relationships.

PubMed

Lewis, Helen; Arber, Sara

2015-09-01

To understand how the physical body, and changes in the physical body, influence peer and intimate relationships and parenting in young adults on renal replacement therapies (RRT). Qualitative interview data from 40 young adults aged 16-30 years with end-stage kidney disease (ESKD), first diagnosed aged 0-19 years, were analysed using modified grounded theory. Alternating modalities of RRT had a 'yo-yo' effect on the bodies of interviewees, repeatedly reconstructing them as either 'transplanted' bodies, often initially obese, or as 'dialysis' bodies', often underweight. Invisible somatic changes had a major impact on gendered social identity, making intimate social relationships and parenthood problematic. Prepubertal onset interviewees were generally less successful in forming partnerships than those with postpubertal onset; and interviewees on dialysis were likely to postpone partnering until they were transplanted. Social networks were essential for finding a partner, but male interviewees had fewer networks than females. Parenthood was particularly challenging for female interviewees. In ESKD, life-saving RRT brings major changes to the body. These adversely affect social relationships and family formation during the crucial period of early adulthood. Effects vary according to age of onset, RRT modality, and gender, with those who were ill before puberty and those on dialysis worst affected. © The Author(s) 2015.

Behaviorism

ERIC Educational Resources Information Center

Moore, J.

2011-01-01

Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…

Does Size Matter?

ERIC Educational Resources Information Center

Watson, David

2014-01-01

In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…

Extreme Scale Computing Studies

DTIC Science & Technology

2010-12-01

PUBLICATION IN ACCORDANCE WITH ASSIGNED DISTRIBUTION STATEMENT. *//Signature// //Signature// KERRY HILL, Program Manager BRADLEY J ...Research Institute William Carlson Institute for Defense Analyses William Dally Stanford University Monty Denneau IBM T. J . Watson Research...for Defense Analyses William Dally, Stanford University Monty Denneau, IBM T. J . Watson Research Laboratories Paul Franzon, North Carolina State

A Challenge to Watson

ERIC Educational Resources Information Center

Detterman, Douglas K.

2011-01-01

Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…

Validating the Watson Glaser Critical Thinking Appraisal

ERIC Educational Resources Information Center

Hassan, Karma El; Madhum, Ghida

2007-01-01

This study validated the Watson Glaser Critical Thinking Appraisal (WGCTA) on a sample of 273 private university students in Lebanon. For that purpose, evidence for construct validation was investigated through identifying the test's factor structure and subscale total correlations, in addition to differences in scores by gender, different levels,…

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

The circumstances of the missing biographer or why Watson didn't narrate these four Sherlock Holmes stories.

PubMed

Caplan, R M

1982-06-01

The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.

Educational Technologists: Leading Change for a New Paradigm of Education

ERIC Educational Resources Information Center

Aslan, Sinem; Reigeluth, Charles M.

2013-01-01

The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…

Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space

ERIC Educational Resources Information Center

Fukawa-Connelly, Timothy Patrick; Newton, Charlene

2014-01-01

Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…

Music Technology and Musical Creativity: Making Connections

ERIC Educational Resources Information Center

Thompson, Douglas Earl

2012-01-01

This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…

Bringing Precision Medicine to Community Oncologists.

PubMed

2017-01-01

Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.

Ultraviolet Absorption Induces Hydrogen-Atom Transfer in G⋅C Watson-Crick DNA Base Pairs in Solution.

PubMed

Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M

2015-12-01

Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DFT investigation of the vibrational properties of GC Watson-Crick and Hoogsteen base pairs in the presence of Mg²⁺, Ca²⁺, and Cu²⁺ ions.

PubMed

Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian

2014-04-01

The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.

Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.

PubMed

Kryachko, E S; Remacle, F

2005-12-08

The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.

Automated problem list generation and physicians perspective from a pilot study.

PubMed

Devarakonda, Murthy V; Mehta, Neil; Tsou, Ching-Huei; Liang, Jennifer J; Nowacki, Amy S; Jelovsek, John Eric

2017-09-01

An accurate, comprehensive and up-to-date problem list can help clinicians provide patient-centered care. Unfortunately, problem lists created and maintained in electronic health records by providers tend to be inaccurate, duplicative and out of date. With advances in machine learning and natural language processing, it is possible to automatically generate a problem list from the data in the EHR and keep it current. In this paper, we describe an automated problem list generation method and report on insights from a pilot study of physicians' assessment of the generated problem lists compared to existing providers-curated problem lists in an institution's EHR system. The natural language processing and machine learning-based Watson 1 method models clinical thinking in identifying a patient's problem list using clinical notes and structured data. This pilot study assessed the Watson method and included 15 randomly selected, de-identified patient records from a large healthcare system that were each planned to be reviewed by at least two internal medicine physicians. The physicians created their own problem lists, and then evaluated the overall usefulness of their own problem lists (P), Watson generated problem lists (W), and the existing EHR problem lists (E) on a 10-point scale. The primary outcome was pairwise comparisons of P, W, and E. Six out of the 10 invited physicians completed 27 assessments of P, W, and E, and in process evaluated 732 Watson generated problems and 444 problems in the EHR system. As expected, physicians rated their own lists, P, highest. However, W was rated higher than E. Among 89% of assessments, Watson identified at least one important problem that physicians missed. Cognitive computing systems like this Watson system hold the potential for accurate, problem-list-centered summarization of patient records, potentially leading to increased efficiency, better clinical decision support, and improved quality of patient care. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

DNA base dimers are stabilized by hydrogen-bonding interactions including non-Watson-Crick pairing near graphite surfaces.

PubMed

Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain

2012-10-11

Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.

WATSON: Detecting organic material in subsurface ice using deep-UV fluorescence and Raman spectroscopy

NASA Astrophysics Data System (ADS)

Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.

2017-12-01

Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as analysis of ice cores obtained during the deployment and returned for subsequent study.

Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.

PubMed

Müller, Andreas; Frey, Jann A; Leutwyler, Samuel

2005-06-16

The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 <-- S0 vibronic spectra of 2PY.U, 2PY.3MU, 2PY.1MU, and 2PY.T were measured using UV laser resonant two-photon ionization (R2PI). The spectra of the Watson-Crick and wobble isomers of 2PY.1MU were separated using UV-UV spectral hole-burning. We identify the different isomers by combining three different diagnostic tools: (1) Selective methylation of the uracil N3-H group, which allows formation of the sugar-edge isomer only, and methylation of the N1-H group, which leads to formation of the Watson-Crick and wobble isomers. (2) The experimental S1 <-- S0 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.

41 CFR 301-75.201 - May we allow the interviewee to use individual Government contractor-issued charge cards for pre...

Code of Federal Regulations, 2010 CFR

2010-07-01

... interviewee to use individual Government contractor-issued charge cards for pre-employment interview travel... System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES AGENCY RESPONSIBILITIES 75-PRE-EMPLOYMENT INTERVIEW TRAVEL... individual Government contractor-issued charge cards for pre-employment interview travel? No. ...

Managing and Creating an Image in the Interview: The Role of Interviewee Initial Impressions

ERIC Educational Resources Information Center

Swider, Brian W.; Barrick, Murray R.; Harris, T. Brad; Stoverink, Adam C.

2011-01-01

In employment interviews, individuals use impression management tactics to present themselves as suitable candidates to interviewers. However, not all impression management tactics, or the interviewees who employ them, are effective at positively influencing interview scores. Results of this study indicate that the relationship between impression…

A Dialect Survey of the Appalachian Region. Final Report.

ERIC Educational Resources Information Center

Qazilbash, A. Hussain

To determine the linguistic structure of the Appalachian region, 9 interviewees from each of 13 states (Alabama, Georgia, Mississippi, Maryland, New York, Kentucky, North Carolina, Ohio, Pennsylvania, South Carolina, Tennessee, Virginia, and West Virginia) were chosen by selected criteria. The interviewees were classified as rustic, modern, and…

Influence of Model's Race and Sex on Interviewees' Self-Disclosure.

ERIC Educational Resources Information Center

Casciani, Joseph M.

1978-01-01

Examined how a model's personal characteristics and disclosure characteristics affect White interviewees' self-disclosures. Validity of Jourard's Self-Disclosure Questionnaire was investigated. Results showed that the model's race did not affect his/her behavior or ratings of models. Self-Disclosure Questionnaire showed subjects would disclose as…

Thermodynamic stability of Hoogsteen and Watson-Crick base pairs in the presence of histone H3-mimicking peptide.

PubMed

Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki

2011-03-14

We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.

Development of a New Critical Thinking Test Using Item Response Theory

ERIC Educational Resources Information Center

Wagner, Teresa A.; Harvey, Robert J.

2006-01-01

The authors describe the initial development of the Wagner Assessment Test (WAT), an instrument designed to assess critical thinking, using the 5-faceted view popularized by the Watson-Glaser Critical Thinking Appraisal (WGCTA; G. B. Watson & E. M. Glaser, 1980). The WAT was designed to reduce the degree of successful guessing relative to the…

Watson for Genomics: Moving Personalized Medicine Forward.

PubMed

Rhrissorrakrai, Kahn; Koyama, Takahiko; Parida, Laxmi

2016-08-01

The confluence of genomic technologies and cognitive computing has brought us to the doorstep of widespread usage of personalized medicine. Cognitive systems, such as Watson for Genomics (WG), integrate massive amounts of new omic data with the current body of knowledge to assist physicians in analyzing and acting on patient's genomic profiles. Copyright © 2016 Elsevier Inc. All rights reserved.

Racial Identification and Audience in "Roll of Thunder, Hear My Cry" and "The Watsons Go to Birmingham--1963"

ERIC Educational Resources Information Center

Barker, Jani L.

2010-01-01

Multiethnic children's literature addresses multiple audiences, providing different reading experiences and benefits for each. Using critical race theory as an interpretive tool, this article examines how two African American historical fiction novels, Mildred Taylor's "Roll of Thunder, Hear My Cry" and Christopher Paul Curtis's "The Watsons Go to…

Watson-Glaser Critical Thinking Appraisal, Form-S for Education Majors

ERIC Educational Resources Information Center

Gadzella, Bernadette M.; Stacks, James; Stephens, Rebecca C.; Masten, William G.

2005-01-01

The purpose of this study was to investigate whether the Watson-Glaser Critical Thinking Appraisal-Form S was a reliable and valid instrument to measure critical thinking for students pursuing a teacher career. The participants were 137 students enrolled in Educational Psychology. The data showed that the alpha for the total WGTA-FS was 0.76 and…

Finding Little Albert: A Journey to John B. Watson's Infant Laboratory

ERIC Educational Resources Information Center

Beck, Hall P.; Levinson, Sharman; Irons, Gary

2009-01-01

In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…

The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.

ERIC Educational Resources Information Center

Hicks, R. E.; Southey, G. N.

1990-01-01

The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)

Hydration of Watson-Crick base pairs and dehydration of Hoogsteen base pairs inducing structural polymorphism under molecular crowding conditions.

PubMed

Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki

2009-03-18

It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.

Crick's gossip test and Watson's boredom principle: A pseudo-mathematical analysis of effort in scientific research.

PubMed

Charlton, Bruce G

2008-01-01

Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.

Base pairing and base mis-pairing in nucleic acids

NASA Technical Reports Server (NTRS)

Wang, A. H. J.; Rich, A.

1986-01-01

In recent years we have learned that DNA is conformationally active. It can exist in a number of different stable conformations including both right-handed and left-handed forms. Using single crystal X-ray diffraction analysis we are able to discover not only additional conformations of the nucleic acids but also different types of hydrogen bonded base-base interactions. Although Watson-Crick base pairings are the predominant type of interaction in double helical DNA, they are not the only types. Recently, we have been able to examine mismatching of guanine-thymine base pairs in left-handed Z-DNA at atomic resolution (1A). A minimum amount of distortion of the sugar phosphate backbone is found in the G x T pairing in which the bases are held together by two hydrogen bonds in the wobble pairing interaction. Because of the high resolution of the analysis we can visualize water molecules which fill in to accommodate the other hydrogen bonding positions in the bases which are not used in the base-base interactions. Studies on other DNA oligomers have revealed that other types of non-Watson-Crick hydrogen bonding interactions can occur. In the structure of a DNA octamer with the sequence d(GCGTACGC) complexed to an antibiotic triostin A, it was found that the two central AT base pairs are held together by Hoogsteen rather than Watson-Crick base pairs. Similarly, the G x C base pairs at the ends are also Hoogsteen rather than Watson-Crick pairing. Hoogsteen base pairs make a modified helix which is distinct from the Watson-Crick double helix.

An analytical and numerical study of Galton-Watson branching processes relevant to population dynamics

NASA Astrophysics Data System (ADS)

Jang, Sa-Han

Galton-Watson branching processes of relevance to human population dynamics are the subject of this thesis. We begin with an historical survey of the invention of the invention of this model in the middle of the 19th century, for the purpose of modelling the extinction of unusual surnames in France and Britain. We then review the principal developments and refinements of this model, and their applications to a wide variety of problems in biology and physics. Next, we discuss in detail the case where the probability generating function for a Galton-Watson branching process is a geometric series, which can be summed in closed form to yield a fractional linear generating function that can be iterated indefinitely in closed form. We then describe the matrix method of Keyfitz and Tyree, and use it to determine how large a matrix must be chosen to model accurately a Galton-Watson branching process for a very large number of generations, of the order of hundreds or even thousands. Finally, we show that any attempt to explain the recent evidence for the existence thousands of generations ago of a 'mitochondrial Eve' and a 'Y-chromosomal Adam' in terms of a the standard Galton-Watson branching process, or indeed any statistical model that assumes equality of probabilities of passing one's genes to one's descendents in later generations, is unlikely to be successful. We explain that such models take no account of the advantages that the descendents of the most successful individuals in earlier generations enjoy over their contemporaries, which must play a key role in human evolution.

New Interview and Observation Measures of the Broader Autism Phenotype: Impressions of Interviewee Measure

ERIC Educational Resources Information Center

Pickles, A.; Parr, J. R.; Rutter, M. L.; De Jonge, M. V.; Wallace, S.; Le Couteur, A. S.; van Engeland, H.; Wittemeyer, K.; McConachie, H.; Roge, B.; Mantoulan, C.; Pedersen, L.; Isager, T.; Poustka, F.; Bolte, S.; Bolton, P.; Weisblatt, E.; Green, J.; Papanikolaou, K.; Bailey, A. J.

2013-01-01

A 20 item observational measure of social functioning, the Impression of Interviewee rating scale, is one of three measures devised to assess the broader autism phenotype. The sample studied included families containing at least two individuals with autism spectrum disorder; observations were undertaken by the researcher who interviewed the…

Conceptions and Contexts: On the Interpretation of Interview and Observational Data

ERIC Educational Resources Information Center

Hallden, Ola; Haglund, Liza; Stromdahl, Helge

2007-01-01

Research within a constructivist approach often relies on interview data, which are used to reveal beliefs held by the interviewee or to expose conceptions or conceptual structures that are supposed to reside within the interviewee. From a sociocultural perspective, severe criticism has been leveled against the neglect of the problems of inferring…

Exploring commonality and difference in in-depth interviewing: a case-study of researching British Asian women.

PubMed

Ramji, Hasmita

2008-03-01

This paper draws on the experience of researching British South Asian women's lives in London as a female British Asian researcher to explore how cultural commonality and difference is shaped by agency and interaction in the research process. It examines these issues through a discussion of how the shared cultural identity of the researcher and the interviewees emerged as both a point of commonality and difference in the research process; with the researcher being ;positioned' in terms of both as a result of the interviewees' agency in interpreting their cultural commonality. In particular, issues of 'Indianness' and religion emerged as points on which interviewees exercised agency and interpreted the researcher's cultural identity. This was the basis on which they claimed commonality or difference and this assessment consequently impacted on their interaction with the researcher. The article suggests that more attention needs to be given to how assumptions made by interviewees regarding the cultural identity of the researcher through their agency and interaction in the research process shapes interview dynamics.

Various extraction methods influence the adhesive properties of DDGS .... pennycress (Thlaspi arvense L.) and lesquerella (Lesquerella fendleri A. Gary (S. Watson) in the fabrication of lignocellulosic composites

USDA-ARS?s Scientific Manuscript database

Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...

1400289

NASA Image and Video Library

2014-04-17

Marshall Center Director Patrick Scheuermann and Dr. Lisa Watson-Morgan talk to news media at the April 17 Marshall 2014 Update. Watson-Morgan, the first woman to be named the center's chief engineer, answered questions about progress on the Space Launch System and other projects, and spoke about the importance of attracting young people to science, technology, engineering and mathematics education to maintain a "pipeline" of future engineers.

Assessing the Watson-Barker Listening Test (WBLT)-Form C in Measuring Listening Comprehension of Post-Secondary Hispanic-American Students

ERIC Educational Resources Information Center

Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.

2014-01-01

The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…

[Structural and Dipole Structure Peculiarities of Hoogsteen Base Pairs Formed in Complementary Nucleobases according to ab initio Quantum Mechanics Studies].

PubMed

Petrenko, Y M

2015-01-01

Ab initio quantum mechanics studies for the detection of structure and dipole structure peculiarities of Hoogsteen base pairs relative to Watson-Crick base pairs, were performed during our work. These base pairs are formed as a result of complementary interactions. It was revealed, that adenine-thymine Hoogsteen base pair and adenine-thymine Watson-Crick base pairs can be formed depending on initial configuration. Cytosine-guanine Hoogsteen pairs are formed only when cytosine was originally protonated. Both types of Hoogsteen pairs have noticeable difference in the bond distances and angles. These differences appeared in purine as well as in pyrimidine parts of the pairs. Hoogsteen pairs have mostly shorter hydrogen bond lengths and significantly larger angles of hydrogen bonds and larger angles between the hydrogen bonds than Watson-Crick base pairs. Notable differences are also observed with respect to charge distribution and dipole moment. Quantitative data on these differences are shown in our work. It is also reported that the values of local parameters (according to Cambridge classification of the parameters which determine DNA properties) in Hoogsteen base pairs, are greatly different from Watson-Crick ones.

Examining Current Conceptualizations of Psychopathology With the MMPI-2/MMPI-2-RF Restructured Clinical Scales: Preliminary Findings From a Cross-Cultural Study.

PubMed

Shkalim, Eleanor; Almagor, Moshe; Ben-Porath, Yossef S

2017-01-01

Watson ( 2005 ) proposed a hierarchical reorganization of the underlying structure of emotional disorders. This study cross-culturally evaluated Watson's (2005) structure of mood and anxiety disorders, using mainly dichotomous criteria, and explored the placement of obsessive-compulsive disorder (OCD) in this model. It also tested Sellbom, Ben-Porath, and Bagby's (2008) proposed elaboration of the 2-factor model (positive and negative activation) that incorporates a higher order dimension of demoralization. One hundred men and 133 women from psychiatric settings in Israel completed the Minnesota Multiphasic Personality Inventory-2 (Butcher et al., 2001 ) and the Maudsley Obsessional-Compulsive Inventory (Hodgson & Rachman, 1977 ). They were interviewed using the Mini International Neuropsychiatric Interview (Sheehan et al., 1998 ). Confirmatory factor analyses replicated Watson's structure for women but not for men. Mixed results were obtained regarding OCD's location in the model. Findings among women support the applicability of Watson's (2005) model across a variety of assessment modalities, as well as in a different language and for diversified cultural backgrounds. This conclusion, however, should be tempered in consideration of the results among men. Findings also provide evidence of the importance of demoralization in mood and anxiety disorders.

Spatial Autocorrelation Approaches to Testing Residuals from Least Squares Regression

PubMed Central

Chen, Yanguang

2016-01-01

In geo-statistics, the Durbin-Watson test is frequently employed to detect the presence of residual serial correlation from least squares regression analyses. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the test will be ineffectual because the value of Durbin-Watson’s statistic depends on the sequence of data points. This paper develops two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran’s index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then by analogy with the Durbin-Watson statistic, two types of new serial correlation indices are constructed. As a case study, the two newly presented statistics are applied to a spatial sample of 29 China’s regions. These results show that the new spatial autocorrelation models can be used to test the serial correlation of residuals from regression analysis. In practice, the new statistics can make up for the deficiencies of the Durbin-Watson test. PMID:26800271

Understanding the impact of genetic testing for inherited retinal dystrophy

PubMed Central

Combs, Ryan; McAllister, Marion; Payne, Katherine; Lowndes, Jo; Devery, Sophie; Webster, Andrew R; Downes, Susan M; Moore, Anthony T; Ramsden, Simon; Black, Graeme; Hall, Georgina

2013-01-01

The capability of genetic technologies is expanding rapidly in the field of inherited eye disease. New genetic testing approaches will deliver a step change in the ability to diagnose and extend the possibility of targeted treatments. However, evidence is lacking about the benefits of genetic testing to support service planning. Here, we report qualitative data about retinal dystrophy families' experiences of genetic testing in United Kingdom. The data were part of a wider study examining genetic eye service provision. Twenty interviewees from families in which a causative mutation had been identified by a genetic eye clinic were recruited to the study. Fourteen interviewees had chosen to have a genetic test and five had not; one was uncertain. In-depth telephone interviews were conducted allowing a thorough exploration of interviewees' views and experiences of the benefits of genetic counselling and testing. Transcripts were analysed using thematic analysis. Both affected and unaffected interviewees expressed mainly positive views about genetic testing, highlighting benefits such as diagnostic confirmation, risk information, and better preparation for the future. Negative consequences included the burden of knowledge, moral dilemmas around reproduction, and potential impact on insurance. The offer of genetic testing was often taken up, but was felt unnecessary in some cases. Interviewees in the study reported many benefits, suggesting genetic testing should be available to this patient group. The benefits and risks identified will inform future evaluation of models of service delivery. This research was part of a wider study exploring experiences of families with retinal dystrophy. PMID:23403902

Understanding the impact of genetic testing for inherited retinal dystrophy.

PubMed

Combs, Ryan; McAllister, Marion; Payne, Katherine; Lowndes, Jo; Devery, Sophie; Webster, Andrew R; Downes, Susan M; Moore, Anthony T; Ramsden, Simon; Black, Graeme; Hall, Georgina

2013-11-01

The capability of genetic technologies is expanding rapidly in the field of inherited eye disease. New genetic testing approaches will deliver a step change in the ability to diagnose and extend the possibility of targeted treatments. However, evidence is lacking about the benefits of genetic testing to support service planning. Here, we report qualitative data about retinal dystrophy families' experiences of genetic testing in United Kingdom. The data were part of a wider study examining genetic eye service provision. Twenty interviewees from families in which a causative mutation had been identified by a genetic eye clinic were recruited to the study. Fourteen interviewees had chosen to have a genetic test and five had not; one was uncertain. In-depth telephone interviews were conducted allowing a thorough exploration of interviewees' views and experiences of the benefits of genetic counselling and testing. Transcripts were analysed using thematic analysis. Both affected and unaffected interviewees expressed mainly positive views about genetic testing, highlighting benefits such as diagnostic confirmation, risk information, and better preparation for the future. Negative consequences included the burden of knowledge, moral dilemmas around reproduction, and potential impact on insurance. The offer of genetic testing was often taken up, but was felt unnecessary in some cases. Interviewees in the study reported many benefits, suggesting genetic testing should be available to this patient group. The benefits and risks identified will inform future evaluation of models of service delivery. This research was part of a wider study exploring experiences of families with retinal dystrophy.

Magnetic Core-Shell Morphology of Structurally Uniform Magnetite Nanoparticles

NASA Astrophysics Data System (ADS)

Krycka, Kathryn

2011-03-01

Magnetic nanoscale structures are intriguing, in part, because of the exotic properties that emerge compared with bulk. The reduction of magnetic moment per atom in magnetite with decreasing nanoparticle size, for example, has been hypothesized to originate from surface disordering to anisotropy-induced radial canting, which are difficult to distinguish using conventional magnetometry. Small-angle neutron scattering (SANS) is ideal for probing structure, both chemical and magnetic, from nm to microns across an ensemble of particles. Adding polarization analysis (PASANS) of the neutron spin orientation before and after interaction with the scattering particles allows the magnetic structure to be separated into its vector components. Application of this novel technique to 9 nm magnetite nanoparticles closed-packed into face-centered crystallites with order of a micron revealed that at nominal saturation the missing magnetic moments unexpectedly interacted to form well-ordered shells 1.0 to 1.5 nm thick canted perpendicular to their ferrimagnetic cores between 160 to 320 K. These shells additionally displayed intra-particle ``cross-talk'', selecting a common orientation over clusters of tens of nanoparticles. However, the shells disappeared when the external field was removed and interparticle magnetic interactions were negligible (300 K), confirming their magnetic origin. This work has been carried out in collaboration with Ryan Booth, Julie Borchers, Wangchun Chen, Liv Dedon, Thomas Gentile, Charles Hogg, Yumi Ijiri, Mark Laver, Sara Majetich, James Rhyne, and Shannon Watson.

41 CFR 301-75.103 - What are our responsibilities when we authorize an interviewee to use common carrier...

Code of Federal Regulations, 2010 CFR

2010-07-01

... interview travel? 301-75.103 Section 301-75.103 Public Contracts and Property Management Federal Travel Regulation System TEMPORARY DUTY (TDY) TRAVEL ALLOWANCES AGENCY RESPONSIBILITIES 75-PRE-EMPLOYMENT INTERVIEW TRAVEL Travel Expenses § 301-75.103 What are our responsibilities when we authorize an interviewee to use...

If Only I Had Known...: Young People's Participation in the Construction of Their Learning Disability Labels

ERIC Educational Resources Information Center

Savaria, Elizabeth; Underwood, Kathryn; Sinclair, Delia

2011-01-01

This study explores how young people participate in the construction of their learning disabilities and how the experience impacts their self-concept. None of the interviewees in the study participated in the Identification Placement and Review Committee (IPRC) meetings conducted in Ontario. The interviewees did participate in a variety of other…

Interviewee Perceptions of Employment Screening Interviews: Relationships among Perceptions of Communication Satisfaction, Interviewer Credibility and Trust, Interviewing Experience, and Interview Outcomes.

ERIC Educational Resources Information Center

Jablin, Fredric M.; And Others

A study examined employment screening interviews to determine the relationships between an interviewee's perceptions of interview communication satisfaction, interviewer credibility and trust, previous interviewing experiences, and a number of interview outcomes, including expectation of a second interview. Data were collected from 69 students…

Use of Edible Laminate Layers in Intermediate Moisture Food Rations to Inhibit Moisture Migration

DTIC Science & Technology

2016-04-29

methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on one side Watson, Inc. Dual-sided HPMC moisture...barrier film Hydroxypropyl methylcellulose, propylene glycol, citric acid, modified starch , white beeswax Water resistant coating on both sides...Moisture Barrier (BWMB) film #1 Pullulan*, beeswax, glycerin, propylene glycol, starch , polysorbate 80 Water soluble Watson, Inc. Pullulan BWMB film

"I May Be Crackin', But Um Fackin": Racial Humor in "The Watsons Go To Birmingham--1963"

ERIC Educational Resources Information Center

McNair, Jonda C.

2008-01-01

This article examines the utilization of racial humor in Christopher Paul Curtis' novel, "The Watsons Go To Birmingham--1963." The theoretical perspectives that inform the analysis include critical race theory and humor theory. The results of the analysis reveal that the use of humor in this book is influenced to a significant degree by race and…

Immersion in the Field: The Elementary Block Network in the Watson College of Education at the University of North Carolina Wilmington

ERIC Educational Resources Information Center

Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian

2014-01-01

In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…

Visual Marking and Change Blindness: Moving Occluders and Transient Masks Neutralize Shape Changes to Ignored Objects

ERIC Educational Resources Information Center

Watson, Derrick G.; Kunar, Melina A.

2010-01-01

Visual search efficiency improves by presenting (previewing) one set of distractors before the target and remaining distractor items (D. G. Watson & G. W. Humphreys, 1997). Previous work has shown that this preview benefit is abolished if the old items change their shape when the new items are added (e.g., D. G. Watson & G. W. Humphreys,…

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

PubMed

Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

2013-06-17

Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A Systems Thinking Framework for Assessing and Addressing Malaria Locally: An Alternative to the Globalization of Anti-Malaria Policies

ERIC Educational Resources Information Center

Willis, Derek W.

2010-01-01

This dissertation analyzes a decision system that was used in the early 1900s in the Federated Malay States (FMS) by Malcolm Watson in order to make anti-malaria program recommendations to decision makers in a wide range of ecological settings. Watson's recommendations to decision makers throughout the FMS led to a dramatic suppression of malaria…

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase ι: Hoogsteen or Watson-Crick base pairing?†

PubMed Central

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-01

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536

Accommodation of an N-(deoxyguanosin-8-yl)-2-acetylaminofluorene adduct in the active site of human DNA polymerase iota: Hoogsteen or Watson-Crick base pairing?

PubMed

Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse

2009-01-13

Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.

Regulating and coping with distress during police interviews of traumatized victims.

PubMed

Risan, Patrick; Binder, Per-Einar; Milne, Rebecca

2016-11-01

The aim of this study was to qualitatively explore approaches to police interviewing of traumatized victims experiencing distress. Specifically, we examined the research question: What do police investigators regard as useful approaches to regulating distress, maintaining rapport and promoting the well-being of the interviewee? To explore processes relevant to the research objective, 21 semistructured interviews were conducted of police investigators who interviewed survivors following the Utøya massacre on July 22, 2011 in Norway. To examine the relationship between the research question and the material, we used thematic analysis based on a reflexive hermeneutic-phenomenological epistemology. Following the analysis, 3 main themes emerged: (1) becoming aware of the interviewees' capacity to cope with distress by attending to nonverbal cues, (2) interviewers communicating acceptance and modeling how to cope with painful emotions, and, (3) regulating distress by responding to the interviewees' emotional needs, helping them to feel safe and promoting the positive. The findings of the study show the importance of relational processes in investigative interviewing of traumatized interviewees, particularly with regard to coping with emotions. The results suggest that if the police investigator who is conducting an investigative interview can offer a trusting, safe and compassionate relationship, or if he or she steers the relational dynamics toward safety in the present moment when distress arises, he or she may facilitate the regulation of distress. We propose that if the interviewee's emotions are managed in this way during the police interview, it may lead to increased rapport and promote psychological health. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Adults' recollections and perceptions of childhood caregiving to a parent with significant physical disability.

PubMed

Iezzoni, Lisa I; Wint, Amy J; Kuhlthau, Karen A; Boudreau, Alexy Arauz

2016-04-01

Caregiving roles of children <18 years of age living with parents with health conditions or disability have been studied extensively abroad, but little U.S. research has examined the caregiving activities and perceptions of children with parents with significant physical disability. To examine children's caregiving activities for their disabled parent, childhood perceptions of these activities, and adult views of this caregiving. We conducted 1-h, semi-structured, open-ended interviews with 20 persons age ≥21 years who as children (age < 18 years) had a parent with significant mobility disability. We used conventional content analysis to identify themes. Interviewees' mean (standard deviation) age was 36.7 (13.8) years; 4 were male. As children, most interviewees assisted their disabled parent with activities of daily living (ADLs) and instrumental ADLs; some children provided more medical supports. Several parents, especially of older interviewees, did not seek their children's care. Interviewees reported both positive and negative childhood attitudes about caregiving. Roughly half recalled as children feeling proud, special, or otherwise positively toward caregiving activities, while about one-third viewed caregiving as just part of their daily reality (i.e., simply needing to be done). Approximately half remembered also feeling resentful, primarily from time demands, insufficient appreciation, and being different from their peers. Interviewees reported gender and cultural factors affecting their caregiving roles and perceptions. Children can provide significant care to parents with physical disability. Understanding better their roles and perceptions could suggest ways to improve these experiences for both child and parent. Copyright © 2016 Elsevier Inc. All rights reserved.

Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.

PubMed

Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M

2015-03-19

Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.

Watson-Crick base pairing controls excited-state decay in natural DNA.

PubMed

Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang

2014-10-13

Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Creating an Effective Multi-Domain Wide-Area Surveillance Platform to Enhance Border Security

DTIC Science & Technology

2008-03-01

SWOT ANALYSIS ........................................................................................43 I. ANALYSIS OF PROS AND CONS ...weaknesses and opportunities and SWOT analysis was also used to build pros and cons for the platform. All the interviewees liked unmanned platforms...because of the reduced night hour’s operations and SWOT analysis was also used to build pros and cons for the platform. All the interviewees really

33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

Code of Federal Regulations, 2010 CFR

2010-07-01

... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

Code of Federal Regulations, 2011 CFR

2011-07-01

... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

Code of Federal Regulations, 2014 CFR

2014-07-01

... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

Code of Federal Regulations, 2012 CFR

2012-07-01

... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

33 CFR 165.761 - Security Zones; Port of Palm Beach, Port Everglades, Port of Miami, and Port of Key West, Florida.

Code of Federal Regulations, 2013 CFR

2013-07-01

... all waters between Watson Park and Star Island on the MacArthur Causeway south to the Port of Miami...′ N, 080°10.92′ W to 25°46.88′ N, 080°10.84′ W, and ending on Watson Park at 25°47.00′ N, 080°10.67′ W...

An indole-linked C8-deoxyguanosine nucleoside acts as a fluorescent reporter of Watson-Crick versus Hoogsteen base pairing.

PubMed

Schlitt, Katherine M; Millen, Andrea L; Wetmore, Stacey D; Manderville, Richard A

2011-03-07

Pyrrole- and indole-linked C(8)-deoxyguanosine nucleosides act as fluorescent reporters of H-bonding specificity. Their fluorescence is quenched upon Watson-Crick H-bonding to dC, while Hoogsteen H-bonding to G enhances emission intensity. The indole-linked probe is ∼ 10-fold brighter and shows promise as a fluorescent reporter of Hoogsteen base pairing.

Optimal Repair And Replacement Policy For A System With Multiple Components

DTIC Science & Technology

2016-06-17

Numerical Demonstration To implement the linear program, we use the Python Programming Language (PSF 2016) with the Pyomo optimization modeling language...opre.1040.0133. Hart, W.E., C. Laird, J. Watson, D.L. Woodruff. 2012. Pyomo–optimization modeling in python , vol. 67. Springer Science & Business...Media. Hart, W.E., J. Watson, D.L. Woodruff. 2011. Pyomo: modeling and solving mathematical programs in python . Mathematical Programming Computation 3(3

Perception of Long-Period Complex Sounds

DTIC Science & Technology

1989-11-27

Richard M. Warren AFOSR Grant No. 88-0320 M CES Guttman, N. & Julesz, B. (1963). Lower limits of auditory periodicity analysis. Journal of the Aostical...order within auditory sequences. Peretion & PsvchobhVsics, 12, 86-90. Watson, C.S., (1987). Uncertainty, informational masking, and the capacity of...immediate memory. In W.A. Yost and C.S. Watson (eds.), Auditory Processing of Camlex Sounds. New Jersey: lawrence Erlbaum Associates, pp. 267-277

33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

Code of Federal Regulations, 2011 CFR

2011-07-01

...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

Code of Federal Regulations, 2013 CFR

2013-07-01

...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

Code of Federal Regulations, 2014 CFR

2014-07-01

...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

33 CFR 162.117 - St. Marys River, Sault Ste. Marie, Michigan.

Code of Federal Regulations, 2012 CFR

2012-07-01

...”—downbound traffic only; (ii) Pipe Island Course from Sweets Point to Watson Reefs Light-downbound traffic... Island Passage to the east of Pipe Island Shoal and north of Pipe Island Twins from Watson Reefs Light to...: (i) Johnson Point from Buoy “18” to Buoy “22”; (ii) Mirre Point from Buoy “26” to Buoy “28”; or (iii...

Oral chemotherapy in paediatric oncology in the UK: problems, perceptions and information needs of parents.

PubMed

Christiansen, Nanna; Taylor, Kevin M G; Duggan, Catherine

2008-10-01

To identify problems, perceptions and information needs of parents and carers regarding oral chemotherapy. Two Paediatric Oncology Centres in the UK. A semi-structured questionnaire was developed in consultation with professionals working within paediatric oncology. Questionnaires were administered in face-to-face interviews with parents of patients attending clinic appointments. Responses to questions were coded and entered into a database for descriptive and inferential analyses. Responses to open questions were coded using simple thematic analysis whereby codes and themes emerged from the data and were compared and contrasted between respondents. Findings were further validated by quotes from interviewees to open questions. Awareness and knowledge of medicines, information needs and handling procedures. Fifty-five interviews were conducted. Most interviewees viewed oral and intravenous chemotherapy as equally important and potent. Three-quarters of parents were aware of the adverse effects chemotherapy could have on them, worryingly three-quarters of the same group of parents did not use all the handling precaution methods advised by health care professionals. Knowledge of acute lymphoblastic leukaemia maintenance treatment was assessed in 47 interviewees; 31 parents were able to explain the reasons for maintenance chemotherapy. Interviewees felt well informed by the hospital and found it easy to access information they needed. The data suggest the majority of parents had a great interest in understanding the disease and treatment, with 91% using the internet to access further information. Three-quarters of parents faced some kind of difficulty when dealing with oral chemotherapy, including problems with the patient not taking the drug, technical and supply problems and problems following the drug regimen. Self-reported compliance in this study was high with 69.1% of interviewees stating they never forgot a single dose. 72.2% of interviewees used a reminder method, of which 81.6% were written reminders. This study highlights that although the support systems offered by the paediatric oncology centres were good, certain areas need improvement, specifically the manner in which parents/carers are educated and informed.

Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing

DTIC Science & Technology

2008-01-01

complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING

Balancing Value and Risk in Information Sharing Through Obfuscation

DTIC Science & Technology

2012-09-20

California, Los Angeles Chatschik Bisdikian IBM T.J. Watson Research Center Lance M. Kaplan US Army Research Laboratory Abstract—Fast-paced data-to...AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) IBM T.J. Watson Research...giving us annotations for both the white listed activity detection as well as the black listed activity recognition . We implemented five features

Neutron Diffraction Investigations of Magnetism in BiFeO3 Epitaxial Films

DTIC Science & Technology

2011-01-01

magnetism;epitaxial thin film;BiFeO3 Daisuke Kan, Wangchun Chen, Shannon Watson, Songxue Chi, Ross Erwin, Garry J. McIntyre, Sylvia C. Capelli, William ...Weinheim 1567wileyonlinelibrary.comAdv. Funct. Mater. 2011, 21, 1567–1574 William Ratcliff II , * Daisuke Kan , * Wangchun Chen , Shannon Watson...15 ] S. W. Lovesey , Theory of Neutron Scattering from Condensed Matter vol. 2 Oxford , New York , 1984 . [ 16 ] W. Gavin Williams

Index of Air Weather Service Technical Publications. Headquarters AWS and Subordinate Units.

DTIC Science & Technology

1982-07-01

Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. 105-48 "Study of Blowing Dust in the 19th Weather...Area," by Capt L. F. Haker , 33p. "Forecasting in the Watson Lake Area," by Capt F. F. Hooper, 28p. "On the Origin and Climatology of Noctilucent

Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes

PubMed Central

Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.

2015-01-01

Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137

Mispairs with Watson-Crick base-pair geometry observed in ternary complexes of an RB69 DNA polymerase variant.

PubMed

Xia, Shuangluo; Konigsberg, William H

2014-04-01

Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.

Spatial, Hysteretic, and Adaptive Host-Guest Chemistry in a Metal-Organic Framework with Open Watson-Crick Sites.

PubMed

Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan

2015-09-01

Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reasons and remedies for under-representation of women in medical leadership roles: a qualitative study from Australia

PubMed Central

Bismark, Marie; Morris, Jennifer; Thomas, Laura; Loh, Erwin; Phelps, Grant; Dickinson, Helen

2015-01-01

Objective To elicit medical leaders’ views on reasons and remedies for the under-representation of women in medical leadership roles. Design Qualitative study using semistructured interviews with medical practitioners who work in medical leadership roles. Interviews were transcribed verbatim and transcripts were analysed using thematic analysis. Setting Public hospitals, private healthcare providers, professional colleges and associations and government organisations in Australia. Participants 30 medical practitioners who hold formal medical leadership roles. Results Despite dramatic increases in the entry of women into medicine in Australia, there remains a gross under-representation of women in formal, high-level medical leadership positions. The male-dominated nature of medical leadership in Australia was widely recognised by interviewees. A small number of interviewees viewed gender disparities in leadership roles as a ‘natural’ result of women's childrearing responsibilities. However, most interviewees believed that preventable gender-related barriers were impeding women's ability to achieve and thrive in medical leadership roles. Interviewees identified a range of potential barriers across three broad domains—perceptions of capability, capacity and credibility. As a counter to these, interviewees pointed to a range of benefits of women adopting these roles, and proposed a range of interventions that would support more women entering formal medical leadership roles. Conclusions While women make up more than half of medical graduates in Australia today, significant barriers restrict their entry into formal medical leadership roles. These constraints have internalised, interpersonal and structural elements that can be addressed through a range of strategies for advancing the role of women in medical leadership. These findings have implications for individual medical practitioners and health services, as well as professional colleges and associations. PMID:26576814

Rationing in the emergency department: the good, the bad, and the unacceptable.

PubMed

Cross, E; Goodacre, S; O'Cathain, A; Arnold, J

2005-03-01

Waiting times in emergency departments (EDs) are an important government priority. Although substantial efforts are currently being made to reduce waiting times, little attention has been paid to the patients' view. We used qualitative methods to explore patients' perspectives on waiting times and other approaches to rationing and prioritisation. Face to face, in depth, qualitative interviews (n = 11) explored how patients valued waiting times for non-urgent ED care. The framework approach (identifying a thematic framework through repeated re-reading) was used to analyse transcripts. Interviewees found some forms of rationing and prioritisation acceptable. They expected rationing by delay, but required explanations or information on the reason for their wait. They valued prioritisation by triage (rationing by selection) and thought that this role could be expanded for the re-direction of non-urgent patients elsewhere (rationing by deflection). Interviewees were mainly unwilling or unable to engage in prioritisation of different types of patients, openly prioritising only those with obvious clinical need, and children. However, some interviewees were willing to ration implicitly, labelling some attenders as inappropriate, such as those causing a nuisance. Others felt it was unacceptable to blame "inappropriate" attenders, as their attendance may relate to lack of information or awareness of service use. Explicit rationing between services was not acceptable, although some believed there were more important priorities for NHS resources than ED waiting times. Interviewees disagreed with the hypothetical notion of paying to be seen more quickly in the ED (rationing by charging). Interviewees expected to wait and accepted the need for prioritisation, although they were reluctant to engage in judgements regarding prioritisation. They supported the re-direction of patients with certain non-urgent complaints. However, they perceived a need for more explanation and information about their wait, the system, and alternative services.

78 FR 10631 - List of Allottees or Heirs Determined To Receive Monetary Compensation Under the White Earth...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-14

... Edsel None F534080891 A1F22 Estey, Denise Claire Bond None F534080891 A1F21 Fox, James None F534081226 A1A Fox, James None F534081226 A3 Fox, James None F534081226 A11A1 Fox, James None F534081226 A6A1 Fox, James None F534081226 A4A Fox, James None F534081226 A1B1 Fox, James None F534081226 A11A2A Fox, James...

Does the Watson-Jones or Modified Smith-Petersen Approach Provide Superior Exposure for Femoral Neck Fracture Fixation?

PubMed

Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius

2018-07-01

A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that are relevant to femoral neck fracture reduction and fixation. After controlling for age, body mass index, height, and sex, we found the modified Smith-Petersen approach provided a mean of 2.36 cm (95% confidence interval [CI], 0.45-4.28 cm; p = 0.015) additional exposure without rectus femoris tenotomy (p = 0.015) and 3.33 cm (95% CI, 1.42-5.24 cm; p = 0.001) additional exposure with a tenotomy compared with the Watson-Jones approach. The labrum, femoral head, subcapital femoral neck, basicervical femoral neck, and greater trochanter were reliably visible and palpable in both approaches. The lesser trochanter was palpable in all of the modified Smith-Petersen and none of the Watson-Jones approaches (p < 0.001). All modified Smith-Petersen approaches (10 of 10) provided visualization and palpation of the medial femoral neck, whereas visualization of the medial femoral neck was only possible in one of 10 Watson-Jones approaches (p < 0.001) and palpation was possible in eight of 10 Watson-Jones versus all 10 modified Smith-Petersen approaches (p = 0.470). In the hands of surgeons experienced with both surgical approaches to the femoral neck, the modified Smith-Petersen approach, with or without rectus femoris tenotomy, provides superior exposure of the femoral neck and articular surface as well as visualization and palpation of clinically relevant proximal femoral anatomic landmarks compared with the Watson-Jones approach. Open reduction and internal fixation of a femoral neck fracture is typically performed in a young patient (< 60 years old) with the objective of obtaining anatomic reduction that would not be possible by closed manipulation, thus enhancing healing potential. In the hands of surgeons experienced in both approaches, the modified Smith-Petersen approach offers improved direct access for reduction and fixation. Higher quality reductions and fixation are expected to translate to improved healing potential and outcomes. Although our experimental results are promising, further clinical studies are needed to verify if this larger exposure area imparts increased quality of reduction, healing, and improved outcomes compared with other approaches. The learning curve for the exposure is unclear, but the approach has broad applications and is frequently used in other subspecialties such as for direct anterior THA and pediatric septic hip drainage. Surgeons treating femoral neck fractures with open reduction and fixation should familiarize themselves with the modified Smith-Petersen approach.

Evidence for Watson-Crick and not Hoogsteen or wobble base pairing in the selection of nucleotides for insertion opposite pyrimidines and a thymine dimer by yeast DNA pol eta.

PubMed

Hwang, Hanshin; Taylor, John-Stephen

2005-03-29

We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the Klenow fragment, and the lesser role of shape selection in insertion by pol eta due to its more open and less constrained active site.

Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.

PubMed

Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu

2004-03-01

A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson-Crick base pair in SECIS element plays an important role in the selenocysteine expression by UGA codon.

Recommendations for a Standardized Program Management Office (PMO) Time Compliance Network Order (TCNO) Patching Process

DTIC Science & Technology

2007-03-01

self -reporting. The interview process and resulting data analysis may be impacted by research bias since both were conducted by the same individual...the processes you employ? Answer: 97 MAJCOM CONTACTS RESPOSIBLE FOR GENERAL TCNO PROCEDURES SECTION 1: INTERVIEWEE INFO Question 1: Please...BASE-LEVEL NCC CONTACTS RESPOSIBLE FOR GENERAL TCNO PROCEDURES SECTION 1: INTERVIEWEE INFO Question 1: Please provide your general job description

[Social intelligence deficits in autistic children and adolescents--subjective theories of psychosocial health care professionals].

PubMed

Krech, M; Probst, P

1998-10-01

The paper is concerned with personal theories of health care professionals about deficiencies in social intelligence of autistic persons. In the component-model of social intelligence means the ability of individuals or groups, to interact with each other in social situations. This contains social perception, social behavior as well as social conceptions and refers to emotional, cognitive and normative aspects. 33 interviewees, working as psychologists or teachers in kindergartens, schools or therapy institutions, are questioned by a half-standardized single interview concerning their beliefs about nonverbal social abilities, social perspective taking, and construction of a theory of mind in autistic persons. The major finding is: The impairments can be found in all aspects of social intelligence. Especially emotional handicaps, which are quoted by more than 80% of the interviewees, and low cognitive preconditions of mastering social stimuli, which are quoted by nearly all interviewees, are relevant. The subjective theories of the interviewees are in accordance to the models of parents as well as the models of the leading experts. The professional relationship to autistic persons and the practical experiences of the health care professionals lead to their specific personal theories of deficiencies in social intelligence of autistic people with wide consequences in respect to the professional contact with the autistic children and young adults.

"Functional foods compensate for an unhealthy lifestyle". Some Swedish consumers' impressions and perceived need of functional foods.

PubMed

Landström, Eva; Hursti, Ulla-Kaisa Koivisto; Magnusson, Maria

2009-08-01

The aim of the present study was to explore some Swedish consumers' impressions of and perceived need of functional foods. Data were collected through 10 focus groups. A total of 46 individuals participated (31 females, 18-75 years, and 16 males, 18-78 years). The interviews were transcribed verbatim and analysed by the use of content analysis. Uncertainties--e.g., if functional foods are normal foods or medicines, if the foods would give additional physiological effects and/or if the ingredients and substances could cause harm--caused questions among the interviewees of trustworthiness and a feeling of losing control. The interviewees debated on the necessity of functional foods. Apart from perceiving functional foods as unnatural, the interviewees thought that functional foods would falsely compensate for an unhealthy lifestyle. The use of functional foods was considered to be justified when a healthy lifestyle is incapable of improving people's health. The interviewees perceived themselves to be in no need of functional foods. They thought that the foods were meant for others, for those in unquestionable need. We conclude that the impressions of FF among Swedish consumers are complex and versatile. The necessity of FF was justified unless no other lifestyle changes were able to improve a person's state of health.

Prenatal HIV testing: the compartmentalization of women's sexual risk exposure and the return of the maternal fetal conflict.

PubMed

Kelly, Kristin; Hampson, Sarah Cote; Huff, Jamie

2012-01-01

The purpose of the researchers in this study was to investigate how women who were being tested for HIV during their pregnancies were evaluating, conceptualizing, and negotiating their risk of infection. The study included two focus groups and 20 in-depth interviews with 30 patients, ages 17-38 years, from diverse ethnic/racial, social, and economic backgrounds. Qualitative analyses of the interview transcripts revealed support for the idea that pregnant women have a responsibility to minimize risks to their fetus, with all interviewees describing actions to minimize those risks while pregnant. Two sub-themes emerged that were related to the presence of differences in how interviewees conceptualized risk depending on the type of risk being discussed. In the case of diet and lifestyle influences, interviewees framed their health and the health of the fetus as connected. In contrast, when the issue of HIV risk and testing was raised, the interviewees described the risk of HIV to themselves and their fetuses as separate concerns and, with few exceptions, reported no effort to reduce the risk of becoming infected while pregnant (beyond consenting to HIV screening while receiving prenatal care). Findings suggest the importance of developing HIV prevention messages that counter the compartmentalization of risk during pregnancy.

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes

DTIC Science & Technology

2007-10-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)

DTIC Science & Technology

2007-01-01

reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07

Identification of Genetic Markers of the Invasive Phenotype in Human Breast Cancer

DTIC Science & Technology

2000-10-01

Mandinova A, Atar D, Schafer BW, Spiess M, Aebi U, Heizmann CW: J, Schnitt S, Livingston DM: Location of BRCA1 in human breast and Distinct...Genetic Markers of the Invasive Phenotype in Human Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Peter H. Watson CONTRACTING ORGANIZATION: University of...Markers of the Invasive Phenotype DAMD17-97-1-7320 in Human Breast Cancer 6. AUTHOR(S) Dr. Peter H. Watson 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ray, L.; Hoffmann, G.W.; Thaler, R.M.

The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reactionmore » cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+/sup 208/Pb elastic scattering and compared with experimental data.« less

The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.

PubMed

Bende, Attila; Muntean, Cristina M

2014-03-01

The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

The first example of a Hoogsteen base-paired DNA duplex in dynamic equilibrium with a Watson-Crick base-paired duplex--a structural (NMR), kinetic and thermodynamic study.

PubMed

Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J

2001-06-01

A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.

Characterization of the Trans Watson-Crick GU Base Pair Located in the Catalytic Core of the Antigenomic HDV Ribozyme

PubMed Central

Lévesque, Dominique; Reymond, Cédric; Perreault, Jean-Pierre

2012-01-01

The HDV ribozyme’s folding pathway is, by far, the most complex folding pathway elucidated to date for a small ribozyme. It includes 6 different steps that have been shown to occur before the chemical cleavage. It is likely that other steps remain to be discovered. One of the most critical of these unknown steps is the formation of the trans Watson-Crick GU base pair within loop III. The U23 and G28 nucleotides that form this base pair are perfectly conserved in all natural variants of the HDV ribozyme, and therefore are considered as being part of the signature of HDV-like ribozymes. Both the formation and the transformation of this base pair have been studied mainly by crystal structure and by molecular dynamic simulations. In order to obtain physical support for the formation of this base pair in solution, a set of experiments, including direct mutagenesis, the site-specific substitution of chemical groups, kinetic studies, chemical probing and magnesium-induced cleavage, were performed with the specific goal of characterizing this trans Watson-Crick GU base pair in an antigenomic HDV ribozyme. Both U23 and G28 can be substituted for nucleotides that likely preserve some of the H-bond interactions present before and after the cleavage step. The formation of the more stable trans Watson-Crick base pair is shown to be a post-cleavage event, while a possibly weaker trans Watson-Crick/Hoogsteen interaction seems to form before the cleavage step. The formation of this unusually stable post-cleavage base pair may act as a driving force on the chemical cleavage by favouring the formation of a more stable ground state of the product-ribozyme complex. To our knowledge, this represents the first demonstration of a potential stabilising role of a post-cleavage conformational switch event in a ribozyme-catalyzed reaction. PMID:22768274

Molecular dynamics correctly models the unusual major conformation of the GAGU RNA internal loop and with NMR reveals an unusual minor conformation.

PubMed

Spasic, Aleksandar; Kennedy, Scott D; Needham, Laura; Manoharan, Muthiah; Kierzek, Ryszard; Turner, Douglas H; Mathews, David H

2018-05-01

The RNA "GAGU" duplex, (5'GAC GAGU GUCA) 2 , contains the internal loop (5'-GAGU-3') 2 , which has two conformations in solution as determined by NMR spectroscopy. The major conformation has a loop structure consisting of trans -Watson-Crick/Hoogsteen GG pairs, A residues stacked on each other, U residues bulged outside the helix, and all sugars with a C2'- endo conformation. This differs markedly from the internal loops, (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-UAGG-3') 2 , which all have cis -Watson-Crick/Watson-Crick AG "imino" pairs flanked by cis -Watson-Crick/Watson-Crick canonical pairs resulting in maximal hydrogen bonding. Here, molecular dynamics was used to test whether the Amber force field (ff99 + bsc0 + OL3) approximates molecular interactions well enough to keep stable the unexpected conformation of the GAGU major duplex structure and the NMR structures of the duplexes containing (5'-G AG C-3') 2 , (5'-A AG U-3') 2 , and (5'-U AG G-3') 2 internal loops. One-microsecond simulations were repeated four times for each of the duplexes starting in their NMR conformations. With the exception of (5'-UAGG-3') 2 , equivalent simulations were also run starting with alternative conformations. Results indicate that the Amber force field keeps the NMR conformations of the duplexes stable for at least 1 µsec. They also demonstrate an unexpected minor conformation for the (5'-GAGU-3') 2 loop that is consistent with newly measured NMR spectra of duplexes with natural and modified nucleotides. Thus, unrestrained simulations led to the determination of the previously unknown minor conformation. The stability of the native (5'-GAGU-3') 2 internal loop as compared to other loops can be explained by changes in hydrogen bonding and stacking as the flanking bases are changed. © 2018 Spasic et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Anthropometrically estimated total body water volumes are larger than modeled urea volume in chronic hemodialysis patients: effects of age, race, and gender.

PubMed

Daugirdas, John T; Greene, Tom; Depner, Thomas A; Chumlea, Cameron; Rocco, Michael J; Chertow, Glenn M

2003-09-01

The modeled volume of urea distribution (Vm) in intermittently hemodialyzed patients is often compared with total body water (TBW) volume predicted from population studies of patient anthropometrics (Vant). Using data from the HEMO Study, we compared Vm determined by both blood-side and dialysate-side urea kinetic models with Vant as calculated by the Watson, Hume-Weyers, and Chertow anthropometric equations. Median levels of dialysate-based Vm and blood-based Vm agreed (43% and 44% of body weight, respectively). These volumes were lower than anthropometric estimates of TBW, which had median values of 52% to 55% of body weight for the three formulas evaluated. The difference between the Watson equation for TBW and modeled urea volume was greater in Caucasians (19%) than in African Americans (13%). Correlations between Vm and Vant determined by each of the three anthropometric estimation equations were similar; but Vant derived from the Watson formula had a slightly higher correlation with Vm. The difference between Vm and the anthropometric formulas was greatest with the Chertow equation, less with the Hume-Weyers formula, and least with the Watson estimate. The age term in the Watson equation for men that adjusts Vant downward with increasing age reduced an age effect on the difference between Vant and Vm in men. The findings show that kinetically derived values for V from blood-side and dialysate-side modeling are similar, and that these modeled urea volumes are lower by a substantial amount than anthropometric estimates of TBW. The higher values for anthropometry-derived TBW in hemodialyzed patients could be due to measurement errors. However, the possibility exists that TBW space is contracted in patients with end-stage renal disease (ESRD) or that the TBW space and the urea distribution space are not identical.

Confronting the Terrorism of Boko Haram in Nigeria

DTIC Science & Technology

2012-05-01

the blight of corruption greatly weakens the strands of trust between the state and the citizens it aims to govern. One interviewee used a medical ... medical doc- tors, scientists, and academics to leave their professions and go into politics just to make money. For example, as a May 2011 article in...nor a functioning insurance system in the country. As one interviewee recounted, “You can purchase medical , health, life, automobile or other kinds of

The Attitudes of Indian Palliative-care Nurses and Physicians to Pain Control and Palliative Sedation.

PubMed

Gielen, Joris; Gupta, Harmala; Rajvanshi, Ambika; Bhatnagar, Sushma; Mishra, Seema; Chaturvedi, Arvind K; den Branden, Stef Van; Broeckaert, Bert

2011-01-01

We wanted to assess Indian palliative-care nurses and physicians' attitudes toward pain control and palliative sedation. From May to September 2008, we interviewed 14 physicians and 13 nurses working in different palliative-care programs in New Delhi, using a semi-structured questionnaire, and following grounded-theory methodology (Glaser and Strauss). The interviewees did not consider administration of painkillers in large doses an ethical problem, provided the pain killers are properly titrated. Mild palliative sedation was considered acceptable. The interviewees disagreed whether palliative sedation can also be deep and continuous. Arguments mentioned against deep continuous palliative sedation were the conviction that it may cause unacceptable side effects, and impedes basic daily activities and social contacts. A few interviewees said that palliative sedation may hasten death. Due to fears and doubts regarding deep continuous palliative sedation, it may sometimes be too easily discarded as a treatment option for refractory symptoms.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meadows, B.T.; /Cincinnati U.

A new approach to the analysis of three body decays is presented. Model-independent results are obtained for the S-wave K{pi} amplitude as a function of K{pi} invariant mass. These are compared with results from K{sup -}{pi}{sup +} elastic scattering, and the prediction of the Watson theorem, that the phase behavior be the same below K{eta}' threshold, is tested. Contributions from I = 1/2 and I = 3/2 are not resolved in this study. If I = 1/2 dominates, however, the Watson theorem does not describe these data well.

Determination of Frontal Structure in the Mid-Atlantic Region from WSR-88D Doppler Radar Velocity Azimuth Displays

DTIC Science & Technology

1997-01-09

Riordan Gerald F. Watson Steven E. Koch Chairman of Advisory Committee Dedication I would like to dedicate, first and foremost, this thesis to the Lord...Officer. Tony was promoted to the rick of Cap(alnin June 1995. While atOffut AFB, he was selected by AFIT to attend North Carolina State University to...advisory committee, Dr. Steven E. Koch (Chairman), Dr. Allen J. Riordan , and Dr. Gerald F. Watson. Their guidance and personal interest in this work

Study of the Physics of Insulating Films as Related to the Reliability of Metal-Oxide Semiconductor Devices

DTIC Science & Technology

1980-11-01

materials work and sample preparation of D.W. Dong; the technical assistance of F.L. Pesavento and J.A. Calise; the assistance in device fabrication...FILMS D.J. DiMaria R. Ghez D.W. Dong I.B.M. Thomas J. Watson Research Center Yorktown Heights, New York 10598 Technical Assistance of F.L. Pesavento and... Pesavento and J.A. Calise; the assistance with gate metallizations by the Silicon Facility and Central Scientific Services at the T.J. Watson

Flood Plain Information, Mill, Watson, and Lahaska Creeks, Bucks County, Pennsylvania.

DTIC Science & Technology

1975-05-01

AD-AIOI 592 ARENGINEER DISTRICT PHI LADELPHIA P A F/6 8/8 T7LOOD PLAIN INFORMATION, MIL , WATSON, AND LAI4ASKA CREEKS, SUCK-’ETCIU) UNCLASSIFIED...will be iu LblckW V’ A PREPARED FOR THE BUCKS COUNTY PLANNING COMMISSION p BY CORPS OF ENGINEERS, U.S. ARMY PHILADELPHIA DISTRICT MAY 975 8 1 7 20 055...No. 4655 at Langhorne , Pennsylvania) ..... ................. 8 3 Peak Flows for the Intermediate Regional and Standard Project Floods

Introduction and Overview of the Industrial Interactive Panel Session

NASA Astrophysics Data System (ADS)

Seiler, David

2014-03-01

A unique industrial panel covering the challenges and needs of various industries and how being innovative is important. The session involves two invited industry speakers (24 minutes each) who will set the stage for the interactive round table panel session. The Panel, led by moderator Mark Bernius (Morgan Advanced Materials), consists of the two invited speakers plus an additional five industry panelists. The first thirty minutes of the panel session has the five additional panelists introducing themselves and their work/company. These introductions could include what they or their company does, sharing one or two technical highlights, listing some challenges or needs for physicists, and what innovation breakthroughs are needed in their industries. The final hour of the session will be highly interactive with questions to the panel coming from the moderator, the audience, and the panelists themselves. Questions that might be addressed include: how physicists are or could be critical in advancing innovation; how can AIP/APS/FIAP help industry get the physics help they need to be innovative (knowledge, the right staff, etc.); what role can students and post docs play in advancing industry's mission; etc. We invite you to participate in this interactive session and ask our industry experts your own interesting and challenging questions. The invited speakers are George Thompson, Intel, and Rick Watkins, Nike. The panel members also include Jason Cleveland, Asylum Research; Robert Doering, Texas Instruments; William Gallagher, IBM T.J. Watson Research Center; James Hollenhorst, Agilent Technologies; and Martin Poitzsch, Schlumberger-Doll Research.

What Roles Can Scientists Play in Public Discourse?

NASA Astrophysics Data System (ADS)

Oppenheimer, Michael

2011-04-01

What is a useful and proper role for scientists in the public arena? How can we best discriminate where the boundary lies between expert knowledge and values or political opinion, and how can we properly honor that line? What can we expect in the way of reception for our interventions, and how can we increase their efficacy? Involvement in public policy debates is a common and accepted role for scientists in many disciplines. In the sciences related to public health, it is taken for granted that experts will talk about the implications of their research for public policy, whether in regard to smoking, diet, or disease spread. There is also a remarkable track record of geoscientists taking a lead role in the public arena and actually affecting public policy—F. Sherwood Rowland and Mario Molina collaborated on ozone depletion research at the Department of Chemistry at University of California, Irvine and then went on to make outstanding public contributions, as have James Hansen (at NASA's Goddard Institute for Space Studies); Robert Watson (first at NASA, then at the University of East Anglia); and, of course, the late Stephen Schneider (first at the U.S. National Center for Atmospheric Research, then Stanford) on climate. Some “public” geoscientists have restricted their activities to interpreting science for the wider public, while others have endorsed specific policy initiatives (see Figure 1). I firmly believe that the quality of public discourse and the information reaching policy makers were better for their interventions.

The Learning Preferences of Applicants Who Interview for General Surgery Residency: A Multiinstitutional Study.

PubMed

Kim, Roger H; Kurtzman, Scott H; Collier, Ashley N; Shabahang, Mohsen M

Learning styles theory posits that learners have distinct preferences for how they assimilate new information. The VARK model categorizes learners based on combinations of 4 learning preferences: visual (V), aural (A), read/write (R), and kinesthetic (K). A previous single institution study demonstrated that the VARK preferences of applicants who interview for general surgery residency are different from that of the general population and that learning preferences were associated with performance on standardized tests. This multiinstitutional study was conducted to determine the distribution of VARK preferences among interviewees for general surgery residency and the effect of those preferences on United States Medical Licensing Examination (USMLE) scores. The VARK learning inventory was administered to applicants who interviewed at 3 general surgery programs during the 2014 to 2015 academic year. The distribution of VARK learning preferences among interviewees was compared with that of the general population of VARK respondents. Performance on USMLE Step 1 and Step 2 Clinical Knowledge was analyzed for associations with VARK learning preferences. Chi-square, analysis of variance, and Dunnett's test were used for statistical analysis, with p < 0.05 considered statistically significant. The VARK inventory was completed by a total of 140 residency interviewees. Sixty-four percent of participants were male, and 41% were unimodal, having a preference for a single learning modality. The distribution of VARK preferences of interviewees was different than that of the general population (p = 0.02). By analysis of variance, there were no overall differences in USMLE Step 1 and Step 2 Clinical Knowledge scores by VARK preference (p = 0.06 and 0.21, respectively). However, multiple comparison analysis using Dunnett's test revealed that interviewees with R preferences had significantly higher scores than those with multimodal preferences on USMLE Step 1 (239 vs. 222, p = 0.02). Applicants who interview for general surgery residency have a different pattern of VARK preferences than that of the general population. Interviewees with preferences for read/write learning modalities have higher scores on the USMLE Step 1 than those with multimodal preferences. Learning preferences may have impact on residency applicant selection and represents a topic that warrants further investigation. Copyright © 2016 Association of Program Directors in Surgery. Published by Elsevier Inc. All rights reserved.

What can we learn from trial decliners about improving recruitment? Qualitative study.

PubMed

Hughes-Morley, Adwoa; Young, Bridget; Hempel, Roelie J; Russell, Ian T; Waheed, Waquas; Bower, Peter

2016-10-12

Trials increasingly experience problems in recruiting participants. Understanding the causes of poor recruitment is critical to developing solutions. We interviewed people who had declined a trial of an innovative psychological therapy for depression (REFRAMED) about their response to the trial invitation, in order to understand their decision and identify ways to improve recruitment. Of 214 people who declined the trial, 35 (16 %) gave permission to be contacted about a qualitative study to explore their decision. Analysis of transcripts of semi-structured interviews was informed by grounded theory. We interviewed 20 informants: 14 women and six men, aged 18 to 77 years. Many interviewees had prior experience of research participation and positive views of the trial. Interviewees' decision making resembled a four-stage sequential process; in each stage they either decided not to participate in the trial or progressed to the next stage. In stage 1, interviewees assessed the invitation in the context of their experiences and attitudes; we term those who opted out at this stage 'prior decliners' as they had an established position of declining trials. In stage 2, interviewees assessed their own eligibility; those who judged themselves ineligible and opted out at this stage are termed 'self-excluders'. In stage 3, interviewees assessed their need for the trial therapy and potential to benefit; we term those who decided they did not need the trial therapy and opted out at this stage 'treatment decliners'. In stage 4, interviewees deliberated the benefits and costs of trial participation; those who opted out after judging that disadvantages outweighed advantages are termed 'trial decliners'. Across all stages, most individuals declined because they judged themselves ineligible or not in need of the trial therapy. While 'prior decliners' are unlikely to respond to any trial recruitment initiative, the factors leading others to decline are amenable to amelioration as they do not arise from a rejection of trials or a personal stance. To improve recruitment in similar trials, the most successful interventions are likely to address patients' assessments of their eligibility and their potential to benefit from the trial treatment, rather than reducing trial burden. International Standard Randomised Controlled Trial Number: ISRCTN85784627 . Registration date 10 August 2011.

Durbin-Watson partial least-squares regression applied to MIR data on adulteration with edible oils of different origins.

PubMed

Jović, Ozren

2016-12-15

A novel method for quantitative prediction and variable-selection on spectroscopic data, called Durbin-Watson partial least-squares regression (dwPLS), is proposed in this paper. The idea is to inspect serial correlation in infrared data that is known to consist of highly correlated neighbouring variables. The method selects only those variables whose intervals have a lower Durbin-Watson statistic (dw) than a certain optimal cutoff. For each interval, dw is calculated on a vector of regression coefficients. Adulteration of cold-pressed linseed oil (L), a well-known nutrient beneficial to health, is studied in this work by its being mixed with cheaper oils: rapeseed oil (R), sesame oil (Se) and sunflower oil (Su). The samples for each botanical origin of oil vary with respect to producer, content and geographic origin. The results obtained indicate that MIR-ATR, combined with dwPLS could be implemented to quantitative determination of edible-oil adulteration. Copyright © 2016 Elsevier Ltd. All rights reserved.

Role modeling excellence in clinical nursing practice.

PubMed

Perry, R N Beth

2009-01-01

Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.

James L. Young | NREL

Science.gov Websites

L. Young James Young Postdoctoral Researcher-Chemistry James.Young@nrel.gov | 303-275-4456 Orcid ID http://orcid.org/0000-0001-7291-0079 Dr. James L. Young is a Postdoctoral Researcher at the National -splitting photocathode," Nature Energy (2017). View all NREL publications for James L. Young.

Strength trapped within weakness/ weakness trapped within strength: the influence of family of origin experiences on the lives of abused women.

PubMed

Buchbinder, Eli; Birnbaum, Liora

2010-06-01

By conceptualizing abused women as victims or survivors, the literature offers two contradictory narratives of abused women. The aim of this article is to show that these two narratives are not mutually exclusive but rather can be used simultaneously to represent battered women's existential experiences. The study sample was comprised of 20 Israeli battered women. Three in-depth interviews were conducted with each participant-twice for data collection purposes and once for validating the themes that emerged from the content analysis. "Strength trapped in weakness/weakness trapped in strength" was found to be a dominant theme in the life narratives of the interviewees. Most interviewees grew up in families of origin in distress; most were abused physically and emotionally. Although this anguish colored their lives with pain and turmoil, their experiences were the key to their ability to overcome difficulties. From the onset, interviewees' lives were marked by a sense of threat and deprivation, but these very difficulties were also the source of a sense of power that emerged from the women's struggle with their past. In their attempts to cope with and transcend the legacies of their past, interviewees' feelings oscillated continuously between past and present, creating a unique powerful sense of simultaneously being victims and survivors. Implications for intervention are suggested.

"And now for the good news..." the impact of negative and positive messages in self-management education for people with Type 2 diabetes: A qualitative study in an ethnically diverse population.

PubMed

Eborall, Helen C; Virdee, Satnam K; Patel, Naina; Redwood, Sabi; Greenfield, Sheila M; Stone, Margaret A

2016-03-01

To explore the impact of Diabetes Education and Self Management for Ongoing and Newly Diagnosed (DESMOND) Foundation education, particularly from interviewees' narratives regarding recall of good and bad news messages and behaviour changes. In-depth, semi-structured interviews were conducted with a purposive sample (n=19) of people who had attended education sessions as part of a randomised controlled trial in two UK sites with ethnically diverse populations. Data collection and analysis were informed by the constant comparative approach and facilitated through charting. Findings were similar in people from different ethnic backgrounds. Exploration of levels of recall of the sessions suggested that this was variable and sometimes very limited, but that interviewees had all assimilated some relevant learning. Key themes emerged relating to the way in which interviewees recalled and had been influenced by positive (good news) and negative (bad news) messages within the education sessions, including biomedical explanations. Both types of message appeared to have an important role in terms of motivation to change behaviour, but a notable observation was that none of the interviewees recalled receiving bad news messages when diagnosed. Our findings have highlighted the importance of providing and combining both negative and positive messages within education designed to promote self-management behaviour change. © The Author(s) 2015.

Human DNA primase uses Watson-Crick hydrogen bonds to distinguish between correct and incorrect nucleoside triphosphates.

PubMed

Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D

2004-09-28

Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.

Structure and Dynamics of RNA Repeat Expansions That Cause Huntington's Disease and Myotonic Dystrophy Type 1.

PubMed

Chen, Jonathan L; VanEtten, Damian M; Fountain, Matthew A; Yildirim, Ilyas; Disney, Matthew D

2017-07-11

RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

[Analysis of Conformational Features of Watson-Crick Duplex Fragments by Molecular Mechanics and Quantum Mechanics Methods].

PubMed

Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A

2016-01-01

It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.

Reasons and remedies for under-representation of women in medical leadership roles: a qualitative study from Australia.

PubMed

Bismark, Marie; Morris, Jennifer; Thomas, Laura; Loh, Erwin; Phelps, Grant; Dickinson, Helen

2015-11-16

To elicit medical leaders' views on reasons and remedies for the under-representation of women in medical leadership roles. Qualitative study using semistructured interviews with medical practitioners who work in medical leadership roles. Interviews were transcribed verbatim and transcripts were analysed using thematic analysis. Public hospitals, private healthcare providers, professional colleges and associations and government organisations in Australia. 30 medical practitioners who hold formal medical leadership roles. Despite dramatic increases in the entry of women into medicine in Australia, there remains a gross under-representation of women in formal, high-level medical leadership positions. The male-dominated nature of medical leadership in Australia was widely recognised by interviewees. A small number of interviewees viewed gender disparities in leadership roles as a 'natural' result of women's childrearing responsibilities. However, most interviewees believed that preventable gender-related barriers were impeding women's ability to achieve and thrive in medical leadership roles. Interviewees identified a range of potential barriers across three broad domains-perceptions of capability, capacity and credibility. As a counter to these, interviewees pointed to a range of benefits of women adopting these roles, and proposed a range of interventions that would support more women entering formal medical leadership roles. While women make up more than half of medical graduates in Australia today, significant barriers restrict their entry into formal medical leadership roles. These constraints have internalised, interpersonal and structural elements that can be addressed through a range of strategies for advancing the role of women in medical leadership. These findings have implications for individual medical practitioners and health services, as well as professional colleges and associations. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

Mixed-methods investigation of women's experiences with second-trimester abortion care in the Midwest and Northeast United States.

PubMed

Blanchard, Kelly; Meadows, Jill L; Gutierrez, Hialy R; Hannum, Curtiss Ps; Douglas-Durham, Ella F; Dennis, Amanda J

2017-12-01

We studied women's experiences seeking and receiving second-trimester abortion care in two geographically and legislatively different settings to inform ways to improve abortion care access and services. We conducted in-depth interviews with women who obtained second-trimester abortion care. Themes from the interviews were then used to inform a self-administered survey, which was completed by 108 women who received second-trimester abortion care in the Northeast and Midwest. We calculated descriptive statistics and used chi-squared and t-tests to compare responses. We interviewed eight women and surveyed 108 women. Most interviewees and 65.2% of survey respondents reported difficulties accessing care. Although most interview and survey respondents had insurance, a slight majority reported difficulty funding care. All interviewees and 57.9% of survey respondents reported positive experiences with providers, with many interviewees and 62.0% of survey respondents saying their abortion care was better than their usual health care. Most interviewees and 75.8% of survey respondents reported pain as low to moderate, and the majority of participants reported it was the same or less than expected. Knowledge about abortion restrictions was low. Most interviewees and 68.4% survey respondents disagreed with restrictions on insurance coverage of abortion. Common recommendations to improve experiences were to ensure travel and financial support and to decrease wait times at clinics. There were few regional differences among outcomes. Women seeking second-trimester abortion in these locations reported positive abortion experiences. However, they had to overcome significant obstacles to obtain care. This is the first study to systematically research women's second-trimester care experiences in two different regions of the United States. Regardless of location, women experienced barriers due to policies that impose gestational age restrictions, limit provider availability (consequently increasing wait times), and increase costs. Policy change to reduce these barriers is critical to improve access to and experiences with second trimester abortion care. Copyright © 2017 Elsevier Inc. All rights reserved.

Localization and anharmonicity of the vibrational modes for GC Watson-Crick and Hoogsteen base pairs.

PubMed

Bende, Attila; Bogdan, Diana; Muntean, Cristina M; Morari, Cristian

2011-12-01

We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by using two different implementations of the DFT method. We assign the vibrational frequencies to cytosine or to guanine using the vibrational density of states. Next, we investigate the importance of anharmonic corrections for the vibrational modes. In particular, the unusual anharmonic effect of the H(+) vibration in the case of the Hoogsteen base pair configuration is discussed.

Updating the Standard Spatial Observer for Contrast Detection

NASA Technical Reports Server (NTRS)

Ahumada, Albert J.; Watson, Andrew B.

2011-01-01

Watson and Ahmuada (2005) constructed a Standard Spatial Observer (SSO) model for foveal luminance contrast signal detection based on the Medelfest data (Watson, 1999). Here we propose two changes to the model, dropping the oblique effect from the CSF and using the cone density data of Curcio et al. (1990) to estimate the variation of sensitivity with eccentricity. Dropping the complex images, and using medians to exclude outlier data points, the SSO model now accounts for essentially all the predictable variance in the data, with an RMS prediction error of only 0.67 dB.

Barriers to higher education: commonalities and contrasts in the experiences of Hindu and Muslim young women in urban Bengaluru

PubMed Central

Sahu, Biswamitra; Jeffery, Patricia; Nakkeeran, N.

2017-01-01

Abstract Gender inequalities in educational attainment have attracted considerable attention and this article aims to contribute to our understanding of young women’s access to higher education. The article is based on our in-depth interviews with 26 Hindu and Muslim young women attending colleges in urban Bengaluru (formerly Bangalore), south India, and explores the barriers they confronted in fulfilling their aspirations. We highlight the similarities amongst the young women, as well as the distinctive experiences of the Hindu and Muslim interviewees. Financial constraints, lack of safety for women in public space, and gender bias, gossip and social control within the family and the local community affected Hindu and Muslim interviewees in substantially similar ways. For the Muslim interviewees, however, gender disadvantage was compounded by their minority status. This both underlines the importance of incorporating communal politics into our analysis and undermines popular discourses that stereotype Muslims in India as averse to girls’ and young women’s education. PMID:28392620

The Attitudes of Indian Palliative-care Nurses and Physicians to Pain Control and Palliative Sedation

PubMed Central

Gielen, Joris; Gupta, Harmala; Rajvanshi, Ambika; Bhatnagar, Sushma; Mishra, Seema; Chaturvedi, Arvind K; den Branden, Stef Van; Broeckaert, Bert

2011-01-01

Aim: We wanted to assess Indian palliative-care nurses and physicians’ attitudes toward pain control and palliative sedation. Materials and Methods: From May to September 2008, we interviewed 14 physicians and 13 nurses working in different palliative-care programs in New Delhi, using a semi-structured questionnaire, and following grounded-theory methodology (Glaser and Strauss). Results: The interviewees did not consider administration of painkillers in large doses an ethical problem, provided the pain killers are properly titrated. Mild palliative sedation was considered acceptable. The interviewees disagreed whether palliative sedation can also be deep and continuous. Arguments mentioned against deep continuous palliative sedation were the conviction that it may cause unacceptable side effects, and impedes basic daily activities and social contacts. A few interviewees said that palliative sedation may hasten death. Conclusion: Due to fears and doubts regarding deep continuous palliative sedation, it may sometimes be too easily discarded as a treatment option for refractory symptoms. PMID:21633619

Barriers to higher education: commonalities and contrasts in the experiences of Hindu and Muslim young women in urban Bengaluru.

PubMed

Sahu, Biswamitra; Jeffery, Patricia; Nakkeeran, N

2017-03-04

Gender inequalities in educational attainment have attracted considerable attention and this article aims to contribute to our understanding of young women's access to higher education. The article is based on our in-depth interviews with 26 Hindu and Muslim young women attending colleges in urban Bengaluru (formerly Bangalore), south India, and explores the barriers they confronted in fulfilling their aspirations. We highlight the similarities amongst the young women, as well as the distinctive experiences of the Hindu and Muslim interviewees. Financial constraints, lack of safety for women in public space, and gender bias, gossip and social control within the family and the local community affected Hindu and Muslim interviewees in substantially similar ways. For the Muslim interviewees, however, gender disadvantage was compounded by their minority status. This both underlines the importance of incorporating communal politics into our analysis and undermines popular discourses that stereotype Muslims in India as averse to girls' and young women's education.

African Immigrants in Low-Wage Direct Health Care: Motivations, Job Satisfaction, and Occupational Mobility.

PubMed

Covington-Ward, Yolanda

2017-06-01

This study explores motivations, job satisfaction, and overall perceived occupational mobility for African immigrants working in low-wage direct health care occupations. The study uses qualitative semi-structured interviews with a sample of thirty African immigrant workers in the greater Pittsburgh metropolitan area. Results show that four major themes captured the motivations of interviewees for doing direct care work: passion for care work, quick money, easily obtained employment, and direct care work as a pathway to other health occupations. The majority of the interviewees were satisfied with their jobs, yet almost all of them saw their occupations as temporary or transitional employment. Most of the interviewees also saw their jobs as lacking occupational mobility. In light of the increased national demand for direct care workers, the growing numbers of immigrants in the direct care labor force, and the high turnover and low retention rates of direct care workers overall, the study suggests that more must be done to make direct care work attractive and rewarding for African immigrant workers.

Paradigmatic Entrapment

DTIC Science & Technology

2007-05-17

10 Ibid., 532-533. 11 Ibid., 76. 12 James L. Gibson, John M. Ivancevich , and James H. Donnelly, Organizations, 3d ed...Nuclear Age. Edited by Peter Paret. Princeton: Princeton University Press, 1986. Gibson, James L., John M. Ivancevich and James H. Donnelly, Jr

Applications of the Galton Watson process to human DNA evolution and demography

NASA Astrophysics Data System (ADS)

Neves, Armando G. M.; Moreira, Carlos H. C.

2006-08-01

We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton-Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman Nbar is constrained to a small range depending on the probability p that a child is a female. Assuming that the value p≈0.488 valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable probability is 2.0492

Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering

NASA Astrophysics Data System (ADS)

Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.

2017-06-01

The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.

Organizational Excellence: Three Keys to the Centralization/Decentralization Debate

DTIC Science & Technology

2012-02-15

33Sheets, 36. 34Sheets, 55. 35James L. Gibson, John M. Ivancevich and James H. Donnelly, Jr., Organizations: Structure, Processes, Behavior...Accounting Office, 1993. Gibson, James L., John M. Ivancevich and James H. Donnelly, Jr.. Organizations: Structure, Processes, Behavior. Dallas, TX

Early Phase Endotoxin Tolerance: A Study of the Cellular Mechanisms which Underlie a State of Acquired Refractoriness to Endotoxin-induced Toxic Manifestations

DTIC Science & Technology

1985-12-13

Her leadership , help, and understanding at crltlcal times will always be remembered. Thank you for help ing me attain this great goal and captu~e a...by Braude §1 ~!- (1955) and Cremer and Watson (1957 ) to be the primary site of endotoxin localization following i.v. injection] were st imulated by...A-specif ic tr iggeri ng r eceptor on murine B lymp hocytes. Eur. J. Immunol. 8:63 . Cremer , N. and D.W. Watson. 1957. Inf luence of s tress on

Biological and Nano-Technological Applications of Artificial DNAs Made Exclusively of Nonnatural C-Nucleosides with Four Types of Nonnatural Bases

DTIC Science & Technology

2011-08-19

A) CD, (B) UV, (C) Tm, and (D) titration experiments of d(iG*)8/d(C)8. d(T/A*/T)n WC WC
 d(T/A/T)n Watson – Crick (WC)
 Hoogsteen
 Symmetrical A...base Figure 7. Triplex formation of the natural T/A/T which has one Watson - Crick (WC)-type and one Hoogsteen-type hydrogen-bondings, and the...Final Report for AOARD Grant FA2386-10-1-4033 “Biological and Nano-technological Applications of Artificial DNAs Made Exclusively of Nonnatutal C

Dissociation of single-strand DNA: single-walled carbon nanotube hybrids by Watson-Crick base-pairing.

PubMed

Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon

2010-08-18

It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.

Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.

PubMed

Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole

2010-08-25

Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.

Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.

PubMed

Kottemann, Molly C; Smogorzewska, Agata

2013-01-17

The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.

Structure of 2,4-Diaminopyrimidine - Theobromine Alternate Base Pairs

NASA Technical Reports Server (NTRS)

Gengeliczki, Zsolt; Callahan, Michael P.; Kabelac, Martin; Rijs, Anouk M.; deVries, Mattanjah S.

2011-01-01

We report the structure of clusters of 2,4-diaminopyrimidine with 3,7-dimethylxanthine (theobromine) in the gas phase determined by IR-UV double resonance spectroscopy in both the near-IR and mid-IR regions in combination with ab initio computations. These clusters represent potential alternate nucleobase pairs, geometrically equivalent to guanine-cytosine. We have found the four lowest energy structures, which include the Watson-Crick base pairing motif. This Watson-Crick structure has not been observed by resonant two-photon ionization (R2PI) in the gas phase for the canonical DNA base pairs.

Journey of a molecular biologist.

PubMed

Nomura, Masayasu

2011-01-01

My journey into a research career began in fermentation biochemistry in an applied science department during the difficult post-World War II time in Japan. Subsequently, my desire to do research in basic science developed. I was fortunate to be a postdoctoral fellow in the United States during the early days of molecular biology. From 1957 to 1960, I worked with three pioneers of molecular biology, Sol Spiegelman, James Watson, and Seymour Benzer. These experiences helped me develop into a basic research scientist. My initial research projects at Osaka University, and subsequently at the University of Wisconsin, Madison, were on the mode of action of colicins as well as on mRNA and ribosomes. Following success in the reconstitution of ribosomal subunits, my efforts focused more on ribosomes, initially on the aspects of structure, function, and in vitro assembly, such as the construction of the 30S subunit assembly map. After this, my laboratory studied the regulation of the synthesis of ribosomes and ribosomal components in Escherichia coli. Our achievements included the discovery of translational feedback regulation of ribosomal protein synthesis and the identification of several repressor ribosomal proteins used in this regulation. In 1984, I moved to the University of California, Irvine, and initiated research on rRNA transcription by RNA polymerase I in the yeast Saccharomyces cerevisiae. The use of yeast genetics combined with biochemistry allowed us to identify genes uniquely involved in rRNA synthesis and to elucidate the mechanism of initiation of transcription. This essay is a reflection on my life as a research scientist.

The 'Biologically-Inspired Computing' Column

NASA Technical Reports Server (NTRS)

Hinchey, Mike

2006-01-01

The field of Biology changed dramatically in 1953, with the determination by Francis Crick and James Dewey Watson of the double helix structure of DNA. This discovery changed Biology for ever, allowing the sequencing of the human genome, and the emergence of a "new Biology" focused on DNA, genes, proteins, data, and search. Computational Biology and Bioinformatics heavily rely on computing to facilitate research into life and development. Simultaneously, an understanding of the biology of living organisms indicates a parallel with computing systems: molecules in living cells interact, grow, and transform according to the "program" dictated by DNA. Moreover, paradigms of Computing are emerging based on modelling and developing computer-based systems exploiting ideas that are observed in nature. This includes building into computer systems self-management and self-governance mechanisms that are inspired by the human body's autonomic nervous system, modelling evolutionary systems analogous to colonies of ants or other insects, and developing highly-efficient and highly-complex distributed systems from large numbers of (often quite simple) largely homogeneous components to reflect the behaviour of flocks of birds, swarms of bees, herds of animals, or schools of fish. This new field of "Biologically-Inspired Computing", often known in other incarnations by other names, such as: Autonomic Computing, Pervasive Computing, Organic Computing, Biomimetics, and Artificial Life, amongst others, is poised at the intersection of Computer Science, Engineering, Mathematics, and the Life Sciences. Successes have been reported in the fields of drug discovery, data communications, computer animation, control and command, exploration systems for space, undersea, and harsh environments, to name but a few, and augur much promise for future progress.

The psychology and physiology of temperament: pragmatism in context.

PubMed

Bordogna, F

2001-01-01

This paper traces William James's famous "temperament thesis" according to which the philosophical stance that individuals take depends on their "temperaments." It seeks to understand James's conception of temperament by locating James within a set of contemporary investigations that linked the sources of mental, and even higher, intellectual processes to the physiological and organic constitution of the individual. The paper argues that James understood temperament along the reflex-arc model and discusses the implications of that physiological account of temperament for James's overall conception of philosophy.

Investigation of the H7 ordinary chondrite, Watson 012: Implications for recognition and classification of Type 7 meteorites

NASA Astrophysics Data System (ADS)

Tait, Alastair W.; Tomkins, Andrew G.; Godel, Bélinda M.; Wilson, Siobhan A.; Hasalova, Pavlina

2014-06-01

Despite the fact that the number of officially classified meteorites is now over 45,000, we lack a clearly defined sequence of samples from a single parent body that records the entire range in metamorphic temperatures from pristine primitive meteorites up to the temperatures required for extensive silicate partial melting. Here, we conduct a detailed analysis of Watson 012, an H7 ordinary chondrite, to generate some clarity on the textural and chemical changes associated with equilibrium-based silicate partial melting in chondritic meteorites. To do this we compare the textures in the meteorite with those preserved in metamorphic contact aureoles on Earth. The most distinctive texture generated by the partial melting that affected Watson 012 is an extensively interconnected plagioclase network, which is clearly observable with a petrographic microscope. Enlarged metal-troilite grains are encapsulated at widenings in this plagioclase network, and this is clearly visible in reflected light. Together with these features, we define a series of other characteristics that can be used to more clearly classify chondritic meteorites as being of petrologic Type 7. To provide comprehensive evidence of silicate partial melting and strengthen the case for using simple petrographic observations to classify similar meteorites, we use high-resolution X-ray computed tomography to demonstrate that the plagioclase network has a high degree of interconnectedness and crystallised as large (cm-scale) skeletal crystals within an olivine-orthopyroxene-clinopyroxene framework, essentially pseudomorphing a melt network. Back-scattered electron imaging and element mapping are used to show that some of the clino- and orthopyroxene in Watson 012 also crystallised from silicate melt, and the order of crystallisation was orthopyroxene → clinopyroxene → plagioclase. X-ray diffraction data, supported by bulk geochemistry, are used to show that plagioclase and ortho- and clinopyroxene were added to the Watson 012 sample by through-flowing basaltic melt. Along with the absence of glass and granophyre, this interconnected network of coarse-grained skeletal plagioclase indicates that the sample cooled slowly at depth within the parent body. The evidence of melt flux indicates that Watson 012 formed in the presence of a gravitational gradient, and thus at significant distance from the centre of the H chondrite parent body (the gravitational gradient at the centre would be zero). Our interpretation is that incipient silicate partial melting in Watson 012 occurred when a region of radiogenically heated H6 material located at considerable depth (possibly at ∼15-20 km from surface) was heated by an additional ca. 200-300 °C in association with a large shock event. Due to insulation at depth within an already hot parent body, the post-shock temperature equilibrated and remained above the solidus long enough for widespread equilibrium-based silicate partial melting, and for melt to migrate. Although the observed melting may have been facilitated by additional heating from an impact event, this is not an example of instantaneous shock melting, which produces thermal disequilibrium at short length scales and distinctly different textures. A small number of H, L and LL chondrites have been previously classified as being of petrologic Type 7; with our new criteria to support that classification, these represent our best opportunity to explore the transition from high temperature sub-solidus metamorphism through the onset of silicate partial melting in three different parent bodies.

Comparing early signs and basic symptoms as methods for predicting psychotic relapse in clinical practice.

PubMed

Eisner, Emily; Drake, Richard; Lobban, Fiona; Bucci, Sandra; Emsley, Richard; Barrowclough, Christine

2018-02-01

Early signs interventions show promise but could be further developed. A recent review suggested that 'basic symptoms' should be added to conventional early signs to improve relapse prediction. This study builds on preliminary evidence that basic symptoms predict relapse and aimed to: 1. examine which phenomena participants report prior to relapse and how they describe them; 2. determine the best way of identifying pre-relapse basic symptoms; 3. assess current practice by comparing self- and casenote-reported pre-relapse experiences. Participants with non-affective psychosis were recruited from UK mental health services. In-depth interviews (n=23), verbal checklists of basic symptoms (n=23) and casenote extracts (n=208) were analysed using directed content analysis and non-parametric statistical tests. Three-quarters of interviewees reported basic symptoms and all reported conventional early signs and 'other' pre-relapse experiences. Interviewees provided rich descriptions of basic symptoms. Verbal checklist interviews asking specifically about basic symptoms identified these experiences more readily than open questions during in-depth interviews. Only 5% of casenotes recorded basic symptoms; interviewees were 16 times more likely to report basic symptoms than their casenotes did. The majority of interviewees self-reported pre-relapse basic symptoms when asked specifically about these experiences but very few casenotes reported these symptoms. Basic symptoms may be potent predictors of relapse that clinicians miss. A self-report measure would aid monitoring of basic symptoms in routine clinical practice and would facilitate a prospective investigation comparing basic symptoms and conventional early signs as predictors of relapse. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Patient-perceived acceptability and behaviour change benefits of inhaler reminders and adherence feedback: A qualitative study.

PubMed

Foster, Juliet M; Reddel, Helen K; Usherwood, Tim; Sawyer, Susan M; Smith, Lorraine

2017-08-01

Little is known about patients' perceptions of electronic inhaler reminders, which have emerged in recent years as adherence promotion aids. This study explored asthma patients' attitudes toward the acceptability and utility of inhaler reminders. Participants from a 6-month cluster randomized controlled trial who received reminders for missed doses via SmartTrack adherence monitors (Adherium Ltd) were interviewed to explore their perceptions; interviews were audio-recorded, transcribed and analysed thematically. 18 participants (50% male, mean age 39 years [range 17-68]) were interviewed. Three themes were identified. Acceptability and Feasibility: Interviewees found the monitor easy to use. For some, concerns about the monitor itself affected adherence, e.g. leaving it at home to avoid breakage. Positive features included that reminders played only for missed doses, and the choice of reminder tunes. Utility and Behavioural Impact: Interviewees described reminders as an effective "training" tool for adherence, encouraging habit-formation, behaviour change and attitude change. Reminders were considered less acceptable or useful by participants who preferred taking medication only when symptomatic or who doubted the necessity or safety of their medication. Sustainability: Some interviewees reported sustained behaviour change, supported by reminders, through the establishment of routine or via experiential learning that good adherence improved their asthma. Other interviewees wanted ongoing support (i.e. reminders or substitute adherence cues) after study end. Patients with asthma found 6-months' use of reminders and adherence feedback acceptable and useful for improving their adherence attitudes, adherence behaviours and confidence in asthma self-management. Some patients may benefit from ongoing adherence support. Copyright © 2017 Elsevier Ltd. All rights reserved.

Adults’ Recollections and Perceptions of Childhood Caregiving to a Parent with Significant Physical Disability

PubMed Central

Iezzoni, Lisa I.; Wint, Amy J.; Kuhlthau, Karen A.; Boudreau, Alexy Arauz

2015-01-01

Background Caregiving roles of children < 18 years of age living with parents with health conditions or disability have been studied extensively abroad, but little U.S. research has examined the caregiving activities and perceptions of children with parents with significant physical disability. Objective To examine children’s caregiving activities for their disabled parent, childhood perceptions of these activities, and adult views of this caregiving. Methods We conducted one-hour, semi-structured, open-ended interviews with 20 persons age ≥ 21 years who as children (age < 18 years) had a parent with significant mobility disability. We used conventional content analysis to identify themes. Results Interviewees’ mean (standard deviation) age was 36.7 (13.8) years; 4 were male. As children, most interviewees assisted their disabled parent with activities of daily living (ADLs) and instrumental ADLs; some children provided more medical supports. Several parents, especially of older interviewees, did not seek their children’s care. Interviewees reported both positive and negative childhood attitudes about caregiving. Roughly half recalled as children feeling proud, special, or otherwise positively toward caregiving activities, while about one-third viewed caregiving as just part of their daily reality (i.e., simply needing to be done). Approximately half remembered also feeling resentful, primarily from time demands, insufficient appreciation, and being different from their peers. Interviewees reported gender and cultural factors affecting their caregiving roles and perceptions. Conclusions Children can provide significant care to parents with physical disability. Understanding better their roles and perceptions could suggest ways to improve these experiences for both child and parent. PMID:26712460

Watson: A new link in the IIE iron chain

NASA Technical Reports Server (NTRS)

Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence

1994-01-01

Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.

[The Watson-Crick model of the DNA doublehelix. The history of the discovery and the role of the protein paradigm].

PubMed

Hagemann, Rudolf

2007-01-01

At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).

The Darwinian Center to the Vision of William James.

ERIC Educational Resources Information Center

Bredo, Eric

The essence of William James's vision can sometimes be hard to discover due to emotional volatility and exploratory impulsiveness. On the other hand, beneath James's apparent inconsistency was a constancy of purpose that can be easily underestimated. This paper argues that the center of James's vision lay in an interpretation of Darwinism. By…

[Perception and attitude of rural community to the construction of Asian elephant conservation corridors in Xishuangbanna].

PubMed

Li, Zheng-Ling; Chen, Ming-Yong; Wu, Zhao-Lu; Wang, Qian; Dong, Yong-Hua

2009-06-01

By using contingent valuation method (CVM), an investigation was made from November 2007 to March 2008 on the perception and attitude of 196 households in 5 villages within 2 planned Asian elephant conservation corridors in Xishuangbanna to the construction of the corridors. 80.61% of the interviewees conditionally supported the corridors construction. The main factors affecting the interviewees' support willingness included their education level, per capita income, and perceptions to Asian elephant protection, human-elephant relations, and corridor utilization patterns and its beneficiaries, among which, the interviewees' awareness of Asian elephant conservation, corridor utilization patterns, and corridor beneficiaries had strong influence on the support willingness, with the correlation coefficient being 0.231, 0.236, and -0.304, respectively. The rural community holding the land tenure played a key role in the corridors construction. To effectively design and planning the construction of biological conservation corridor, it is necessary to have a deep understanding on the perceptions and attitudes of rural community to the construction of the corridor and to obtain their support and participation for this construction.

Definitions of Violence: Narratives of Survivors From the War in Bosnia and Herzegovina.

PubMed

Basic, Goran

2018-07-01

Previous research on violence during the war in Bosnia and Herzegovina has resulted in a one-sided presentation of the phenomenon of "war violence." Researchers have emphasized the importance of narratives in general but have not analyzed stories on war violence that were the product of interpersonal interaction and meaning-making activity. The aim of this article is to fill this knowledge gap by analyzing survivor narratives of the 1990s war in northwestern Bosnia. The focus is on analyzing interviewees' descriptions of wartime violence and the discursive patterns that contribute to constructing the phenomenon of "war violence." My analysis reveals an intimate relationship between how an interviewee interprets the biographical consequences of war violence and the individual's own war experiences. All interviewees described war violence as something that is morally reprehensible. These narratives, from both perpetrators of violence and those subjected to violence, recount violent situations that not only exist as mental constructions but also live on even after the war; thus, they have real consequences for the individuals and their society.

Shopping with Acquired Brain Injuries, Coping Strategies and Maslowian Principles.

PubMed

Andersson, Jonas E; Skehan, Terry; Rydén, Monica; Lagerkrans, Elisabeth

2016-01-01

A positive outcome of the modern welfare state is prolonged life expectancy. In Sweden, the expected life span has increased with approximatively 25 years during the 20th century [Statistics Sweden]. However, ageing is associated with an increased risk for acquiring cognitive and physical disabilities. This study is based on anonymized interviews with groups of older persons who experience cognitive problems and relatives. The interviewees were asked about everyday activities like shopping groceries, clothes or other necessities. The interviewees identified problems and described a series of strategies for coping. This paper uses fictionalized characters to present problems and coping strategies that the interviewees use to overcome cognitive challenges when shopping groceries. The strategies range from complete withdrawal, an increased dependency on proxies to the development of elaborate techniques to mask their problem and obtain assistance. Following the current trend in the design of the Swedish sales environment - large scale, abundance of goods and Maslowian strategies for making people stay longer (and spend more money) - accessibility in the built environment is often an absent friend.

77 FR 58773 - Drawbridge Operation Regulations; James River, Newport News, VA

Federal Register 2010, 2011, 2012, 2013, 2014

2012-09-24

... Operation Regulations; James River, Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Notice of temporary... schedule that governs the US 17/258 Bridge across the James River, mile 5.0, at Newport News, VA. The... 17/258 Bridge over the James River, mile 5.0, at Newport News, VA opens on signal as required by 33...

From Father to Son: Generative Care and Gradual Conversion in William James's Writing of "The Varieties"

ERIC Educational Resources Information Center

Bridgers, Lynn; Snarey, John R.

2003-01-01

Using a historical and biographical, then developmental, approach, this article examines William James's spiritual family history by reviewing key events in the life of his father, Henry James, Sr. It pays particular attention to Henry Sr's tumultuous relationship with his own father, William James of Albany, and Henry Sr's subsequent conversion…

William Watson Cheyne (1852-1932): a life in medicine and his innovative surgical treatment of congenital hydrocephalus.

PubMed

Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane

2013-11-01

William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.

Tautomeric transition between wobble A·C DNA base mispair and Watson-Crick-like A·C* mismatch: microstructural mechanism and biological significance.

PubMed

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-06-21

Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)<-->A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.

pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.

PubMed

Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo

2009-11-23

Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

PubMed

Yang, Haozhe; Mei, Hui; Seela, Frank

2015-07-06

Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Impact of self-funding on patient experience of oral anticoagulation self-monitoring: a qualitative study

PubMed Central

Tompson, Alice; Heneghan, Carl; Sutton, Stephen; Fitzmaurice, David; Ward, Alison

2016-01-01

Objective To explore the impact self-funding has on patient experience of oral anticoagulation therapy self-monitoring. Design Semistructured, qualitative interviews were conducted. Transcripts were analysed thematically using constant comparison. Setting England. Participants Interviewees were participants of the Cohort Study of Anticoagulation Self-Monitoring (CASM). Cohort members were recruited as they bought a monitor from the major manufacturer in the UK. A purposive sample was invited to be interviewed on completion of the 12-month cohort follow-up. Data Patient narratives on their experiences of self-monitoring their oral anticoagulation therapy in non-trial conditions. Results 26 interviews were completed. Interviewees viewed purchasing the monitoring device as a long-term commitment balancing the limitations of clinic-based monitoring against the cost. They were unable to try out the monitor prior to purchase and therefore had to be confident in their own ability to use it. The variable provision of self-monitoring equipment caused resentment, and interviewees were uncomfortable negotiating with healthcare professionals. High test strip usage while learning how to use the monitor caused anxiety that was exacerbated by worries about their cost. However, self-funding did mean that interviewees felt a sense of ownership and were determined to persevere to overcome problems. Conclusions Self-funding has negative implications in terms of equity of access; however, the money invested acts as a barrier to discontinuation. If oral anticoagulation therapy self-monitoring devices and consumables were provided free of charge in routine care, the training and support available in England may need to be reviewed to prevent discontinuation rates rising to those observed in clinical trials. PMID:28011812

Use of strategies to improve retention in primary care randomised trials: a qualitative study with in-depth interviews.

PubMed

Brueton, V C; Stevenson, F; Vale, C L; Stenning, S P; Tierney, J F; Harding, S; Nazareth, I; Meredith, S; Rait, G

2014-01-24

To explore the strategies used to improve retention in primary care randomised trials. Qualitative in-depth interviews and thematic analysis. 29 UK primary care chief and principal investigators, trial managers and research nurses. In-depth face-to-face interviews. Primary care researchers use incentive and communication strategies to improve retention in trials, but were unsure of their effect. Small monetary incentives were used to increase response to postal questionnaires. Non-monetary incentives were used although there was scepticism about the impact of these on retention. Nurses routinely used telephone communication to encourage participants to return for trial follow-up. Trial managers used first class post, shorter questionnaires and improved questionnaire designs with the aim of improving questionnaire response. Interviewees thought an open trial design could lead to biased results and were negative about using behavioural strategies to improve retention. There was consensus among the interviewees that effective communication and rapport with participants, participant altruism, respect for participant's time, flexibility of trial personnel and appointment schedules and trial information improve retention. Interviewees noted particular challenges with retention in mental health trials and those involving teenagers. The findings of this qualitative study have allowed us to reflect on research practice around retention and highlight a gap between such practice and current evidence. Interviewees describe acting from experience without evidence from the literature, which supports the use of small monetary incentives to improve the questionnaire response. No such evidence exists for non-monetary incentives or first class post, use of which may need reconsideration. An exploration of barriers and facilitators to retention in other research contexts may be justified.

Use of strategies to improve retention in primary care randomised trials: a qualitative study with in-depth interviews

PubMed Central

Brueton, V C; Stevenson, F; Vale, C L; Stenning, S P; Tierney, J F; Harding, S; Nazareth, I; Meredith, S; Rait, G

2014-01-01

Objective To explore the strategies used to improve retention in primary care randomised trials. Design Qualitative in-depth interviews and thematic analysis. Participants 29 UK primary care chief and principal investigators, trial managers and research nurses. Methods In-depth face-to-face interviews. Results Primary care researchers use incentive and communication strategies to improve retention in trials, but were unsure of their effect. Small monetary incentives were used to increase response to postal questionnaires. Non-monetary incentives were used although there was scepticism about the impact of these on retention. Nurses routinely used telephone communication to encourage participants to return for trial follow-up. Trial managers used first class post, shorter questionnaires and improved questionnaire designs with the aim of improving questionnaire response. Interviewees thought an open trial design could lead to biased results and were negative about using behavioural strategies to improve retention. There was consensus among the interviewees that effective communication and rapport with participants, participant altruism, respect for participant's time, flexibility of trial personnel and appointment schedules and trial information improve retention. Interviewees noted particular challenges with retention in mental health trials and those involving teenagers. Conclusions The findings of this qualitative study have allowed us to reflect on research practice around retention and highlight a gap between such practice and current evidence. Interviewees describe acting from experience without evidence from the literature, which supports the use of small monetary incentives to improve the questionnaire response. No such evidence exists for non-monetary incentives or first class post, use of which may need reconsideration. An exploration of barriers and facilitators to retention in other research contexts may be justified. PMID:24464427

Current use of wild plants with edible underground storage organs in a rural population of Patagonia: between tradition and change.

PubMed

Ochoa, Juan José; Ladio, Ana Haydee

2015-09-25

Edible plants with underground storage organs (USOs) are neglected resources. We studied the local ecological knowledge edible plants with (USOs) in rural populations of North-Patagonia in order to establish how people are utilizing these plants. Some aspect of corpus-praxis-cosmos complex associated to the local ecological knowledge was documented and discussed. In addition, variation in this ecological knowledge due to age, gender, family structure, ethnic self-determination was also evaluated. Semi-structured interviews were conducted with 51 inhabitants in order to study the relationship between the current use of plants with USOs and the age, sex, family group composition and ethnic self-identification of interviewees. In addition, the Cultural Importance Index for each species was calculated. The current richness of known species in these populations is a total of 9 plants. Plants with USOs tend to be used more frequently as the age of the interviewee increases. Women and men showed no differences in the average richness of species cited. The interviewees who share their homes with other generations use these plants more frequently than those who live alone. Our results indicate that the interviewees who identified themselves as belonging to the Mapuche people use these plants more frequently. For the Mapuche people, wild plants have constituted material and symbolic resources of great importance in their historical subsistence. In addition, they are currently being redefined as elements which present a connection with ancestral practices, produce a strong relationship with the 'land', and become markers which identify the 'natural' (historical) ways of their people; these are key elements in the current political processes of identity revaluation. This research is valuable to stimulate cultural revival and health promotion programs in the communities with their own local, cultural food.

Expertise among professional magicians: an interview study.

PubMed

Rissanen, Olli; Pitkänen, Petteri; Juvonen, Antti; Kuhn, Gustav; Hakkarainen, Kai

2014-01-01

The purpose of the present investigation was to analyse interviews of highly regarded Finnish magicians. Social network analysis (N = 120) was used to identify Finland's most highly regarded magicians (N = 16). The selected participants' careers in professional magic and various aspects of their professional conduct were examined by relying on semi-structured interviews. The results revealed that cultivation of professional level competence in magic usually requires an extensive period of time compared with other domains of expertise. Magic is a unique performing art and it differs from other professions focusing on deceiving the audience. A distinctive feature of magical expertise is that the process takes place entirely through informal training supported by communities of magical practitioners. Three interrelated aspects of magical activity were distinguished: magic tricks, performance, and audience. Although magic tricks constitute a central aspect of magic activity, the participants did not talk about their tricks extensively; this is in accordance with the secretive nature of magic culture. The interviews revealed that a core aspect of the magicians' activity is performance in front of an audience that repeatedly validates competence cultivated through years of practice. The interviewees reported investing a great deal of effort in planning, orchestrating, and reflecting on their performances. Close interaction with the audience plays an important role in most interviewees' activity. Many participants put a great deal of effort in developing novel magic tricks. It is common to borrow magic effects from fellow magicians and develop novel methods of implementation. Because magic tricks or programs are not copyrighted, many interviewees considered "stealing" an unacceptable and unethical aspect of magical activity. The interviewees highlighted the importance of personality and charisma in the successful pursuit of magic activity.

Developing a speciality: regearing the specialist public health workforce.

PubMed

Chapman, J; Abbott, S; Carter, Y H

2005-03-01

To identify issues surrounding the future training needs of the specialist public health workforce following the most recent restructuring of the National Health Service (NHS) in England. All directors of public health (DsPH) based in strategic health authorities and nine senior staff working in public health at the regional level were invited to participate in a semi-structured telephone interview. Twenty-six people were interviewed. Many interviewees expressed concern that because consultants and specialists in public health will be working in much smaller teams than hitherto, they will have to generalize their skills to cover a much wider range of functions (including board-level duties). This may result in a loss of specialist expertise. Successful public health practice in the new structures will require new ways of interorganizational working that will add an administrative burden to specialists in public health. Also, the creation of a board-level post in each primary care trust (PCT) has resulted in more time spent on corporate responsibilities and less on public health for DsPH, who are often the only fully trained specialist in public health in their PCT. Furthermore, interviewees expressed their anxiety about the lack of diversity in the posts available to specialists in public health and particularly to those newly completing their specialist training. Generally, interviewees felt that traditional public health roles and responsibilities were being eclipsed by corporate and managerial ones. Professional development activities were being carried out, but in a rather ad-hoc fashion. Interviewees were hopeful that public health networks would lead professional development initiatives once they were more established. It is important that excellence in public health is maintained through a set of accreditable standards, whilst corporate skills, essential to successful public health practice in the new UK NHS, are developed among specialists in public health.

Expertise among professional magicians: an interview study

PubMed Central

Rissanen, Olli; Pitkänen, Petteri; Juvonen, Antti; Kuhn, Gustav; Hakkarainen, Kai

2014-01-01

The purpose of the present investigation was to analyse interviews of highly regarded Finnish magicians. Social network analysis (N = 120) was used to identify Finland's most highly regarded magicians (N = 16). The selected participants' careers in professional magic and various aspects of their professional conduct were examined by relying on semi-structured interviews. The results revealed that cultivation of professional level competence in magic usually requires an extensive period of time compared with other domains of expertise. Magic is a unique performing art and it differs from other professions focusing on deceiving the audience. A distinctive feature of magical expertise is that the process takes place entirely through informal training supported by communities of magical practitioners. Three interrelated aspects of magical activity were distinguished: magic tricks, performance, and audience. Although magic tricks constitute a central aspect of magic activity, the participants did not talk about their tricks extensively; this is in accordance with the secretive nature of magic culture. The interviews revealed that a core aspect of the magicians' activity is performance in front of an audience that repeatedly validates competence cultivated through years of practice. The interviewees reported investing a great deal of effort in planning, orchestrating, and reflecting on their performances. Close interaction with the audience plays an important role in most interviewees' activity. Many participants put a great deal of effort in developing novel magic tricks. It is common to borrow magic effects from fellow magicians and develop novel methods of implementation. Because magic tricks or programs are not copyrighted, many interviewees considered “stealing” an unacceptable and unethical aspect of magical activity. The interviewees highlighted the importance of personality and charisma in the successful pursuit of magic activity. PMID:25566156

Poor and Rich in James: A Relevance Theory Approach to James's Use of the Old Testament

ERIC Educational Resources Information Center

Morales, Nelson R.

2015-01-01

The epistle of James was for years a forgotten book in academic circles. In recent decades, however, a renewed focus on early Judaism has generated interest in looking at James with new eyes. Poverty and wealth in the epistle continues to be a point of interest. Other topics, however, are still to be explored. One of these topics is the rhetorical…

Assistant Secretary of Defense for Legislative Affairs

Science.gov Websites

Links Mission Congressional Links Secretary of Defense James Mattis
James Mattis" title=" Secretary of Defense James Mattis" /> The

Test of time: what if little Albert had escaped?

PubMed

Field, Andy P; Nightingale, Zoë C

2009-04-01

Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.

Applied Meteorology Unit (AMU) Quarterly Report Fourth Quarter FY-14

NASA Technical Reports Server (NTRS)

Bauman, William H.; Crawford, Winifred C.; Watson, Leela R.; Shafer, Jaclyn

2014-01-01

Ms. Crawford completed the final report for the dual-Doppler wind field task. Dr. Bauman completed transitioning the 915-MHz and 50-MHz Doppler Radar Wind Profiler (DRWP) splicing algorithm developed at Marshall Space Flight Center (MSFC) into the AMU Upper Winds Tool. Dr. Watson completed work to assimilate data into model configurations for Wallops Flight Facility (WFF) and Kennedy Space Center/Cape Canaveral Air Force Station (KSC/CCAFS). Ms. Shafer began evaluating the a local high-resolution model she had set up previously for its ability to forecast weather elements that affect launches at KSC/CCAFS. Dr. Watson began a task to optimize the data-assimilated model she just developed to run in real time.

Incentives and intrinsic motivation in healthcare.

PubMed

Berdud, Mikel; Cabasés, Juan M; Nieto, Jorge

It has been established in the literature that workers within public organisations are intrinsically motivated. This paper is an empirical study of the healthcare sector using methods of qualitative analysis research, which aims to answer the following hypotheses: 1) doctors are intrinsically motivated; 2) economic incentives and control policies may undermine doctors' intrinsic motivation; and 3) well-designed incentives may encourage doctors' intrinsic motivation. We conducted semi-structured interviews à-la-Bewley with 16 doctors from Navarre's Healthcare Service (Servicio Navarro de Salud-Osasunbidea), Spain. The questions were based on current theories of intrinsic motivation and incentives to test the hypotheses. Interviewees were allowed to respond openly without time constraints. Relevant information was selected, quantified and analysed by using the qualitative concepts of saturation and codification. The results seem to confirm the hypotheses. Evidence supporting hypotheses 1 and 2 was gathered from all interviewees, as well as indications of the validity of hypothesis 3 based on interviewees' proposals of incentives. The conclusions could act as a guide to support the optimal design of incentive policies and schemes within health organisations when healthcare professionals are intrinsically motivated. Copyright © 2016 SESPAS. Publicado por Elsevier España, S.L.U. All rights reserved.

Physiology as the antechamber to metaphysics: the young William James's hope for a philosophical psychology.

PubMed

Croce, P J

1999-11-01

In the 5 years before 1878, when his career in psychology was becoming established, William James wrote a series of notes and reviews assessing the work of many of the pioneers in the new field. Adopting a public and confident voice, even while he was privately still uncertain and searching, James criticized the dogmatism of positivist and idealist claims to the study of the human brain and mind. In his short writings of 1873-1877, James started to formulate his own middle path. His first steps on that path show that he did not reject either scientific or philosophic inquiry; instead, he viewed scientific knowledge as a way to understand philosophical questions more deeply. Saving his sharpest critiques for positivism, James endorsed scientific investigation without materialist assmptions. While his career in psychology was still only a hope, James treated science as a means toward humanist insight.

Traveltime, reaeration, and water-quality characteristics during low-flow conditions in Wilsons Creek and the James River near Springfield, Missouri

USGS Publications Warehouse

Berkas, W.R.

1987-01-01

Before upgrading the Southwest Wastewater-Treatment Plant near Springfield, Missouri, to tertiary treatment, adverse water quality conditions resulting from discharge of wastewater effluent to Wilson Creek were documented in the creek and in the James River. About 7 years after the upgrading of the treatment plant, traveltime, reaeration, and water quality characteristics were determined in Wilsons Creek and the James River. Traveltime was measured once in Wilsons Creek and twice in the James River during low-flow conditions. Traveltimes in the James River were estimated for discharge between 55 and 200 cu ft/sec at a site near Boaz. Reaeration coefficients were calculated for five reaches in Wilsons Creek and the James River using the modified-tracer technique. Calculated reaeration coefficients were compared with coefficients predicted by twelve empirical equations and one equation was chosen that best fit the data. Water quality data were collected during two 44-hr periods, August 14 to 16, 1984, and July 23 to 25, 1985. Samples were collected at the outflow of the Southwest Wastewater Treatment Plant at seven sites along Wilsons Creek and the James River. Dissolved-oxygen concentrations in Wilsons Creek and the James River were all larger than Missouri 's water quality standard of 5.0 mg/l. Ammonia concentrations and 5-day carbonaceous biochemical oxygen demands were small, which indicated that the oxygen consumption by oxidizing ammonia and carbonaceous organic materials would be insignificant. Measured streambed oxygen demand in the James River was largest directly downstream from Wilsons Creek. (USGS)

Speculation on Curriculum from the Perspective of William James.

ERIC Educational Resources Information Center

Shubert, William H; Zissis, Georgiana

1988-01-01

This article discusses the implications for curriculum theory, research, and practice of William James' thought. Also considered is the question of what curriculum theory and research might be like if James had garnered greater influence than Thorndike. (IAH)

45 CFR 2490.170 - Compliance procedures.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...

45 CFR 2490.170 - Compliance procedures.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...

45 CFR 2400.31 - Selection process.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...

45 CFR 2400.31 - Selection process.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...

45 CFR 2400.31 - Selection process.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION... outstanding applicants from each state for James Madison Fellowships. (b) From among candidates recommended for fellowships by the Fellow Selection Committee, the Foundation will name James Madison Fellows. The...

45 CFR 2490.170 - Compliance procedures.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...

45 CFR 2490.170 - Compliance procedures.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...

45 CFR 2490.170 - Compliance procedures.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Public Welfare Regulations Relating to Public Welfare (Continued) JAMES MADISON MEMORIAL FELLOWSHIP... THE JAMES MADISON MEMORIAL FELLOWSHIP FOUNDATION § 2490.170 Compliance procedures. (a) Except as... for coordinating implementation of this section. Complaints may be sent to James Madison Memorial...

Salvaging the self in a world without soul: William James's The Principles of psychology.

PubMed

Coon, D J

2000-05-01

This article explores William James's transformation of the religious soul into the secular self in The Principles of Psychology. Although James's views on the self are familiar to many historians of psychology, the article places his treatment of the self within the broader social and cultural context of a secularizing, industrializing society. There were palpable tensions and anxieties that accompanied the cultural shift, and these are particularly transparent in James's Principles. James attempted the project of secularizing the soul in order to promote a natural science of the mind but with marked ambivalence for the project, because it left out some of the moral and metaphysical questions of great interest to him.

Silver ions-mediated conformational switch: facile design of structure-controllable nucleic acid probes.

PubMed

Wang, Yongxiang; Li, Jishan; Wang, Hao; Jin, Jianyu; Liu, Jinhua; Wang, Kemin; Tan, Weihong; Yang, Ronghua

2010-08-01

Conformationally constraint nucleic acid probes were usually designed by forming an intramolecular duplex based on Watson-Crick hydrogen bonds. The disadvantages of these approaches are the inflexibility and instability in complex environment of the Watson-Crick-based duplex. We report that this hydrogen bonding pattern can be replaced by metal-ligation between specific metal ions and the natural bases. To demonstrate the feasibility of this principle, two linear oligonucleotides and silver ions were examined as models for DNA hybridization assay and adenosine triphosphate detection. The both nucleic acids contain target binding sequences in the middle and cytosine (C)-rich sequences at the lateral portions. The strong interaction between Ag(+) ions and cytosines forms stable C-Ag(+)-C structures, which promises the oligonucleotides to form conformationally constraint formations. In the presence of its target, interaction between the loop sequences and the target unfolds the C-Ag(+)-C structures, and the corresponding probes unfolding can be detected by a change in their fluorescence emission. We discuss the thermodynamic and kinetic opportunities that are provided by using Ag(+) ion complexes instead of traditional Watson-Crick-based duplex. In particular, the intrinsic feature of the metal-ligation motif facilitates the design of functional nucleic acids probes by independently varying the concentration of Ag(+) ions in the medium.

Trauma-related guilt: conceptual development and relationship with posttraumatic stress and depressive symptoms.

PubMed

Browne, Kendall C; Trim, Ryan S; Myers, Ursula S; Norman, Sonya B

2015-04-01

Despite high prevalence and concerning associated problems, little effort has been made to conceptualize the construct of posttraumatic guilt. This investigation examined the theoretical model of trauma-related guilt proposed by Kubany and Watson (2003). This model hypothesizes that emotional and physical distress related to trauma memories partially mediates the relationship between guilt cognitions and posttraumatic guilt. Using path analysis, this investigation (a) empirically evaluated relationships hypothesized in Kubany and Watson's model, and (b) extended this conceptualization by evaluating models whereby guilt cognitions, distress, and posttraumatic guilt were related to posttraumatic stress disorder (PTSD) symptoms depression symptom severity. Participants were male U.S. Iraq and Afghanistan veterans (N = 149). Results yielded a significant indirect effect from guilt cognitions to posttraumatic guilt via distress, providing support for Kubany and Watson's model (β = .14). Findings suggested distress may be the strongest correlate of PTSD symptoms (β = .47) and depression symptoms (β = .40), and that guilt cognitions may serve to intensify the relationship between distress and posttraumatic psychopathology. Research is needed to evaluate whether distress specific to guilt cognitions operates differentially on posttraumatic guilt when compared to distress more broadly related to trauma memories. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

Small-Angle Neutron Scattering Studies of Magnetic Correlation Lengths in Nanoparticle Assemblies

NASA Astrophysics Data System (ADS)

Majetich, Sara

2009-03-01

Small-angle neutron scattering (SANS) measurements of ordered arrays of surfactant-coated magnetic nanoparticle reveal characteristic length scales associated with interparticle and intraparticle magnetic ordering. The high degree of uniformity in the monodisperse nanoparticle size and spacing leads to a pronounced diffraction peak and allows for a straightforward determination of these length scales [1]. There are notable differences in these length scales depending on the particle moment, which depends on the material (Fe, Co, Fe3O4) and diameter, and also on whether the metal particle core is surrounded by an oxide shell. For 8.5 nm particles containing an Fe core and thick Fe3O4 shell, evidence of a spin flop phase is seen in the magnetite shell when a field is applied , but not when the shell thickness is ˜0.5 nm [2]. 8.0 nm particles with an e-Co core and 0.75 nm CoO shell show no exchange bias effects while similar particles with a 2 nm thick shell so significant training effects below 90 K. Polarized SANS studied of 7 nm Fe3O4 nanoparticle assemblies show the ability to resolve the magnetization components in 3D. [4pt] [1] M. Sachan, C. Bonnoit, S. A. Majetich, Y. Ijiri, P. O. Mensah-Bonsu, J. A. Borchers, and J. J. Rhyne, Appl. Phys. Lett. 92, 152503 (2008). [0pt] [2] Yumi Ijiri, Christopher V. Kelly, Julie A. Borchers, James J. Rhyne, Dorothy F. Farrell, Sara A. Majetich, Appl. Phys. Lett. 86, 243102-243104 (2005). [0pt] [3] K. L. Krycka, R. Booth, J. A. Borchers, W. C. Chen, C. Conlon, T. Gentile, C. Hogg, Y. Ijiri, M. Laver, B. B. Maranville, S. A. Majetich, J. Rhyne, and S. M. Watson, Physica B (submitted).

Re-Presenting James Britton: A Symposium.

ERIC Educational Resources Information Center

Tirrell, Mary Kay; And Others

1990-01-01

Presents revised versions of four symposium papers examining the work of linguist, teacher, and educator of teachers James Britton. Includes "James Britton: An Impressionistic Sketch" (Mary Kay Tirrell); "Collaborating with Jimmy Britton" (Gordon M. Pradl); "Rejoicing in the Margins" (John Warnock); and "A…

1. Historic American Buildings Survey James F. and Jean B. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHEAST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA

2. Historic American Buildings Survey James F. and Jean B. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

2. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 EXTERIOR FROM THE SOUTHWEST Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics

PubMed Central

2016-01-01

Background We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. Objective To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. Methods The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Results Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. Conclusions IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise. PMID:27729304

IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.

PubMed

Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita

2016-10-11

We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix. IBMWA is a new alternative for data analytics software that automates descriptive, predictive, and visual analytics. This program is very user-friendly but requires data preprocessing, statistical conceptual understanding, and domain expertise.

Pretreatment of Parsley (Petroselinum crispum L.) Suspension Cultures with Methyl Jasmonate Enhances Elicitation of Activated Oxygen Species.

PubMed Central

Kauss, H.; Jeblick, W.; Ziegler, J.; Krabler, W.

1994-01-01

Suspension-cultured cells of parsley (Petroselinum crispum L.) were used to demonstrate an influence of jasmonic acid methyl ester (JAME) on the elicitation of activated oxygen species. Preincubation of the cell cultures for 1 d with JAME greatly enhanced the subsequent induction by an elicitor preparation from cell walls of Phytophtora megasperma f. sp. glycinea (Pmg elicitor) and by the polycation chitosan. Shorter preincubation times with JAME were less efficient, and the effect was saturated at about 5 [mu]M JAME. Treatment of the crude Pmg elicitor with trypsin abolished induction of activated oxygen species, an effect similar to that seen with elicitation of coumarin secretion. These results suggest that JAME conditioned the parsley suspension cells in a time-dependent manner to become more responsive to elicitation, reminiscent of developmental effects caused by JAME in whole plants. It is interesting that pretreatment of the parsley cultures with 2,6-dichloroisonicotinic and 5-chlorosalicylic acid only slightly enhanced the elicitation of activated oxygen species, whereas these substances greatly enhanced the elicitation of coumarin secretion. Therefore, these presumed inducers of systemic acquired resistance exhibit a specificity different from JAME. PMID:12232189

Global Demographic Change and Its Implications for Military Power

DTIC Science & Technology

2011-01-01

cent (rather than 9 percent). 11 James W. Vaupel, James R. Carey , and Kaare Christensen, “Aging: It’s Never Too Late,” Science, Vol. 301, No. 5640...3, June 2004, pp. 627–642. 14 Expenses include facility services (hospitalization and nursing home stays), professional services, drugs, dental ...www.census.gov/ipc/www/idb/ Vaupel, James W., James R. Carey , and Kaare Christensen, “Aging: It’s Never Too Late,” Science, Vol. 301, No. 5640, September 19

Aerial photographic water color variations from pollution in the James River

NASA Technical Reports Server (NTRS)

Bressette, W. E.

1978-01-01

A photographic flight was made over the James River on May 17, 1977. The data show that, in general, James River water has very high sunlight reflectance. In the Bailey Bay area this reflectance is drastically reduced. Also shown is a technique for normalizing off-axis variations in radiance film exposure from camera falloff and uneven sunlight conditions to the nadir value. After data normalization, a spectral analysis is performed that identifies Bailey Creek water in James River water. The spectral results when compared with laboratory spectrometer data indicate that reflectance from James River water is dominated by suspended matter, while the substance most likely responsible for reduced reflectance in Bailey Creek water is dissolved organic carbon.

ACHP | News

Science.gov Websites

places to live, work and visit." The newly designated communities are the James Street Commons five geographical wards, and the two neighborhoods represent the city's Central Ward (James Street Preservation and First Lady Michelle Obama are recognizing two of our most exciting neighborhoods, the James

77 FR 32889 - Airworthiness Directives; The Boeing Company Airplanes

Federal Register 2010, 2011, 2012, 2013, 2014

2012-06-04

...., Washington, DC 20590. FOR FURTHER INFORMATION CONTACT: James Sutherland, Aerospace Engineer, Airframe Branch... 98057-3356; phone: 425- 917-6533; fax: 425-917-6590; email: James.Sutherland@faa.gov . SUPPLEMENTARY... more information about this AD, contact James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S...

77 FR 42962 - Airworthiness Directives; The Boeing Company Airplanes

Federal Register 2010, 2011, 2012, 2013, 2014

2012-07-23

... INFORMATION CONTACT: James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S, FAA, Seattle Aircraft...-6590; email: James.Sutherland@faa.gov . SUPPLEMENTARY INFORMATION: Discussion We issued a notice of... this AD, contact James Sutherland, Aerospace Engineer, Airframe Branch, ANM-120S, FAA, Seattle Aircraft...

37 CFR 360.4 - Compliance with statutory dates.

Code of Federal Regulations, 2012 CFR

2012-07-01

... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

37 CFR 360.13 - Compliance with statutory dates.

Code of Federal Regulations, 2013 CFR

2013-07-01

... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

37 CFR 360.13 - Compliance with statutory dates.

Code of Federal Regulations, 2012 CFR

2012-07-01

... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

37 CFR 360.13 - Compliance with statutory dates.

Code of Federal Regulations, 2014 CFR

2014-07-01

... delivered to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

37 CFR 360.4 - Compliance with statutory dates.

Code of Federal Regulations, 2013 CFR

2013-07-01

... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

37 CFR 360.4 - Compliance with statutory dates.

Code of Federal Regulations, 2014 CFR

2014-07-01

... to the Copyright Office Public Information Office, in the James Madison Memorial Building, Room LM... Congress, James Madison Memorial Building, 101 Independence Avenue, SE., Washington, DC 20559-6000. Claims... envelope must be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial...

3. Historic American Buildings Survey James F. and Jean B. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

3. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 ORIGINAL MANTELPIECE AND WINDOW SHUTTERS, FIRST FLOOR Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA

The SHARPn Project on Secondary Use of Electronic Medical Record Data: Progress, Plans, and Possibilities

PubMed Central

Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

2011-01-01

SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010. PMID:22195076

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.

By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of {sup 13}C,{sup 16}O, and {sup 18}O from Penning-trap mass spectrometry, we determine the atomic mass of {sup 17}O to be M[{sup 17}O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of {sup 17}O with the more precise result M[{sup 17}O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of {sup 17}O to better thanmore » 1 part in 10{sup 8}.« less

The SHARPn project on secondary use of Electronic Medical Record data: progress, plans, and possibilities.

PubMed

Chute, Christopher G; Pathak, Jyotishman; Savova, Guergana K; Bailey, Kent R; Schor, Marshall I; Hart, Lacey A; Beebe, Calvin E; Huff, Stanley M

2011-01-01

SHARPn is a collaboration among 16 academic and industry partners committed to the production and distribution of high-quality software artifacts that support the secondary use of EMR data. Areas of emphasis are data normalization, natural language processing, high-throughput phenotyping, and data quality metrics. Our work avails the industrial scalability afforded by the Unstructured Information Management Architecture (UIMA) from IBM Watson Research labs, the same framework which underpins the Watson Jeopardy demonstration. This descriptive paper outlines our present work and achievements, and presages our trajectory for the remainder of the funding period. The project is one of the four Strategic Health IT Advanced Research Projects (SHARP) projects funded by the Office of the National Coordinator in 2010.

Insights to primitive replication derived from structures of small oligonucleotides

NASA Technical Reports Server (NTRS)

Smith, G. K.; Fox, G. E.

1995-01-01

Available information on the structure of small oligonucleotides is surveyed. It is observed that even small oligomers typically exhibit defined structures over a wide range of pH and temperature. These structures rely on a plethora of non-standard base-base interactions in addition to the traditional Watson-Crick pairings. Stable duplexes, though typically antiparallel, can be parallel or staggered and perfect complementarity is not essential. These results imply that primitive template directed reactions do not require high fidelity. Hence, the extensive use of Watson-Crick complementarity in genes rather than being a direct consequence of the primitive condensation process, may instead reflect subsequent selection based on the advantage of accuracy in maintaining the primitive genetic machinery once it arose.

Institutional Conservation Program evaluation project: Results of higher education survey pretest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernard, M.J. III; Collins, N.E.; Ettinger, G.

Teams from Argonne National Laboratory, Lawrence Berkeley Laboratory, and the US Department of Energy visited 14 colleges and universities to pretest a survey instrument that will be mailed to all US colleges and universities to solicit information about energy conservation activities and decision-making processes. The results of the pretest, the final higher education questionnaire, and implications for an elementary and secondary education questionnaire are the primary subjects of this report. Because interviewees offered anecdotes and advice about equipment, management, finances, and maintenance that may be useful to others, narrative summaries of each visit are included. The report also contains themore » interviewees' responses to the pretest questions.« less

37 CFR 301.2 - Official addresses.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

37 CFR 301.2 - Official addresses.

Code of Federal Regulations, 2013 CFR

2013-07-01

..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

37 CFR 301.2 - Official addresses.

Code of Federal Regulations, 2014 CFR

2014-07-01

..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

37 CFR 301.2 - Official addresses.

Code of Federal Regulations, 2012 CFR

2012-07-01

..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

4. Historic American Buildings Survey James F. and Jean B. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. Historic American Buildings Survey James F. and Jean B. O'Gorman, Photographers October 1963 LATE 19th-CENTURY MANTELPIECE IN FIRST FLOOR ROOM Gift of James F. and Jean B. O'Gorman - Stephen Higginson Jr. House, 7 Kirkland Street, Cambridge, Middlesex County, MA

37 CFR 301.2 - Official addresses.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., Room LM-401 in the James Madison Memorial Building, Monday through Friday, between 8:30 a.m. and 5 p.m., and be addressed as follows: Copyright Royalty Board, Library of Congress, James Madison Memorial... Royalty Board, Library of Congress, James Madison Memorial Building, 101 Independence Avenue, SE...

75 FR 62421 - Notice of Lodging of Consent Decree Under the Clean Air Act

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-08

... States of America v. James Valley Ethanol, LLC, Northern Lights Ethanol, LLC, and Poet Plant Management... Ethanol, LLC (``James Valley''), Northern Lights Ethanol, LLC (``Northern Lights''), and POET Plant.... Defendant James Valley owns an ethanol production facility in Brown County, South Dakota, near Groton (the...

75 FR 9904 - James A. Holland; Denial of Hearing; Final Debarment Order

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-04

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration [Docket No. FDA-2009-N-0205] James A. Holland; Denial of Hearing; Final Debarment Order AGENCY: Food and Drug Administration, HHS. ACTION: Notice. SUMMARY: The Food and Drug Administration (FDA) is denying James A. Holland's request for...

78 FR 50458 - Entergy Nuclear Operations, Inc., James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-19

... Nuclear Operations, Inc., James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee Nuclear Power Station, Pilgrim Nuclear Power Station, Request for Action AGENCY: Nuclear Regulatory Commission. ACTION: Request... that the NRC take action with regard to James A. Fitzpatrick Nuclear Power Plant, Vermont Yankee...

Henry James on the Art of Acting.

ERIC Educational Resources Information Center

Thompson, David W.

Henry James, the nineteenth-century American novelist, also served on occasion as a theatre critic. Between 1875 and 1890 he reviewed several productions in Boston, New York, London, and Paris for "Atlantic Monthly" and other periodicals. The reviews are of interest because of James' high standards regarding acting and his often…

William James's Moral Theory

ERIC Educational Resources Information Center

Cooper, Wesley

2003-01-01

James's moral theory, primarily as set out in "The Moral Philosopher and the Moral Life" (in his "The Will To Believe" (1897)), is presented here as having a two-level structure, an empirical or historical level where progress toward greater moral inclusiveness is central, and a metaphysical or end-of-history level--James's "kingdom of…

78 FR 24232 - National Register of Historic Places; Notification of Pending Nominations and Related Actions

Federal Register 2010, 2011, 2012, 2013, 2014

2013-04-24

... Air Forces Contract Pilot School (Primary), 2700 S. Peterson Ave., Douglas, 13000270 Jones County James, Lemuel and Mary House, 153 James Rd., James, 13000271 Thomas County Hopkins, Judge Henry William..., Inc.--Ouachita Candy Company, Inc., 215 Walnut St., Monroe, 13000275 NEBRASKA Douglas County Olson's...

Religion and organ donation: the views of UK faith leaders.

PubMed

Randhawa, Gurch; Brocklehurst, Anna; Pateman, Ruth; Kinsella, Suzannah; Parry, Vivienne

2012-09-01

This article reports the findings from the one-to-one interviews with the main UK faith and belief leaders which were commissioned by the Organ Donation Taskforce as part of its evidence gathering. Interviews were arranged with the main faith and belief organisations within the UK. Interviews covered a range of issues related to organ donation. Although some faith groups had some reservations regarding organ donation, interviews with these leaders demonstrated that none of these faith groups have reached a consensus against organ donation. The interviewees stated that the majority opinion in their faith or belief group is to permit organ donation, with some actively supporting it. Interviewees were keen to stress that there is a broad spectrum of opinion on organ transplantation within each faith and belief group and that consequently it is difficult to speak on behalf of an entire group. One complication mentioned by interviewees is that as organ transplantation is a relatively new medical procedure, there is no explicit reference to it in many original religious texts. Consequently, positions on the receipt and donation of organs are based on interpretation. It was felt that a much greater level of engagement is needed, as organ donation is currently not a priority for many faith and belief groups.

Reasons for self-medication and perceptions of risk among Mexican migrant farm workers.

PubMed

Horton, Sarah; Stewart, Analisia

2012-08-01

Although the frequency of self-medication among Mexican migrants has been well-documented in the public health literature, the multiple reasons for this practice are poorly understood. Most studies point to migrants' cultural preferences for Mexican medications, their prior experiences in countries where antibiotics are loosely regulated, and their lack of access to health care as the primary factors behind their self-medication. Based on participant observation and in-depth interviews with 23 Mexican migrants in a farm working community in the interior of California, we argue that occupational vulnerability is an equally important factor that encourages self-medication. All 23 of our interviewees reported having engaged in some degree of self-medication, notable in this location 8 h from the US-Mexico border. Among interviewees, occupational vulnerability represented an even more important factor influencing self-medication than lack of health insurance or lack of legal documentation. While interviewees did express a preference for Mexican medications as more potent and effective, this did not necessarily translate to a preference for using them without a doctor's supervision. Finally, we show that rather than remaining unaware of the risks of following this custom "transported from Latin America", Mexican migrants devised an elaborate hierarchy of resort of the safest self-medication practices to follow.

Using Electronic Health Records to Support Clinical Trials: A Report on Stakeholder Engagement for EHR4CR

PubMed Central

McCowan, Colin; Thomson, Elizabeth; Szmigielski, Cezary A.; Kalra, Dipak; Sullivan, Frank M.; Prokosch, Hans-Ulrich; Dugas, Martin; Ford, Ian

2015-01-01

Background. The conduct of clinical trials is increasingly challenging due to greater complexity and governance requirements as well as difficulties with recruitment and retention. Electronic Health Records for Clinical Research (EHR4CR) aims at improving the conduct of trials by using existing routinely collected data, but little is known about stakeholder views on data availability, information governance, and acceptable working practices. Methods. Senior figures in healthcare organisations across Europe were provided with a description of the project and structured interviews were subsequently conducted to elicit their views. Results. 37 structured interviewees in Germany, UK, Switzerland, and France indicated strong support for the proposed EHR4CR platform. All interviewees reported that using the platform for assessing feasibility would enhance the conduct of clinical trials and the majority also felt it would reduce workloads. Interviewees felt the platform could enhance trial recruitment and adverse event reporting but also felt it could raise either ethical or information governance concerns in their country. Conclusions. There was clear support for EHR4CR and a belief that it could reduce workloads and improve the conduct and quality of trials. However data security, privacy, and information governance issues would need to be carefully managed in the development of the platform. PMID:26539523

Knowledge, attitude and practice of mammography among women users of public health services.

PubMed

Marinho, Luiz Alberto Barcelos; Cecatti, José Guilherme; Osis, Maria José Duarte; Gurgel, Maria Salete Costa

2008-04-01

To evaluate knowledge, attitude and practice related to mammography among women users of local health services, identifying barriers to its performance. A total of 663 women were interviewed at 13 local health centers in a city of Southeastern Brazil, in 2001. Interviewees were randomly selected at each center and they were representative from different socioeconomic conditions. The number of interviewees at each center was proportional to monthly mean appointments. For data analysis, answers were described as knowledge, attitude, practice and their respective adequacies and then they were correlated with control variables through the chi-square test. Only 7.4% of the interviewees had adequate knowledge on mammography, while 97.1% of women had an adequate attitude. The same was seen for the practice of mammography that was adequate in 35.7% of the cases. The main barrier to mammography was lack of referral by physicians working at the health center (81.8%). There was an association between adequacy of attitude and five years or more of education and being married. There was also an association between adequacy of mammography practice and being employed and family income up to four minimum wages. Women users of local health services had no adequate knowledge and practice related to mammography despite having an adequate attitude about this exam.

Using Electronic Health Records to Support Clinical Trials: A Report on Stakeholder Engagement for EHR4CR.

PubMed

McCowan, Colin; Thomson, Elizabeth; Szmigielski, Cezary A; Kalra, Dipak; Sullivan, Frank M; Prokosch, Hans-Ulrich; Dugas, Martin; Ford, Ian

2015-01-01

The conduct of clinical trials is increasingly challenging due to greater complexity and governance requirements as well as difficulties with recruitment and retention. Electronic Health Records for Clinical Research (EHR4CR) aims at improving the conduct of trials by using existing routinely collected data, but little is known about stakeholder views on data availability, information governance, and acceptable working practices. Senior figures in healthcare organisations across Europe were provided with a description of the project and structured interviews were subsequently conducted to elicit their views. 37 structured interviewees in Germany, UK, Switzerland, and France indicated strong support for the proposed EHR4CR platform. All interviewees reported that using the platform for assessing feasibility would enhance the conduct of clinical trials and the majority also felt it would reduce workloads. Interviewees felt the platform could enhance trial recruitment and adverse event reporting but also felt it could raise either ethical or information governance concerns in their country. There was clear support for EHR4CR and a belief that it could reduce workloads and improve the conduct and quality of trials. However data security, privacy, and information governance issues would need to be carefully managed in the development of the platform.

Andrea Watson | NREL

Science.gov Websites

energy solutions for emission mitigation, international climate change strategies, and renewable energy technical decision making. Andrea's expertise lies in strategic planning, change strategies, and decision

The role of primary health care services to better meet the needs of Aboriginal Australians transitioning from prison to the community.

PubMed

Lloyd, Jane E; Delaney-Thiele, Dea; Abbott, Penny; Baldry, Eileen; McEntyre, Elizabeth; Reath, Jennifer; Indig, Devon; Sherwood, Juanita; Harris, Mark F

2015-07-22

Aboriginal Australians are more likely than other Australians to cycle in and out of prison on remand or by serving multiple short sentences-a form of serial incarceration and institutionalisation. This cycle contributes to the over-representation of Aboriginal Australians in prison and higher rates of recidivism. Our research examined how primary health care can better meet the health care and social support needs of Aboriginal Australians transitioning from prison to the community. Purposive sampling was used to identify 30 interviewees. Twelve interviews were with Aboriginal people who had been in prison; ten were with family members and eight with community service providers who worked with former inmates. Thematic analysis was conducted on the interviewees' description of their experience of services provided to prisoners both during incarceration and on transition to the community. Interviewees believed that effective access to primary health care on release and during transition was positively influenced by providing appropriate healthcare to inmates in custody and by properly planning for their release. Further, interviewees felt that poor communication between health care providers in custody and in the community prior to an inmate's release, contributed to a lack of comprehensive management of chronic conditions. System level barriers to timely communication between in-custody and community providers included inmates being placed on remand which contributed to uncertainty regarding release dates and therefore difficulties planning for release, cycling in and out of prison on short sentences and being released to freedom without access to support services. For Aboriginal former inmates and family members, release from prison was a period of significant emotional stress and commonly involved managing complex needs. To support their transition into the community, Aboriginal former inmates would benefit from immediate access to culturally- responsive community -primary health care services. At present, however, pre-release planning is not always available, especially for Aboriginal inmates who are more likely to be on remand or in custody for less than six months.

Equity in interviews: do personal characteristics impact on admission interview scores?

PubMed

Lumb, Andrew B; Homer, Matthew; Miller, Amy

2010-11-01

Research indicates that some social groups are disadvantaged by medical school selection systems. The stage(s) of a selection process at which this occurs is unknown, but at interview, when applicant and interviewer are face-to-face, there is potential for social bias to occur. We performed a detailed audit of the interview process for a single-entry year to a large UK medical school. Our audit included investigating the personal characteristics of both interviewees and interviewers to find out whether any of these factors, including the degree of social matching between individual pairs of interviewees and interviewers, influenced the interview scores awarded. A total of 320 interviewers interviewed 734 applicants, providing complete data for 2007 interviewer-interviewee interactions. The reliability of the interview process was estimated using generalisability theory at 0.82-0.87. For both interviewers and interviewees, gender, ethnic background, socio-economic group and type of school attended had no influence on the interview scores awarded or achieved. Staff and student interviewer marks did not differ significantly. Although numbers in each group of staff interviewers were too small for formal statistical analysis, there were no obvious differences in marks awarded between different medical specialties or between interviewers with varying amounts of interviewing experience. Our data provide reassurance that the interview does not seem to be the stage of selection at which some social groups are disadvantaged. These results support the continued involvement of senior medical students in the interview process. Despite the lack of evidence that an interview is useful for predicting future academic or clinical success, most medical schools continue to use interviews as a fundamental component of their selection process. Our study has shown that at least this arguably misplaced reliance upon interviewing is not introducing further social bias into the selection system. © Blackwell Publishing Ltd 2010.

Life after a lung transplant: a balance of joy and challenges.

PubMed

Graarup, Jytte; Mogensen, Elin Lindberg; Missel, Malene; Berg, Selina Kikkenborg

2017-11-01

To describe patients' experiences throughout the first four months post-lung transplant. Health professionals are familiar with the fact that patients' average survival after a lung transplant is about seven years and that 74% of these patients reject new organs within the first two years. By contrast, knowledge of these patients' perspectives after lung transplantation is scant. A qualitative study was conducted between May 2013-May 2014 in which 26 interviewees participated - four months post-transplant - based on a semistructured interview guide. The data were inductively analysed using a content thematic approach within a phenomenological and hermeneutic frame. The main findings in the study reveal that (1) having a lung transplant is an overwhelming experience, which for some patients includes (2) troubling physical and psychological challenges. The interviewees were happy to get another chance to live, although some of them suffered from medical side effects, postoperative complications and psychological problems. When asked about the future, interviewees stated that life could be described as (3) a balance of joy and challenges. They had received a new chance in life and were eager to fulfil their life hopes and dreams. At the same time, they were worried about the future. Having a lung transplant implies rules that have to be followed. What are the healthy choices they are supposed to make? And will there be a tomorrow? Having a lung transplant is described as an overwhelming experience because of the improvement in the physical function of the body. Patients were grateful to family, friends and healthcare professionals for supporting them. The first four months post-transplantation were described as both physically and psychologically challenging. Interviewees were aware of the prognosis for patients following lung transplantation. They expressed feelings of worry and insecurity but still had hopes and dreams. The patients are troubled by both physical and psychological challenges after lung transplantation. Several areas call for interventions from healthcare professionals during the early post-transplant period. © 2017 John Wiley & Sons Ltd.

Seasonal fish community variation in headwater mangrove creeks in the southwestern everglades: An examination of their role as dry-down refuges

USGS Publications Warehouse

Rehage, Jennifer S.; Loftus, W.F.

2007-01-01

The connectivity between the fish community of estuarine mangroves and that of freshwater habitats upstream remains poorly understood. In the Florida Everglades, mangrove-lined creeks link freshwater marshes to estuarine habitats downstream and may act as dry-season refuges for freshwater fishes. We examined seasonal dynamics in the fish community of ecotonal creeks in the southwestern region of Everglades National Park, specifically Rookery Branch and the North and Watson rivers. Twelve low-order creeks were sampled via electrofishing, gill nets, and minnow traps during the wet season, transition period, and dry season in 2004-2005. Catches were greater in Rookery Branch than in the North and Watson rivers, particularly during the transition period. Community composition varied seasonally in Rookery Branch, and to a greater extent for the larger species, reflecting a pulse of freshwater taxa into creeks as marshes upstream dried periodically. The pulse was short-lived, a later sample showed substantial decreases in freshwater fish numbers. No evidence of a similar influx was seen in the North and Watson rivers, which drain shorter hydroperiod marshes and exhibit higher salinities. These results suggest that head-water creeks can serve as important dry-season refugia. Increased freshwater flow resulting from Everglades restoration may enhance this connectivity. ?? 2007 Rosenstiel School of Marine and Atmospheric Science of the University of Miami.

Electronic coupling between Watson-Crick pairs for hole transfer and transport in desoxyribonucleic acid

NASA Astrophysics Data System (ADS)

Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker

2001-04-01

Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.

RNAHelix: computational modeling of nucleic acid structures with Watson-Crick and non-canonical base pairs.

PubMed

Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju

2017-02-01

Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.

8. John and James Dobson Carpet Mill, East and West ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

8. John and James Dobson Carpet Mill, East and West Parcels, site plan, and survey lower left, 1865. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1865, p. 279. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA

Map showing quarries, mines, prospects, and sample data in and near the James River Face Wilderness, Bedford and Rockbridge counties, Virginia

USGS Publications Warehouse

Gazdik, Gertrude C.; Ross, Robert B.

1982-01-01

The area, on the crest of the Blue Ridge Mountains, is drained by small tributaries of the James River.  Altitudes range from 600 ft where U.S. Route 501 crosses the James River to 3,073 ft on Highcock Knob.

Development of an Integrated Mobile Robot System at Carnegie Mellon University: June 1988

DTIC Science & Technology

1989-07-01

Kevin Dowling, Thad Druffel, James Frazier, Eric Hoffman, Ralph Hyre, James Ladd, James Martin, Clark McDonald, Jim Moody, I’enning Pangels, David ... Simon , Bryon Smith, Eddie Wyatt, Yoshi ""to, Taka Fujimori, nso Kweon, Doug Reece, and Tony Stentz. 3 Section I Introduction Introduction and Overview

James Madison High School. A Curriculum for American Students.

ERIC Educational Resources Information Center

Bennett, William J.

This document presents the Secretary of Education's personal concept of a sound secondary school core curriculum. It is called "James Madison High School" in honor of President James Madison and his strong views that the people, in order to govern properly, must arm themselves with knowledge. The theoretical curriculum consists of four…

Space perception and William James's metaphysical presuppositions.

PubMed

Farrell, Martin J

2011-05-01

William James's overtly philosophical work may be more continuous with his psychological work than is sometimes thought. His Essays in Radical Empiricism can be understood as an explicit statement of the absolute presupposition that formed the basis of Jamesian psychology: that direct experience is primary and has to be taken at face value. An examination of James's theory of space perception suggests that, even in his early work, he presupposed the primacy of direct experience, and that later changes in his account of space perception can be understood as making his view more consistent with this presupposition. In his earlier view of space perception, James argued that sensations were directly experienced as spatial, though he accepted that spatial relations between sensations may be constructed by higher order thought. In his later view, however, James argued that spatial relations were just as directly experienced as sensations. The work of T. H. Green may have prompted James to recognize the full consequence of his ideas and to realize that taking experience at face value required that spatial relations be thought of as intrinsic to experience rather than the result of intellectual construction.

[Nicolas Dobo and Pierre Jame about the army medical general Lucian Jame].

PubMed

Dobo, N; Jame, P

1996-01-01

Lucien Jame was born October the 20th 1891 at Gourdon (Lot). State Police Officer's son, he studied in Lyon at the Military Health School. Called up August the 6th 1914, he shined among many fights and wore a lot of medals. After the armistice he defended his thesis upon "Venereal diseases prophylaxis study". March the 9th 1921, medical Officer in South Algeria, he published some original articles regarding to leprosis, tuberculosis and malaria. After a competitive examination in France, Lucien Jame became a Medical Commanding Officer of Military Health Service in Toulouse where Nicolas Dobo was at his disposal. August the 6th 1943, in the same rank in Algier then in Rabat, Lucien Jame reached the top of his career as Chief Executive of Military Health Service. He planed First French army medical operations through Italy, France and Germany battles. "Grand-Officier de la Légion d'honneur", the Army Medical General Lucien Jame retired but kept on with works dedicated to hygiene and preventive medicine till he died, June the 16th, 1969.

Richard Watson.

PubMed

Wright, Ian; Bevin, William

2017-11-25

An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.

The Chemical Adventures of Sherlock Holmes: The Blackwater Escape.

ERIC Educational Resources Information Center

Waddell, Thomas G.; Rybolt, Thomas R.

2003-01-01

Presents a mystery based on the well-known characters, Sherlock Holmes and Dr. Watson. Emphasizes qualitative inorganic analysis, laboratory observations, and oxidation-reduction processes. (Author/YDS)

Integration of Statistical and Physical Models of Short Fatigue Crack Growth.

DTIC Science & Technology

1987-02-01

M.R. James and B.N. Cox, *Fundamental Characterization of Surface Microplasticity ," Final Report on NSF Grant No. DMR-8310652, July 1986. 23. W.L...Dec. 1985. 24. W.L. Morris, B.N. Cox and M.R. James, " Microplastic Deformation of Al 2219- T85 I," to be published in Acta Metall. 25. B.N. Cox, W.L...Morris and M.R. James, "Two-Stage Microplastic Surface Defor- mation in Al 2219-T851," to be published in Acta Metall. 26. W.L. Morris, M.R. James and

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brauer, Carolyn S.; Pearson, John C.; Drouin, Brian J.

The spectrum of ethyl cyanide, or propionitrile (CH{sub 3}CH{sub 2}CN), has been repeatedly observed in the interstellar medium with large column densities and surprisingly high temperatures in hot core sources. The construction of new, more sensitive, observatories accessing higher frequencies such as Herschel, ALMA, and SOFIA have made it important to extend the laboratory data for ethyl cyanide to coincide with the capabilities of the new instruments. We report extensions of the laboratory measurements of the rotational spectrum of ethyl cyanide in its ground vibrational state to 1.6 THz. A global analysis of the ground state, which includes all ofmore » the previous data and 3356 newly assigned transitions, has been fitted to within experimental error to J = 132, K = 36, using both Watson A-reduced and Watson S-reduced Hamiltonians.« less

Visible contrast energy metrics for detection and discrimination

NASA Astrophysics Data System (ADS)

Ahumada, Albert J.; Watson, Andrew B.

2013-03-01

Contrast energy was proposed by Watson, Barlow, and Robson (Science, 1983) as a useful metric for representing luminance contrast target stimuli because it represents the detectability of the stimulus in photon noise for an ideal observer. We propose here the use of visible contrast energy metrics for detection and discrimination among static luminance patterns. The visibility is approximated with spatial frequency sensitivity weighting and eccentricity sensitivity weighting. The suggested weighting functions revise the Standard Spatial Observer (Watson and Ahumada, J. Vision, 2005) for luminance contrast detection , extend it into the near periphery, and provide compensation for duration. Under the assumption that the detection is limited only by internal noise, both detection and discrimination performance can be predicted by metrics based on the visible energy of the difference images.

An atlas of the (near) future: cognitive computing applications for medical imaging (Conference Presentation)

NASA Astrophysics Data System (ADS)

LeGrand, Anne

2017-02-01

The role of medical imaging in global health systems is literally fundamental. Like labs, medical images are used at one point or another in almost every high cost, high value episode of care. CT scans, mammograms, and x-rays, for example, "atlas" the body and help chart a course forward for a patient's care team. Imaging precision has improved as a result of technological advancements and breakthroughs in related medical research. Those advancements also bring with them exponential growth in medical imaging data. As IBM trains Watson to "see" medical images, Ms. Le Grand will discuss recent advances made by Watson Health and explore the potential value of "augmented intelligence" to assist healthcare providers like radiologists and cardiologists, as well as the patients they serve.

Exploring William James's Radical Empiricism and Relational Ontologies for Alternative Possibilities in Education

ERIC Educational Resources Information Center

Thayer-Bacon, Barbara J.

2017-01-01

In "A Pluralistic Universe," James argues that the world we experience is more than we can describe. Our theories are incomplete, open, and imperfect. Concepts function to try to shape, organize, and describe this open, flowing universe, while the universe continually escapes beyond our artificial boundaries. For James and myself, the…

11. John and James Dobson Carpet Mill, East and West ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

11. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-lower left, and survey-right, 1877. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1877, pp. 1095-1096. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA

13. John and James Dobson Carpet Mill, East and West ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

13. John and James Dobson Carpet Mill, East and West parcels, site plan-upper left, elevation-upper right, and survey-below, 1885. Hexamer, Ernest and Son. Hexamer General Surveys, 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1885, pp. 1890-1891. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA

9. John and James Dobson Carpet Mill, portion of West ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. John and James Dobson Carpet Mill, portion of West parcel, site plan-left, elevation-upper right, and survey-lower right, 1873. Hexamer, Ernest and Son. Hexamer General Surveys 1867-1895, Philadelphia, Pennsylvania: E. Hexamer and Son, 1873, pp. 670-671. - John & James Dobson Carpet Mill (West Parcel), 4041-4055 Ridge Avenue, Philadelphia, Philadelphia County, PA

Landscapes of Removal and Resistance: Edwin James's Nineteenth-Century Cross-Cultural Collaborations

ERIC Educational Resources Information Center

Lyndgaard, Kyhl

2010-01-01

The life of Edwin James (1797-1861) is bookended by the Lewis and Clark expedition (1803-6) and the Civil War (1861-65). James's work engaged key national concerns of western exploration, natural history, Native American relocation, and slavery. His principled stands for preservation of lands and animals in the Trans-Mississippi West and his…

Michael Woodhouse | NREL

Science.gov Websites

, physics and chemistry. (1998-2002) Featured Publications Fu, R., T.L. James, M. Woodhouse. "Economic /10.1039/C3EE40701B. Goodrich, A., P. Hacke, Q. Wang, B. Sopori, R. Margolis, T.L. James, and Woodhouse, M InformationMicrosoft Excel. Woodhouse, M., A. Goodrich, R. Margolis, T.L. James, M. Lokanc, and R. Eggert. "

77 FR 27118 - Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA

Federal Register 2010, 2011, 2012, 2013, 2014

2012-05-09

... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0114] RIN 1625-AA00 Safety Zone; Rocketts Red Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA... Glare Fireworks, Ancarrows Landing Park, James River, Richmond, VA in the Federal Register (76 FR 13525...

Toni Wolff-James Kirsch correspondence.

PubMed

Kirsch, Thomas B

2003-09-01

This paper draws on the letters between Toni Wolff and James Kirsch from 1929-1933 and from 1949-1953 to highlight some aspects of Toni Wolff's relationship with her superviser and former analysand, James Kirsch. Her personality, her approach to her work as analyst, and her relationship with Jung and with colleagues are illustrated with selected quotes from the correspondence.

33 CFR 165.504 - Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 33 Navigation and Navigable Waters 2 2014-07-01 2014-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...

78 FR 48609 - Safety Zone; James River; Newport News, VA

Federal Register 2010, 2011, 2012, 2013, 2014

2013-08-09

...-AA00 Safety Zone; James River; Newport News, VA AGENCY: Coast Guard, DHS. ACTION: Temporary final rule...-0670 to read as follows: Sec. 165.T05-0670 Safety Zone, James River, Newport News, VA. (a) Definitions...'11'' N longitude 076[deg]38'40'' W, located near Fort Eustis in Newport News, VA. (c) Regulations. (1...

33 CFR 165.504 - Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 33 Navigation and Navigable Waters 2 2011-07-01 2011-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...

33 CFR 165.504 - Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 33 Navigation and Navigable Waters 2 2013-07-01 2013-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...

33 CFR 165.504 - Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...

33 CFR 165.504 - Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va.

Code of Federal Regulations, 2012 CFR

2012-07-01

... 33 Navigation and Navigable Waters 2 2012-07-01 2012-07-01 false Newport News Shipbuilding and Dry Dock Company Shipyard, James River, Newport News, Va. 165.504 Section 165.504 Navigation and Navigable... Coast Guard District § 165.504 Newport News Shipbuilding and Dry Dock Company Shipyard, James River...

Introspecting in the Spirit of William James: Comment on Fox, Ericsson, and Best (2011)

ERIC Educational Resources Information Center

Schooler, Jonathan W.

2011-01-01

Fox, Ericsson, and Best's (2011) thoughtful justification of the use of think-aloud protocols for revealing the stream of consciousness comes on the centennial of the death of William James, history's greatest practitioner and advocate of introspection. This confluence naturally invites speculation about how James might have responded to the…

75 FR 59237 - TRICARE Co-Pay Waiver at Captain James A. Lovell Federal Health Care Center Demonstration Project

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-27

... Federal Health Care Center Demonstration Project AGENCY: Office of the Secretary, Department of Defense. ACTION: Notice of TRICARE Co-Pay waiver at Captain James A. Lovell Federal Health Care Center... ``TRICARE Co-Pay Waiver at Captain James A. Lovell Federal Health Care (FHCC) Demonstration Project.'' Under...

The Octopus, the Squid and the Tortoise

ERIC Educational Resources Information Center

Caruth, Gail D.; Caruth, Donald L.

2013-01-01

What is the role of the Doctor of Philosophy (PhD) today? This is not a new question. In 1903, William James questioned the value of the degree as an indicator of teaching ability. Unfortunately, the issue James raised has never been resolved. Move forward in time to 1990. Theodore Ziolkowski essentially agreed with James, but raised additional…

Work settings of the first seven cohorts of James Cook University Bachelor of Medicine, Bachelor of Surgery graduates: Meeting a social accountability mandate through contribution to the public sector and Indigenous health services.

PubMed

Woolley, Torres; Sen Gupta, Tarun; Larkins, Sarah

2018-05-25

The James Cook University medical school's mission is to produce a workforce appropriate for the health needs of northern Australia. James Cook University medical graduate data were obtained via cross-sectional survey of 180 early-career James Cook University medical graduates from 2005-2011 (response rate of 180/298 contactable graduates = 60%). Australian medical practitioner data for 2005-2009 graduates were obtained via the 2015 'Medicine in Australia: Balancing Employment and Life' wave 8 dataset. Comparison of the range of work settings and hours worked by James Cook University medical graduates to Australian medical graduates. Compared to a similar group of Australian medical graduates, James Cook University Bachelor of Medicine, Bachelor of Surgery graduates are significantly more likely to work in government-funded 'public' organisations (hospitals, community health centres, Aboriginal Community Controlled Health Services, government departments, agencies or defence forces). In particular, James Cook University medical graduates were more likely to work in Aboriginal Community Controlled Health Services and community health centres and other state-run primary health care organisations than other Australian medical graduates. James Cook University medical graduates appear to work in a higher proportion of public settings; in particular, primary care settings, than Australian medical graduates. This is an appropriate mix for the predominantly rural and remote geography of Queensland and its associated medical workforce priorities. Reporting medical graduate outcomes by their nature of practice could be an important adjunct to other measures, such as geographic location and choice of specialty. © 2018 National Rural Health Alliance Ltd.

Region 5: Indiana Adequate Letter (11/4/2005)

EPA Pesticide Factsheets

This is a letter from Stephen Rothblatt, Director, to Kathryn Watson regarding the redesignation petition and maintenance plan for the Jackson County and Greene County 8-hour ozone nonattainment area.

Quantum Linear Systems Theory

DTIC Science & Technology

2013-02-15

Matthew James, Andre Carvalho and Michael Hush completed some work analyzing cross-phase modulation using single photon quantum filtering techniques...ANU Michael Hush January – June, 2012, Postdoc, ANU Matthew R. James Professor, Australian National University Ian R. Petersen Professor...appear, IEEE Trans. Aut. Control., 2013. A. R. R. Carvalho, M. R. Hush , and M. R. James, “Cavity driven by a single photon: Conditional dynamics and

Lonely Courage, Commemorative Confrontation, and Communal Therapy: William James Remembers the Massachusetts 54th

ERIC Educational Resources Information Center

Stob, Paul

2012-01-01

On May 31, 1897, William James, one of America's most influential philosophers and psychologists, delivered the first civic oration of his career. The principal orator at the dedication of the Robert Gould Shaw memorial in Boston, James did what commemorative speakers are not supposed to do. He chose to be confrontational and divisive in a…

78 FR 11094 - Drawbridge Operation Regulation; James River, Between Isle of Wight and Newport News, VA

Federal Register 2010, 2011, 2012, 2013, 2014

2013-02-15

... Operation Regulation; James River, Between Isle of Wight and Newport News, VA AGENCY: Coast Guard, DHS... River, mile 5.0, between Isle of Wight and Newport News, VA. This deviation is necessary to facilitate... Isle of Isle and Newport News, VA opens on signal. The James River Bridge has vertical clearances in...

The King James Bible and the Politics of Religious Education: Secular State and Sacred Scripture

ERIC Educational Resources Information Center

Gearon, Liam

2013-01-01

This article provides an outline historical-educational analysis of the King James Bible from its 1611 publication through to its four-hundredth anniversary commemoration in 2011. With particular focus on England, the article traces the educational impact of the King James Bible and charts, in the country of its origin, its progressive decline in…

77 FR 64718 - Safety Zone; Steam Ship Col. James M. Schoonmaker Relocation Project, Maumee River, Toledo, OH

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-23

... DEPARTMENT OF HOMELAND SECURITY Coast Guard 33 CFR Part 165 [Docket No. USCG-2012-0939] RIN 1625-AA00 Safety Zone; Steam Ship Col. James M. Schoonmaker Relocation Project, Maumee River, Toledo, OH...-0939 as follows: Sec. 165.T09-0939 Safety Zone; Steam Ship Col. James M. Schoonmaker relocation project...

Automatic Determination of the Need for Intravenous Contrast in Musculoskeletal MRI Examinations Using IBM Watson's Natural Language Processing Algorithm.

PubMed

Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho

2018-04-01

Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was relatively robust to spelling and grammatical errors, which were frequent. Implementation of this automated MR contrast determination system as a clinical decision support tool may save considerable time and effort of the radiologist while potentially decreasing error rates, and require no change in order entry or workflow.

Information Technology Governance Domains in Hospitals: A Case Study in Iran

PubMed Central

Shahi, Mehraban; Sadoughi, Farahnaz; Ahmadi, Maryam

2015-01-01

IT governance is a set of organizational structures ensuring decision-making rights and responsibilities with regard to the organization’s IT assets. This qualitative study was carried out to identify the IT governance domains in teaching hospitals affiliated to Iran University of Medical Sciences. There were 10 heads of IT departments and 10 hospital directors. Semi structured interviews used for data collection. To analyze the data content analysis was applied. All the interviewees (100%) believed that decisions upon hospital software needs could be made in a decentralized fashion by the IT department of the university. Most of the interviewees (90%) believed that there were policies for logistics and maintenance of networks, purchase and maintenance, standards and general policies in the direction of the policies of the ministry of health and medical education. About 80% of the interviewees believed that the current emphasis of the hospital’s IT unit and the hospital management for outsourcing of services were in the format of specialized contracts and under supervision of the university Statistic and IT department. A hospital strategic committee is an official organizational group consisting of hospital executives, heads of IT and multiple functional areas and business units in a hospital. In this committee, “the head of hospital” acts as the director of IT activities and ensures that IT strategies are alignment with the hospital business strategies. PMID:25948446

Near-death states reported in a sample of 50 misusers.

PubMed

Corazza, Ornella; Schifano, Fabrizio

2010-05-01

Increase in recreational ketamine use may be a cause for concern. We aimed here at assessing, in a sample of ketamine misusers, concordance between the typical near-death experience (NDE) features and the on-drug psychoactive effects the subjects experienced. In 2003-2005, a sample of previous ketamine misusers recollecting a ketamine-related NDE were recruited through snowballing and screened with the means of the Greyson NDE Scale; 125 participants made an initial contact with the researcher and 50 reported a minimum score of seven at the "Greyson NDE Scale". Interviewees were in the range 21-66 years old; 27 participants (54%) were educated at BA level, 18 (36%) had an MSc, and 5 (10%) a PhD. Eight (16%) interviewees had a definite religious background. An average lifetime ketamine intake of 140 occasions was reported by the interviewees, who typically presented with a polydrug, including cannabis and MDMA/ecstasy, misuse history. In 45 (90%) cases, the NDE occurred during the first few occasions of intake. Most frequent features of reported NDE states included: altered perception of time (90%), strong sense of detaching from own physical body (88%), and a sense of peace/joy (76% of subjects). Although results here described were elicited from a self-selected, nonrandomized, limited size sample of misusers, we suggest that recreational ketamine intake may be associated with occurrence of near-death related states.

Information technology governance domains in hospitals: a case study in Iran.

PubMed

Shahi, Mehraban; Sadoughi, Farahnaz; Ahmadi, Maryam

2014-11-30

IT governance is a set of organizational structures ensuring decision-making rights and responsibilities with regard to the organization's IT assets. This qualitative study was carried out to identify the IT governance domains in teaching hospitals affiliated to Iran University of Medical Sciences. There were 10 heads of IT departments and 10 hospital directors. Semi structured interviews used for data collection. To analyze the data content analysis was applied. All the interviewees (100%) believed that decisions upon hospital software needs could be made in a decentralized fashion by the IT department of the university. Most of the interviewees (90%) believed that there were policies for logistics and maintenance of networks, purchase and maintenance, standards and general policies in the direction of the policies of the ministry of health and medical education. About 80% of the interviewees believed that the current emphasis of the hospital's IT unit and the hospital management for outsourcing of services were in the format of specialized contracts and under supervision of the university Statistic and IT department. A hospital strategic committee is an official organizational group consisting of hospital executives, heads of IT and multiple functional areas and business units in a hospital. In this committee, "the head of hospital" acts as the director of IT activities and ensures that IT strategies are alignment with the hospital business strategies.

Debating Deindustrialization: A Comparative Analysis of Brazil and Mexico

DTIC Science & Technology

2014-09-01

production costs and import more capital-intensive goods.29 As James Petras describes the cycle, cheap labor-intensive manufacturing decreases in...29 James Petras , “A New International Division of Labor?,” MERIP Reports, no. 94 (February 1, 1981): 28, doi:10.2307...3. Outsourcing James Petras looks at a new international division of labor and outsourcing as possible causes of manufacturing decline within an

Maniac Talk - Dr. James Garvin

NASA Image and Video Library

2014-05-28

James Garvin Maniac Lecture, 28 May 2014 Dr. James Garvin, Chief Scientist, NASA Goddard Space Flight Center, presented a Maniac Talk entitled "From Brownian Motion to Mars, by way of hockey on the rocks." Jim shared how his passion for rocks and landscapes drove him to promote new remote sensing approaches for measuring their topologies and led to founding of the Mars Science Laboratory and its Curiosity Rover.

Biocides for the Battlefield - Interim Report

DTIC Science & Technology

2010-09-24

for public release; distribution is unlimited. James H . Wynne Materials Chemistry Branch Chemistry Division Preston a. Fulmer Chemical Dynamics and...b. ABSTRACT c. THIS PAGE 18. NUMBER OF PAGES 17. LIMITATION OF ABSTRACT Biocides for the Battlefield—Interim Report James H . Wynne and Preston A...distribution is unlimited. Unclassified Unclassified Unclassified SAR 25 James H . Wynne (202) 404-4010 The ability to disinfect surfaces and manufacture self

The US Army and Security Force Assistance: Assessing the Need for an Institutionalized Advisory Capability

DTIC Science & Technology

2009-03-03

Army Special Forces. Following a 2008 meeting with Gen James N. Mattis (Commander, US Joint Forces Command), Gen James T. Conway (Commandant, US...CAPABILITY Approved by: , Thesis Committee Chair James B. Martin, Ph.D. , Member Gary J. Bjorge, Ph.D. , Member Robert D...Technology: Information technology, bio -technology, weaponry, increased access to information Demographic Changes: Population growth, youth bulge

National Department of Space

DTIC Science & Technology

2008-03-25

Ivancevich , Fundamentals of Management, 6th ed. (Texas: Business Publications, 1987), 85. Figure 4. Fayol’s 14 Classical Principles of Management Many...Jr., James L. Gibson and John M. Ivancevich , Fundamentals of Management, 6th ed. (Texas: Business Publications, 1987), 182. 36 recognize four by...http://www.the spacereview.com/article/913/1 (accessed 7 September 2007) 59 James H. Donnelly Jr., James L. Gibson and John M. Ivancevich

4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept. 16, 1940 (A) EXTERIOR, GENERAL VIEW FROM SOUTH WEST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

Nucleic acid nanomaterials: Silver-wired DNA

NASA Astrophysics Data System (ADS)

Auffinger, Pascal; Ennifar, Eric

2017-10-01

DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

3. VIEW OF WILLOW CREEK TRESTLE FROM CORNER BASELINE AVENUE AND 185TH AVENUE, FACING NORTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

MMPI Indices in the Discrimination of Brain-Damaged and Schizophrenic Groups

ERIC Educational Resources Information Center

Holland, Terrill R.; And Others

1975-01-01

The results of this investigation support Watson's (1971) hypothesis that his Schizophrenia-Organicity scales might be valid discriminators of braindamaged and schizophrenic patients equated for degree of intellectual deficit. (Author)

Finite-size scaling of survival probability in branching processes

NASA Astrophysics Data System (ADS)

Garcia-Millan, Rosalba; Font-Clos, Francesc; Corral, Álvaro

2015-04-01

Branching processes pervade many models in statistical physics. We investigate the survival probability of a Galton-Watson branching process after a finite number of generations. We derive analytically the existence of finite-size scaling for the survival probability as a function of the control parameter and the maximum number of generations, obtaining the critical exponents as well as the exact scaling function, which is G (y ) =2 y ey /(ey-1 ) , with y the rescaled distance to the critical point. Our findings are valid for any branching process of the Galton-Watson type, independently of the distribution of the number of offspring, provided its variance is finite. This proves the universal behavior of the finite-size effects in branching processes, including the universality of the metric factors. The direct relation to mean-field percolation is also discussed.

Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.

PubMed

Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A

2017-11-16

 Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.

The web server of IBM's Bioinformatics and Pattern Discovery group.

PubMed

Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo

2003-07-01

We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/.

The web server of IBM's Bioinformatics and Pattern Discovery group

PubMed Central

Huynh, Tien; Rigoutsos, Isidore; Parida, Laxmi; Platt, Daniel; Shibuya, Tetsuo

2003-01-01

We herein present and discuss the services and content which are available on the web server of IBM's Bioinformatics and Pattern Discovery group. The server is operational around the clock and provides access to a variety of methods that have been published by the group's members and collaborators. The available tools correspond to applications ranging from the discovery of patterns in streams of events and the computation of multiple sequence alignments, to the discovery of genes in nucleic acid sequences and the interactive annotation of amino acid sequences. Additionally, annotations for more than 70 archaeal, bacterial, eukaryotic and viral genomes are available on-line and can be searched interactively. The tools and code bundles can be accessed beginning at http://cbcsrv.watson.ibm.com/Tspd.html whereas the genomics annotations are available at http://cbcsrv.watson.ibm.com/Annotations/. PMID:12824385

Watson, Swellengrebel and species sanitation: environmental and ecological aspects.

PubMed

Bradley, D J

1994-08-01

Following the discovery of mosquito transmission of malaria, the theory and practice of malaria control by general and selective removal of specific vector populations resulted particularly from Malcolm Watson's empirical work in peninsular Malaysia, first in the urban and peri-urban areas of Klang and Port Swettenham and subsequently in the rural rubber plantations, and from the work of N.H. Swellengrebel in nearby Indonesia on the taxonomy, ecology and control of anophelines. They developed the concept of species sanitation: the selective modification of the environment to render a particular anopheline of no importance as a vector in a particular situation. The lack of progress along these lines in India at that time is contrasted with that in south-east Asia. The extension of species sanitation and related concepts to other geographical areas and to other vector-borne disease situations is outlined.

Base modification strategies to modulate immune stimulation by an siRNA.

PubMed

Valenzuela, Rachel Anne P; Suter, Scott R; Ball-Jones, Alexi A; Ibarra-Soza, José M; Zheng, Yuxuan; Beal, Peter A

2015-01-19

Immune stimulation triggered by siRNAs is one of the major challenges in the development of safe RNAi-based therapeutics. Within an immunostimulatory siRNA sequence, this hurdle is commonly addressed by using ribose modifications (e.g., 2'-OMe or 2'-F), which results in decreased cytokine production. However, as immune stimulation by siRNAs is a sequence-dependent phenomenon, recognition of the nucleobases by the trigger receptor(s) is also likely. Here, we use the recently published crystal structures of Toll-like receptor 8 (TLR8) bound to small-molecule agonists to generate computational models for ribonucleotide binding by this immune receptor. Our modeling suggested that modification of either the Watson-Crick or Hoogsteen face of adenosine would disrupt nucleotide/TLR8 interactions. We employed chemical synthesis to alter either the Watson-Crick or Hoogsteen face of adenosine and evaluated the effect of these modifications in an siRNA guide strand by measuring the immunostimulatory and RNA interference properties. For the siRNA guide strand tested, we found that modifying the Watson-Crick face is generally more effective at blocking TNFα production in human peripheral blood mononuclear cells (PBMCs) than modification at the Hoogsteen edge. We also observed that modifications near the 5'-end were more effective at blocking cytokine production than those placed at the 3'-end. This work advances our understanding of how chemical modifications can be used to optimize siRNA performance. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rare disease diagnosis: A review of web search, social media and large-scale data-mining approaches.

PubMed

Svenstrup, Dan; Jørgensen, Henrik L; Winther, Ole

2015-01-01

Physicians and the general public are increasingly using web-based tools to find answers to medical questions. The field of rare diseases is especially challenging and important as shown by the long delay and many mistakes associated with diagnoses. In this paper we review recent initiatives on the use of web search, social media and data mining in data repositories for medical diagnosis. We compare the retrieval accuracy on 56 rare disease cases with known diagnosis for the web search tools google.com, pubmed.gov, omim.org and our own search tool findzebra.com. We give a detailed description of IBM's Watson system and make a rough comparison between findzebra.com and Watson on subsets of the Doctor's dilemma dataset. The recall@10 and recall@20 (fraction of cases where the correct result appears in top 10 and top 20) for the 56 cases are found to be be 29%, 16%, 27% and 59% and 32%, 18%, 34% and 64%, respectively. Thus, FindZebra has a significantly (p < 0.01) higher recall than the other 3 search engines. When tested under the same conditions, Watson and FindZebra showed similar recall@10 accuracy. However, the tests were performed on different subsets of Doctors dilemma questions. Advances in technology and access to high quality data have opened new possibilities for aiding the diagnostic process. Specialized search engines, data mining tools and social media are some of the areas that hold promise.

Impact of Heterogeneity and Lattice Bond Strength on DNA Triangle Crystal Growth.

PubMed

Stahl, Evi; Praetorius, Florian; de Oliveira Mann, Carina C; Hopfner, Karl-Peter; Dietz, Hendrik

2016-09-07

One key goal of DNA nanotechnology is the bottom-up construction of macroscopic crystalline materials. Beyond applications in fields such as photonics or plasmonics, DNA-based crystal matrices could possibly facilitate the diffraction-based structural analysis of guest molecules. Seeman and co-workers reported in 2009 the first designed crystal matrices based on a 38 kDa DNA triangle that was composed of seven chains. The crystal lattice was stabilized, unprecedentedly, by Watson-Crick base pairing. However, 3D crystallization of larger designed DNA objects that include more chains such as DNA origami remains an unsolved problem. Larger objects would offer more degrees of freedom and design options with respect to tailoring lattice geometry and for positioning other objects within a crystal lattice. The greater rigidity of multilayer DNA origami could also positively influence the diffractive properties of crystals composed of such particles. Here, we rationally explore the role of heterogeneity and Watson-Crick interaction strengths in crystal growth using 40 variants of the original DNA triangle as model multichain objects. Crystal growth of the triangle was remarkably robust despite massive chemical, geometrical, and thermodynamical sample heterogeneity that we introduced, but the crystal growth sensitively depended on the sequences of base pairs next to the Watson-Crick sticky ends of the triangle. Our results point to weak lattice interactions and high concentrations as decisive factors for achieving productive crystallization, while sample heterogeneity and impurities played a minor role.

Biologically important conformational features of DNA as interpreted by quantum mechanics and molecular mechanics computations of its simple fragments.

PubMed

Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A

2018-02-01

Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.

Effects of Nursing Care Based on Watson's Theory of Human Caring on Anxiety, Distress, And Coping, When Infertility Treatment Fails: A Randomized Controlled Trial.

PubMed

Durgun Ozan, Yeter; Okumuş, Hülya

2017-06-01

Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.

The nitrous oxide "dream" of Cora Gray: a dental anesthesia story of 1884.

PubMed

Christen, Arden G; Christen, Joan A

2014-01-01

In the September 1884 issue of Frank Leslie's Popular Monthly magazine, a fictional dramatic short story was published concerning the dental use of nitrous oxide. Entitled, "Cora Gray," it was written by the well-known American journalist and poet John Whittaker Watson (1815-1848), who authored hundreds of sentimental, tragic and dramatic poems, serials and stories concerning the destitute lives and deaths of downtrodden young women of that time. His greatest poetic effort, "Beautiful Snow," (1869) tells of a young prostitute who freezes to death in a snow bank. Watson, born in New York City, was educated at the University of New York, where he studied medicine. He also developed and used his skills as an engraver, journalist and writer. Watson obviously based his imaginative narrative on his medical knowledge of nitrous oxide and its physical and psychological side effects when inhaled. The story centers around the dreamlike romantic experiences of a 19-year-old female dental patient while she is under the effects of this gas. It explicitly depicts the administration of nitrous oxide and the resulting erotic visions and hallucinations that the young patient experiences. We make reference to other cautionary scientific writings from the late 1800s, in order to point out and clarify the potentially negative repercussions of nitrous oxide when administered to female dental patients without the presence of a third party. The ethics and propriety of anesthesia administration remain as perennial questions in dentistry to this day.

Zr diffusion in titanite

NASA Astrophysics Data System (ADS)

Cherniak, D. J.

2006-11-01

Chemical diffusion of Zr under anhydrous, pO2-buffered conditions has been measured in natural titanite. The source of diffusant was either zircon powder or a ZrO2-Al2O3-titanite mixture. Experiments were run in sealed silica glass capsules with solid buffers (to buffer at NNO or QFM). Rutherford Backscattering Spectrometry (RBS) was used to measure diffusion profiles. The following Arrhenius parameters were obtained for Zr diffusion parallel to c over the temperature range 753-1,100°C under NNO-buffered conditions: D Zr = 5.33 × 10-7 exp(-325 ± 30 kJ mol-1/RT) m2 s-1 Diffusivities are similar for experiments buffered at QFM. These data suggest that titanite should be moderately retentive of Zr chemical signatures, with diffusivities slower than those for O and Pb in titanite, but faster than those for Sr and the REE. When applied in evaluation of the relative robustness of the recently developed Zr-in-titanite geothermometer (Hayden and Watson, Abstract, 16th V.M. Goldschmidt Conference 2006), these findings suggest that Zr concentrations in titanite will be less likely to be affected by later thermal disturbance than the geothermometer based on Zr concentrations in rutile (Zack et al. in Contrib Mineral Petrol 148:471-488, 2004; Watson et al. in Contrib Mineral. Petrol, 2006), but much less resistant to diffusional alteration subsequent to crystallization than the Ti-in-Zircon geothermometer (Watson and Harrison in Science 308:841-844, 2005).

Rare disease diagnosis: A review of web search, social media and large-scale data-mining approaches

PubMed Central

Svenstrup, Dan; Jørgensen, Henrik L; Winther, Ole

2015-01-01

Physicians and the general public are increasingly using web-based tools to find answers to medical questions. The field of rare diseases is especially challenging and important as shown by the long delay and many mistakes associated with diagnoses. In this paper we review recent initiatives on the use of web search, social media and data mining in data repositories for medical diagnosis. We compare the retrieval accuracy on 56 rare disease cases with known diagnosis for the web search tools google.com, pubmed.gov, omim.org and our own search tool findzebra.com. We give a detailed description of IBM's Watson system and make a rough comparison between findzebra.com and Watson on subsets of the Doctor's dilemma dataset. The recall@10 and recall@20 (fraction of cases where the correct result appears in top 10 and top 20) for the 56 cases are found to be be 29%, 16%, 27% and 59% and 32%, 18%, 34% and 64%, respectively. Thus, FindZebra has a significantly (p < 0.01) higher recall than the other 3 search engines. When tested under the same conditions, Watson and FindZebra showed similar recall@10 accuracy. However, the tests were performed on different subsets of Doctors dilemma questions. Advances in technology and access to high quality data have opened new possibilities for aiding the diagnostic process. Specialized search engines, data mining tools and social media are some of the areas that hold promise. PMID:26442199

Presidential Search: Selecting the Top Candidates.

ERIC Educational Resources Information Center

Stead, Ronald S.

1988-01-01

The winnowing of a large number of presidential candidates to a smaller, more manageable group is discussed. Initial screening, candidate information, evaluation form, reference checking, and selecting interviewees are described. (MLW)

Vice President Pence Tours Jet Propulsion Laboratory

NASA Image and Video Library

2018-04-28

U.S. Vice President Mike Pence, left, thanks JPL Deputy Director Lt. Gen. (Ret) Larry James, JPL Director Michael Watkins, JPL Distinguished Visiting Scientist and Spouse of UAG Chairman James Ellis, Elisabeth Pate-Cornell , UAG Chairman, Admiral (Ret) James Ellis , and California Institute of Technology President Thomas Rosenbaum, right, for giving him a tour of NASA's Jet Propulsion Laboratory, Saturday, April 28, 2018 in Pasadena, California. Photo Credit: (NASA/Bill Ingalls)

Hybrid Threat Center of Gravity Analysis: Cutting the Gordian Knot

DTIC Science & Technology

2016-04-04

U.S. Marine Corps General James Mattis summed this best when he stated that “we expect future enemies to look at the four approaches [Traditional...synthesis is what we call hybrid warfare.”15 15 James N. Mattis and Frank Hoffman, "Future...accoun tid=12686 (accessed August 16, 2015). Mattis , James N. and Frank Hoffman. "Future Warfare: The Rise of Hybrid wars." United States Naval

Missile Defense Acquisition: Failure Is Not An Option

DTIC Science & Technology

2016-01-26

Missile Defense Acquisition: Failure is Not an Option 8 capabilities. Retired Marine General James Mattis ’ renowned quote rings true, “The enemy...american-missile-defense-why-failure-is- an-option. 18 Vago Muradian, “Interview: Gen. James Mattis , Commander, U.S. Joint Forces Command,” 23 May...2010, http://archive.defensenews.com/article/20100523/DEFFEAT03/5230301/Gen- James - Mattis . 19 Institute for Defense Analyses, p. II-3. 20 Missile

Sir James Reid and the Death of Queen Victoria: An Early Model for End-of-Life Care.

PubMed

Abrams, Robert C

2015-12-01

An appraisal of the last ten days of Queen Victoria's life, viewed primarily from the perspective of her personal physician, Sir James Reid, is presented. Sir James' clinical encounters with his patient and the Royal Family are examined to reveal his strategic and medical thinking and gauge his level of success in basic palliative aims. It was found that the lack of effective medical interventions, tensions within the Royal Family, the importance of his post to Sir James' professional career, and the political ramifications unavoidably connected with the illness of a head of state, all presented challenges to Reid's efforts to ease the physical and emotional pain of Queen Victoria's dying. Key features of Sir James' approach included reliance on physician-patient and physician-family relationships, emphasis on emotional support for the patient, and the careful selection of interventions for the family. In the first years of the 20th century, an era when the contemporary concepts of palliative care, hospice, and family dynamics did not exist, Sir James' management of the Queen's final illness suggested an early model for end-of-life care. By the end of Queen Victoria's life, Sir James was seen to have preserved his patient's comfort and dignity, at the same time advancing family and societal acceptance of the death of this matriarchal figure. © The Author 2014. Published by Oxford University Press on behalf of The Gerontological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

14. VIEW OF CEDAR MILL CREEK TRESTLE FROM TRESTLE OVER ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

14. VIEW OF CEDAR MILL CREEK TRESTLE FROM TRESTLE OVER CEDAR MILL CREEK ON SPUR LINE, FACING SOUTHWEST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

6. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

6. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept 16, 1940 (B) EXTERIOR, DETAIL OF ENTRANCE & ENTRANCE FRONT, FROM WEST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

Sport Management Interns--Selection Qualifications.

ERIC Educational Resources Information Center

Cuneen, Jacquelyn; Sidwell, M. Joy

1993-01-01

Examines and rates the background qualifications and qualities, identified by sport management practitioners through an examination of paper credentials, that are desired in interviewees vying for selection into sport management internship positions. (GLR)

The insights of health and welfare professionals on hurdles that impede economic evaluations of welfare interventions.

PubMed

Schepers, J; Plaete, J; De Bourdeaudhuij, I; Annemans, L; Simoens, S

2017-08-01

Four hurdles associated with economic evaluations in welfare interventions were identified and discussed in a previous published literature review. These hurdles include (i) 'Ignoring the impact of condition-specific outcomes', (ii) 'Ignoring the impact of QoL externalities', (iii) 'Calculation of costs from a too narrow perspective' and (iv) 'The lack of well-described & standardized interventions'. This study aims to determine how healthcare providers and social workers experience and deal with these hurdles in practice and what solutions or new insights they would suggest. Twenty-two professionals of welfare interventions carried out in Flanders, were interviewed about the four described hurdles using a semi-structured interview. A thematic framework was developed to enable the qualitative analysis. The analysis of the semi-structured interviews was facilitated through the use of the software program QRS NVivo 10. The interviews revealed a clear need to tackle these hurdles. The interviewees confirmed that further study of condition-specific outcomes in economic evaluations are needed, especially in the field of mental health and stress. The proposed dimensions for the condition-specific questionnaires varied however between the groups of interviewees (i.e. general practitioners vs social workers). With respect to QoL externalities, the interviewees confirmed that welfare interventions have an impact on the social environment of the patient (friends and family). There was however no consensus on how this impact of QoL externalities should be taken into account in welfare interventions. Professionals also suggested that besides health care costs, the impact of welfare interventions on work productivity, the patients' social life and other items should be incorporated. Standardization appears to be of limited added value for most of the interviewees because they need a certain degree of freedom to interpret the intervention. Furthermore, the target population of the interventions is diverse which requires a tailor-made approach. This qualitative research demonstrated that these hurdles occur in practice. The proposed solutions for these hurdles can contribute to the improvement of the methodological quality of economic evaluations of welfare interventions.

Digital science games' impact on sixth and eighth graders' perceptions of science

NASA Astrophysics Data System (ADS)

Peng, Li-Wei

2009-12-01

The quasi-experimental study investigated sixth and eighth graders' perceptions of science with gender, grade levels, and educational experiences as the variables. The Theory of Planned Behavior (Ajzen, 1985) claims that attitude toward the behavior, subjective norm, and perceived behavioral control play a major role in people's intentions, and these intentions ultimately impact their behavior. The study adopted a quantitative research approach by conducting a science perceptions survey for examining students' self-efficacy in learning science (i.e., perceived behavioral control), value of science (i.e., attitude toward the behavior), motivation in science (i.e., attitude toward the behavior), and perceptions of digital science games in science classes (i.e., perceived behavioral control). A total of 255 participants' responses from four rural Appalachian middle school science classrooms in southeastern Ohio were analyzed through a three-way ANCOVA factorial pre-test and post-test data analysis with experimental and comparison groups. Additionally, the study applied a semi-structured, in-depth interview as a qualitative research approach to further examine STEAM digital science games' and Fellows' impact on students' perceptions of science. Eight students in the experimental group were interviewed. Interview data were analyzed with an inductive method. The results found in the three-way ANCOVA data analysis indicated that the diversity of educational experiences was a significant factor that impacted sixth and eighth graders' perceptions of science. Additionally, the interaction of gender and educational experiences was another significant factor that impacted sixth and eighth graders' perceptions of science. The findings of the two short-answer questions identified the reasons why the participants liked or disliked science, as well as why the participants would or would not choose a career in science. The conclusions of the semi-structured, in-depth interview supported that the interviewees' perceptions of the STEAM digital science games and Fellows ranged from neutral to positive. Seven out of eight of the interviewees commented that the STEAM digital science games and Fellows enhanced the interviewees' perceptions of science and their choice of careers. Five out of eight of the interviewees intended to have careers in science.

Getting added value from using qualitative research with randomized controlled trials: a qualitative interview study

PubMed Central

2014-01-01

Background Qualitative research is undertaken with randomized controlled trials of health interventions. Our aim was to explore the perceptions of researchers with experience of this endeavour to understand the added value of qualitative research to the trial in practice. Methods A telephone semi-structured interview study with 18 researchers with experience of undertaking the trial and/or the qualitative research. Results Interviewees described the added value of qualitative research for the trial, explaining how it solved problems at the pretrial stage, explained findings, and helped to increase the utility of the evidence generated by the trial. From the interviews, we identified three models of relationship of the qualitative research to the trial. In ‘the peripheral’ model, the trial was an opportunity to undertake qualitative research, with no intention that it would add value to the trial. In ‘the add-on’ model, the qualitative researcher understood the potential value of the qualitative research but it was viewed as a separate and complementary endeavour by the trial lead investigator and wider team. Interviewees described how this could limit the value of the qualitative research to the trial. Finally ‘the integral’ model played out in two ways. In ‘integral-in-theory’ studies, the lead investigator viewed the qualitative research as essential to the trial. However, in practice the qualitative research was under-resourced relative to the trial, potentially limiting its ability to add value to the trial. In ‘integral-in-practice’ studies, interviewees described how the qualitative research was planned from the beginning of the study, senior qualitative expertise was on the team from beginning to end, and staff and time were dedicated to the qualitative research. In these studies interviewees described the qualitative research adding value to the trial although this value was not necessarily visible beyond the original research team due to the challenges of publishing this research. Conclusions Health researchers combining qualitative research and trials viewed this practice as strengthening evaluative research. Teams viewing the qualitative research as essential to the trial, and resourcing it in practice, may have a better chance of delivering its added value to the trial. PMID:24913438

Getting added value from using qualitative research with randomized controlled trials: a qualitative interview study.

PubMed

O'Cathain, Alicia; Goode, Jackie; Drabble, Sarah J; Thomas, Kate J; Rudolph, Anne; Hewison, Jenny

2014-06-09

Qualitative research is undertaken with randomized controlled trials of health interventions. Our aim was to explore the perceptions of researchers with experience of this endeavour to understand the added value of qualitative research to the trial in practice. A telephone semi-structured interview study with 18 researchers with experience of undertaking the trial and/or the qualitative research. Interviewees described the added value of qualitative research for the trial, explaining how it solved problems at the pretrial stage, explained findings, and helped to increase the utility of the evidence generated by the trial. From the interviews, we identified three models of relationship of the qualitative research to the trial. In 'the peripheral' model, the trial was an opportunity to undertake qualitative research, with no intention that it would add value to the trial. In 'the add-on' model, the qualitative researcher understood the potential value of the qualitative research but it was viewed as a separate and complementary endeavour by the trial lead investigator and wider team. Interviewees described how this could limit the value of the qualitative research to the trial. Finally 'the integral' model played out in two ways. In 'integral-in-theory' studies, the lead investigator viewed the qualitative research as essential to the trial. However, in practice the qualitative research was under-resourced relative to the trial, potentially limiting its ability to add value to the trial. In 'integral-in-practice' studies, interviewees described how the qualitative research was planned from the beginning of the study, senior qualitative expertise was on the team from beginning to end, and staff and time were dedicated to the qualitative research. In these studies interviewees described the qualitative research adding value to the trial although this value was not necessarily visible beyond the original research team due to the challenges of publishing this research. Health researchers combining qualitative research and trials viewed this practice as strengthening evaluative research. Teams viewing the qualitative research as essential to the trial, and resourcing it in practice, may have a better chance of delivering its added value to the trial.

Capture and commercialization of blue land crabs ("guaiamum") Cardisoma guanhumi (Lattreille, 1825) along the coast of Bahia State, Brazil: an ethnoecological approach.

PubMed

Firmo, Angélica M S; Tognella, Mônica M P; Silva, Saulo R; Barboza, Raynner R R D; Alves, Rômulo R N

2012-03-19

Blue Land Crab (Cardisoma guanhumi) is one of the most important crustacean species captured and commercialized in Brazil. Although this species is not considered to be threatened with extinction, populations of C. guanhumi are known to be rapidly diminishing due to heavy harvesting pressures and degradation of their natural habitats, highlighting the necessity of developing and implanting management and protection strategies for their populations. There have been no ethnozoological publications that have focused specifically on C. guanhumi, in spite of importance of this type of information for developing efficient management plans of resource utilization. So, the present work describes the ethnoecological aspects of the capture and commercialization of C. guanhumi by a fishing community in northeastern Brazil. Field work was carried out in the municipality of Mucuri, Bahia in Brazil, between the months of January and March/2011 through the use of open semi-structured interviews with all of the crustacean harvesters in city who acknowledged their work in capturing this species, totaling 12 interviewees. The informants were identified through the use of the "snowball" sampling technique. In addition to the interviews themselves, the "guided tour" technique and direct observations was employed. According all the interviewees, the C. guanhumi is popularly called "guaiamum" and is collected in "apicum" zones. They recognize sexual dimorphism in the species based on three morphological characteristics and the harvesters also pointed two stages in the reproductive cycle during the year and another phase mentioned by the interviewees was ecdysis. All of the interviewed affirmed that the size and the quantities C. guanhumi stocks in Mucuri have been diminishing. All of the interviewees agreed that the species and other mangrove resources constituted their principal source of income. The harvesters dedicated three to five days a week to collect Blue Land Crabs and the principal technique utilized for capturing is a trap called a "ratoeira" (rat-trap). The results of the present work demonstrated that the community retains a vast and important volume of knowledge about C. guanhumi that could subsidize both scientific studies and the elaboration of viable management and conservation strategies for this species.

Special Inspector General for Afghanistan Reconstruction (SIGAR) Quarterly Report to the United States Congress

DTIC Science & Technology

2012-10-30

James Mattis , Commander of CENTCOM, and General John Allen, Commander of the International Security Assistance Force (ISAF) warning that Afghan con...September 17, 2012, CENTCOM commander General James N. Mattis advised DoD heads of contracting to avoid contracting with 20 individuals and entities...Admiral James Stavridis, at Panetta’s left. NATO Secretary General Anders Fogh Rasmussen stands at Panetta’s right. (DoD photo) SPECIAL INSPECTOR GENERAL

Building Security in the Persian Gulf

DTIC Science & Technology

2010-01-01

developments within ACT, and building on the leadership and success of the outgoing U.S. commander, General James Mattis , U.S. Marine Corps (who retains...following the end of the war in Iraq. The author would like to thank RAND President James Thomson, who supported the development of a proj- ect plan designed...bers from diverse issue backgrounds, all of whom have extensive experience both in research and in policy formulation. These were David Aaron, James

High Frontier - The Journal for Space, Cyberspace & Missile Professionals. Volume 6, Number 1, November 2009

DTIC Science & Technology

2009-11-01

signs of just that!” In a response sent several days following Van Riper’s e-mail, [US Marine Corp Lt Gen James ] Mattis —who is now in the post Van...29 Regaining Credibility: Making Nuclear Sustainment a Model of Excellence Col James D. Fisher...Taverney, retired and Col James D. Rendleman, retired . . . . . . 53 Legislative Perspective Weapon Systems Acquisition Reform Act Maj Jung H. Ha

Fostering Creative Thinking Within the U.S. Army Command and General Staff Officers’ Course Curriculum

DTIC Science & Technology

2016-06-10

and complexity to their learning” that is not present in traditional teaching methods (James and Brookfield 2014, 4). In Engaging Imagination... method described is the use of visually based teaching and learning. James and Brookfield, delineate between looking and seeing (James and Brookfield...learning methods more applicable to some students as opposed to others. However, the exploration of visual teaching techniques through the use of pictures

Compendium of Licensable Patents Issued to the Edgewood Research, Development and Engineering Center and Previous Activities.

DTIC Science & Technology

1997-01-01

of Chemical Decontamination Inventors Philip W. Bartram, Noel C. Dibona , James H. Buchanan and Dennis K. Rohrbaugh Abstract An absorption process of...Decontamination Inventors Philip W. Bartram, Noel C. Dibona , James H. Buchanan and Dennis K. Rohrbaugh Abstract An improved method of decontaminating a...Using a Macro-reticular Strong Acid Resin Inventors Philip W. Bartram, Noel C. Dibona , James H. Buchanan, and Dennis K. Rohrbaugh Abstract A

Earth observations of Hudson Bay, Canada taken from OV-105 during STS-99

NASA Image and Video Library

2000-03-14

STS099-706-090 (11-22 February 2000) ---One of the astronauts aboard the Space Shuttle Endeavour for the STS-99 mission recorded this 70mm image of Hannah Bay, in the southern part of St. James Bay. The river is the Harricanaw River. Numerous shorelines around Hudson and St. James Bays are distinctive in winter because of snow cover. According to NASA scientists, shorelines were created when the overlying glaciers retreated and the land underneath rebounded causing the Hudson and St. James Bay waters to retreat northward. These ridges are 100 to 200 meters in width and heights can reach up to 7 meters. The land along St. James Bay consists mainly of tidal flats and salt marshes.

Mercury at the Oat Hill Extension Mine and James Creek, Napa County, California: Tailings, Sediment, Water, and Biota, 2003-2004

USGS Publications Warehouse

Slowey, Aaron J.; Rytuba, James J.; Hothem, Roger L.; May, Jason T.

2007-01-01

Executive Summary The Oat Hill Extension (OHE) Mine is one of several mercury mines located in the James Creek/Pope Creek watershed that produced mercury from the 1870's until 1944 (U.S. Bureau of Mines, 1965). The OHE Mine developed veins and mineralized fault zones hosted in sandstone that extended eastward from the Oat Hill Mine. Waste material from the Oat Hill Mine was reprocessed at the OHE Mine using gravity separation methods to obtain cinnabar concentrates that were processed in a retort. The U.S. Bureau of Land Management requested that the U.S. Geological Survey measure and characterize mercury and other chemical constituents that are potentially relevant to ecological impairment of biota in tailings, sediment, and water at the OHE Mine and in the tributaries of James Creek that drain the mine area (termed Drainage A and B) (Figs. 1 and 2). This report summarizes such data obtained from sampling of tailings and sediments at the OHE on October 17, 2003; water, sediment, and biota from James Creek on May 20, 2004; and biota on October 29, 2004. These data are interpreted to provide a preliminary assessment of the potential ecological impact of the mine on the James Creek watershed. The mine tailings are unusual in that they have not been roasted and contain relatively high concentrations of mercury (400 to 1200 ppm) compared to unroasted waste rock at other mines. These tailings have contaminated a tributary to James Creek with mercury primarily by erosion, on the basis of higher concentration of mercury (780 ng/L) measured in unfiltered (total mercury, HgT) spring water flowing from the OHE to James Creek compared to 5 to 14 ng/L HgT measured in James Creek itself. Tailing piles (presumably from past Oat Hill mine dumping) near the USBLM property boundary and upstream of the main OHE mine drainage channel (Drainage A; Fig. 2) also likely emit mercury, on the basis of their mercury composition (930 to 1200 ppm). The OHE spring water is likely an appreciable source of sulfate and carbonate to James Creek, because the spring water was enriched in sulfate (130 mg/L) and carbonate (430 mg/L as CaCO3) compared to James Creek water (70 to 100 mg/L SO42- and 110 to 170 mg/L as CaCO3) at the time of sampling. Concentrations of mercury in active channel sediment from James Creek are variable and potentially high, on the basis of chemical analysis (2.5 to 17 _g/g-wet sediment) and easily visible cinnabar grains in panned concentrates. Average (geometric mean) organic mercury (presumably monomethyl mercury (MMHg); ?2.3.3) concentrations in several invertebrate taxa collected from the James Creek watershed locations were higher than invertebrates taken from a Northern California location lacking a known point source of mercury. The mean proportion of MMHg to total mercury in James Creek predatory insect samples was 40 percent (1 standard deviation = 30 percent); only 40 percent of all insect samples had a MMHg/HgT proportion greater than 0.5. The low proportions of MMHg measured in invertebrates in James Creek and the presence of cinnabar in the creek suggest that some invertebrates may have anomolously high Hg concentrations as a result of the injestion or adhesion of extremely fine-grained cinnabar particles. Interpretation of HgT in frogs and fish as an indicator of mercury reactivity, biouptake, or trophic transfer is limited, pending MMHg measuremens, by the possibility of these whole-body samples having contained cinnabar particles at the time of analysis. To minimize this limitation, the gastrointestinal tracts and external surfaces of all amphibians, where cinnabar most likely resides, were carefully flushed to remove any visible particles. However, extremely fine-grained, invisible, adhesive cinnabar particles likely exist in the amphibians' habitats. HgT in foothill yellow-legged frogs collected from the James Creek study area, ranging from 0.1 to 0.6 ug/g Hg, was on average twice that of an extensive

76 FR 14396 - Change in Bank Control Notices; Acquisitions of Shares of a Bank or Bank Holding Company

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-16

.... Louis, Missouri 63166-2034: 1. The Greenwood Childrens' Trust, Brentwood, Tennessee, with Jane Allison Crewse, Brentwood, Tennessee; Ann Greenwood Watson, Owensboro, Kentucky; Helen Virginia Futvoye, Jackson...

7. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

7. Historic American Buildings Survey (Fed.) Stanley P. Mixon, Photographer Sept 16, 1940 (D) EXTERIOR, PRIVY AT REAR OF LOT, VIEW FROM SOUTH EAST - Watson-Bancroft House, Main Street, East Windsor Hill, Hartford County, CT

6. VIEW EAST TOWARDS LOTTSFORD BRANCH, THE AMPHITHEATRELIKE PLANTING AREA ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

6. VIEW EAST TOWARDS LOTTSFORD BRANCH, THE AMPHITHEATRE-LIKE PLANTING AREA ON THE SOUTH SLOPE OF WATSON'S HILL - U.S. Plant Introduction Station, Landscape, 11601 Old Pond Road, Glenn Dale, Prince George's County, MD

Spying on volcanoes

NASA Astrophysics Data System (ADS)

Watson, Matthew

2017-07-01

Active volcanoes can be incredibly dangerous, especially to those who live nearby, but how do you get close enough to observe one in action? Matthew Watson explains how artificial drones are providing volcanologists with insights that could one day save human lives

12. VIEW OF SWITCHES AND SPURS FROM NEAR EAST END ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

12. VIEW OF SWITCHES AND SPURS FROM NEAR EAST END OF CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD, FACING SOUTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

13. VIEW FROM CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

13. VIEW FROM CEDAR MILL CREEK TRESTLE NEAR MERLO ROAD TOWARD TRESTLE ON SPUR TRACK OVER CEDAR MILL CREEK, FACING NORTHEAST - Oregon Electric Railway Westside Corridor, Between Watson & 185th Avenues, Beaverton, Washington County, OR

4. Historic American Buildings Survey, Arthur C. Haskell, Photographer. 1935. ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. Historic American Buildings Survey, Arthur C. Haskell, Photographer. 1935. (e) Int-Staircase from Jonathan Watson House, formerly on High St., Medford. - Colonel Isaac Royall Slave Quarters, 15 George Street, Medford, Middlesex County, MA

ACHP | News | ACHP Spring Business Meeting

Science.gov Websites

Meeting Chairman John L. Nau, III awarded the Federal Communications Commission and the National Endowment Chairman John L. Nau, III NEH Acting Chairwoman Carole Watson receives the award from ACHP Chairman John L

Graduate nurse internship program: a formalized orientation program.

PubMed

Phillips, Tracy; Hall, Mellisa

2014-01-01

The graduate nurse internship program was developed on the basis of Watson's Human Caring Theory. In this article, the author discusses how an orientation program was formalized into an internship program and how the theory was applied.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

PubMed

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

PubMed

Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

2016-05-17

The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Exact Derivation of a Finite-Size Scaling Law and Corrections to Scaling in the Geometric Galton-Watson Process

PubMed Central

Corral, Álvaro; Garcia-Millan, Rosalba; Font-Clos, Francesc

2016-01-01

The theory of finite-size scaling explains how the singular behavior of thermodynamic quantities in the critical point of a phase transition emerges when the size of the system becomes infinite. Usually, this theory is presented in a phenomenological way. Here, we exactly demonstrate the existence of a finite-size scaling law for the Galton-Watson branching processes when the number of offsprings of each individual follows either a geometric distribution or a generalized geometric distribution. We also derive the corrections to scaling and the limits of validity of the finite-size scaling law away the critical point. A mapping between branching processes and random walks allows us to establish that these results also hold for the latter case, for which the order parameter turns out to be the probability of hitting a distant boundary. PMID:27584596

Relationships between critical thinking and attitudes toward women's roles in society.

PubMed

Loo, Robert; Thorpe, Karran

2005-01-01

This exploratory study is the first examination of the relationships between critical thinking--as measured by subscales on the Watson-Glaser Critical Thinking Appraisal Form S (WGCTA Form S; G. B. Watson & E. M. Glaser, 1994)-and attitudes toward women's roles in society--as measured by subscales on the Attitudes Toward Women Scale (AWS: J. T. Spence & R. L. Helmreich, 1972). The authors hypothesized that greater critical thinking skills would be associated with more liberal attitudes toward women's roles in society. Results from a sample of 90 nursing and management undergraduates supported the hypothesis. There were moderate correlations between scores from the WGCTA Form S Inference (.24 to .37) and Deduction (.19 to .26) subtests and scores from the AWS Freedom and Independence; Marital Relationships and Obligation; and Vocational, Educational, and Intellectual Roles subscales. These findings suggest that further research with larger samples and cross-cultural samples is warranted.

Cenotes (sinkholes) of the Yucatan Peninsula, Mexico, as a habitat of adult trematodes of fish.

PubMed

Scholz, T; Vargas-Vázquez, J; Moravec, F; Vivas-Rodríguez, C; Mendoza-Franco, E

1995-01-01

Examination of a total of 581 fish specimens of 15 species from 39 cenotes (sinkholes) in the Yucatan Peninsula, southeastern Mexico, revealed the presence of 10 species of adult trematodes. These were as follows: Saccocoelioides sogandaresi Lumsden, 1963, Saccocoelioides sp. (family Haploporidae), Cichlasotrema ujati Pineda et Andrade, 1989 (Angiodictyidae), Crassicutis cichlasomae Manter, 1936 (Homalometridae), Magnivitellinum simplex Kloss, 1966 (Macroderoididae), Stunkardiella minima (Stunkard, 1938) (Acanthostomidae), Oligogonotylus manteri Watson, 1976 (Cryptogonimidae), Genarchella tropica (Manter, 1936), G. astyanactis (Watson, 1976), and G. isabellae (Lamothe-Argumedo, 1977) (Derogenidae). Saccocoelioides sogandaresi is reported from Mexico for the first time. Poecilia velifera and P. latipunctata for S. sogandaresi, Cichlasoma octofasciatum for C. cichlasomae, Cichlasoma friedrichstahli and C. meeki for O. manteri, and C. meeki, C. octofasciatum and Gobiomorus dormitor for G. isabellae represent new host records. Most species found are described and figured and their host range and distribution are discussed.

Laser-induced free-free transitions in elastic electron scattering from CO2

NASA Astrophysics Data System (ADS)

Musa, Mohamed; MacDonald, Amy; Tidswell, Lisa; Holmes, Jim; St. Francis Xavier Laser Scattering Lab Team

2011-03-01

This report presents measurements of laser-induced free-free transitions of electrons scattered from CO2 molecules in the ground electronic state at incident electron energies of 3.8 and 5.8 eV under pulsed CO2 laser field. The differential cross section of free-free transitions involving absorption and emission of up to two photons were measured at various scattering angles with the polarization of the laser either parallel with or perpendicular to the the momentum change vector of the scattered electrons. The results of the parallel geometry are found to be in qualitative agreement with the predictions of the Kroll-Watson approximation within the experimental uncertainty whereas those of the perpendicular geometry show marked discrepancy with the Kroll-Watson predictions. This work was supported by the Natural Sciences and Engineering Research Council of Canada and the St. Francis Xavier University Council for Research.

Nerve injury after hip arthroplasty. 5/600 cases after uncemented hip replacement, anterolateral approach versus direct lateral approach.

PubMed

van der Linde, M J; Tonino, A J

1997-12-01

In 600 consecutive uncemented total hip replacements, 2 surgical approaches were used: the direct lateral Hardinge approach in supine position (group I: 241 cases) or in a lateral position (group II: 280 cases) and the anterolateral Watson-Jones approach in supine position (group III: 79 cases). 5 patients had clinically evident peripheral nerve injuries confirmed with EMG: none in group I, 1 lesion of the nervus ischiadicus and nervus femoralis in group II and 4 nervus femoralis lesions in group III, of which 1 was combined with an obturator nerve injury. The nerve injuries were evaluated with EMG. All 4 nervus femoralis lesions recovered spontaneously, but the one patients in group II had a persistent palsy of the peroneal nerve. The anatomical basis for the higher prevalence of nervus femoralis lesions in the anterolateral Watson-Jones approach is described.

Singly and Doubly Excited States of the D-Dimensional Helium Atom(Supported by DOD-ONR N00014-94-1-0998)

NASA Astrophysics Data System (ADS)

Carzoli, J.; Dunn, M.; Watson, D. K.

1998-05-01

Large order dimensional perturbation theory (DPT) has been used to study the ground and a number of excited states of two-electron atoms for the case L=0. Here we present the first application of recent work generalizing DPT to higher angular momentum.(M. Dunn, D.K. Watson, Ann. Phys. 251 (1996) 266)^,(M. Dunn, D.K. Watson, The Large Dimension Limit of Higher Angular Momentum States. Phys. Rev. A. (accepted for publication)) In this work we begin the investigation of P^o states, presenting results for the energies of some of the lowest lying states and discuss the analytic structure of these energies as functions of 1/D. We also obtain energies of corresponding D^o states with almost no additional effort by making use of interdimensional degeneracies with the P^o states.

Capturing student mathematical engagement through differently enacted classroom practices: applying a modification of Watson's analytical tool

NASA Astrophysics Data System (ADS)

Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq

2018-04-01

This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.

Reduction of display artifacts by random sampling

NASA Technical Reports Server (NTRS)

Ahumada, A. J., Jr.; Nagel, D. C.; Watson, A. B.; Yellott, J. I., Jr.

1983-01-01

The application of random-sampling techniques to remove visible artifacts (such as flicker, moire patterns, and paradoxical motion) introduced in TV-type displays by discrete sequential scanning is discussed and demonstrated. Sequential-scanning artifacts are described; the window of visibility defined in spatiotemporal frequency space by Watson and Ahumada (1982 and 1983) and Watson et al. (1983) is explained; the basic principles of random sampling are reviewed and illustrated by the case of the human retina; and it is proposed that the sampling artifacts can be replaced by random noise, which can then be shifted to frequency-space regions outside the window of visibility. Vertical sequential, single-random-sequence, and continuously renewed random-sequence plotting displays generating 128 points at update rates up to 130 Hz are applied to images of stationary and moving lines, and best results are obtained with the single random sequence for the stationary lines and with the renewed random sequence for the moving lines.

[Considering body ethics in the healthcare profession].

PubMed

Wang, Shin-Yun

2014-10-01

This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.

Contribution of transpersonal care to cardiac patients in the postoperative period of heart surgery.

PubMed

Rabelo, Ana Cleide Silva; Souza, Fabíola Vládia Feire Silva; Silva, Lúcia de Fátima da

2018-06-07

To know the contribution of Watson's theory to nursing care for cardiac patients in the postoperative period of cardiac surgery. This is a qualitative study based on the research-care method conducted with ten patients who underwent cardiac surgery in a specialised hospital from June to August 2013, in the city of Fortaleza, Ceará, Brazil. Data were submitted to content analysis based on the Clinical Caritas Process. The results led to four thematic categories: Awareness of being cared for by another being, System of beliefs and subjectivity, Relation of support and trust, and Expression of feelings. Surgery transformed the lives of the patients related to the process of being cared for by other people. The application of Watson's theory to care for cardiac patients after heart surgery shed valuable light on the importance of transpersonal care for the expansion of nursing care.

Statement on nursing: a personal perspective.

PubMed

McCutcheon, Tonna

2004-01-01

Contemporary nursing is based on a conglomerate of theoretical nursing models. These models each incorporate four central concepts: person, health, environment, and nursing. By defining these concepts, nurses develop an individual framework from which they base their nursing practice. As an aspiring nurse practitioner in the gastroenterology field, I have retrospectively assessed my personal definitions of person, health, environment, and nursing. From these definitions, I am able to incorporate specific theoretical frameworks into my personal belief system, thus formulating a basis for my nursing practice. This foundation is comprised of the influence of nursing theorists Jean Watson, Sister Callista Roy, Kolcaba, Florence Nightingale, and Ida J. Orlando; the Perioperative Patient-Focused Model; Watson's Theory of Human Caring; theories regarding transpersonal human caring and healing; and feminist theories. Therefore, this article describes self-examination of nursing care by defining central nursing concepts, acknowledging the influence of nursing theorists and theories, and developing a personal framework from which I base my nursing practice.

41 CFR 301-1.3 - Who is eligible for TDY allowances?

Code of Federal Regulations, 2010 CFR

2010-07-01

...) Interviewees performing pre-employment interview travel; (c) Employees who must interrupt official business travel to perform emergency travel as a result of an incapacitating illness or injury or a personal...

Why do young adults with Type 1 diabetes find it difficult to manage diabetes in the workplace?

PubMed

Balfe, Myles; Brugha, Ruairi; Smith, Diarmuid; Sreenan, Seamus; Doyle, Frank; Conroy, Ronan

2014-03-01

This article explores how and why workplace environments impact diabetes management for adults people with Type 1 diabetes, 23-30 years of age. Interviews were conducted with 35 young adults, 29 women and 6 men. The majority of these interviewees worked in sectors such as banking, technology and administration. Young adults found it difficult to manage diabetes in the workplace for two main reasons: work-related time pressures and the non-routine nature of interviewees' work and working environment. Young adults also found it difficult to get the time to exercise both inside and outside of work. Young adults with Type 1 diabetes need to be provided with the tools and technologies that they need to manage diabetes in modern flexible workplaces. Copyright © 2014 Elsevier Ltd. All rights reserved.

A window of opportunity: declining rates of hepatitis B virus infection among injection drug users in Rio de Janeiro, and prospects for targeted hepatitis B vaccination.

PubMed

Oliveira, Sabrina A N; Hacker, Mariana A; Oliveira, M Lourdes A; Yoshida, Clara F T; Telles, Paulo R; Bastos, Francisco I

2005-01-01

To measure hepatitis B virus (HBV) infection rates among injection drug users in Rio de Janeiro, Brazil, and to report their knowledge of and attitudes toward hepatitis and HBV vaccination. 609 injection drug users recruited in Rio de Janeiro between 1999 and 2001 answered a questionnaire and were tested for hepatitis B and other blood-borne infections. Questions covered sociodemographic information, alcohol and illicit drug consumption, drug injection and sexual practices, medical history, and knowledge about HIV, AIDS and viral hepatitis. The prevalence of HBV infection was 27.1%, with 3.4% of the sample positive for HbsAg (active infection) and 0.8% positive for anti-HBs (indicating previous HBV vaccination). Most interviewees (81.3%) were aware of at least one form of viral hepatitis and received information from many different sources. In agreement with laboratory findings, 96.7% of the interviewees stated they had never been vaccinated against hepatitis B, but almost all unvaccinated interviewees (97.8%) said they would volunteer to be vaccinated if HBV vaccination were available. Few of the injection drug users surveyed had ever been vaccinated against HBV. Although most were aware of the risks posed by viral hepatitis, this awareness seldom translated into consistent behavioral change. The participants' willingness to be vaccinated against HBV suggests that the implementation of vaccination for this population may help decrease rates of hepatitis B infection.

Effect of knowledge and economic status on sandfly control activities by householders at risk of cutaneous leishmaniasis in the subandean region of Huila department, Colombia.

PubMed

Pardo, Raúl H; Carvajal, Alexander; Ferro, Cristina; Davies, Clive R

2006-10-01

Householder vector control measures can be encouraged by health promotion campaigns which take into account peoples' attitudes and focus on key gaps in knowledge. To describe household sandfly control practices in an endemic area of cutaneous leishmaniasis in the department of Huila, Colombia, and determine how these are influenced by attitudes, knowledge and socioeconomic status. A household questionnaire was applied to collect information on: demography, socioeconomic status, knowledge of cutaneous leishmaniasis and of sandflies and their role in transmission, and the control activities practiced. Indoor sandfly abundance was estimated by light trap collections. Amongst 249 interviewees, 86% knew about cutaneous leishmaniasis and 98% sand flies. 35% of interviewees who knew about cutaneous leishmaniasis practiced measures with the purpose of its control. This practice was higher amongst the 32% who knew that sand flies transmit cutaneous leishmaniasis. However, 82% of interviewees practiced sand fly control measures, and these were significantly associated with high sand fly abundance. Measures included smoke, bednets, and house spraying with insecticide or non-insecticidal substances. Householders using the high cost measures (bednets and insecticide) had the highest economic status. Health education programmes should note that sand fly nuisance can initiate control measures, but that knowledge of the role of sand flies in transmission could enhance activities. The socioeconomic findings indicate that targeted bednet subsidies could reduce inequities in health status amongst cutaneous leishmaniasis endemic communities.

Mental and behavioral health environments: critical considerations for facility design.

PubMed

Shepley, Mardelle McCuskey; Watson, Angela; Pitts, Francis; Garrity, Anne; Spelman, Elizabeth; Kelkar, Janhawi; Fronsman, Andrea

2016-01-01

The purpose of the study was to identify features in the physical environment that are believed to positively impact staff and patients in psychiatric environments and use these features as the foundation for future research regarding the design of mental and behavioral health facilities. Pursuant to a broad literature review that produced an interview script, researchers conducted 19 interviews of psychiatric staff, facility administrators and architects. Interview data were analyzed using the highly structured qualitative data analysis process authored by Lincoln and Guba (1985). Seventeen topics were addressed ranging from the importance of a deinstitutionalized environment to social interaction and autonomy. The interviewees reinforced the controversy that exists around the implications of a deinstitutionalized environment, when the resulting setting diminishes patient and staff safety. Respondents tended to support open nurse stations vs. enclosed stations. Support for access to nature and the provision of an aesthetic environment was strong. Most interviewees asserted that private rooms were highly desirable because lower room density reduces the institutional character of a unit. However, a few interviewees adamantly opposed private rooms because they considered the increased supervision of one patient by another to be a deterrent to self-harm. The need to address smoking rooms in future research received the least support of all topics. Responses of interviews illustrate current opinion regarding best practice in the design of psychiatric facilities. The findings emphasize the need for more substantive research on appropriate physical environments in mental and behavioral health settings. Copyright © 2016 Elsevier Inc. All rights reserved.

Unconventional natural gas development and public health: toward a community-informed research agenda

PubMed Central

Korfmacher, Katrina Smith; Elam, Sarah; Gray, Kathleen M.; Haynes, Erin; Hughes, Megan Hoert

2015-01-01

Unconventional natural gas development (UNGD) using high-volume horizontal hydraulic fracturing (“fracking”) has vastly increased the potential for domestic natural gas production in recent years. However, the rapid expansion of UNGD has also raised concerns about its potential impacts on public health. Academics and government agencies are developing research programs to explore these concerns. Community involvement in activities such as planning, conducting, and communicating research is widely recognized as having an important role in promoting environmental health. Historically, however, communities most often engage in research after environmental health concerns have emerged. This community information needs assessment took a prospective approach to integrating community leaders' knowledge, perceptions, and concerns into the research agenda prior to initiation of local UNGD. We interviewed community leaders about their views on environmental health information needs in three states (New York, North Carolina, and Ohio) prior to widespread UNGD. Interviewees emphasized the cumulative, long-term, and indirect determinants of health, as opposed to specific disease outcomes. Responses focused not only on information needs, but also on communication and transparency with respect to research processes and funding. Interviewees also prioritized investigation of policy approaches to effectively protect human health over the long term. Although universities were most often cited as a credible source of information, interviewees emphasized the need for multiple strategies for disseminating information. By including community leaders' concerns, insights, and questions from the outset, the research agenda on UNGD is more likely to effectively inform decision making that ultimately protects public health. PMID:25204212

[Study of the healthcare background and psychosocial environment of the Maghrebian immigrant population in Catalonia [Spain

PubMed

Saura, Rosa Maria; Suñol, Rosa; Vallejo, Paula; Lahoz, Sonia; Atxotegui, Joseba; El Manouari, Mohamed

2008-01-01

The aim of this study was to gather information on the healthcare background and social environment of the Maghrebian immigrant population in Catalonia in order to guide the management and provision of social services and the work of the organizations supporting this collective. To gather data, we used a questionnaire exploring healthcare and social variables, including stressors and social support. Data collection was performed by pollsters in Arabic. We performed 403 interviews. Most interviewees had a health card providing access to public healthcare and knew where to access healthcare. The most frequently used services were primary care and emergency departments. In primary care, almost all of the interviewees were provided explanations, but 30% were unable to understand them properly. Health professionals seemed to have inadequate awareness of cultural and religious differences. Work, housing, distance from the family, and legal status were stressful factors for more than half of this population. Social support was low. Three quarters of the interviewees felt lonely. More than half of this population had completely or partially fulfilled their expectations of migration, while 11% felt they were in a worse situation. The main areas for improvement are the provision of information on conditions of healthcare access, promotion of social interaction, the use of associations for immigrants especially during the first phases of the migration process and facilitating religious activities. Health professionals should be provided with training in intercultural issues.

The contribution of William James to the origins of "scientific" psychology.

PubMed

Ferreri, Antonio M

2006-01-01

This paper illustrates the specific nature of the contribution made by the psychology of William James to the construction of modern scientific psychology. Universally recognized as the father of American scientific psychology, William James still remains a much-debated scientist, mainly for two reasons. First, he was interested in subjects that were often very far from the narrow and traditional approaches taken by the greater part of his contemporary colleagues. Secondly, in order to enlighten psychological issues, he continued to adopt multidisciplinary contributions, rather than selecting only those that stemmed from experimental and specifically laboratory contexts. James has been recently inserted in the more complex international consortium of psychologists, psychiatrists, physicians, psychotherapists, and philosophers that has been called "the French-Swiss-English-and-American psychotherapeutic alliance." This does in reality seem a more appropriate framework for understanding the specificity of James's psychology. In order to illustrate the peculiar Jamesian way of thinking about psychological issues, this paper undertakes an examination of his classical concept of the "stream of thought." Here, in fact, many different contributions converge in defining and outlining "the primary fact of consciousness"--personal, subjective, and introspective observation; philosophical arguments; "mental experiments," and psychopathological experiences; but, most of all, neurological data derived specifically from brain physiology. This last contribution has been too often underestimated, as has also the background of James's training in the development of experimental psychology, neurology, and physiology at Harvard before 1890. The paper concludes with the assertion that James represents the prototype of a new way of defining the scientific quality of modern psychology, far from the narrow definition given by the laboratory experimentalists fresh from the German universities at the end of the nineteenth century.

Resourcing the Army National Guard for its Domestic and Federal Missions

DTIC Science & Technology

2009-05-21

and tear on the 14 Peter Spiegel, "Panels finds Guard is down," Los Angeles Times, February 1, 2008. 15 Amanda Terkel, “Sebelius: Iraq War is...James Lovelace , the former Army Operations Officer, testified to the Commission on the National Guard and Reserves, that: During this period of...established a synchronized cycle of readiness and training for 76 LTG James J. Lovelace JR. “Statement by Lieutenant General James J. Lovelace , JR. Deputy

An Interactive Microcomputer Wargame for an Air Battle.

DTIC Science & Technology

1982-10-01

Monterey, California THESIS An Interactive Microcomputer Wargame for an Air Battle by James Owen Wilson October 1982 Thesis Advisor: A. F. Andrus...CONTIRCT 00 GRAN0T 186degg(.J James Owen Wilson 11101FRINA 111ANZATGN 0009 O GO498 1. PROGRAM 9L9060" . PRJr.AS S. ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ f9 PR@UN...Wargame for an Air Battle by James Owen Wilson Lieutenant, United States Navy oo B.A., University of Texas, 1974 Accession ForSubmitted in partial

Vice President Pence Tours Jet Propulsion Laboratory

NASA Image and Video Library

2018-04-28

U.S. Vice President Mike Pence, 2nd from left, poses for a group photograph with JPL Director Michael Watkins, left, JPL Deputy Director Lt. Gen. (Ret) Larry James, California Institute of Technology President Thomas Rosenbaum, JPL Distinguished Visiting Scientist and Spouse of UAG Chairman James Ellis, Elisabeth Pate-Cornell, and UAG Chairman, Admiral (Ret) James Ellis, right, after having toured NASA's Jet Propulsion Laboratory, Saturday, April 28, 2018 in Pasadena, California. Photo Credit: (NASA/Bill Ingalls)

Using Repertory Grids to Explore Musical Skills and Attitudes in a Mature-Age Adult at the Early Stages of Learning for Self-Fulfilment: A Case Study of James

ERIC Educational Resources Information Center

Taylor, Angela

2012-01-01

Repertory grids were used as a research tool to explore 73-year-old James' musical development over two years. Choosing two music learning cultures for his instrumental learning, James learned the piano in a college workshop and the Appalachian dulcimer in his local folk group. There were clear changes in his musical skills and attitudes,…

Army Network-Enabled Operations: Expectations, Performance, and Opportunities for Future Improvements

DTIC Science & Technology

2012-01-01

trusted the ability of the Army networks to alert him to the presence of significant ground threats. Similarly, then–MG James Mattis was confident that he...CJTF and Component Essential Capability Analysis, draft briefing, August 2, 2004. Mattis , LtGen. James N., U.S. Marine Corps, and LtCol. (Ret...Hattie Bouyer in Headquarters, Depart- ment of the Army, Office of the Chief Information Officer/G-6. We are indebted to James Cooke and Colonel Chris

Reorganizing Geographic Combatant Command Headquarters for Joint Force 2020

DTIC Science & Technology

2013-05-01

Corps General James N. Mattis , U.S. Central Command Commander, before the House Armed Services Committee on March 7, 2012, about the posture of U.S...Prentice Hall, 2002. Legal Organization of Defense. http://www.ndu.edu/library/pbrc/36L52.pdf (accessed January 21, 2013). 99 Mattis , James N...Statement of U.S. Marine Corps General James N. Mattis , U.S. Central Command Commander, before the House Armed Services Committee on March 7, 2012

The Glass Ceiling - A Question of Joint Officer Development - Why Only Five USAF Geographic Combatant Commanders?

DTIC Science & Technology

2010-07-26

kit/OEF.asp (accessed March 6, 2011). 19 U.S. Central Command. "US CENTCOM Leadership: General James N. Mattis , Commander,‖ http... Mattis , USMC Commander, USCENTCOM 0 2 Cmdr, Task Force 58 Cmdr, USJFCOM Admiral James G. Stavridis, USN Commander, USEUCOM 1 2 Plans Officer, JCS...U.S. Central Command. "US CENTCOM Leadership." General James N. Mattis . https://slsp.http://www.centcom.mil/en/about-centcom/leadership

CYBER THREAT AWARENESS FOR THE WARFIGHTER

DTIC Science & Technology

2016-02-16

Writing on the future of cyber warfare, Col William Poirier and Maj James Lotspeich posit that eventually advances in the Air Force’s cyber...Defending the Walls,” 3. 7 Col William J. Poirier and Maj James Lotspeich, “Air Force Cyber Warfare - Now and the Future,” Air and Space Power Journal 27...and Associated Terms, 8 November 2010. http://www.dtic.mil/doctrine/new_pubs/jp1_02.pdf. Poirier , Col William J., and Lotspeich, Maj James. “Air

Shifting Focus: Assessing the Role of U.S. Army Special Forces in the Counterproliferation of Weapons of Mass Destruction

DTIC Science & Technology

2014-06-01

4 The Japanese cult Aum Shinrikyo desired a capability so much that they purchased a ranch in Western Australia in order to mine uranium and even...Security, eds. James A. Russell and James J. Wirtz (New York: Routledge, 2008), 164. 9 interdict suspected proliferation activities would meet...Proliferation Efforts,” in Globalization and WMD Proliferation: Terrorism, Transnational Networks, and International Security, eds. James A. Russell

Differential Effects of Methyl Jasmonate on the Expression of the Early Light-Inducible Proteins and Other Light-Regulated Genes in Barley1

PubMed Central

Wierstra, Inken; Kloppstech, Klaus

2000-01-01

The effects of methyl jasmonate (JA-Me) on early light-inducible protein (ELIP) expression in barley (Hordeum vulgare L. cv Apex) have been studied. Treatment of leaf segments with JA-Me induces the same symptoms as those exhibited by norflurazon bleaching, including a loss of pigments and enhanced light stress that results in increased ELIP expression under both high- and low-light conditions. The expression of both low- and high-molecular-mass ELIP families is considerably down-regulated by JA-Me at the transcript and protein levels. This repression occurs despite increased photoinhibition measurable as a massive degradation of D1 protein and a delayed recovery of photosystem II activity. In JA-Me-treated leaf segments, the decrease of the photochemical efficiency of photosystem II under high light is substantially more pronounced as compared to controls in water. The repression of ELIP expression by JA-Me is superimposed on the effect of the increased light stress that leads to enhanced ELIP expression. The fact that the reduction of ELIP transcript levels is less pronounced than those of light-harvesting complex II and small subunit of Rubisco transcripts indicates that light stress is still affecting gene expression in the presence of JA-Me. The jasmonate-induced protein transcript levels that are induced by JA-Me decline under light stress conditions. PMID:11027731

Nick Langle | NREL

Science.gov Websites

., Howard P. Hanson, Lynn Rauchenstein, James Van Zwieten, Desikan Bharathan, Donna Heimiller, Nicholas Langle, George N. Scott, James Potemra, N. John Nagurny, and Eugene Jansen. 2012. Ocean Thermal

37 CFR 251.1 - Official addresses.

Code of Federal Regulations, 2011 CFR

2011-07-01

..., James Madison Memorial Building, Room LM-401, 101 Independence Avenue, SE., Washington, DC 20559-6000...: Copyright Office General Counsel/CARP, Room 403, James Madison Memorial Building, 101 Independence Avenue...

37 CFR 251.1 - Official addresses.

Code of Federal Regulations, 2010 CFR

2010-07-01

..., James Madison Memorial Building, Room LM-401, 101 Independence Avenue, SE., Washington, DC 20559-6000...: Copyright Office General Counsel/CARP, Room 403, James Madison Memorial Building, 101 Independence Avenue...

The Case of James Leininger: An American Case of the Reincarnation Type.

PubMed

Tucker, Jim B

2016-01-01

Numerous cases of young children who report memories of previous lives have been studied over the last 50 years. Though such cases are more easily found in cultures that have a general belief in reincarnation, they occur in the West as well. This article describes the case of James Leininger, an American child who at age two began having intense nightmares of a plane crash. He then described being an American pilot who was killed when his plane was shot down by the Japanese. He gave details that included the name of an American aircraft carrier, the first and last name of a friend who was on the ship with him, and a location and other specifics about the fatal crash. His parents eventually discovered a close correspondence between James׳s statements and the death of a World War II pilot named James Huston. Documentation of James׳s statements that was made before Huston was identified includes a television interview with his parents that never aired but which the author has been able to review. Copyright © 2016 Elsevier Inc. All rights reserved.

A Balancing Act: Scientists Seek to Reduce the Risk of Falls in the Elderly.

PubMed

Berglund, Jennifer

2017-01-01

It was the inaugural day of the study in 2005 when Brad Manor went out into the hot Louisiana sun to meet his first patient, a gentleman we'll call James. Manor, now director of the Mobility and Brain Function Lab at the Harvard-affiliated Institute for Aging Research, was, at that time, a Ph.D. student at Louisiana State University (Figure 1). James, a man in his early 70s, suffered from peripheral neuropathy, a condition that caused significant nerve damage in his legs and feet. James got out of his car, carrying his cane in his hand, and walked with Manor to the lab. It wasn't until they were standing still and talking in the exam room that James leaned on his cane with its tip on the floor to stabilize himself. Manor was surprised. "That's opposite to what we typically think," he remarks, looking back on the incident. "Intuitively, standing seems simpler than walking." But James had much more difficulty standing and was actually quite competent while in motion.

William James, Nitrous Oxide, and the Anaesthetic Revelation.

PubMed

Moon, Jane S; Kuza, Catherine M; Desai, Manisha S

2018-01-01

William James greatly influenced the fields of psychology, philosophy, and religion during the late 19 th and early 20 th centuries. This was the era of Modernism, a time when many writers rejected the certainty of Enlightenment ideals. Positivism, which rose to prominence in the early 19th century, had emphasized physical phenomena, empirical evidence, and the scientific method. Darwin's On the Origin of Species (1859), with its theory of natural selection, provided an explanation for the evolution of species apart from a divine Creator. Within this context, William James served as a "mediator between scientific agnosticism and the religious view of the world." James' own experience inhaling nitrous oxide played an important role in shaping his views. For James, the use of nitrous oxide served a key role in elucidating some of his most central ideas: 1) the value of religion, and the emphasis on mysticism and revelation (as opposed to theology and doctrine) as religion's foundation; 2) the universe as pluralistic (as opposed to absolutist, constant, eternal), driven by chance, experience, and change. Copyright © 2017 Elsevier Inc. All rights reserved.

Famous optician: James Clerk Maxwell

NASA Astrophysics Data System (ADS)

Haidar, Riad

2018-04-01

Mainly known for his unifying theory of electricity, magnetism and induction, James Clerk Maxwell also concluded that light was an electromagnetic wave, and was responsible for the first true colour photograph.

49 CFR 37.53 - Exception for New York and Philadelphia.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Eastern Paralyzed Veterans Association, Inc., James J. Peters, Terrance Moakley, and Denise Figueroa... between Eastern Paralyzed Veterans Association of Pennsylvania, Inc., and James J. Peters, individually...

1. Historic American Buildings Survey James Butters, Photographer. Mar, 28, ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

1. Historic American Buildings Survey James Butters, Photographer. Mar, 28, 1936. GENERAL FRONT VIEW (SOUTHWEST ELEVATION) - Marschalk Printing Office, Wall & Franklin Streets, Natchez, Adams County, MS

Is Watson's ``CHARGE-MODIFIED'' Reduced Mass always best for Diatomic Ions ?

NASA Astrophysics Data System (ADS)

Le Roy, Robert J.; Dattani, Nikesh S.

2016-06-01

Watson's landmark reformulation of the Born-Oppenheimer separation problem has been the basis of most combined-isotopologue analyses of diatomic spectroscopic data since 1980. One noteworthy feature of this work was his proposal that description of the dynamical behaviour of a diatomic ion with (±) charge Q, formed from atoms with isotopic masses of M_1 and M_2, should use a ``charge-modified'' reduced mass: μWat≡ M_1 M_2 /(M_1 + M_2 - Q m_e) , in which m_e is the electron mass, and this proposal seems to have been benignly accepted and adopted. The first quantitative test of this proposal was in the pioneering combined-isotopologue direct-potential-fit (CI-DPF) study of HeH^+ by Coxon and Hajigeorgiou in 1999, where they compared the quality of fit for analyses that used different choices for the definition of the reduced masses of the various isotopologues, and found that the best choice seemed to be to use conventional two-body reduced masses for (M_1 - 1/2 m_e) and (M_2 - 1/2 m_e ). This question was re-examined recently in the context of a CI-DPF study of CH^+, and a rather different conclusion was reached. The present paper combines new CI-DPF studies of HeH^+ and BeH^+ with our recent CH^+ work, and attempts to draw some general conclusions on this matter. J.K.G. Watson, J. Mol. Spectrosc. 80, 411 (1980) J.A. Coxon and P. Hajigeorgiou, J. Mol. Spectrosc. 193, 306 (1999). Y.-S. Cho and R.J. Le Roy, J. Chem. Phys. 144, 024311 (2016)

DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds

PubMed Central

Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.

2008-01-01

We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765

Comparing the Concept of Caring in Islamic Perspective with Watson and Parse's Nursing Theories

PubMed Central

Sadat-Hoseini, Akram-Sadat; Khosropanah, Abdoul-Hosein

2017-01-01

Background: In the nursing profession, it is apparent that the definition of caring differs between various perspectives. This article compares the difference of caring in Islamic with the Parse and Watson theories. Materials and Methods: In this study, we use concept analyses of Walker–Avants and compare research methods. Material used is all Islamic documents. Results: According to Islamic documents, there are four major types of caring, namely, (1) God taking care of humans, (2) Humans taking care of themselves, (3) Other humans taking care of humans, and (4) The universe taking care of humans and vice versa. God caring for humans affects the three other types of caring. All three definitions of caring have humanistic and holistic view. According to Watson's and Parse's definition, the development of the caring theory is based on the person's experiences that result from human interactions with, and experiences of, their environment. In Islamic definition, although the caring process is affected by environmental experiences and interactions, human not developed only base the effect of environment; rather, it is developed on the basis of human nature and divine commands. God taking care of humans is specific to Islamic perspective and is not found in other definitions. Islamic perspective maintains that God is the creator of humanity and is in charge of guiding humans. A superior form of human can always be discovered. Conclusions: Thus, nursing implementation in Muslims must be done based on Islamic commands, and Islamic commands are superior to human experiences. However, Islamic commands interpreted with human wisdom and thought can be striving toward excellence. PMID:28584543

Rotational Spectrum, Conformational Composition, Intramolecular Hydrogen Bonding, and Quantum Chemical Calculations of Mercaptoacetonitrile (HSCH2C≡N), a Compound of Potential Astrochemical Interest.

PubMed

Møllendal, Harald; Samdal, Svein; Guillemin, Jean-Claude

2016-03-31

The microwave spectra of mercaptoacetonitrile (HSCH2C≡N) and one deuterated species (DSCH2C≡N) were investigated in the 7.5-124 GHz spectral interval. The spectra of two conformers denoted SC and AP were assigned. The H-S-C-C chain of atoms is synclinal in SC and anti-periplanar in AP. The ground state of SC is split into two substates separated by a comparatively small energy difference resulting in closely spaced transitions with equal intensities. Several transitions of the parent species of SC deviate from Watson's Hamiltonian. Only slight improvements were obtained using a Hamiltonian that takes coupling between the two substates into account. Deviations from Watson's Hamiltonian were also observed for the parent species of AP. However, the spectrum of the deuterated species, which was investigated only for the SC conformer, fits satisfactorily to Watson's Hamiltonian. Relative intensity measurements found SC to be lower in energy than AP by 3.8(3) kJ/mol. The strength of the intramolecular hydrogen bond between the thiol and cyano groups was estimated to be ∼2.1 kJ/mol. The microwave work was augmented by quantum chemical calculations at CCSD and MP2 levels using basis sets of minimum triple-ζ quality. Mercaptoacetonitrile has astrochemical interest, and the spectra presented herein should be useful for a potential identification of this compound in the interstellar medium. Three different ways of generating mercaptoacetonitrile from compounds already found in the interstellar medium were explored by quantum chemical calculations.

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed Central

Berressem, R; Engels, J W

1995-01-01

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457