Science.gov

Sample records for intestinal peptide transporter

  1. Transport of Antihypertensive Peptide RVPSL, Ovotransferrin 328-332, in Human Intestinal Caco-2 Cell Monolayers.

    PubMed

    Ding, Long; Wang, Liying; Zhang, Yan; Liu, Jingbo

    2015-09-23

    The objective of this study was to investigate the transepithelial transport of RVPSL (Arg-Val-Pro-Ser-Leu), an egg-white-derived peptide with angiotensin I-converting enzyme (ACE) inhibitory and antihypertensive activity, in human intestinal Caco-2 cell monolayers. Results revealed that RVPSL could be passively transported across Caco-2 cell monolayers. However, during the process of transport, 36.31% ± 1.22% of the initial RVPSL added to the apical side was degraded, but this degradation decreased to 23.49% ± 0.68% when the Caco-2 cell monolayers were preincubated with diprotin A (P < 0.001), suggesting that RVPSL had a low resistance to various brush border membrane peptidases. When transport from the apical side to the basolateral side was investigated, the apparent permeability coefficient (Papp) was (6.97 ± 1.11) × 10(-6) cm/s. The transport route of RVPSL appears to be the paracellular pathway via tight junctions, as only cytochalasin D, a disruptor of tight junctions (TJs), significantly increased the transport rate (P < 0.001). In addition, the relationship between the structure of RVPSL and transport across Caco-2 cell monolayers was studied by mutation of RVPSL. It was found that N-terminal Pro residues were more beneficial for transport of pentapeptides across Caco-2 cell monolayers than Arg and Val. Furthermore, RVPSL could be more easily transported as smaller peptides, especially in the form of dipeptides and tripeptides.

  2. Effects of cysteamine supplementation on the intestinal expression of amino acid and peptide transporters and intestinal health in finishing pigs.

    PubMed

    Zhou, Ping; Luo, Yiqiu; Zhang, Lin; Li, Jiaolong; Zhang, Bolin; Xing, Shen; Zhu, Yuping; Gao, Feng; Zhou, Guanghong

    2017-02-01

    This study aimed to evaluate the effects of cysteamine supplementation on the expression of jejunal amino acid and peptide transporters and intestinal health in finishing pigs. Sixty barrows were allocated into two experimental diets consisting of a basal control diet supplemented with 0 or 142 mg/kg cysteamine. After 41 days, 10 pigs per treatment were slaughtered. The results showed that cysteamine supplementation increased the apparent digestibility of crude protein (CP) (P < 0.05) and the trypsin activity in jejunal digesta (P < 0.01). Cysteamine supplementation also increased the messenger RNA abundance of SLC7A7, SLC7A9 and SLC15A1, occludin, claudin-1 and zonula occludens protein-1 (P < 0.001) in the jejunum mucosa. Increased glutathione content (P < 0.01) and glutathione peroxidase activity (P < 0.05) and decreased malondialdehyde content (P < 0.01) were observed in pigs receiving cysteamine. Additionally, cysteamine supplementation increased the concentrations of secretory immunoglobulin A (IgA) (P < 0.05), IgM (P < 0.001) and IgG (P < 0.001) in the jejunal mucosa. It is concluded that cysteamine supplementation could influence protein digestion and absorption via increasing trypsin activity, enhancing the digestibility of CP, and promoting the expression of jejunal amino acid and peptide transporters. Moreover, cysteamine improved intestinal integrity, antioxidant capacity and immune function in the jejunum, which were beneficial for intestinal health.

  3. Salinity-Dependent Shift in the Localization of Three Peptide Transporters along the Intestine of the Mozambique Tilapia (Oreochromis mossambicus)

    PubMed Central

    Con, Pazit; Nitzan, Tali; Cnaani, Avner

    2017-01-01

    The peptide transporter (PepT) systems are well-known for their importance to protein absorption in all vertebrate species. These symporters use H+ gradient at the apical membrane of the intestinal epithelial cells to mediate the absorption of small peptides. In fish, the intestine is a multifunctional organ, involved in osmoregulation, acid-base regulation, and nutrient absorption. Therefore, we expected environmental stimuli to affect peptide absorption. We examined the effect of three environmental factors; salinity, pH and feeding, on the expression, activity and localization of three PepT transporters (PepT1a, PepT1b, PepT2) along the intestine of the Mozambique tilapia (Oreochromis mossambicus). Quantitative real time PCR (qPCR) analysis demonstrated that the two PepT1 variants are typical to the proximal intestinal section while PepT2 is typical to the distal intestinal sections. Immunofluorescence analysis with custom-made antibodies supported the qPCR results, localized both transporters on the apical membrane of enterocytes and provided the first evidence for the participation of PepT2 in nutrient absorption. This first description of segment-specific expression and localization points to a complementary role of the different peptide transporters, corresponding to the changes in nutrient availability along the intestine. Both gene expression and absorption activity assays showed that an increase in water salinity shifted the localization of the PepT genes transcription and activity down along the intestinal tract. Additionally, an unexpected pH effect was found on the absorption of small peptides, with increased activity at higher pH levels. This work emphasizes the relationships between different functions of the fish intestine and how they are affected by environmental conditions. PMID:28167916

  4. Glycans in the intestinal peptide transporter PEPT1 contribute to function and protect from proteolysis.

    PubMed

    Stelzl, Tamara; Geillinger-Kästle, Kerstin Elisabeth; Stolz, Jürgen; Daniel, Hannelore

    2017-03-23

    Despite the fact that many membrane proteins carry extracellular glycans, little is known about whether the glycan chains also affect protein function. We recently demonstrated that the proton-coupled oligopeptide transporter 1 (PEPT1) in the intestine is glycosylated at six asparagine residues (N50, N406, N439, N510, N515, N532). Mutagenesis-induced disruption of the individual N-glycosylation site N50, which is highly conserved among mammals, was detected to significantly enhance the PEPT1 mediated inward transport of peptides. Here, we show for the murine protein, that the inhibition of glycosylation at sequon N50 by substituting N50 with glutamine, lysine or cysteine, or by replacing S52 with alanine, equally altered PEPT1 transport kinetics in oocytes. Further, we provide evidence that the uptake of [(14)C]-glycyl-sarcosine in immortalized murine small intestinal (Mode-K) or colonic epithelial (PTK-6) cells stably expressing the PEPT1 transporter N50Q is also significantly increased relative to the wild type protein. By using electrophysiological recordings and tracer flux studies, we further demonstrate that the rise in transport velocity observed for PEPT1 N50Q is bidirectional. In line with these findings, we show that attachment of biotin derivatives, comparable in weight to 2-4 monosaccharides, to the PEPT1 N50C transporter slows down the transport velocity. In addition, our experiments provide strong evidence that glycosylation of PEPT1 confers resistance against proteolytic cleavage by proteinase K, while a remarkable intrinsic stability against trypsin, even in absence of N-linked glycans, was detected.

  5. Expression of an antimicrobial peptide, digestive enzymes and nutrient transporters in the intestine of E. praecox-infected chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coccidiosis is a major intestinal disease of poultry, caused by several species of the protozoan Eimeria. The objective of this study was to examine changes in expression of digestive enzymes, nutrient transporters and an antimicrobial peptide following an Eimeria praecox challenge of chickens at d...

  6. Guanylin peptides regulate electrolyte and fluid transport in the Gulf toadfish (Opsanus beta) posterior intestine.

    PubMed

    Ruhr, Ilan M; Bodinier, Charlotte; Mager, Edward M; Esbaugh, Andrew J; Williams, Cameron; Takei, Yoshio; Grosell, Martin

    2014-11-01

    The physiological effects of guanylin (GN) and uroguanylin (UGN) on fluid and electrolyte transport in the teleost fish intestine have yet to be thoroughly investigated. In the present study, the effects of GN, UGN, and renoguanylin (RGN; a GN and UGN homolog) on short-circuit current (Isc) and the transport of Cl-, Na+, bicarbonate (HCO3-), and fluid in the Gulf toadfish (Opsanus beta) intestine were determined using Ussing chambers, pH-stat titration, and intestinal sac experiments. GN, UGN, and RGN reversed the Isc of the posterior intestine (absorptive-to-secretory), but not of the anterior intestine. RGN decreased baseline HCO3- secretion, but increased Cl- and fluid secretion in the posterior intestine. The secretory response of the posterior intestine coincides with the presence of basolateral NKCC1 and apical cystic fibrosis transmembrane conductance regulator (CFTR), the latter of which is lacking in the anterior intestine and is not permeable to HCO3- in the posterior intestine. However, the response to RGN by the posterior intestine is counterintuitive given the known role of the marine teleost intestine as a salt- and water-absorbing organ. These data demonstrate that marine teleosts possess a tissue-specific secretory response, apparently associated with seawater adaptation, the exact role of which remains to be determined.

  7. Intestinal expression of peptide transporter 1 (PEPT1) at different life stages of Japanese eel, Anguilla japonica.

    PubMed

    Ahn, Hyojin; Yamada, Yoshiaki; Okamura, Akihiro; Tsukamoto, Katsumi; Kaneko, Toyoji; Watanabe, Soichi

    2013-10-01

    The expression of peptide transporter 1 (PEPT1) was investigated at the different life stages of Japanese eel, Anguilla japonica. The cDNA encoding Japanese eel PEPT1 was cloned and sequenced. The hydrophilicity plot analysis of its deduced amino acid sequence showed high similarities with topological features of known PEPT1 molecules in other species. Tissue distribution analysis confirmed that PEPT1 mRNA was detected specifically in the anterior and posterior intestines of adult eel. In eel larvae at 13days post hatching (dph), PEPT1 mRNA expression was mainly detected in the intestinal tract regions. The trypsinogen mRNA was only detected in the gastric region including the pancreas. Intense immunoreaction for PEPT1 was observed in the apical membrane of the intestinal epithelial cells of both larval and adult eel. These results indicated that PEPT1 was an intestine-specific transporter, which was localized at the luminal side of the epithelial cells, suggesting that di/tri-peptide absorption via PEPT1 takes place in the eel intestine. According to the ontogenetic analyses by quantitative PCR, PEPT1 and trypsinogen mRNA expressions were simultaneously increased at 5-7 dph. It is thus assumed that nutrient absorption systems in the intestinal tracts of larvae become functional at this age.

  8. The Intestinal Peptide Transporter PEPT1 Is Involved in Food Intake Regulation in Mice Fed a High-Protein Diet

    PubMed Central

    Sailer, Manuela; Daniel, Hannelore

    2011-01-01

    High-protein diets are effective in achieving weight loss which is mainly explained by increased satiety and thermogenic effects. Recent studies suggest that the effects of protein-rich diets on satiety could be mediated by amino acids like leucine or arginine. Although high-protein diets require increased intestinal amino acid absorption, amino acid and peptide absorption has not yet been considered to contribute to satiety effects. We here demonstrate a novel finding that links intestinal peptide transport processes to food intake, but only when a protein-rich diet is provided. When mice lacking the intestinal peptide transporter PEPT1 were fed diets containing 8 or 21 energy% of protein, no differences in food intake and weight gain were observed. However, upon feeding a high-protein (45 energy%) diet, Pept1−/− mice reduced food intake much more pronounced than control animals. Although there was a regain in food consumption after a few days, no weight gain was observed which was associated with a reduced intestinal energy assimilation and increased fecal energy losses. Pept1−/− mice on high-protein diet displayed markedly reduced plasma leptin levels during the period of very low food intake, suggesting a failure of leptin signaling to increase energy intake. This together with an almost two-fold elevated plasma arginine level in Pept1−/− but not wildtype mice, suggests that a cross-talk of arginine with leptin signaling in brain, as described previously, could cause these striking effects on food intake. PMID:22031831

  9. Oral peptide specific egg antibody to intestinal sodium-dependent phosphate co-transporter-2b is effective at altering phosphate transport in vitro and in vivo.

    PubMed

    Bobeck, Elizabeth A; Hellestad, Erica M; Sand, Jordan M; Piccione, Michelle L; Bishop, Jeff W; Helvig, Christian; Petkovich, Martin; Cook, Mark E

    2015-06-01

    Hyperimmunized hens are an effective means of generating large quantities of antigen specific egg antibodies that have use as oral supplements. In this study, we attempted to create a peptide specific antibody that produced outcomes similar to those of the human pharmaceutical, sevelamer HCl, used in the treatment of hyperphosphatemia (a sequela of chronic renal disease). Egg antibodies were generated against 8 different human intestinal sodium-dependent phosphate cotransporter 2b (NaPi2b) peptides, and hNaPi2b peptide egg antibodies were screened for their ability to inhibit phosphate transport in human intestinal Caco-2 cell line. Antibody produced against human peptide sequence TSPSLCWT (anti-h16) was specific for its peptide sequence, and significantly reduced phosphate transport in human Caco-2 cells to 25.3±11.5% of control nonspecific antibody, when compared to nicotinamide, a known inhibitor of phosphate transport (P≤0.05). Antibody was then produced against the mouse-specific peptide h16 counterpart (mouse sequence TSPSYCWT, anti-m16) for further analysis in a murine model. When anti-m16 was fed to mice (1% of diet as dried egg yolk powder), egg yolk immunoglobulin (IgY) was detected using immunohistochemical staining in mouse ileum, and egg anti-m16 IgY colocalized with a commercial goat anti-NaPi2b antibody. The effectiveness of anti-m16 egg antibody in reducing serum phosphate, when compared to sevelamer HCl, was determined in a mouse feeding study. Serum phosphate was reduced 18% (P<0.02) in mice fed anti-m16 (1% as dried egg yolk powder) and 30% (P<0.0001) in mice fed sevelamer HCl (1% of diet) when compared to mice fed nonspecific egg immunoglobulin. The methods described and the findings reported show that oral egg antibodies are useful and easy to prepare reagents for the study and possible treatment of select diseases.

  10. Role of Vagal Innervation in Diurnal Rhythm of Intestinal Peptide Transporter 1 (PEPT1)

    PubMed Central

    Qandeel, Hisham G.; Alonso, Fernando; Hernandez, David J.; Duenes, Judith A.; Zheng, Ye; Scow, Jeffrey S.; Sarr, Michael G.

    2010-01-01

    BACKGROUND: Protein is absorbed predominantly as di/tripeptides via H+/peptide cotransporter-1 (PEPT1). We demonstrated previously diurnal variations in expression and function of duodenal and jejunal but not ileal PEPT1; neural regulation of this pattern is unexplored. HYPOTHESIS: Complete abdominal vagotomy abolishes diurnal variations in gene expression and transport function of PEPT1. METHODS: 24 rats maintained in a 12-h light/dark room [6AM-6PM] underwent abdominal vagotomy; 24 other rats were controls. Four weeks later, mucosal levels of mRNA and protein were measured at 9AM, 3PM, 9PM, and 3AM (n=6 each) by quantitative real time-PCR and Western blots, respectively; transporter-mediated uptake of di-peptide (Gly-Sar) was measured by the everted-sleeve technique. RESULTS: Diurnal variation in mRNA, as in controls, was retained post-vagotomy in duodenum and jejunum (peak at 3PM, p<0.05) but not in ileum. Diurnal variations in expression of protein and Gly-Sar uptake, however, were absent post-vagotomy (p>0.3). Similar to controls, maximal uptake was in jejunum after vagotomy (Vmax-nmol/cm/min: jejunum vs. duodenum and ileum; 163 vs. 88 and 71 at 3AM; p<0.04); Km remained unchanged. CONCLUSIONS: Vagal innervation appears to mediate in part diurnal variations in protein expression and transport function of PEPT1, but not diurnal variation in mRNA expression of PEPT1. PMID:19707837

  11. Characteristics of transmural potential changes associated with the proton-peptide co-transport in toad small intestine.

    PubMed

    Abe, M; Hoshi, T; Tajima, A

    1987-12-01

    1. Ionic dependence and kinetic properties of the peptide-evoked potentials across everted toad intestine were investigated with eighteen dipeptides and four tripeptides. All peptides evoked saturable increases in the mucosal negativity regardless of the presence of Na+. 2. The peptide-evoked potentials recorded in the absence of Na+ were sensitive to external pH (pHo); lowering pHo from 7.4 to 6.5 and 5.5 caused stepwise increases in their amplitude. 3. Loading epithelial cells with 9-aminoacridine or acetate caused a significant increase or decrease in amplitude of the Gly-Gly-evoked potential, suggesting intracellular alkalinization or acidification also has a great influence on the peptide-evoked potential. 4. Kinetically, Na+-independent peptide-evoked potentials conformed to simple Michaelis-Menten kinetics, and lowering pHo caused a decrease of the half-saturation concentration (Kt) for Gly-Gly without changing the maximum potential difference increase. Similar affinity-type kinetic effect was also seen for Gly-Gly influx. 5. Simultaneous measurements of Gly-Gly-induced increase in short-circuit current and Gly-Gly influx revealed that the coupling ratio of H+ and Gly-Gly flows was 1.78 +/- 0.12, suggesting the stoichiometry of the H+-peptide co-transport being 2:1. 6. Kinetic analyses of the peptide-evoked potentials indicated that all glycyl-dipeptides tested (Gly-Gly, Gly-Pro, Gly-Sar, Gly-Leu, Gly-Phe) and other dipeptides (Ala-Ala, Ala-Phe, Phe-Ala) shared a common carrier. Gly-Gly-Gly and Ala-Ala-Ala were also found to share the same carrier, while Phe-Phe, Leu-Leu and Phe-Leu appeared to be transported by a different carrier. 7. Kt values for di- and tripeptides, which apparently shared a common carrier, fell in a narrow range (0.5-2.2 mM). There was no clear correlation between 1/Kt value and molecular weight.

  12. The mRNA expression of amino acid transporters, aminopeptidase, and the di- and tri-peptide transporter PepT1 in the intestine and liver of post-hatch broiler chicks

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Amino acid transporter (AAT) proteins are responsible for the movement of amino acids (AA) in and out of cells. Aminopeptidase (APN) cleaves AAs from the N terminus of polypeptides making them available for transport, while PepT1 is a di- and tri- peptide transporter. In the intestine, these prote...

  13. PI3K p110α/Akt signaling negatively regulates secretion of the intestinal peptide neurotensin through interference of granule transport.

    PubMed

    Li, Jing; Song, Jun; Cassidy, Margaret G; Rychahou, Piotr; Starr, Marlene E; Liu, Jianyu; Li, Xin; Epperly, Garretson; Weiss, Heidi L; Townsend, Courtney M; Gao, Tianyan; Evers, B Mark

    2012-08-01

    Neurotensin (NT), an intestinal peptide secreted from N cells in the small bowel, regulates a variety of physiological functions of the gastrointestinal tract, including secretion, gut motility, and intestinal growth. The class IA phosphatidylinositol 3-kinase (PI3K) family, which comprised of p110 catalytic (α, β and δ) and p85 regulatory subunits, has been implicated in the regulation of hormone secretion from endocrine cells. However, the underlying mechanisms remain poorly understood. In particular, the role of PI3K in intestinal peptide secretion is not known. Here, we show that PI3K catalytic subunit, p110α, negatively regulates NT secretion in vitro and in vivo. We demonstrate that inhibition of p110α, but not p110β, induces NT release in BON, a human endocrine cell line, which expresses NT mRNA and produces NT peptide in a manner analogous to N cells, and QGP-1, a pancreatic endocrine cell line that produces NT peptide. In contrast, overexpression of p110α decreases NT secretion. Consistently, p110α-inhibition increases plasma NT levels in mice. To further delineate the mechanisms contributing to this effect, we demonstrate that inhibition of p110α increases NT granule trafficking by up-regulating α-tubulin acetylation; NT secretion is prevented by overexpression of HDAC6, an α-tubulin deacetylase. Moreover, ras-related protein Rab27A (a small G protein) and kinase D-interacting substrate of 220 kDa (Kidins220), which are associated with NT granules, play a negative and positive role, respectively, in p110α-inhibition-induced NT secretion. Our findings identify the critical role and novel mechanisms for the PI3K signaling pathway in the control of intestinal hormone granule transport and release.

  14. PI3K p110α/Akt Signaling Negatively Regulates Secretion of the Intestinal Peptide Neurotensin Through Interference of Granule Transport

    PubMed Central

    Li, Jing; Song, Jun; Cassidy, Margaret G.; Rychahou, Piotr; Starr, Marlene E.; Liu, Jianyu; Li, Xin; Epperly, Garretson; Weiss, Heidi L.; Townsend, Courtney M.; Gao, Tianyan

    2012-01-01

    Neurotensin (NT), an intestinal peptide secreted from N cells in the small bowel, regulates a variety of physiological functions of the gastrointestinal tract, including secretion, gut motility, and intestinal growth. The class IA phosphatidylinositol 3-kinase (PI3K) family, which comprised of p110 catalytic (α, β and δ) and p85 regulatory subunits, has been implicated in the regulation of hormone secretion from endocrine cells. However, the underlying mechanisms remain poorly understood. In particular, the role of PI3K in intestinal peptide secretion is not known. Here, we show that PI3K catalytic subunit, p110α, negatively regulates NT secretion in vitro and in vivo. We demonstrate that inhibition of p110α, but not p110β, induces NT release in BON, a human endocrine cell line, which expresses NT mRNA and produces NT peptide in a manner analogous to N cells, and QGP-1, a pancreatic endocrine cell line that produces NT peptide. In contrast, overexpression of p110α decreases NT secretion. Consistently, p110α-inhibition increases plasma NT levels in mice. To further delineate the mechanisms contributing to this effect, we demonstrate that inhibition of p110α increases NT granule trafficking by up-regulating α-tubulin acetylation; NT secretion is prevented by overexpression of HDAC6, an α-tubulin deacetylase. Moreover, ras-related protein Rab27A (a small G protein) and kinase D-interacting substrate of 220 kDa (Kidins220), which are associated with NT granules, play a negative and positive role, respectively, in p110α-inhibition-induced NT secretion. Our findings identify the critical role and novel mechanisms for the PI3K signaling pathway in the control of intestinal hormone granule transport and release. PMID:22700584

  15. Supplementation with branched-chain amino acids to a low-protein diet regulates intestinal expression of amino acid and peptide transporters in weanling pigs.

    PubMed

    Zhang, Shihai; Qiao, Shiyan; Ren, Man; Zeng, Xiangfang; Ma, Xi; Wu, Zhenlong; Thacker, Philip; Wu, Guoyao

    2013-11-01

    This study determined the effects of dietary branched-chain amino acids (AA) (BCAA) on growth performance, expression of jejunal AA and peptide transporters, and the colonic microflora of weanling piglets fed a low-protein (LP) diet. One hundred and eight Large White × Landrace × Duroc piglets (weaned at 28 days of age) were fed a normal protein diet (NP, 20.9 % crude protein), an LP diet (LP, 17.1 % crude protein), or an LP diet supplemented with BCAA (LP + BCAA, 17.9 % crude protein) for 14 days. Dietary protein restriction reduced piglet growth performance and small-intestinal villous height, which were restored by BCAA supplementation to the LP diet to values for the NP diet. Serum concentrations of BCAA were reduced in piglets fed the LP diet while those in piglets fed the LP + BCAA diet were similar to values for the NP group. mRNA levels for Na(+)-neutral AA exchanger-2, cationic AA transporter-1, b(0,+) AA transporter, and 4F2 heavy chain were more abundant in piglets fed the LP + BCAA diet than the LP diet. However, mRNA and protein levels for peptide transporter-1 were lower in piglets fed the LP + BCAA diet as compared to the LP diet. The colonic microflora did not differ among the three groups of pigs. In conclusion, growth performance, intestinal development, and intestinal expression of AA transporters in weanling piglets are enhanced by BCAA supplementation to LP diets. Our findings provide a new molecular basis for further understanding of BCAA as functional AA in animal nutrition.

  16. Bile acid-regulated peroxisome proliferator-activated receptor-α (PPARα) activity underlies circadian expression of intestinal peptide absorption transporter PepT1/Slc15a1.

    PubMed

    Okamura, Ayako; Koyanagi, Satoru; Dilxiat, Adila; Kusunose, Naoki; Chen, Jia Jun; Matsunaga, Naoya; Shibata, Shigenobu; Ohdo, Shigehiro

    2014-09-05

    Digested proteins are mainly absorbed as small peptides composed of two or three amino acids. The intestinal absorption of small peptides is mediated via only one transport system: the proton-coupled peptide transporter-1 (PepT1) encoded from the soluble carrier protein Slc15a1. In mammals, intestinal expression of PepT1/Slc15a1 oscillates during the daily feeding cycle. Although the oscillation in the intestinal expression of PepT1/Slc15a1 is suggested to be controlled by molecular components of circadian clock, we demonstrated here that bile acids regulated the oscillation of PepT1/Slc15a1 expression through modulating the activity of peroxisome proliferator-activated receptor α (PPARα). Nocturnally active mice mainly consumed their food during the dark phase. PPARα activated the intestinal expression of Slc15a1 mRNA during the light period, and protein levels of PepT1 peaked before the start of the dark phase. After food intake, bile acids accumulated in intestinal epithelial cells. Intestinal accumulated bile acids interfered with recruitment of co-transcriptional activator CREB-binding protein/p300 on the promoter region of Slc15a1 gene, thereby suppressing PPARα-mediated transactivation of Slc15a1. The time-dependent suppression of PPARα-mediated transactivation by bile acids caused an oscillation in the intestinal expression of PepT1/Slc15a1 during the daily feeding cycle that led to circadian changes in the intestinal absorption of small peptides. These findings suggest a molecular clock-independent mechanism by which bile acid-regulated PPARα activity governs the circadian expression of intestinal peptide transporter.

  17. In Vitro and Clinical Evaluations of the Drug-Drug Interaction Potential of a Metabotropic Glutamate 2/3 Receptor Agonist Prodrug with Intestinal Peptide Transporter 1

    PubMed Central

    Long, Amanda J.; Annes, William F.; Witcher, Jennifer W.; Knadler, Mary Pat; Ayan-Oshodi, Mosun A.; Mitchell, Malcolm I.; Leese, Phillip; Hillgren, Kathleen M.

    2017-01-01

    Despite peptide transporter 1 (PEPT1) being responsible for the bioavailability for a variety of drugs, there has been little study of its potential involvement in drug-drug interactions. Pomaglumetad methionil, a metabotropic glutamate 2/3 receptor agonist prodrug, utilizes PEPT1 to enhance absorption and bioavailability. In vitro studies were conducted to guide the decision to conduct a clinical drug interaction study and to inform the clinical study design. In vitro investigations determined the prodrug (LY2140023 monohydrate) is a substrate of PEPT1 with Km value of approximately 30 µM, whereas the active moiety (LY404039) is not a PEPT1 substrate. In addition, among the eight known PEPT1 substrates evaluated in vitro, valacyclovir was the most potent inhibitor (IC50 = 0.46 mM) of PEPT1-mediated uptake of the prodrug. Therefore, a clinical drug interaction study was conducted to evaluate the potential interaction between the prodrug and valacyclovir in healthy subjects. No effect of coadministration was observed on the pharmacokinetics of the prodrug, valacyclovir, or either of their active moieties. Although in vitro studies showed potential for the prodrug and valacyclovir interaction via PEPT1, an in vivo study showed no interaction between these two drugs. PEPT1 does not appear to easily saturate because of its high capacity and expression in the intestine. Thus, a clinical interaction at PEPT1 is unlikely even with a compound with high affinity for the transporter. PMID:27895114

  18. cis-Peptide Bonds: A Key for Intestinal Permeability of Peptides? .

    PubMed

    Marelli, Udaya Kiran; Ovadia, Oded; Frank, Andreas Oliver; Chatterjee, Jayanta; Gilon, Chaim; Hoffman, Amnon; Kessler, Horst

    2015-10-19

    Recent structural studies on libraries of cyclic hexapeptides led to the identification of common backbone conformations that may be instrumental to the oral availability of peptides. Furthermore, the observation of differential Caco-2 permeabilities of enantiomeric pairs of some of these peptides strongly supports the concept of conformational specificity driven uptake and also suggests a pivotal role of carrier-mediated pathways for peptide transport, especially for scaffolds of polar nature. This work presents investigations on the Caco-2 and PAMPA permeability profiles of 13 selected N-methylated cyclic pentaalanine peptides derived from the basic cyclo(-D-Ala-Ala4 -) template. These molecules generally showed moderate to low transport in intestinal epithelia with a few of them exhibiting a Caco-2 permeability equal to or slightly higher than that of mannitol, a marker for paracellular permeability. We identified that the majority of the permeable cyclic penta- and hexapeptides possess an N-methylated cis-peptide bond, a structural feature that is also present in the orally available peptides cyclosporine A and the tri-N-methylated analogue of the Veber-Hirschmann peptide. Based on these observations it appears that the presence of N-methylated cis-peptide bonds at certain locations may promote the intestinal permeability of peptides through a suitable conformational preorganization.

  19. Models to predict intestinal absorption of therapeutic peptides and proteins.

    PubMed

    Antunes, Filipa; Andrade, Fernanda; Ferreira, Domingos; Nielsen, Hanne Morck; Sarmento, Bruno

    2013-01-01

    Prediction of human intestinal absorption is a major goal in the design, optimization, and selection of drugs intended for oral delivery, in particular proteins, which possess intrinsic poor transport across intestinal epithelium. There are various techniques currently employed to evaluate the extension of protein absorption in the different phases of drug discovery and development. Screening protocols to evaluate protein absorption include a range of preclinical methodologies like in silico, in vitro, in situ, ex vivo and in vivo. It is the careful and critical use of these techniques that can help to identify drug candidates, which most probably will be well absorbed from the human intestinal tract. It is well recognized that the human intestinal permeability cannot be accurately predicted based on a single preclinical method. However, the present social and scientific concerns about the animal well care as well as the pharmaceutical industries need for rapid, cheap and reliable models predicting bioavailability give reasons for using methods providing an appropriate correlation between results of in vivo and in vitro drug absorption. The aim of this review is to describe and compare in silico, in vitro, in situ, ex vivo and in vivo methods used to predict human intestinal absorption, giving a special attention to the intestinal absorption of therapeutic peptides and proteins.

  20. Structural Design of Oligopeptides for Intestinal Transport Model.

    PubMed

    Hong, Seong-Min; Tanaka, Mitsuru; Koyanagi, Riho; Shen, Weilin; Matsui, Toshiro

    2016-03-16

    Glycyl-sarcosine (Gly-Sar) is a well-known model substrate for the intestinal uptake of dipeptides through peptide transporter 1 (PepT1). However, there are no other model peptides larger than tripeptides to evaluate their intestinal transport ability. In this study, we designed new oligopeptides based on the Gly-Sar structure in terms of protease resistance. Gly-Sar-Sar was found to be an appropriate transport model for tripeptides because it does not degrade during the transport across the rat intestinal membrane, while Gly-Gly-Sar was degraded to Gly-Sar during the 60 min transport. Caco-2 cell transport experiments revealed that the designed oligopeptides based on Gly-Sar-Sar showed a significantly (p < 0.05) lower transport ability by factors of 1/10-, 1/25-, and 1/40-fold for Gly-Sar-Sar, Gly-Sar-Sar-Sar, and Gly-Sar-Sar-Sar-Sar, respectively, compared to Gly-Sar (apparent permeability coefficient: 38.6 ± 11.4 cm/s). Cell experiments also showed that the designed tripeptide and Gly-Sar were transported across Caco-2 cell via PepT1, whereas the tetra- and pentapeptides were transported through the paracellular tight-junction pathway.

  1. Impact of peptide transporter 1 on the intestinal absorption and pharmacokinetics of valacyclovir after oral dose escalation in wild-type and PepT1 knockout mice.

    PubMed

    Yang, Bei; Hu, Yongjun; Smith, David E

    2013-10-01

    The primary objective of this study was to determine the in vivo absorption properties of valacyclovir, including the potential for saturable proton-coupled oligopeptide transporter 1 (PepT1)-mediated intestinal uptake, after escalating oral doses of prodrug within the clinical dose range. A secondary aim was to characterize the role of PepT1 on the tissue distribution of its active metabolite, acyclovir. [³H]Valacyclovir was administered to wild-type (WT) and PepT1 knockout (KO) mice by oral gavage at doses of 10, 25, 50, and 100 nmol/g. Serial blood samples were collected over 180 minutes, and tissue distribution studies were performed 20 minutes after a 25-nmol/g oral dose of valacyclovir. We found that the C(max) and area under the curve (AUC)₀₋₁₈₀ of acyclovir were 4- to 6-fold and 2- to 3-fold lower, respectively, in KO mice for all four oral doses of valacyclovir. The time to peak concentration of acyclovir was 3- to 10-fold longer in KO compared with WT mice. There was dose proportionality in the C(max) and AUC₀₋₁₈₀ of acyclovir in WT and KO mice over the valacyclovir oral dose range of 10-100 nmol/g (i.e., linear absorption kinetics). No differences were observed in the peripheral tissue distribution of acyclovir once these tissues were adjusted for differences in perfusing drug concentrations in the systemic circulation. In contrast, some differences were observed between genotypes in the concentrations of acyclovir in the distal intestine. Collectively, the findings demonstrate a critical role of intestinal PepT1 in improving the rate and extent of oral absorption for valacyclovir. Moreover, this study provides definitive evidence for the rational development of a PepT1-targeted prodrug strategy.

  2. Digesting New Elements in Peptide Transport.

    PubMed

    Lyons, Joseph A; Nissen, Poul

    2015-10-06

    In this issue of Structure, Beale et al. (2015) define structurally and functionally a large extracellular domain unique to mammalian peptide transporters and its implications for the transport of basic di- and tri-peptides (Beale et al., 2015).

  3. Development of intestinal transport function in mammals.

    PubMed

    Pácha, J

    2000-10-01

    Considerable progress has been made over the last decade in the understanding of mechanisms responsible for the ontogenetic changes of mammalian intestine. This review presents the current knowledge about the development of intestinal transport function in the context of intestinal mucosa ontogeny. The review predominantly focuses on signals that trigger and/or modulate the developmental changes of intestinal transport. After an overview of the proliferation and differentiation of intestinal mucosa, data about the bidirectional traffic (absorption and secretion) across the developing intestinal epithelium are presented. The largest part of the review is devoted to the description of developmental patterns concerning the absorption of nutrients, ions, water, vitamins, trace elements, and milk-borne biologically active substances. Furthermore, the review examines the development of intestinal secretion that has a variety of functions including maintenance of the fluidity of the intestinal content, lubrication of mucosal surface, and mucosal protection. The age-dependent shifts of absorption and secretion are the subject of integrated regulatory mechanisms, and hence, the input of hormonal, nervous, immune, and dietary signals is reviewed. Finally, the utilization of energy for transport processes in the developing intestine is highlighted, and the interactions between various sources of energy are discussed. The review ends with suggestions concerning possible directions of future research.

  4. Structural specificity of mucosal-cell transport and metabolism of peptide drugs: implication for oral peptide drug delivery

    NASA Technical Reports Server (NTRS)

    Bai, J. P.; Amidon, G. L.

    1992-01-01

    The brush border membrane of intestinal mucosal cells contains a peptide carrier system with rather broad substrate specificity and various endo- and exopeptidase activities. Small peptide (di-/tripeptide)-type drugs with or without an N-terminal alpha-amino group, including beta-lactam antibiotics and angiotensin-converting enzyme (ACE) inhibitors, are transported by the peptide transporter. Polypeptide drugs are hydrolyzed by brush border membrane proteolytic enzymes to di-/tripeptides and amino acids. Therefore, while the intestinal brush border membrane has a carrier system facilitating the absorption of di-/tripeptide drugs, it is a major barrier limiting oral availability of polypeptide drugs. In this paper, the specificity of peptide transport and metabolism in the intestinal brush border membrane is reviewed.

  5. Adaptive regulation of intestinal nutrient transporters.

    PubMed Central

    Diamond, J M; Karasov, W H

    1987-01-01

    Because most eukaryotic somatic cells are bathed in a constant internal milieu, most of their proteins are constitutive, unlike the adaptive enzymes of bacteria. However, intestinal mucosal cells, like bacteria, face a varying milieu. Hence, we tested for adaptive regulation of intestinal nutrient transporters, sought its functional significance, and compared it with regulation of bacterial proteins. All 12 transporters studied proved to be regulated by dietary substrate levels. Regulation in the intestine is slower than in bacteria and shows lower peak-to-basal activity levels. Regulatory patterns vary greatly among transporters: two sugars and two nonessential amino acids monotonically up-regulate their transporters, two vitamins and three minerals monotonically down-regulate their transporters, and two transporters of essential amino acids respond nonmonotonically to levels of their substrates. These varied patterns arise from trade-offs among four factors: transporter costs, calories yielded by metabolizable substrates, fixed daily requirements of essential nutrients, and toxicity of certain nutrients in large amounts. Based on these trade-offs, we predict the form of regulatory pattern for intestinal transporters not yet studied. PMID:3470788

  6. Food Derived Bioactive Peptides and Intestinal Barrier Function

    PubMed Central

    Martínez-Augustin, Olga; Rivero-Gutiérrez, Belén; Mascaraque, Cristina; Sánchez de Medina, Fermín

    2014-01-01

    A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF) whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action. PMID:25501338

  7. Food derived bioactive peptides and intestinal barrier function.

    PubMed

    Martínez-Augustin, Olga; Rivero-Gutiérrez, Belén; Mascaraque, Cristina; Sánchez de Medina, Fermín

    2014-12-09

    A wide range of food-derived bioactive peptides have been shown to exert health-promoting actions and are therefore considered functional foods or nutraceuticals. Some of these actions are related to the maintenance, reinforcement or repairment of the intestinal barrier function (IBF) whose role is to selectively allow the absorption of water, nutrients and ions while preventing the influx of microorganisms from the intestinal lumen. Alterations in the IBF have been related to many disorders, such as inflammatory bowel disease or metabolic syndrome. Components of IBF are the intestinal epithelium, the mucus layer, secretory immunoglobulin A and cells of the innate and adaptive immune systems. Here we review the effects of food derived bioactive peptides on these IBF components. In vitro and in vivo effects, both in healthy and disease states, have been reviewed. Although limited, the available information indicates a potential for food-derived peptides to modify IBF and to contribute to disease treatment, but further research is needed to better isolate responsible peptides, and to help define their mode of action.

  8. Intestinal Transport of Weak Electrolytes

    PubMed Central

    Jackson, Michael J.; Shiau, Yih-Fu; Bane, Susan; Fox, Margaret

    1974-01-01

    A study has been made of the transmural fluxes of benzoic, phenylacetic, and pentanoic acids, benzylamine, hexylamine, and D-amphetamine across rat jejunum incubated in vitro. The M to S fluxes of the weak acids were greater than their corresponding S to M fluxes, and the S to M fluxes of the weak bases were larger than their M to S fluxes. These patterns of asymmetric movements were observed when the transmural electrical potential difference was clamped at 0 mV, and when the pH values of the mucosal and serosal fluids were identical. The effects of a weak acid on the fluxes of other weak electrolytes were qualitatively similar when the effector weak acid was added to the mucosal fluid, and when it was added to the serosal fluid. But the effects of a weak base on the fluxes of other weak electrolytes were dependent upon its location, and the interactions observed when the effector weak base was added to the mucosal fluid were qualitatively different than those seen when it was added to the serosal fluid. The interactions between weak electrolytes could readily be explained in terms of the function of a system of three compartments in series, in which the pH of the intermediate compartment is greater than that of the bulk phases. But these observations could not be explained in terms of an analogous system involving an intermediate compartment of low pH, or in terms of a carrier mediated system. The transport function of the three-compartment system can be described in the form of an equation, and it is found that a pH difference of less than 0.5 unit may explain our observations on weak electrolyte transport. PMID:4812635

  9. Theaflavins, dimeric catechins, inhibit peptide transport across Caco-2 cell monolayers via down-regulation of AMP-activated protein kinase-mediated peptide transporter PEPT1.

    PubMed

    Takeda, Junko; Park, Ha-Young; Kunitake, Yuri; Yoshiura, Keiko; Matsui, Toshiro

    2013-06-15

    In the small intestine, peptide transporter 1 (PEPT1) plays a role in the transport of di- and tripeptides. In this study, we investigated whether theaflavins (TFs) affect the absorption of small peptides in human intestinal Caco-2 cells, since TFs do not penetrate through the cells and might be involved in intestinal transport systems. In transport experiments, the transport of glycyl-sarcosine (Gly-Sar, a model molecule for PEPT1 transport) and other dipeptides (Val-Tyr and Ile-Phe) were significantly reduced (P<0.05) in TFs-pretreated cells. In TF 3'-O-gallate-pretreated cells, Western blot analysis revealed attenuated expression of PEPT1 transporter and Gly-Sar transport was completely ameliorated by 10 μM Compound C, an AMP-activated protein kinase (AMPK) inhibitor. In conclusion, the present study demonstrated that TFs inhibit peptide transport across Caco-2 cell monolayers, probably through suppression of AMPK-mediated PEPT1 expression, which should be considered a new bioactivity of TFs in black tea.

  10. Intestinal transport and metabolism of bile acids

    PubMed Central

    Dawson, Paul A.; Karpen, Saul J.

    2015-01-01

    In addition to their classical roles as detergents to aid in the process of digestion, bile acids have been identified as important signaling molecules that function through various nuclear and G protein-coupled receptors to regulate a myriad of cellular and molecular functions across both metabolic and nonmetabolic pathways. Signaling via these pathways will vary depending on the tissue and the concentration and chemical structure of the bile acid species. Important determinants of the size and composition of the bile acid pool are their efficient enterohepatic recirculation, their host and microbial metabolism, and the homeostatic feedback mechanisms connecting hepatocytes, enterocytes, and the luminal microbiota. This review focuses on the mammalian intestine, discussing the physiology of bile acid transport, the metabolism of bile acids in the gut, and new developments in our understanding of how intestinal metabolism, particularly by the gut microbiota, affects bile acid signaling. PMID:25210150

  11. Electron Transport in Short Peptide Single Molecules

    NASA Astrophysics Data System (ADS)

    Cui, Jing; Brisendine, Joseph; Ng, Fay; Nuckolls, Colin; Koder, Ronald; Venkarataman, Latha

    We present a study of the electron transport through a series of short peptides using scanning tunneling microscope-based break junction method. Our work is motivated by the need to gain a better understanding of how various levels of protein structure contribute to the remarkable capacity of proteins to transport charge in biophysical processes such as respiration and photosynthesis. We focus here on short mono, di and tri-peptides, and probe their conductance when bound to gold electrodes in a native buffer environment. We first show that these peptides can bind to gold through amine, carboxyl, thiol and methyl-sulfide termini. We then focus on two systems (glycine and alanine) and show that their conductance decays faster than alkanes terminated by the same linkers. Importantly, our results show that the peptide bond is less conductive than a sigma carbon-carbon bond. This work was supported in part by NSF-DMR 1507440.

  12. Immunocytochemical detection of vasoactive intestinal peptide-like and peptide histidine isoleucine-like peptides in the nervous system and the excretory system of adult Nippostrongylus brasiliensis.

    PubMed

    Foster, N

    1998-05-01

    Vasoactive intestinal peptide-like and peptide histidine isoleucine-like immunoreactivities were detected in the excretory duct of adult male and female Nippostrongylus brasiliensis, thus indicating the source of these two physiologically active peptides previously isolated from the excretory/secretory products of adult N. brasiliensis. In the nervous system immunoreactivity to both these peptides was confined to females and was found in the neurons of the ovijector associated ganglion. This is consistent with co-synthesis of vasoactive intestinal peptide-like and peptide histidine isoleucine-like peptides which has also been shown to occur in all mammalian vasoactive intestinal peptid-ergic neurons studied to date. However, in addition to this, and in common to some previous studies on helminth vasoactive intestinal peptide and peptide histidine isoleucine immunoreactivities, co-synthesis of the peptides was not indicated in a pair of branched neurons which projected posteriorly and peripherally from the ganglion associated with the ovijector of females and which terminated in two pairs of ganglia also exhibiting vasoactive intestinal peptide-like immunoreactivity only. The position of these ganglia indicated that they innervate muscles close to the body wall and may be responsible for the muscular contractions required for expulsion of eggs from female Nippostrongylus brasiliensis. This is also the first study to successfully detect these peptides in the excretory system of gastrointestinal nematodes.

  13. Vasoactive intestinal peptide and electrical activity influence neuronal survival

    SciTech Connect

    Brenneman, D.E.; Eiden, L.E.

    1986-02-01

    Blockage of electrical activity in dissociated spinal cord cultures results in a significant loss of neurons during a critical period in development. Decreases in neuronal cell numbers and SVI-labeled tetanus toxin fixation produced by electrical blockage with tetrodotoxin (TTX) were prevented by addition of vasoactive intestinal peptide (VIP) to the nutrient medium. The most effective concentration of VIP was 0.1 nM. At higher concentrations, the survival-enhancing effect of VIP on TTX-treated cultures was attenuated. Addition of the peptide alone had no significant effect on neuronal cell counts or tetanus toxin fixation. With the same experimental conditions, two closely related peptides, PHI-27 (peptide, histidyl-isoleucine amide) and secretin, were found not to increase the number of neurons in TTX-treated cultures. Interference with VIP action by VIP antiserum resulted in neuronal losses that were not significantly different from those observed after TTX treatment. These data indicate that under conditions of electrical blockade a neurotrophic action of VIP on neuronal survival can be demonstrated.

  14. Intestinal transport as a potential determinant of drug bioavailability.

    PubMed

    Nauli, Andromeda M; Nauli, Surya M

    2013-08-01

    Orally administered drugs are generally absorbed by the small intestine and transported either to the lymphatic system or to the hepatic portal system. In general, lipid soluble drugs and vitamins are transported by the small intestine to the lymphatics, and water-soluble drugs are transported to the hepatic portal system. By avoiding the early hepatic first pass effect, the lymphatic transport system may increase drug bioavailability. In addition to its transport systems, the small intestine may affect drug bioavailability through drug uptake, intestinal first pass effect, recruitment of drugs by chylomicrons, formation and secretion of chylomicrons, and enterohepatic circulation. All of these factors should be considered when formulating orally administered lipophilic drugs. Our data also suggest that Caco-2 cells may serve as a valuable in vitro model to study the intestinal transport of orally administered drugs.

  15. Cloning and expression of the human vasoactive intestinal peptide receptor.

    PubMed Central

    Sreedharan, S P; Robichon, A; Peterson, K E; Goetzl, E J

    1991-01-01

    Vasoactive intestinal peptide (VIP) is a neuroendocrine mediator found in the central and peripheral nervous system. Distinct subsets of neural, respiratory, gastrointestinal, and immune cells bear specific high-affinity receptors for VIP, which are associated with a guanine nucleotide-binding (G) protein capable of activating adenylate cyclase. A cDNA clone (GPRN1) encoding the human VIP receptor was identified in libraries prepared from the Nalm 6 line of leukemic pre-B lymphoblasts and the HT-29 line of colon carcinoma cells. The deduced 362-amino acid polypeptide sequence encoded by GPRN1 shares a seven-transmembrane-segment hydropathicity profile with other G protein-coupled receptors. Northern blot analyses identified a 2.7-kilobase transcript of the VIP receptor in Nalm 6 and HT-29 cells as well as in tissues from rat brain, colon, heart, lung, kidney, spleen, and small intestine. COS-6 cells transfected with GPRN1 bound 125I-labeled VIP specifically with a dissociation constant (Kd) of 2.5 nM. VIP--and less effectively secretin, peptide histidine isoleucine (PHI), and glucagon competitively displaced bound 125I-VIP from transfected COS-6 cells, with potencies in the order VIP greater than secretin = PHI much greater than glucagon. VIP stimulated adenylate cyclase activity in stably transfected Chinese hamster ovary K1 cells, inducing a 3-fold increase in the intracellular level of cAMP. When the antisense orientation of the VIP receptor clone was introduced into HT-29 cells, there was a 50% suppression of the specific binding of 125I-VIP and of the VIP-induced increase in cAMP level, relative to untransfected cells. The VIP receptor cloned exhibits less than or equal to 24% homology with other receptors in the same superfamily and thus represents a subset of G protein-coupled receptors for peptide ligands. Images PMID:1675791

  16. Glucagon-like peptide-2 induces rapid digestive adaptation following intestinal resection in preterm neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Short bowel syndrome (SBS) is a frequent complication after intestinal resection in infants suffering from intestinal disease. We tested whether treatment with the intestinotrophic hormone glucagon-like peptide-2 (GLP-2) increases intestinal volume and function in the period immediately following in...

  17. Human intestine luminal ACE2 and amino acid transporter expression increased by ACE-inhibitors.

    PubMed

    Vuille-dit-Bille, Raphael N; Camargo, Simone M; Emmenegger, Luca; Sasse, Tom; Kummer, Eva; Jando, Julia; Hamie, Qeumars M; Meier, Chantal F; Hunziker, Schirin; Forras-Kaufmann, Zsofia; Kuyumcu, Sena; Fox, Mark; Schwizer, Werner; Fried, Michael; Lindenmeyer, Maja; Götze, Oliver; Verrey, François

    2015-04-01

    Sodium-dependent neutral amino acid transporter B(0)AT1 (SLC6A19) and imino acid (proline) transporter SIT1 (SLC6A20) are expressed at the luminal membrane of small intestine enterocytes and proximal tubule kidney cells where they exert key functions for amino acid (re)absorption as documented by their role in Hartnup disorder and iminoglycinuria, respectively. Expression of B(0)AT1 was shown in rodent intestine to depend on the presence of the carboxypeptidase angiotensin-converting enzyme 2 (ACE2). This enzyme belongs to the renin-angiotensin system and its expression is induced by treatment with ACE-inhibitors (ACEIs) or angiotensin II AT1 receptor blockers (ARBs) in many rodent tissues. We show here in the Xenopus laevis oocyte expression system that human ACE2 also functionally interacts with SIT1. To investigate in human intestine the potential effect of ACEIs or ARBs on ACE2, we analysed intestinal biopsies taken during routine gastroduodenoscopy and ileocolonoscopy from 46 patients of which 9 were under ACEI and 13 ARB treatment. Analysis of transcript expression by real-time PCR and of proteins by immunofluorescence showed a co-localization of SIT1 and B(0)AT1 with ACE2 in the brush-border membrane of human small intestine enterocytes and a distinct axial expression pattern of the tested gene products along the intestine. Patients treated with ACEIs displayed in comparison with untreated controls increased intestinal mRNA levels of ACE2, peptide transporter PEPT1 (SLC15A1) and AA transporters B(0)AT1 and PAT1 (SLC36A1). This study unravels in human intestine the localization and distribution of intestinal transporters involved in amino acid absorption and suggests that ACEIs impact on their expression.

  18. The role of vasoactive intestinal peptide in scavenging singlet oxygen

    SciTech Connect

    Misra, B.R.; Misra, H.P. )

    1990-02-26

    The neuropeptide vasoactive intestinal peptide (VIP), a highly basic 28 amino acid peptide, has a widespread distribution in the body. The functional specificity of this peptide not only includes its potent vasodilatory activity, but also its role in protecting lungs against acute injury, in preventing T-lymphocyte proliferation and in modulating immune function. The purpose of this study was to examine the possible antioxidant properties of VIP. The authors found that VIP up to 50 {mu}g/ml had no inhibitory effect on its reduction of cytochrome C by xanthine and xanthine oxidase, indicating that the peptide does not have significant O{sub 2} scavenging ability. However, VIP was found to inhibit, in a dose-dependent manner, the {sup 1}O{sub 2} dependent 2, 2, 6, 6 tetramethyl piperidine oxide (TEMPO) formation. {sup 1}O{sub 2} was produced by rose benzal photosensitizing system and was detected as TEMP-{sup 1}O{sub 2} adduct (TEMPO) by electron paramagnetic resonance (EPR) spectroscopic technique. The formation of TEMPO signal was strongly inhibited by {beta}-carotene, histidine as well as azide, but not by superoxide dismutase (48 {mu}g/ml), catalase (20 {mu}g/ml) and mannitol (6mM), indicating that TEMPO signal was a TEMP-{sup 1}O{sub 2} adduct. These results indicate that VIP has potent antioxidant activity and may serve as a singlet O{sub 2} scavenger, thus it may modulate the oxidative tissue injury caused by this reactive oxygen species.

  19. Expression pattern of peptide and amino acid genes in digestive tract of transporter juvenile turbot ( Scophthalmus maximus L.)

    NASA Astrophysics Data System (ADS)

    Xu, Dandan; He, Gen; Mai, Kangsen; Zhou, Huihui; Xu, Wei; Song, Fei

    2016-04-01

    Turbot ( Scophthalmus maximus L.), a carnivorous fish species with high dietary protein requirement, was chosen to examine the expression pattern of peptide and amino acid transporter genes along its digestive tract which was divided into six segments including stomach, pyloric caeca, rectum, and three equal parts of the remainder of the intestine. The results showed that the expression of two peptide and eleven amino acid transporters genes exhibited distinct patterns. Peptide transporter 1 (PepT1) was rich in proximal intestine while peptide transporter 2 (PepT2) was abundant in distal intestine. A number of neutral and cationic amino acid transporters expressed richly in whole intestine including B0-type amino acid transporter 1 (B0AT1), L-type amino acid transporter 2 (LAT2), T-type amino acid transporter 1 (TAT1), proton-coupled amino acid transporter 1 (PAT1), y+L-type amino acid transporter 1 (y+LAT1), and cationic amino acid transporter 2 (CAT2) while ASC amino acid transporter 2 (ASCT2), sodium-coupled neutral amino acid transporter 2 (SNAT2), and y+L-type amino acid transporter 2 (y+LAT2) abundantly expressed in stomach. In addition, system b0,+ transporters (rBAT and b0,+AT) existed richly in distal intestine. These findings comprehensively characterized the distribution of solute carrier family proteins, which revealed the relative importance of peptide and amino acid absorption through luminal membrane. Our findings are helpful to understand the mechanism of the utilization of dietary protein in fish with a short digestive tract.

  20. The Responses of Rat Intestinal Brush Border and Cytosol Peptide Hydrolase Activities to Variation in Dietary Protein Content DIETARY REGULATION OF INTESTINAL PEPTIDE HYDROLASES

    PubMed Central

    Nicholson, J. Alex; McCarthy, Denis M.; Kim, Young S.

    1974-01-01

    The effects of variation in dietary protein content on small intestinal brush border and cytosol peptide hydrolase activities have been investigated. One group of rats was fed a high protein diet (55% casein) and another group was fed a low protein diet (10% casein). After 1 wk, brush border peptide hydrolase activity (L-leucyl-β-naphthylamide as substrate) and cytosol peptide hydrolase activity (L-prolyl-L-leucine as substrate) were determined in mucosae taken from the proximal, middle, and distal small intestine. As judged by several parameters, brush border peptide hydrolase activity was significantly greater in rats fed the high protein diet when data for corresponding segments were compared. In contrast, no significant difference was seen in cytosol peptide hydrolase activity. In a second study, brush border and cytosol peptide hydrolase activities were determined in the proximal intestine by utilizing an additional three peptide substrates: L-leucyl-L-alanine, L-phenylalanylglycine, and glycyl-L-phenylalanine. Sucrase, maltase, and alkaline phosphatase activities were also determined. As before, brush border peptide hydrolase activities were significantly greater in rats fed the high protein diet. However, activities of the nonproteolytic brush border enzymes did not vary significantly with diet. In contrast to the results obtained with L-prolyl-L-leucine as substrate for the cytosol enzymes, cytosol activity against the three additional peptide substrates was greater in rats fed the high protein diet. It is suggested that the brush border peptide hydrolase response to variation in dietary protein content represents a functional adaptation analogous to the regulation of intestinal disaccharidases by dietary carbohydrates. The implication of the differential responses of the cytosol peptide hydrolases is uncertain, since little is known of the functional role of these nonorgan-specific enzymes. PMID:4430719

  1. Electrogenic, proton-coupled, intestinal dipeptide transport in herbivorous and carnivorous teleosts.

    PubMed

    Thamotharan, M; Gomme, J; Zonno, V; Maffia, M; Storelli, C; Ahearn, G A

    1996-05-01

    In both herbivorous tilapia (Oreochromis mossambicus) and carnivorous rockfish (Sebastes caurinus) intestinal and pyloric cecal brush-border membrane vesicles (BBMV), [14C]glycylsarcosine ([14C]Gly-Sar) uptake was stimulated by a transmembrane proton gradient. A transmembrane K(+)-diffusion potential (inside negative) stimulated [14C]Gly-Sar uptake above that observed with short-circuited vesicles, whereas an inwardly directed Na+ gradient in both fishes had no effect on peptide uptake. In tilapia, [14C]Gly-Sar influx occurred by the combination of 1) a high-affinity, saturable, proton gradient-dependent carrier system [Kt [concentration that equals one-half of maximum influx (Jmax)] = 0.56 +/- 0.08 mM; Jmax = 1,945.0 +/- 174.6 pmol.mg protein-1.10 s-1]; 2) a low-affinity, nonsaturable (within 1-10 mM), proton gradient-dependent carrier system (nonsaturable carrier-mediated transport component = 4,514.0 +/- 28.1 pmol.mg protein-1.10 s-1.mM-1); and 3) a diffusional component accounting for < 10% of total influx within the concentration range tested. Influx (10 s) of 1-10 mM [14C]Gly-Sar in tilapia intestine was significantly (P < 0.01) inhibited by 10 mM diethylpyrocarbonate, a specific inhibitor of proton-coupled peptide transport systems. [14C]Gly-Sar influx into tilapia BBMV showed cis-inhibition and trans-stimulation by Gly-Pro, suggesting that [14C]Gly-Sar and Gly-Pro shared the same mucosal peptide transporter in fish. These observations strongly suggest that intestinal transport of peptides in herbivorous and carnivorous fishes is proton gradient dependent, electrogenic, sodium independent, and qualitatively resembles the peptide transport paradigm proposed for mammals.

  2. Actions of vasoactive intestinal peptide and secretin on chief cells prepared from guinea pig stomach

    SciTech Connect

    Sutliff, V.E.; Raufman, J.P.; Jensen, R.T.; Gardner, J.D.

    1986-07-01

    Vasoactive intestinal peptide and secretin increased cellular cAMP and pepsinogen secretion in dispersed chief cells from guinea pig gastric mucosa. With each peptide there was a close correlation between the dose-response curve for changes in cellular cAMP and that for changes in pepsinogen secretion. Vasoactive intestinal peptide- (10-28) and secretin- (5-27) had no agonist activity and antagonized the actions of vasoactive intestinal peptide and secretin on cellular cAMP and pepsinogen secretion. Studies of binding of SVI-vasoactive intestinal peptide and of SV-secretin indicated that gastric chief cells possess four classes of binding sites for vasoactive intestinal peptide and secretin and that occupation of two of these classes of binding sites correlates with the abilities of vasoactive intestinal peptide and secretin to increase cellular cAMP and pepsinogen secretion. What function, in any, is mediated by occupation by the other two classes of binding sites remains to be determined.

  3. Development and physiological regulation of intestinal lipid absorption. III. Intestinal transporters and cholesterol absorption.

    PubMed

    Hui, David Y; Labonté, Eric D; Howles, Philip N

    2008-04-01

    Intestinal cholesterol absorption is modulated by transport proteins in enterocytes. Cholesterol uptake from intestinal lumen requires several proteins on apical brush-border membranes, including Niemann-Pick C1-like 1 (NPC1L1), scavenger receptor B-I, and CD36, whereas two ATP-binding cassette half transporters, ABCG5 and ABCG8, on apical membranes work together for cholesterol efflux back to the intestinal lumen to limit cholesterol absorption. NPC1L1 is essential for cholesterol absorption, but its function as a cell surface transporter or an intracellular cholesterol transport protein needs clarification. Another ATP transporter, ABCA1, is present in the basolateral membrane to mediate HDL secretion from enterocytes.

  4. Stapled Vasoactive Intestinal Peptide (VIP) Derivatives Improve VPAC2 Agonism and Glucose-Dependent Insulin Secretion.

    PubMed

    Giordanetto, Fabrizio; Revell, Jefferson D; Knerr, Laurent; Hostettler, Marie; Paunovic, Amalia; Priest, Claire; Janefeldt, Annika; Gill, Adrian

    2013-12-12

    Agonists of vasoactive intestinal peptide receptor 2 (VPAC2) stimulate glucose-dependent insulin secretion, making them attractive candidates for the treatment of hyperglycaemia and type-II diabetes. Vasoactive intestinal peptide (VIP) is an endogenous peptide hormone that potently agonizes VPAC2. However, VIP has a short serum half-life and poor pharmacokinetics in vivo and is susceptible to proteolytic degradation, making its development as a therapeutic agent challenging. Here, we investigated two peptide cyclization strategies, lactamisation and olefin-metathesis stapling, and their effects on VPAC2 agonism, peptide secondary structure, protease stability, and cell membrane permeability. VIP analogues showing significantly enhanced VPAC2 agonist potency, glucose-dependent insulin secretion activity, and increased helical content were discovered; however, neither cyclization strategy appeared to effect proteolytic stability or cell permeability of the resulting peptides.

  5. Intestinal organoids for assessing nutrient transport, sensing and incretin secretion.

    PubMed

    Zietek, Tamara; Rath, Eva; Haller, Dirk; Daniel, Hannelore

    2015-11-19

    Intestinal nutrient transport and sensing are of emerging interest in research on obesity and diabetes and as drug targets. Appropriate in vitro models are lacking that allow both, studies on transport processes as well as sensing and subsequent incretin hormone secretion including intracellular signaling. We here demonstrate that murine small-intestinal organoids are the first in vitro model system enabling concurrent investigations of nutrient and drug transport, sensing and incretin hormone secretion as well as fluorescent live-cell imaging of intracellular signaling processes. By generating organoid cultures from wild type mice and animals lacking different nutrient transporters, we show that organoids preserve the main phenotypic features and functional characteristics of the intestine. This turns them into the best in vitro model currently available and opens new avenues for basic as well as medical research.

  6. Intestinal organoids for assessing nutrient transport, sensing and incretin secretion

    PubMed Central

    Zietek, Tamara; Rath, Eva; Haller, Dirk; Daniel, Hannelore

    2015-01-01

    Intestinal nutrient transport and sensing are of emerging interest in research on obesity and diabetes and as drug targets. Appropriate in vitro models are lacking that allow both, studies on transport processes as well as sensing and subsequent incretin hormone secretion including intracellular signaling. We here demonstrate that murine small-intestinal organoids are the first in vitro model system enabling concurrent investigations of nutrient and drug transport, sensing and incretin hormone secretion as well as fluorescent live-cell imaging of intracellular signaling processes. By generating organoid cultures from wild type mice and animals lacking different nutrient transporters, we show that organoids preserve the main phenotypic features and functional characteristics of the intestine. This turns them into the best in vitro model currently available and opens new avenues for basic as well as medical research. PMID:26582215

  7. Transepithelial transport of PAMAM dendrimers across isolated intestinal tissue

    NASA Astrophysics Data System (ADS)

    Hubbard, Dallin A.

    Poly(amido amine) (PAMAM) dendrimers have shown potential to carry poorly absorbed drugs across the intestinal barrier and into systemic circulation, reducing the need for intravenous injections. Much of the in vitro transepithelial transport of PAMAM dendrimers to date has been investigated using Caco-2 monolayers which lack the microvilli morphology and enzymes present in isolated intestinal tissues. In addition, a challenge in predicting oral absorption is establishing a correlation between transport across rodent and human intestinal tissues. This dissertation focused on investigating the transepithelial transport of PAMAM dendrimers across rat and human isolated intestinal tissues. Permeability values in isolated tissues were compared with those across Caco-2 cell monolayers. Results indicate a difference in transport of PAMAM dendrimers, morphological changes and transepithelial electrical resistance between Caco-2 cell monolayers, rat and human intestinal tissue models. A relatively high transport rate across the tissues, given the macromolecular nature of PAMAM dendrimers, shows promise for use of these constructs for oral delivery in human.

  8. The Mesenteric Lymph Duct Cannulated Rat Model: Application to the Assessment of Intestinal Lymphatic Drug Transport

    PubMed Central

    Trevaskis, Natalie L.; Hu, Luojuan; Caliph, Suzanne M.; Han, Sifei; Porter, Christopher J.H.

    2015-01-01

    The intestinal lymphatic system plays key roles in fluid transport, lipid absorption and immune function. Lymph flows directly from the small intestine via a series of lymphatic vessels and nodes that converge at the superior mesenteric lymph duct. Cannulation of the mesenteric lymph duct thus enables the collection of mesenteric lymph flowing from the intestine. Mesenteric lymph consists of a cellular fraction of immune cells (99% lymphocytes), aqueous fraction (fluid, peptides and proteins such as cytokines and gut hormones) and lipoprotein fraction (lipids, lipophilic molecules and apo-proteins). The mesenteric lymph duct cannulation model can therefore be used to measure the concentration and rate of transport of a range of factors from the intestine via the lymphatic system. Changes to these factors in response to different challenges (e.g., diets, antigens, drugs) and in disease (e.g., inflammatory bowel disease, HIV, diabetes) can also be determined. An area of expanding interest is the role of lymphatic transport in the absorption of orally administered lipophilic drugs and prodrugs that associate with intestinal lipid absorption pathways. Here we describe, in detail, a mesenteric lymph duct cannulated rat model which enables evaluation of the rate and extent of lipid and drug transport via the lymphatic system for several hours following intestinal delivery. The method is easily adaptable to the measurement of other parameters in lymph. We provide detailed descriptions of the difficulties that may be encountered when establishing this complex surgical method, as well as representative data from failed and successful experiments to provide instruction on how to confirm experimental success and interpret the data obtained. PMID:25866901

  9. Acylation of Glucagon-Like Peptide-2: Interaction with Lipid Membranes and In Vitro Intestinal Permeability

    PubMed Central

    Trier, Sofie; Linderoth, Lars; Bjerregaard, Simon; Andresen, Thomas Lars; Rahbek, Ulrik Lytt

    2014-01-01

    Background Acylation of peptide drugs with fatty acid chains has proven beneficial for prolonging systemic circulation as well as increasing enzymatic stability without disrupting biological potency. Acylation has furthermore been shown to increase interactions with the lipid membranes of mammalian cells. The extent to which such interactions hinder or benefit delivery of acylated peptide drugs across cellular barriers such as the intestinal epithelia is currently unknown. The present study investigates the effect of acylating peptide drugs from a drug delivery perspective. Purpose We hypothesize that the membrane interaction is an important parameter for intestinal translocation, which may be used to optimize the acylation chain length for intestinal permeation. This work aims to characterize acylated analogues of the intestinotrophic Glucagon-like peptide-2 by systematically increasing acyl chain length, in order to elucidate its influence on membrane interaction and intestinal cell translocation in vitro. Results Peptide self-association and binding to both model lipid and cell membranes was found to increase gradually with acyl chain length, whereas translocation across Caco-2 cells depended non-linearly on chain length. Short and medium acyl chains increased translocation compared to the native peptide, but long chain acylation displayed no improvement in translocation. Co-administration of a paracellular absorption enhancer was found to increase translocation irrespective of acyl chain length, whereas a transcellular enhancer displayed increased synergy with the long chain acylation. Conclusions These results show that membrane interactions play a prominent role during intestinal translocation of an acylated peptide. Acylation benefits permeation for shorter and medium chains due to increased membrane interactions, however, for longer chains insertion in the membrane becomes dominant and hinders translocation, i.e. the peptides get ‘stuck’ in the cell

  10. Expression and Function of Intestinal Hexose Transporters after Small Intestinal Denervation

    PubMed Central

    Iqbal, Corey W.; Fatima, Javairiah; Duenes, Judith; Houghton, Scott G.; Kasparek, Michael S.; Sarr, Michael G.

    2009-01-01

    Background The role of neural regulation in expression and function of intestinal hexose transporters is unknown. Aim To determine the role of intestinal innervation in gene expression and function of the membrane hexose transporters, SGLT1, GLUT2, and GLUT5 in the enterocyte. Hypothesis Denervation of the small intestine decreases expression of hexose transporters leading to decreased glucose absorption. Methods Six groups of Lewis rats were studied (n=6 each): control, 1 wk after sham laparotomy, 1 and 8 wk after syngeneic (no immune rejection) orthotopic small bowel transplantation (SBT) (SBT1, SBT8) to induce complete extrinsic denervation, and 1 and 8 wk after selective disruption of intrinsic neural continuity to jejunoileum by gut transection and reanastomosis (T/A1, T/A8). All tissue was harvested between 8AM and 10AM. In duodenum, jejunum, and ileum, mucosal mRNA levels were quantitated by real time PCR, protein by Western blotting, and transporter-mediated glucose absorption using the everted sleeve technique. Results Across the six groups, relative gene expression of hexose transporter mRNA and protein levels were unchanged and no difference in transporter-mediated glucose uptake was evident in any region. Glucose transporter affinity (Km) and functional transporter levels (Vmax) calculated for duodenum and jejunum showed no difference between the six groups. Conclusion Baseline regulation of hexose transporter function is not mediated tonically by intrinsic or extrinsic neural continuity to the jejunoileum. PMID:19541015

  11. Regulation of Intestinal Glucose Absorption by Ion Channels and Transporters

    PubMed Central

    Chen, Lihong; Tuo, Biguang; Dong, Hui

    2016-01-01

    The absorption of glucose is electrogenic in the small intestinal epithelium. The major route for the transport of dietary glucose from intestinal lumen into enterocytes is the Na+/glucose cotransporter (SGLT1), although glucose transporter type 2 (GLUT2) may also play a role. The membrane potential of small intestinal epithelial cells (IEC) is important to regulate the activity of SGLT1. The maintenance of membrane potential mainly depends on the activities of cation channels and transporters. While the importance of SGLT1 in glucose absorption has been systemically studied in detail, little is currently known about the regulation of SGLT1 activity by cation channels and transporters. A growing line of evidence suggests that cytosolic calcium ([Ca2+]cyt) can regulate the absorption of glucose by adjusting GLUT2 and SGLT1. Moreover, the absorption of glucose and homeostasis of Ca2+ in IEC are regulated by cation channels and transporters, such as Ca2+ channels, K+ channels, Na+/Ca2+ exchangers, and Na+/H+ exchangers. In this review, we consider the involvement of these cation channels and transporters in the regulation of glucose uptake in the small intestine. Modulation of them may be a potential strategy for the management of obesity and diabetes. PMID:26784222

  12. Regulation of Intestinal Glucose Absorption by Ion Channels and Transporters.

    PubMed

    Chen, Lihong; Tuo, Biguang; Dong, Hui

    2016-01-14

    The absorption of glucose is electrogenic in the small intestinal epithelium. The major route for the transport of dietary glucose from intestinal lumen into enterocytes is the Na⁺/glucose cotransporter (SGLT1), although glucose transporter type 2 (GLUT2) may also play a role. The membrane potential of small intestinal epithelial cells (IEC) is important to regulate the activity of SGLT1. The maintenance of membrane potential mainly depends on the activities of cation channels and transporters. While the importance of SGLT1 in glucose absorption has been systemically studied in detail, little is currently known about the regulation of SGLT1 activity by cation channels and transporters. A growing line of evidence suggests that cytosolic calcium ([Ca(2+)]cyt) can regulate the absorption of glucose by adjusting GLUT2 and SGLT1. Moreover, the absorption of glucose and homeostasis of Ca(2+) in IEC are regulated by cation channels and transporters, such as Ca(2+) channels, K⁺ channels, Na⁺/Ca(2+) exchangers, and Na⁺/H⁺ exchangers. In this review, we consider the involvement of these cation channels and transporters in the regulation of glucose uptake in the small intestine. Modulation of them may be a potential strategy for the management of obesity and diabetes.

  13. Vasoactive intestinal peptide, a promising agent for myopia?

    PubMed Central

    Cakmak, Ayse Idil; Basmak, Hikmet; Gursoy, Huseyin; Ozkurt, Mete; Yildirim, Nilgun; Erkasap, Nilufer; Bilgec, Mustafa Deger; Tuncel, Nese; Colak, Ertugrul

    2017-01-01

    AIM To investigate the role of vasoactive intestinal peptide (VIP) in form-deprivation myopia (FDM). METHODS FDM was created in three groups of eight chicks by placing a translucent diffuser on their right eyes. Intravitreal injections of saline and VIP were applied once a day into the occluded eyes of groups 2 and 3, respectively. Retinoscopy and axial length (AL) measurements were performed on the first and 8th days of diffuser wear. The retina mRNA levels of the VIP receptors and the ZENK protein in right eyes of the three groups and left eyes of the first group on day 8 were determined using real time polymerase chain reaction (PCR). RESULTS The median final refraction (D) in right eyes were -13.75 (-16.00, -12.00), -11.50 (-12.50, -7.50), and -1.50 (-4.75, -0.75) in groups 1, 2, and 3, respectively (P<0.001). The median AL (mm) in right eyes were 10.65 (10.00, 11.10), 9.90 (9.70, 10.00), and 9.20 (9.15, 9.25) in groups 1, 2, and 3, respectively (P<0.001). The median delta-delta cycle threshold (CT) values for the VIP2 receptors were 1.07 (0.82, 1.43), 1.22 (0.98, 1.65), 0.29 (0.22, 0.45) in right eyes of groups 1, 2, and 3, and 1.18 (0.90, 1.37) in left eyes of group 1, respectively (P=0.001). The median delta-delta CT values for the ZENK protein were 1.07 (0.63, 5.03), 3.55 (2.20, 5.55), undetectable in right eyes of groups 1, 2, and 3 and 1.89 (0.21, 4.73) in left eyes of group 1, respectively (P=0.001). CONCLUSION VIP has potential inhibitory effects in the development of FDM. PMID:28251078

  14. Transmembrane transport of peptide type compounds: prospects for oral delivery

    NASA Technical Reports Server (NTRS)

    Lipka, E.; Crison, J.; Amidon, G. L.

    1996-01-01

    Synthesis and delivery of potential therapeutic peptides and peptidomimetic compounds has been the focus of intense research over the last 10 years. While it is widely recognized that numerous limitations apply to oral delivery of peptides, some of the limiting factors have been addressed and their mechanisms elucidated, which has lead to promising strategies. This article will briefly summarize the challenges, results and current approaches of oral peptide delivery and give some insight on future strategies. The barriers determining peptide bioavailability after oral administration are intestinal membrane permability, size limitations, intestinal and hepatic metabolism and in some cases solubility limitations. Poor membrane permeabilities of hydrophilic peptides might be overcome by structurally modifying the compounds, thus increasing their membrane partition characteristics and/or their affinity to carrier proteins. Another approach is the site-specific delivery of the peptide to the most permeable parts of the intestine. The current view on size limitation for oral drug delivery has neglected partition considerations. Recent studies suggest that compounds with a molecular weight up to 4000 might be significantly absorbed, assuming appropriate partition behavior and stability. Metabolism, probably the most significant factor in the absorption fate of peptides, might be controlled by coadministration of competitive enzyme inhibitors, structural modifications and administration of the compound as a well absorbed prodrug that is converted into the therapeutically active agent after its absorption. For some peptides poor solubility might present a limitation to oral absorption, an issue that has been addressed by mechanistically defining and therefore improving formulation parameters. Effective oral peptide delivery requires further development in understanding these complex mechanisms in order to maximize the therapeutic potential of this class of compounds.

  15. Tumor suppressor gene adenomatous polyposis coli downregulates intestinal transport.

    PubMed

    Rexhepaj, Rexhep; Rotte, Anand; Gu, Shuchen; Michael, Diana; Pasham, Venkanna; Wang, Kan; Kempe, Daniela S; Ackermann, Teresa F; Brücher, Björn; Fend, Falko; Föller, Michael; Lang, Florian

    2011-05-01

    Loss of function mutations of the tumor suppressor gene adenomatous polyposis coli (APC) underly the familial adenomatous polyposis. Mice carrying an inactivating mutation in the apc gene (apc (Min/+)) similarly develop intestinal polyposis. APC is effective at least in part by degrading β-catenin and lack of APC leads to markedly enhanced cellular β-catenin levels. β-Catenin has most recently been shown to upregulate the Na+/K+ ATPase. The present study, thus, explored the possibility that APC could influence intestinal transport. The abundance and localization of β-catenin were determined utilizing Western blotting and confocal microscopy, the activity of the electrogenic glucose carrier (SGLT1) was estimated from the glucose-induced current in jejunal segments utilizing Ussing chamber experiments and the Na+/H+ exchanger (NHE3) activity from Na+ -dependent re-alkalinization of cytosolic pH (ΔpH(i)) following an ammonium pulse employing BCECF fluorescence. As a result, β-catenin abundance in intestinal tissue was significantly higher in apc (Min/+) mice than in wild-type mice (apc (+/+)). The β-catenin protein was localized in the basolateral membrane. Both, the glucose-induced current and ΔpH(i) were significantly higher in apc (Min/+) mice than in apc (+/+) mice. In conclusion, intestinal electrogenic transport of glucose and intestinal Na+/H+ exchanger activity are both significantly enhanced in apc (Min/+) mice, pointing to a role of APC in the regulation of epithelial transport.

  16. Enhanced visualization of small peptides absorbed in rat small intestine by phytic-acid-aided matrix-assisted laser desorption/ionization-imaging mass spectrometry.

    PubMed

    Hong, Seong-Min; Tanaka, Mitsuru; Yoshii, Saori; Mine, Yoshinori; Matsui, Toshiro

    2013-11-05

    Enhanced visualization of small peptides absorbed through a rat intestinal membrane was achieved by matrix-assisted laser desorption/ionization time-of-flight imaging mass spectrometry (MALDI-IMS) with the aid of phytic acid as a matrix additive. Penetrants through intestinal peptide transporter 1, i.e., glycyl-sarcosine (Gly-Sar, 147.1 m/z) and antihypertensive dipeptide, Val-Tyr (281.2 m/z), were chosen for MALDI-IMS. The signal-to-noise (S/N) ratios of dipeptides Gly-Sar and Val-Tyr were seen to increase by 2.4- and 8.0-fold, respectively, when using a 2',4',6'-trihydroxyacetophenone (THAP) matrix containing 5.0 mM phytic acid, instead of the THAP matrix alone. Owing to the phytic-acid-aided MALDI-IMS method, Gly-Sar and Val-Tyr absorbed in the rat intestinal membrane were successfully visualized. The proposed imaging method also provided useful information on intestinal peptide absorption; to some extent, Val-Tyr was rapidly hydrolyzed to Tyr by peptidases located at the intestinal microvillus during the absorption process. In conclusion, the strongly acidic additive, phytic acid, is beneficial for enhancing the visualization of small peptides using MALDI-IMS, owing to the suppression of ionization-interfering salts in the tissue.

  17. Thermodynamic evidence for a dual transport mechanism in a POT peptide transporter.

    PubMed

    Parker, Joanne L; Mindell, Joseph A; Newstead, Simon

    2014-12-02

    Peptide transport plays an important role in cellular homeostasis as a key route for nitrogen acquisition in mammalian cells. PepT1 and PepT2, the mammalian proton coupled peptide transporters (POTs), function to assimilate and retain diet-derived peptides and play important roles in drug pharmacokinetics. A key characteristic of the POT family is the mechanism of peptide selectivity, with members able to recognise and transport >8000 different peptides. In this study, we present thermodynamic evidence that in the bacterial POT family transporter PepTSt, from Streptococcus thermophilus, at least two alternative transport mechanisms operate to move peptides into the cell. Whilst tri-peptides are transported with a proton:peptide stoichiometry of 3:1, di-peptides are co-transported with either 4 or 5 protons. This is the first thermodynamic study of proton:peptide stoichiometry in the POT family and reveals that secondary active transporters can evolve different coupling mechanisms to accommodate and transport chemically and physically diverse ligands across the membrane.

  18. Heat Stress Reduces Intestinal Barrier Integrity and Favors Intestinal Glucose Transport in Growing Pigs

    PubMed Central

    Pearce, Sarah C.; Mani, Venkatesh; Boddicker, Rebecca L.; Johnson, Jay S.; Weber, Thomas E.; Ross, Jason W.; Rhoads, Robert P.; Baumgard, Lance H.; Gabler, Nicholas K.

    2013-01-01

    Excessive heat exposure reduces intestinal integrity and post-absorptive energetics that can inhibit wellbeing and be fatal. Therefore, our objectives were to examine how acute heat stress (HS) alters intestinal integrity and metabolism in growing pigs. Animals were exposed to either thermal neutral (TN, 21°C; 35–50% humidity; n = 8) or HS conditions (35°C; 24–43% humidity; n = 8) for 24 h. Compared to TN, rectal temperatures in HS pigs increased by 1.6°C and respiration rates by 2-fold (P<0.05). As expected, HS decreased feed intake by 53% (P<0.05) and body weight (P<0.05) compared to TN pigs. Ileum heat shock protein 70 expression increased (P<0.05), while intestinal integrity was compromised in the HS pigs (ileum and colon TER decreased; P<0.05). Furthermore, HS increased serum endotoxin concentrations (P = 0.05). Intestinal permeability was accompanied by an increase in protein expression of myosin light chain kinase (P<0.05) and casein kinase II-α (P = 0.06). Protein expression of tight junction (TJ) proteins in the ileum revealed claudin 3 and occludin expression to be increased overall due to HS (P<0.05), while there were no differences in claudin 1 expression. Intestinal glucose transport and blood glucose were elevated due to HS (P<0.05). This was supported by increased ileum Na+/K+ ATPase activity in HS pigs. SGLT-1 protein expression was unaltered; however, HS increased ileal GLUT-2 protein expression (P = 0.06). Altogether, these data indicate that HS reduce intestinal integrity and increase intestinal stress and glucose transport. PMID:23936392

  19. Fermentable dietary fiber increases GLP-1 secretion and improves glucose homeostasis despite increased intestinal glucose transport capacity in healthy dogs.

    PubMed

    Massimino, S P; McBurney, M I; Field, C J; Thomson, A B; Keelan, M; Hayek, M G; Sunvold, G D

    1998-10-01

    Ileal proglucagon gene expression and postprandial plasma concentrations of proglucagon-derived peptides are reported to change with the type and quantity of dietary fiber ingested by rats. Within the intestine, proglucagon encodes several proglucagon-derived peptides known to modulate intestinal absorption capacity and pancreatic insulin secretion. To determine whether the chronic ingestion of fermentable dietary fiber regulates the expression and synthesis of proglucagon-derived peptides in the distal intestine to modulate glucose homeostasis, the following study was conducted: 16 adult dogs (23 +/- 2 kg) were fed isoenergetic, isonitrogenous diets containing a mixture of high fermentable dietary fibers (HFF) or low fermentable (LFF) wood cellulose for 14 d in a randomized cross-over design. Food was withheld for 16 h before an oral glucose tolerance test was conducted supplying 2 g of glucose/kg body wt, and peripheral blood was collected via a hind-leg catheter at 0, 15, 30, 45, 60, 90 and 120 min for plasma glucose, insulin and glucagon-like peptide-1(7-36)NH2 (GLP-1) analyses. Intestinal samples were collected after the second dietary treatment. Ileal proglucagon mRNA, intestinal (GLP-1) concentrations and the integrated area under the curves (AUC) for plasma GLP-1 and insulin were greater and plasma glucose AUC was reduced when dogs were fed the HFF diet compared to the LFF diet (P < 0.05). Intestinal villi heights, brush border and basolateral glucose transporter protein abundance and jejunal transport capacities were significantly greater when dogs were fed the HFF diet than when fed the LFF diet. In conclusion, improvements in glucose homeostasis are observed in healthy dogs when they ingest fermentable fibers.

  20. The role and pathophysiological relevance of membrane transporter PepT1 in intestinal inflammation and inflammatory bowel disease.

    PubMed

    Ingersoll, Sarah A; Ayyadurai, Saravanan; Charania, Moiz A; Laroui, Hamed; Yan, Yutao; Merlin, Didier

    2012-03-01

    Intestinal inflammation is characterized by epithelial disruption, leading to loss of barrier function and the recruitment of immune cells, including neutrophils. Although the mechanisms are not yet completely understood, interactions between environmental and immunological factors are thought to be critical in the initiation and progression of intestinal inflammation. In recent years, it has become apparent that the di/tripeptide transporter PepT1 may play an important role in the pathogenesis of such inflammation. In healthy individuals, PepT1 is primarily expressed in the small intestine and transports di/tripeptides for metabolic purposes. However, during chronic inflammation such as that associated with inflammatory bowel disease, PepT1 expression is upregulated in the colon, wherein the protein is normally expressed either minimally or not at all. Several recent studies have shown that PepT1 binds to and transports various bacterial di/tripeptides into colon cells, leading to activation of downstream proinflammatory responses via peptide interactions with innate immune receptors. In the present review, we examine the relationship between colonic PepT1-mediated peptide transport in the colon and activation of innate immune responses during disease. It is important to understand the mechanisms of PepT1 action during chronic intestinal inflammation to develop future therapies addressing inappropriate immune activation in the colon.

  1. Inhibition of Intestinal Thiamin Transport in Rat Model of Sepsis

    PubMed Central

    Sassoon, Catherine S.; Zhu, Ercheng; Fang, Liwei; Subramanian, Veedamali S.; Said, Hamid M.

    2016-01-01

    Objective Thiamin deficiency is highly prevalent in patients with sepsis, but the mechanism by which sepsis induces thiamin deficiency is unknown. This study aimed to determine the influence of various severity of sepsis on carrier-mediated intestinal thiamin uptake, level of expressions of thiamin transporters (thiamin transporter-1 (THTR-1) and thiamin transporter-2 (THTR-2)), and mitochondrial thiamin pyrophosphate transporter (MTPPT). Design Randomized, controlled study Setting Research laboratory at a Veterans Affairs Medical Center Subjects Twenty-four Sprague-Dawley rats were randomized into controls, mild, moderate and severe sepsis with equal number of animals in each group. Measurements and Main Results Sepsis was induced by cecal ligation and puncture with the cecum ligated below the cecal valve at 25 %, 50 % and 75 % of cecal length, defined as severe, moderate and mild sepsis, respectively. Control animals underwent laparotomy only. After 2 days of induced sepsis, carrier-mediated intestinal thiamin uptake was measured using [3H]thiamin. Expressions of THTR-1, THTR-2, and MTPPT proteins and mRNA were measured. Proinflammatory cytokines (IL-1β and IL-6), and adenosine triphosphate (ATP) were also measured. Sepsis inhibited [3H]thiamin uptake and the inhibition was a function of sepsis severity. Both cell membranes thiamin transporters and MTPPT expression levels were suppressed; also levels of ATP in the intestine of animals with moderate and severe sepsis were significantly lower than that of sham operated controls. Conclusions For the first time we demonstrated that sepsis inhibited carrier-mediated intestinal thiamin uptake as a function of sepsis severity, suppressed thiamin transporters and MTPPT, leading to ATP depletion. PMID:27065466

  2. Intestinal Permeability and Glucagon-Like Peptide-2 in Children with Autism: A Controlled Pilot Study

    ERIC Educational Resources Information Center

    Robertson, Marli A.; Sigalet, David L.; Holst, Jens J.; Meddings, Jon B.; Wood, Julie; Sharkey, Keith A.

    2008-01-01

    We measured small intestinal permeability using a lactulose:mannitol sugar permeability test in a group of children with autism, with current or previous gastrointestinal complaints. Secondly, we examined whether children with autism had an abnormal glucagon-like peptide-2 (GLP-2) response to feeding. Results were compared with sibling controls…

  3. Carrier-mediated intestinal absorption of valacyclovir, the L-valyl ester prodrug of acyclovir: 1. Interactions with peptides, organic anions and organic cations in rats.

    PubMed

    Sinko, P J; Balimane, P V

    1998-05-01

    The mechanism of intestinal transport of valacyclovir (VACV), the L-valyl ester prodrug of acyclovir, was investigated in rats using an in situ intestinal perfusion technique. VACV demonstrates an oral bioavailability that is three to five time greater than acyclovir, concentration dependent, and saturable in humans. Homogenate and perfused buffer stability results demonstrated that VACV was increasingly unstable with increasing pH. VACV was converted to ACV in a concentration dependent manner during a single pass through the intestinal segment. Perfusions were performed at 37 degrees C, pH 6.5, and under iso-osmotic conditions (290 +/- 10 mOsm L-1). Intestinal outlet concentrations were corrected for VACV that was converted to ACV during the perfusion. The effective dimensionless intestinal permeability (P*e) of VACV was concentration dependent, saturable (intrinsic Km = 1.2 +/- 0.7 mM), and significantly reduced (p < 0.05) in the presence of peptide analogues (amoxicillin, ampicillin, cefadroxil, and cephradine), by the organic anion, p-amino hippuric acid and by the organic cation quinine. VACV transport was not inhibited by classical nucleoside competitive substrates or inhibitors or by valine. These results suggest that H(+)-oligopeptide, H(+)-organic cation, and organic anion transporters are involved in the small intestinal uptake of VACV. The permeability of VACV in the colon was very low, indicating that VACV is predominantly absorbed from the small intestine. VACV P*e was not altered in the presence of glucose-induced convective fluid flow, suggesting that carrier-mediated, transcellular uptake is the predominant absorption pathway of VACV in rat small intestine. Based on these results, the oral bioavailability of VACV appears to be significantly influenced by the preabsorptive conversion of VACV to the poorly absorbed ACV, by the involvement of multiple transporters in VACV small-intestinal uptake, and by the low permeability of VACV in the colon.

  4. Dual system of intestinal thiamine transport in humans

    SciTech Connect

    Hoyumpa, A.M. Jr.; Strickland, R.; Sheehan, J.J.; Yarborough, G.; Nichols, S.

    1982-05-01

    The transport of thiamine across the intestine has been characterized in rats but has not been adequately studied in humans. To determine the kinetics of thiamine intestinal transport directly in humans, mucosal tissues were obtained during routine endoscopy from normal-appearing sites at the second portion of the duodenum. With 3H-dextran as the marker of adherent volume, the uptake of 14C-thiamine hydrochloride by the excised mucosa was measured in vitro. By this method thiamine uptake was linear with tissue weight and with incubation time up to 5 min. Results showed that at low thiamine concentrations (0.2 to 2.0 microM), uptake was saturable whereas at high concentrations (5 to 50 microM), uptake was linear with thiamine concentrations. Pyrithiamine, anoxia, N-ethylmaleimide, and replacement of sodium chloride by mannitol reduced the uptake of 0.5 microM thiamine by 42%, 37%, 32% and 35%, respectively (p less than 0.05) but had no effect on the uptake of 20 microM thiamine. These data suggest that, as in the rat, the intestinal transport of thiamine in humans proceeds by a coexistent dual system. At physiologic concentrations, thiamine is transported primarily by an energy-requiring, sodium-dependent active process, whereas at higher pharmacologic concentrations thiamine uptake is predominantly a passive process.

  5. Cell-penetrating peptides transport therapeutics into cells.

    PubMed

    Ramsey, Joshua D; Flynn, Nicholas H

    2015-10-01

    Nearly 30years ago, certain small, relatively nontoxic peptides were discovered to be capable of traversing the cell membrane. These cell-penetrating peptides, as they are now called, have been shown to not only be capable of crossing the cell membrane themselves but can also carry many different therapeutic agents into cells, including small molecules, plasmid DNA, siRNA, therapeutic proteins, viruses, imaging agents, and other various nanoparticles. Many cell-penetrating peptides have been derived from natural proteins, but several other cell-penetrating peptides have been developed that are either chimeric or completely synthetic. How cell-penetrating peptides are internalized into cells has been a topic of debate, with some peptides seemingly entering cells through an endocytic mechanism and others by directly penetrating the cell membrane. Although the entry mechanism is still not entirely understood, it seems to be dependent on the peptide type, the peptide concentration, the cargo the peptide transports, and the cell type tested. With new intracellular disease targets being discovered, cell-penetrating peptides offer an exciting approach for delivering drugs to these intracellular targets. There are hundreds of cell-penetrating peptides being studied for drug delivery, and ongoing studies are demonstrating their success both in vitro and in vivo.

  6. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms.

    PubMed

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela; Said, Hamid M

    2015-07-15

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines.

  7. Salmonella infection inhibits intestinal biotin transport: cellular and molecular mechanisms

    PubMed Central

    Ghosal, Abhisek; Jellbauer, Stefan; Kapadia, Rubina; Raffatellu, Manuela

    2015-01-01

    Infection with the nontyphoidal Salmonella is a common cause of food-borne disease that leads to acute gastroenteritis/diarrhea. Severe/prolonged cases of Salmonella infection could also impact host nutritional status, but little is known about its effect on intestinal absorption of vitamins, including biotin. We examined the effect of Salmonella enterica serovar Typhimurium (S. typhimurium) infection on intestinal biotin uptake using in vivo (streptomycin-pretreated mice) and in vitro [mouse (YAMC) and human (NCM460) colonic epithelial cells, and human intestinal epithelial Caco-2 cells] models. The results showed that infecting mice with wild-type S. typhimurium, but not with its nonpathogenic isogenic invA spiB mutant, leads to a significant inhibition in jejunal/colonic biotin uptake and in level of expression of the biotin transporter, sodium-dependent multivitamin transporter. In contrast, infecting YAMC, NCM460, and Caco-2 cells with S. typhimurium did not affect biotin uptake. These findings suggest that the effect of S. typhimurium infection is indirect and is likely mediated by proinflammatory cytokines, the levels of which were markedly induced in the intestine of S. typhimurium-infected mice. Consistent with this hypothesis, exposure of NCM460 cells to the proinflammatory cytokines TNF-α and IFN-γ led to a significant inhibition of biotin uptake, sodium-dependent multivitamin transporter expression, and activity of the SLC5A6 promoter. The latter effects appear to be mediated, at least in part, via the NF-κB signaling pathway. These results demonstrate that S. typhimurium infection inhibits intestinal biotin uptake, and that the inhibition is mediated via the action of proinflammatory cytokines. PMID:25999427

  8. Transepithelial Transport of PAMAM Dendrimers Across Isolated Human Intestinal Tissue.

    PubMed

    Hubbard, Dallin; Enda, Michael; Bond, Tanner; Moghaddam, Seyyed Pouya Hadipour; Conarton, Josh; Scaife, Courtney; Volckmann, Eric; Ghandehari, Hamidreza

    2015-11-02

    Poly(amido amine) (PAMAM) dendrimers have shown transepithelial transport across intestinal epithelial barrier in rats and across Caco-2 cell monolayers. Caco-2 models innately lack mucous barriers, and rat isolated intestinal tissue has been shown to overestimate human permeability. This study is the first report of transport of PAMAM dendrimers across isolated human intestinal epithelium. It was observed that FITC labeled G4-NH2 and G3.5-COOH PAMAM dendrimers at 1 mM concentration do not have a statistically higher permeability compared to free FITC controls in isolated human jejunum and colonic tissues. Mannitol permeability was increased at 10 mM concentrations of G3.5-COOH and G4-NH2 dendrimers. Significant histological changes in human colonic and jejunal tissues were observed at G3.5-COOH and G4-NH2 concentrations of 10 mM implying that dose limiting toxicity may occur at similar concentrations in vivo. The permeability through human isolated intestinal tissue in this study was compared to previous rat and Caco-2 permeability data. This study implicates that PAMAM dendrimer oral drug delivery may be feasible, but it may be limited to highly potent drugs.

  9. Acylation of salmon calcitonin modulates in vitro intestinal peptide flux through membrane permeability enhancement.

    PubMed

    Trier, Sofie; Linderoth, Lars; Bjerregaard, Simon; Strauss, Holger M; Rahbek, Ulrik L; Andresen, Thomas L

    2015-10-01

    Acylation of peptide drugs with fatty acid chains has proven beneficial for prolonging systemic circulation, as well as increasing enzymatic stability and interactions with lipid cell membranes. Thus, acylation offers several potential benefits for oral delivery of therapeutic peptides, and we hypothesize that tailoring the acylation may be used to optimize intestinal translocation. This work aims to characterize acylated analogues of the therapeutic peptide salmon calcitonin (sCT), which lowers blood calcium, by systematically increasing acyl chain length at two positions, in order to elucidate its influence on intestinal cell translocation and membrane interaction. We find that acylation drastically increases in vitro intestinal peptide flux and confers a transient permeability enhancing effect on the cell layer. The analogues permeabilize model lipid membranes, indicating that the effect is due to a solubilization of the cell membrane, similar to transcellular oral permeation enhancers. The effect is dependent on pH, with larger effect at lower pH, and is impacted by acylation chain length and position. Compared to the unacylated peptide backbone, N-terminal acylation with a short chain provides 6- or 9-fold increase in peptide translocation at pH 7.4 and 5.5, respectively. Prolonging the chain length appears to hamper translocation, possibly due to self-association or aggregation, although the long chain acylated analogues remain superior to the unacylated peptide. For K(18)-acylation a short chain provides a moderate improvement, whereas medium and long chain analogues are highly efficient, with a 12-fold increase in permeability compared to the unacylated peptide backbone, on par with currently employed oral permeation enhancers. For K(18)-acylation the medium chain acylation appears to be optimal, as elongating the chain causes greater binding to the cell membrane but similar permeability, and we speculate that increasing the chain length further may

  10. Glucagon-like peptide-2 induces rapid digestive adaptation following intestinal resection in preterm neonates

    PubMed Central

    Vegge, Andreas; Thymann, Thomas; Lund, Pernille; Stoll, Barbara; Bering, Stine B.; Hartmann, Bolette; Jelsing, Jacob; Qvist, Niels; Burrin, Douglas G.; Jeppesen, Palle B.; Holst, Jens J.

    2013-01-01

    Short bowel syndrome (SBS) is a frequent complication after intestinal resection in infants suffering from intestinal disease. We tested whether treatment with the intestinotrophic hormone glucagon-like peptide-2 (GLP-2) increases intestinal volume and function in the period immediately following intestinal resection in preterm pigs. Preterm pigs were fed enterally for 48 h before undergoing resection of 50% of the small intestine and establishment of a jejunostomy. Following resection, pigs were maintained on total parenteral nutrition (TPN) without (SBS, n = 8) or with GLP-2 treatment (3.5 μg/kg body wt per h, SBS+GLP-2, n = 7) and compared with a group of unresected preterm pigs (control, n = 5). After 5 days of TPN, all piglets were fed enterally for 24 h, and a nutrient balance study was performed. Intestinal resection was associated with markedly reduced endogenous GLP-2 levels. GLP-2 increased the relative absorption of wet weight (46 vs. 22%), energy (79 vs. 64%), and all macronutrients (all parameters P < 0.05). These findings were supported by a 200% increase in sucrase and maltase activities, a 50% increase in small intestinal epithelial volume (P < 0.05), as well as increased DNA and protein contents and increased total protein synthesis rate in SBS+GLP-2 vs. SBS pigs (+100%, P < 0.05). Following intestinal resection in preterm pigs, GLP-2 induced structural and functional adaptation, resulting in a higher relative absorption of fluid and macronutrients. GLP-2 treatment may be a promising therapy to enhance intestinal adaptation and improve digestive function in preterm infants with jejunostomy following intestinal resection. PMID:23764891

  11. Intestinotrophic Glucagon-Like Peptide-2 (GLP-2) Activates Intestinal Gene Expression and Growth Factor-Dependent Pathways Independent of the Vasoactive Intestinal Peptide Gene in Mice

    PubMed Central

    Yusta, Bernardo; Holland, Dianne; Waschek, James A.

    2012-01-01

    The enteroendocrine and enteric nervous systems convey signals through an overlapping network of regulatory peptides that act either as circulating hormones or as localized neurotransmitters within the gastrointestinal tract. Because recent studies invoke an important role for vasoactive intestinal peptide (VIP) as a downstream mediator of glucagon-like peptide-2 (GLP-2) action in the gut, we examined the importance of the VIP-GLP-2 interaction through analysis of Vip−/− mice. Unexpectedly, we detected abnormal villous architecture, expansion of the crypt compartment, increased crypt cell proliferation, enhanced Igf1 and Kgf gene expression, and reduced expression of Paneth cell products in the Vip−/− small bowel. These abnormalities were not reproduced by antagonizing VIP action in wild-type mice, and VIP administration did not reverse the intestinal phenotype of Vip−/− mice. Exogenous administration of GLP-2 induced the expression of ErbB ligands and immediate-early genes to similar levels in Vip+/+ vs. Vip−/− mice. Moreover, GLP-2 significantly increased crypt cell proliferation and small bowel growth to comparable levels in Vip+/+ vs. Vip−/− mice. Unexpectedly, exogenous GLP-2 administration had no therapeutic effect in mice with dextran sulfate-induced colitis; the severity of colonic injury and weight loss was modestly reduced in female but not male Vip−/− mice. Taken together, these findings extend our understanding of the complex intestinal phenotype arising from loss of the Vip gene. Furthermore, although VIP action may be important for the antiinflammatory actions of GLP-2, the Vip gene is not required for induction of a gene expression program linked to small bowel growth after enhancement of GLP-2 receptor signaling. PMID:22535770

  12. Protein transport across the small intestine in food allergy.

    PubMed

    Reitsma, Marit; Westerhout, Joost; Wichers, Harry J; Wortelboer, Heleen M; Verhoeckx, Kitty C M

    2014-01-01

    In view of the imminent deficiency of protein sources for human consumption in the near future, new protein sources need to be identified. However, safety issues such as the risk of allergenicity are often a bottleneck, due to the absence of predictive, validated and accepted methods for risk assessment. The current strategy to assess the allergenic potential of proteins focuses mainly on homology, stability and cross-reactivity, although other factors such as intestinal transport might be of added value too. In this review, we present an overview of the knowledge of protein transport across the intestinal wall and the methods currently being used to measure this. A literature study reveals that protein transport in sensitised persons occurs para-cellularly with the involvement of mast cells, and trans-cellularly via enterocytes, while in non-sensitised persons micro-fold cells and enterocytes are considered most important. However, there is a lack of comparable systematic studies on transport of allergenic proteins. Knowledge of the multiple protein transport pathways and which model system can be useful to study these processes may be of added value in the risk assessment of food allergenicity.

  13. Expression of small intestinal nutrient transporters in embryonic and posthatch turkeys.

    PubMed

    Weintraut, M L; Kim, S; Dalloul, R A; Wong, E A

    2016-01-01

    Nutrients are absorbed in the small intestine through a variety of transporter proteins, which have not been as well characterized in turkeys as in chickens. The objective of this study was to profile the mRNA expression of amino acid and monosaccharide transporters in the small intestine of male and female turkeys. Jejunum was collected during embryonic development (embryonic d 21 and 24, and d of hatch (DOH)) and duodenum, jejunum, and ileum were collected in a separate experiment during posthatch development (DOH, d 7, 14, 21, and 28). Real-time PCR was used to determine expression of aminopeptidase N (APN), one peptide (PepT1), 6 amino acid (ASCT1, b(o,+)AT, CAT1, EAAT3, LAT1, y(+)LAT2) and 3 monosaccharide (GLUT2, GLUT5, SGLT1) transporters. Data were analyzed by ANOVA using JMP Pro 11.0. APN, b(o,+)AT, PepT1, y(+)LAT2, GLUT5, and SGLT1 showed increased expression from embryonic d 21 and 24 to DOH. During posthatch, all genes except GLUT2 and SGLT1 were expressed greater in females than males. GLUT2 was expressed the same in males as females and SGLT1 was expressed greater in males than females. All basolateral membrane transporters were expressed greater during early development then decreased with age, while the brush border membrane transporters EAAT3, GLUT5, and SGLT1 showed increased expression later in development. Because turkeys showed high-level expression of the anionic amino acid transporter EAAT3, a direct comparison of tissue-specific expression of EAAT3 between chicken and turkey was conducted. The anionic amino acid transporter EAAT3 showed 6-fold greater expression in the ileum of turkeys at d 14 compared to chickens. This new knowledge can be used not only to better formulate turkey diets to accommodate increased glutamate transport, but also to optimize nutrition for both sexes.

  14. Characterization of the rabbit intestinal fructose transporter (GLUT5).

    PubMed Central

    Miyamoto, K; Tatsumi, S; Morimoto, A; Minami, H; Yamamoto, H; Sone, K; Taketani, Y; Nakabou, Y; Oka, T; Takeda, E

    1994-01-01

    Recent studies suggest that the jejunal/kidney-type facilitative glucose transporter (GLUT5) functions as a high-affinity D-fructose transporter. However, its precise role in the small intestine is not clear. In an attempt to identify the fructose transporter in the small intestine, we measured fructose uptake in Xenopus oocytes expressing jejunal mRNA from five species (rat, mouse, rabbit, hamster and guinea-pig). Only jejunal mRNA from the rabbit significantly increased fructose uptake. We also cloned a rabbit GLUT5 cDNA from a jejunal library The predicted amino acid sequence of the 487-residue rabbit GLUT5 showed 72.3 and 67.1% identity with human and rat GLUT5 respectively. Northern-blot analysis revealed GLUT5 transcripts in rabbit duodenum, jejunum and, to a lesser extent, kidney. After separation of rabbit jejunal mRNA on a sucrose density gradient, the fractions that conferred D-fructose transport activity in oocytes also hybridized with rabbit GLUT5 cDNA. Hybrid depletion of jejunal mRNA with a GLUT5 antisense oligonucleotide markedly inhibited the mRNA-induced fructose uptake in oocytes. Immunoblot analysis indicated that GLUT5 (49 kDa) is located in the brush-border membrane of rabbit intestinal epithelial cells. Xenopus oocytes injected with rabbit GLUT5 cRNA exhibited fructose uptake activity with a Km of 11 mM for D-fructose. D-Fructose transport by GLUT5 was significantly inhibited by D-glucose and D-galactose. D-Fructose uptake in brush-border membrane vesicles shows a Km similar to that of GLUT5, but was not inhibited by D-glucose or D-galactose. Finally, cytochalasin B photolabelled a 49 kDa protein in rabbit brush-border-membrane preparations that was immunoprecipitated by antibodies to GLUT5. Our results suggest that GLUT5 functions as a fructose transporter in rabbit small intestine. However, biochemical properties of fructose transport in Xenopus oocytes injected with GLUT5 cRNA differed from those in rabbit jejunal vesicles. Images Figure 2

  15. Intestinal transport of sugars and amino acids in diabetic rats

    PubMed Central

    Olsen, Ward A.; Rosenberg, Irwin H.

    1970-01-01

    The specificity and mechanism of altered intestinal transport of diabetic rats was studied with an everted ring technique. Increased intracellular accumulation of amino acids, as well as galactose and 3-O-methylglucose, was demonstrated in diabetes. The greater accumulation by diabetic intestine could not be attributed to a direct effect of the agent used to induce diabetes or to an alteration in food consumption. Although the changes were related to the severity of diabetes and could be reversed with treatment with insulin, they could not be modified by addition of insulin in vitro. The changes could not be induced in control intestine either with hyperglycemia from glucose infusion or preincubation with glucose in vitro. Although the higher concentration gradients of amino acids, galactose, and 3-O-methylglucose could result from increased energy utilization by diabetic intestine, an alteration of cell membrane function, as well, is suggested by the demonstration with kinetic studies of increased influx with an increase in Vmax. PMID:5409812

  16. Calcium glycerophosphate preserves transepithelial integrity in the Caco-2 model of intestinal transport

    PubMed Central

    Datta, Palika; Weis, Margaret T

    2015-01-01

    AIM: To assess the direct effects of ischemia on intestinal epithelial integrity. Furthermore, clinical efforts at mitigating the effect of hypoperfusion on gut permeability have focused on restoring gut vascular function. METHODS: We report that, in the Caco-2 cell model of transepithelial transport, calcium glycerophosphate (CGP), an inhibitor of intestinal alkaline phosphatase F3, has a significant effect to preserve transepithelial electrical resistance (TEER) and to attenuate increases in mannitol flux rates during hypoxia or cytokine stimulation. RESULTS: The effect was observable even at concentrations as low as 1 μmol/L. As celiac disease is also marked by a loss of gut epithelial integrity, the effect of CGP to attenuate the effect of the α-gliadin peptide 31-55 was also examined. In this instance, CGP exerted little effect of preservation of TEER, but significantly attenuated peptide induced increase in mannitol flux. CONCLUSION: It appears that CGP treatment might synergize with other therapies to preserve gut epithelial integrity. PMID:26290632

  17. Vasoactive intestinal peptide may participate in the vasodilation of the dog hepatic artery

    SciTech Connect

    Varga, G.; Kiss, J.Z.; Papp, M.; Vizi, E.S.

    1986-08-01

    The possible direct action of vasoactive intestinal peptide (VIP) on dog hepatic arterial wall or on the noradrenergic innervation of the artery was investigated in vitro. In addition, VIP-containing nerve fibers and terminals were located in the wall of the artery with immunochemical staining. Direct evidence showed that VIP did not affect the release of (TH)norepinephrine but reduced the response of the isolated hepatic artery to electrical field stimulation and exogenous norepinephrine. This suggest that the effect of VIP is postjunctional on the smooth muscle of the artery. VIP-containing nerve fibers and varicosities were observed in the adventitial and medial layer of the arterial wall. These findings strongly support the hypothesis that vasoactive intestinal peptide is a physiological mediator of vasodilation in the hepatic artery.

  18. Vasoactive Intestinal Peptide Inhibits Human Small-Cell Lung Cancer Proliferation in vitro and in vivo

    NASA Astrophysics Data System (ADS)

    Maruno, Kaname; Absood, Afaf; Said, Sami I.

    1998-11-01

    Small-cell lung carcinoma (SCLC) is an aggressive, rapidly growing and metastasizing, and highly fatal neoplasm. We report that vasoactive intestinal peptide inhibits the proliferation of SCLC cells in culture and dramatically suppresses the growth of SCLC tumor-cell implants in athymic nude mice. In both cases, the inhibition was mediated apparently by a cAMP-dependent mechanism, because the inhibition was enhanced by the adenylate cyclase activator forskolin and the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine in proportion to increases in intracellular cAMP levels, and the inhibition was abolished by selective inhibition of cAMP-dependent protein kinase. If confirmed in clinical trials, this antiproliferative action of vasoactive intestinal peptide may offer a new and promising means of suppressing SCLC in human subjects, without the toxic side effects of chemotherapeutic agents.

  19. Growth of embryo and gene expression of nutrient transporters in the small intestine of the domestic pigeon (Columba livia)*

    PubMed Central

    Chen, Ming-xia; Li, Xiang-guang; Yang, Jun-xian; Gao, Chun-qi; Wang, Bin; Wang, Xiu-qi; Yan, Hui-chao

    2015-01-01

    The objective of this study was to investigate the relationship between gene expression of nutrient (amino acid, peptide, sodium and proton) transporters in the small intestine and embryonic growth in domestic pigeons (Columba livia). One hundred and twenty-five fertilized eggs were randomly assigned into five groups and were incubated under optimal conditions (temperature of 38.1 °C and relative humidity of 55%). Twenty embryos/birds from each group were sacrificed by cervical dislocation on embryonic day (E) 9, 11, 13, 15 and day of hatch (DOH). The eggs, embryos (without yolk sac), and organs (head, brain, heart, liver, lungs, kidney, gizzard, small intestine, legs, and thorax) were dissected, cleaned, and weighed. Small intestine samples were collected for RNA isolation. The mRNA abundance of intestinal nutrient transporters was evaluated by real-time reverse transcription-polymerase chain reaction (RT-PCR). We classified these ten organs into four types according to the changes in relative weight during embryonic development. In addition, the gene expression of nutrient transporters was differentially regulated by embryonic day. The mRNA abundances of b0,+AT, EAAT3, y+LAT2, PepT1, LAT4, NHE2, and NHE3 increased linearly with age, whereas mRNA abundances of CAT1, CAT2, LAT1, EAAT2, SNAT1, and SNAT2 were increased to higher levels on E9 or E11 and then decreased to lower levels until DOH. The results of correlation analysis showed that the gene expressions of b0,+AT, EAAT3, PepT1, LAT4, NHE2, NHE3, and y+LAT2 had positive correlations with body weight (0.71intestinal weight (0.80intestinal weight (−0.84

  20. Growth of embryo and gene expression of nutrient transporters in the small intestine of the domestic pigeon (Columba livia).

    PubMed

    Chen, Ming-xia; Li, Xiang-guang; Yang, Jun-xian; Gao, Chun-qi; Wang, Bin; Wang, Xiu-qi; Yan, Hui-chao

    2015-06-01

    The objective of this study was to investigate the relationship between gene expression of nutrient (amino acid, peptide, sodium and proton) transporters in the small intestine and embryonic growth in domestic pigeons (Columba livia). One hundred and twenty-five fertilized eggs were randomly assigned into five groups and were incubated under optimal conditions (temperature of 38.1 °C and relative humidity of 55%). Twenty embryos/birds from each group were sacrificed by cervical dislocation on embryonic day (E) 9, 11, 13, 15 and day of hatch (DOH). The eggs, embryos (without yolk sac), and organs (head, brain, heart, liver, lungs, kidney, gizzard, small intestine, legs, and thorax) were dissected, cleaned, and weighed. Small intestine samples were collected for RNA isolation. The mRNA abundance of intestinal nutrient transporters was evaluated by real-time reverse transcription-polymerase chain reaction (RT-PCR). We classified these ten organs into four types according to the changes in relative weight during embryonic development. In addition, the gene expression of nutrient transporters was differentially regulated by embryonic day. The mRNA abundances of b(0,+)AT, EAAT3, y(+)LAT2, PepT1, LAT4, NHE2, and NHE3 increased linearly with age, whereas mRNA abundances of CAT1, CAT2, LAT1, EAAT2, SNAT1, and SNAT2 were increased to higher levels on E9 or E11 and then decreased to lower levels until DOH. The results of correlation analysis showed that the gene expressions of b(0,+)AT, EAAT3, PepT1, LAT4, NHE2, NHE3, and y(+)LAT2 had positive correlations with body weight (0.71intestinal weight (0.80intestinal weight (-0

  1. Nutrient-intake-level-dependent regulation of intestinal development in newborn intrauterine growth-restricted piglets via glucagon-like peptide-2.

    PubMed

    Liu, J; Liu, Z; Gao, L; Chen, L; Zhang, H

    2016-10-01

    The objective of the present study was to investigate the intestinal development of newborn intrauterine growth-restricted (IUGR) piglets subjected to normal nutrient intake (NNI) or restricted nutrient intake (RNI). Newborn normal birth weight (NBW) and IUGR piglets were allotted to NNI or RNI levels for 4 weeks from day 8 postnatal. IUGR piglets receiving NNI had similar growth performance compared with that of NBW piglets. Small intestine length and villous height were greater in IUGR piglets fed the NNI than that of piglets fed the RNI. Lactase activity was increased in piglets fed the NNI compared with piglets fed the RNI. Absorptive function, represented by active glucose transport by the Ussing chamber method and messenger RNA (mRNA) expressions of two main intestinal glucose transporters, Na+-dependent glucose transporter 1 (SGLT1) and glucose transporter 2 (GLUT2), were greater in IUGR piglets fed the NNI compared with piglets fed the RNI regimen. The apoptotic process, characterized by caspase-3 activity (a sign of activated apoptotic cells) and mRNA expressions of p53 (pro-apoptotic), bcl-2-like protein 4 (Bax) (pro-apoptotic) and B-cell lymphoma-2 (Bcl-2) (anti-apoptotic), were improved in IUGR piglets fed the NNI regimen. To test the hypothesis that improvements in intestinal development of IUGR piglets fed NNI might be mediated through circulating glucagon-like peptide-2 (GLP-2), GLP-2 was injected subcutaneously to IUGR piglets fed the RNI from day 8 to day 15 postnatal. Although the intestinal development of IUGR piglets fed the RNI regimen was suppressed compared with those fed the NNI regimen, an exogenous injection of GLP-2 was able to bring intestinal development to similar levels as NNI-fed IUGR piglets. Collectively, our results demonstrate that IUGR neonates that have NNI levels could improve intestinal function via the regulation of GLP-2.

  2. Glucagon-like peptide-2 protects impaired intestinal mucosal barriers in obstructive jaundice rats

    PubMed Central

    Chen, Jun; Dong, Jia-Tian; Li, Xiao-Jing; Gu, Ye; Cheng, Zhi-Jian; Cai, Yuan-Kun

    2015-01-01

    AIM: To observe the protective effect of glucagon-like peptide-2 (GLP-2) on the intestinal barrier of rats with obstructive jaundice and determine the possible mechanisms of action involved in the protective effect. METHODS: Thirty-six Sprague-Dawley rats were randomly divided into a sham operation group, an obstructive jaundice group, and a GLP-2 group; each group consisted of 12 rats. The GLP-2 group was treated with GLP-2 after the day of surgery, whereas the other two groups were treated with the same concentration of normal saline. Alanine aminotransferase (ALT), total bilirubin, and endotoxin levels were recorded at 1, 3, 7, 10 and 14 d. Furthermore, on the 14th day, body weight, the wet weight of the small intestine, pathological changes of the small intestine and the immunoglobulin A (IgA) expressed by plasma cells located in the small intestinal lamina propria were recorded for each group. RESULTS: In the rat model, jaundice was obvious, and the rats’ activity decreased 4-6 d post bile duct ligation. Compared with the sham operation group, the obstructive jaundice group displayed increased yellow staining of abdominal visceral serosa, decreased small intestine wet weight, thinning of the intestinal muscle layer and villi, villous atrophy, uneven height, fusion, partial villous epithelial cell shedding, substantial inflammatory cell infiltration and significantly reduced IgA expression. However, no significant gross changes were noted between the GLP-2 and sham groups. With time, the levels of ALT, endotoxin and bilirubin in the GLP-2 group were significantly increased compared with the sham group (P < 0.01). The increasing levels of the aforementioned markers were more significant in the obstructive jaundice group than in the GLP-2 group (P < 0.01). CONCLUSION: GLP-2 reduces intestinal mucosal injuries in obstructive jaundice rats, which might be attributed to increased intestinal IgA and reduced bilirubin and endotoxin. PMID:25593463

  3. Acute interactions between intestinal sugar and calcium transport in vitro.

    PubMed

    Tharabenjasin, Phuntila; Douard, Veronique; Patel, Chirag; Krishnamra, Nateetip; Johnson, Richard J; Zuo, Jian; Ferraris, Ronaldo P

    2014-01-01

    Fructose consumption by Americans has increased markedly, whereas Ca(2+) intake has decreased below recommended levels. Because fructose metabolism decreases enterocyte ATP concentrations, we tested the hypothesis that luminal fructose acutely reduces active, diet-inducible Ca(2+) transport in the small intestine. We confirmed that the decrease in ATP concentrations was indeed greater in fructose- compared with glucose-incubated mucosal homogenates from wild-type and was prevented in fructose-incubated homogenates from ketohexokinase (KHK)(-/-) mice. We then induced active Ca(2+) transport by chronically feeding wild-type, fructose transporter glucose transporter 5 (GLUT5)(-/-), as well as KHK(-/-) mice a low Ca(2+) diet and measured transepithelial Ca(2+) transport in everted duodenal sacs incubated in solutions containing glucose, fructose, or their nonmetabolizable analogs. The diet-induced increase in active Ca(2+) transport was proportional to dramatic increases in expression of the Ca(2+)-selective channel transient receptor potential vanilloid family calcium channel 6 as well as of the Ca(2+)-binding protein 9k (CaBP9k) but not that of the voltage-dependent L-type channel Ca(v)1.3. Crypt-villus distribution of CaBP9k seems heterogeneous, but low Ca(2+) diets induce expression in more cells. In contrast, KHK distribution is homogeneous, suggesting that fructose metabolism can occur in all enterocytes. Diet-induced Ca(2+) transport was not enhanced by addition of the enterocyte fuel glutamine and was always greater in sacs of wild-type, GLUT5(-/-), and KHK(-/-) mice incubated with fructose or nonmetabolizable sugars than those incubated with glucose. Thus duodenal Ca(2+) transport is not affected by fructose and enterocyte ATP concentrations but instead may decrease with glucose metabolism, as Ca(2+) transport remains high with 3-O-methylglucose that is also transported by sodium-glucose cotransporter 1 but cannot be metabolized.

  4. Phosphate transport by rat intestinal basolateral-membrane vesicles.

    PubMed Central

    Ghishan, F K; Kikuchi, K; Arab, N

    1987-01-01

    The characteristics of phosphate transport across intestinal basolateral membranes of the rat were determined by using enriched preparations in which uphill Na+-dependent D-glucose transport could not be demonstrated, but ATP-dependent Ca2+ transport was present. Phosphate transport was saturable, Na+-dependent and exhibited Michaelis-Menten kinetics. Vmax. was 51.1 +/- 4.2 pmol/10 s per mg of protein and Km was 14 +/- 3.9 microM. The transport process was electroneutral. Tracer-exchange experiments and counter-transport studies confirmed the presence of a Na+-Pi carrier at the basolateral membrane. The presence of inside-positive membrane potential did not enhance phosphate uptake, indicating that the Na+ effect is secondary to the presence of the Na+-Pi carrier rather than an induction of positive membrane potential. The stoichiometry of this carrier at pH 7.4 was 2 Na+:1 phosphate, as shown by direct studies utilizing the static-head method. These studies are the first to determine the presence of a phosphate carrier at the basolateral membrane. PMID:3663094

  5. Intestinal transport of hexoses in the rat following chronic heat exposure

    NASA Technical Reports Server (NTRS)

    Carpenter, M.; Musacchia, X. J.

    1979-01-01

    The study examines intestinal transport of sugars (D-glucose and D-galactose) in vitro and assesses organ maintenance in chronically heat-exposed rats. The results suggest that the response of intestinal absorption to heat exposure in the rat involves changes in intestinal weight and in glucose utilization. Despite the reduction in total intestinal weight, the ability of intestinal tissue to transport hexose per unit weight remains stable. Differences in intestinal weight and glucose utilization between pair-fed and heat-exposed animals suggest that the intestinal response to chronic heat exposure is not solely a function of the amount of food consumed. Alterations of hexose transport appear to be related to altered glucose metabolism and not altered transport capacity.

  6. Transepithelial transport of flavanone in intestinal Caco-2 cell monolayers

    SciTech Connect

    Kobayashi, Shoko; Konishi, Yutaka

    2008-03-28

    Our recent study [S. Kobayashi, S. Tanabe, M. Sugiyama, Y. Konishi, Transepithelial transport of hesperetin and hesperidin in intestinal Caco-2 cell monolayers, Biochim. Biophys. Acta, 1778 (2008) 33-41] shows that the mechanism of absorption of hesperetin involves both proton-coupled active transport and transcellular passive diffusion. Here, as well as analyzing the cell permeability of hesperetin, we also study the transport of other flavanones, naringenin and eriodictyol, using Caco-2 cell monolayers. Similar to hesperetin mentioned, naringenin and eriodictyol showed proton-coupled polarized transport in apical-to-basolateral direction in non-saturable manner, constant permeation in the apical-to-basolateral direction (J{sub ap{yields}}{sub bl}) irrespective of the transepithelial electrical resistance (TER), and preferable distribution into the basolateral side after apical loading in the presence of a proton gradient. Furthermore, the proton-coupled J{sub ap{yields}}{sub bl} of hesperetin, naringenin and eriodictyol, were inhibited by substrates of the monocarboxylic acid transporter (MCT), such as benzoic acid, but not by ferulic acid. In contrast, both benzoic and ferulic acids have no stimulatory effect on J{sub ap{yields}}{sub bl} of each flavanone by trans-stimulation analysis. These results indicates that proton-driven active transport is commonly participated in the absorption of flavanone in general, and that its transport is presumed to be unique other than MCT-mediated transport for absorption of phenolic acids (PAs), sodium-dependent MCT (SMCT) nor anion exchanger-mediated transport.

  7. Radiation-induced reductions in transporter mRNA levels parallel reductions in intestinal sugar transport

    PubMed Central

    Roche, Marjolaine; Neti, Prasad V. S. V.; Kemp, Francis W.; Agrawal, Amit; Attanasio, Alicia; Douard, Véronique; Muduli, Anjali; Azzam, Edouard I.; Norkus, Edward; Brimacombe, Michael; Howell, Roger W.

    2010-01-01

    More than a century ago, ionizing radiation was observed to damage the radiosensitive small intestine. Although a large number of studies has since shown that radiation reduces rates of intestinal digestion and absorption of nutrients, no study has determined whether radiation affects mRNA expression and dietary regulation of nutrient transporters. Since radiation generates free radicals and disrupts DNA replication, we tested the hypotheses that at doses known to reduce sugar absorption, radiation decreases the mRNA abundance of sugar transporters SGLT1 and GLUT5, prevents substrate regulation of sugar transporter expression, and causes reductions in sugar absorption that can be prevented by consumption of the antioxidant vitamin A, previously shown by us to radioprotect the testes. Mice were acutely irradiated with 137Cs gamma rays at doses of 0, 7, 8.5, or 10 Gy over the whole body. Mice were fed with vitamin A-supplemented diet (100× the control diet) for 5 days prior to irradiation after which the diet was continued until death. Intestinal sugar transport was studied at days 2, 5, 8, and 14 postirradiation. By day 8, d-glucose uptake decreased by ∼10–20% and d-fructose uptake by 25–85%. With increasing radiation dose, the quantity of heterogeneous nuclear RNA increased for both transporters, whereas mRNA levels decreased, paralleling reductions in transport. Enterocytes of mice fed the vitamin A supplement had ≥ 6-fold retinol concentrations than those of mice fed control diets, confirming considerable intestinal vitamin A uptake. However, vitamin A supplementation had no effect on clinical or transport parameters and afforded no protection against radiation-induced changes in intestinal sugar transport. Radiation markedly reduced GLUT5 activity and mRNA abundance, but high-d-fructose diets enhanced GLUT5 activity and mRNA expression in both unirradiated and irradiated mice. In conclusion, the effect of radiation may be posttranscriptional, and

  8. Metformin Transport by a Newly Cloned Proton-Stimulated Organic Cation Transporter (Plasma Membrane Monoamine Transporter) Expressed in Human Intestine

    PubMed Central

    Zhou, Mingyan; Xia, Li; Wang, Joanne

    2009-01-01

    Metformin is a widely used oral antihyperglycemic drug for the treatment of type II diabetes mellitus. The intestinal absorption of metformin is dose-dependent and involves an active, saturable uptake process. Metformin has been shown to be transported by the human organic cation transporters 1 and 2 (hOCT1–2). We recently cloned and characterized a novel proton-activated organic cation transporter, plasma membrane monoamine transporter (PMAT). We previously showed that PMAT transports many classic organic cations (e.g., monoamine neurotransmitters, 1-methyl-4-phenylpyridinium) in a pH-dependent manner and its mRNA is expressed in multiple human tissues. The goal of this study is to investigate whether metformin is a substrate of PMAT and whether PMAT plays a role in the intestinal uptake of metformin. Using Madin-Darby canine kidney cells stably expressing human PMAT, we showed that metformin is avidly transported by PMAT, with an apparent affinity (Km = 1.32 mM) comparable to those reported for hOCT1–2. Interestingly, the concentration-velocity profile of PMAT-mediated metformin uptake is sigmoidal, with a Hill coefficient of 2.64. PMAT-mediated metformin transport is greatly stimulated by acidic pH, with the uptake rate being ~4-fold higher at pH 6.6 than at pH 7.4. Using a polyclonal antibody against PMAT, we showed that the PMAT protein (58 kDa) was expressed in human small intestine and concentrated on the tips of the mucosal epithelial layer. Taken together, our results suggest that PMAT transports metformin, is expressed in human intestine, and may play a role in the intestinal absorption of metformin and possibly other cationic drugs. PMID:17600084

  9. [Responses of peptide hydrolases of the small and large intestines in rats on the administration of antibiotics].

    PubMed

    Borshchëv, Iu Iu; Gromova, L V; Ermolenko, E I; Grefner, N M; Borshchëva, I Iu; Gruzdkov, A A

    2012-06-01

    Effects of antibiotics on the structure and functional state of the intestine are not clear. We investigated some structural parameters of the small and large intestine, and activities of two intestinal peptide hydrolases in rats after administration of ampicillin and metronidazole during 3 and 5 days. After 3 days of antibiotic administration a decrease in the weight of mucosa in the small intestine, accompanied with a reduction in the villous height and width in this part of the intestine, and in the weight ofmucosa in the colon occured. At the same time the number of goblet cells in the small intestinal epithelium was increased. Specific activities of aminopeptidase M, and glycyl-L-leucine dipeptidase (micromol/min per g) in the mucosa of the small intestine were increased, and the total activities (micromol/min calculated per a part of the intestine) of the same enzymes did not change. The administration of antibiotics for 5 days resulted in increase of specific activity ofaminopeptidase M in the mucosa of the proximal part of the small intestine. In the chyme of the small intestine and colon, activities of the same enzymes (micromol/min calculated per a part of the intestine) were increased on the third and fifth days of the antibiotic administration. Thus, the application ofampicillin and metronidazole within 3-5 days causes a disturbance of the structural and functional parameters in the small and large intestines, which is most pronounced on the third day of the drug administration.

  10. Functions of Ion Transport Peptide and Ion Transport Peptide-Like in the Red Flour Beetle Tribolium castaneum

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ion transport peptide (ITP) and ITP-like (ITPL) are highly conserved neuropeptides in insects and crustaceans. We investigated the alternatively spliced variants of ITP/ITPL in Tribolium castaneum to understand their functions. We identified three alternatively spliced transcripts named itp, itpl-...

  11. Effects of composite antimicrobial peptides in weanling piglets challenged with deoxynivalenol: II. Intestinal morphology and function.

    PubMed

    Xiao, H; Tan, B E; Wu, M M; Yin, Y L; Li, T J; Yuan, D X; Li, L

    2013-10-01

    Deoxynivalenol (DON) affects animal and human health and targets the gastrointestinal tract. The objective of this study was to evaluate the ability of composite antimicrobial peptides (CAP) to repair intestinal injury in piglets challenged with DON. A total of 28 piglets (Duroc × Landrace × Large Yorkshire) weaned at 28 d of age were randomly assigned to receive 1 of 4 treatments (7 pigs/treatment): negative control, basal diet (NC), basal diet + 0.4% composite antimicrobial peptide (CAP), basal diet + 4 mg/kg DON (DON), and basal diet + 4 mg/kg DON + 0.4% CAP (DON + CAP). After an adaptation period of 7 d, blood samples were collected on d 15 and 30 after the initiation of treatment for determinations of the concentrations of D-lactate and diamine oxidase. At the end of the study, all piglets were slaughtered to obtain small intestines for the determination of intestinal morphology, epithelial cell proliferation, and protein expression in the mammalian target of rapamycin (mTOR) signaling pathway. The results showed that DON increased serum concentrations of D-lactate and diamine oxidase, and these values in the CAP and DON + CAP treatments were less than those in the NC and DON treatments, respectively (P < 0.05). The villous height/crypt depth in the jejunum and ileum and the goblet cell number in the ileum in the CAP and DON + CAP treatments were greater than those in the NC and DON treatments (P < 0.05). The proliferating cell nuclear antigen (PCNA) labeling indexes for the jejunum and ileum in the DON + CAP treatment were greater than those in the DON treatment (P < 0.05). The DON decreased (P < 0.05) the relative protein expression of phosphorylated Akt (Protein Kinase B) and mTOR in the jejunal and ileal mucosa and of phosphorylated 4E-binding protein 1 (p-4EBP1) in the jejunal mucosa, whereas CAP increased (P < 0.05) the protein expression of p-4EBP1 in the jejunum. These findings showed that DON could enhance intestinal permeability, damage villi

  12. INFLUENCE OF DIETARY SUBSTANCES ON INTESTINAL DRUG METABOLISM AND TRANSPORT

    PubMed Central

    Won, Christina S.; Oberlies, Nicholas H.; Paine, Mary F.

    2011-01-01

    Successful delivery of promising new chemical entities via the oral route is rife with challenges, some of which cannot be explained or foreseen during drug development. Further complicating an already multifaceted problem is the obvious, yet often overlooked, effect of dietary substances on drug disposition and response. Some dietary substances, particularly fruit juices, have been shown to inhibit biochemical processes in the intestine, leading to altered pharmacokinetic (PK), and potentially pharmacodynamic (PD), outcomes. Inhibition of intestinal CYP3A-mediated metabolism is the major mechanism by which fruit juices, including grapefruit juice, enhances systemic exposure to new and already marketed drugs. Inhibition of intestinal non-CYP3A enzymes and apically-located transport proteins represent recently identified mechanisms that can alter PK and PD. Several fruit juices have been shown to inhibit these processes in vitro, but some interactions have not translated to the clinic. The lack of in vitro-in vivo concordance is due largely to a lack of rigorous methods to elucidate causative ingredients prior to clinical testing. Identification of specific components and underlying mechanisms is challenging, as dietary substances frequently contain multiple, often unknown, bioactive ingredients that vary in composition and bioactivity. A translational research approach, combining expertise from clinical pharmacologists and natural products chemists, is needed to develop robust models describing PK/PD relationships between a given dietary substance and drug of interest. Validation of these models through well-designed clinical trials would facilitate development of common practice guidelines for managing drug-dietary substance interactions appropriately. PMID:21189136

  13. Role of Quercetin in Modulating Chloride Transport in the Intestine

    PubMed Central

    Yu, Bo; Jiang, Yu; Jin, Lingling; Ma, Tonghui; Yang, Hong

    2016-01-01

    Epithelial chloride channels provide the pathways for fluid secretion in the intestine. Cystic fibrosis transmembrane conductance regulator (CFTR) and calcium-activated chloride channels (CaCCs) are the main chloride channels in the luminal membrane of enterocytes. These transmembrane proteins play important roles in many physiological processes. In this study, we have identified a flavonoid quercetin as a modulator of CaCC chloride channel activity. Fluorescence quenching assay showed that quercetin activated Cl− transport in a dose-dependent manner, with EC50 ~37 μM. Short-circuit current analysis confirmed that quercetin activated CaCC-mediated Cl− currents in HT-29 cells that can be abolished by CaCCinh-A01. Ex vivo studies indicated that application of quercetin to mouse ileum and colon on serosal side resulted in activation of CFTR and CaCC-mediated Cl− currents. Notably, we found that quercetin exhibited inhibitory effect against ANO1 chloride channel activity in ANO1-expressing FRT cells and decreased mouse intestinal motility. Quercetin-stimulated short-circuit currents in mouse ileum was multi-component, which included elevation of Ca2+ concentration through L-type calcium channel and activation of basolateral NKCC, Na+/K+-ATPase, and K+ channels. In vivo studies further revealed that quercetin promoted fluid secretion in mouse ileum. The modulatory effect of quercetin on CaCC chloirde channels may therefore represent a potential therapeutic strategy for treating CaCC-related diseases like constipation, secretory diarrhea and hypertension. The inverse effects of quercetin on CaCCs provided evidence that ANO1 and intestinal epithelial CaCCs are different calcium-activated chloride channels. PMID:27932986

  14. Acetylcholine-producing T cells in the intestine regulate antimicrobial peptide expression and microbial diversity.

    PubMed

    Dhawan, Shobhit; De Palma, Giada; Willemze, Rose A; Hilbers, Francisca W; Verseijden, Caroline; Luyer, Misha D; Nuding, Sabine; Wehkamp, Jan; Souwer, Yuri; de Jong, Esther C; Seppen, J; van den Wijngaard, René M; Wehner, Sven; Verdu, Elena; Bercik, Premek; de Jonge, Wouter J

    2016-11-01

    The cholinergic anti-inflammatory pathway reduces systemic tumor necrosis factor (TNF) via acetylcholine-producing memory T cells in the spleen. These choline acetyltransferase (ChAT)-expressing T cells are also found in the intestine, where their function is unclear. We aimed to characterize these cells in mouse and human intestine and delineate their function. We made use of the ChAT-enhanced green fluorescent protein (eGFP) reporter mice. CD4(Cre) mice were crossed to ChAT(fl/fl) mice to achieve specific deletion of ChAT in CD4(+) T cells. We observed that the majority of ChAT-expressing T cells in the human and mouse intestine have characteristics of Th17 cells and coexpress IL17A, IL22, and RORC The generation of ChAT-expressing T cells was skewed by dendritic cells after activation of their adrenergic receptor β2 To evaluate ChAT T cell function, we generated CD4-specific ChAT-deficient mice. CD4ChAT(-/-) mice showed a reduced level of epithelial antimicrobial peptides lysozyme, defensin A, and ang4, which was associated with an enhanced bacterial diversity and richness in the small intestinal lumen in CD4ChAT(-/-) mice. We conclude that ChAT-expressing T cells in the gut are stimulated by adrenergic receptor activation on dendritic cells. ChAT-expressing T cells may function to mediate the host AMP secretion, microbial growth and expansion.

  15. Transport of nattokinase across the rat intestinal tract.

    PubMed

    Fujita, M; Hong, K; Ito, Y; Misawa, S; Takeuchi, N; Kariya, K; Nishimuro, S

    1995-09-01

    Intraduodenal administration of nattokinase (NK) at a dose of 80 mg/kg, resulted in the degradation of fibrinogen in plasma suggesting transport of NK across the intestinal tract in normal rats. The action of NK on the cleavage of fibrinogen in the plasma from blood samples drawn at intervals after intraduodenal administration of the enzyme was investigated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting analysis with an anti-fibrinogen gamma chain antibody. The 270 kDa fragment carrying antigenic sites for the binding of the anti-fibrinogen gamma chain antibody appeared within 0.5 h and was then degraded gradually to a 105 kDa fragment via a 200 kDa fragment. This suggests that fibrinogen was degraded to a 105 kDa fragment via several intermediates (270 and 200 kDa). In parallel with the degradation process, plasma recalcification times were remarkably prolonged NK was also detected in the plasma from blood samples drawn 3 and 5 h after administration of the enzyme by SDS-PAGE and Western blotting analysis with an anti-NK antibody. The results indicate that NK is absorbed from the rat intestinal tract and that NK cleaves fibrinogen in plasma after intraduodenal administration of the enzyme.

  16. Vitamin D and intestinal calcium transport: facts, speculations and hypotheses.

    PubMed

    Wasserman, R H; Fullmer, C S

    1995-07-01

    The intestinal absorption of Ca2+ occurs by both a saturable, transcellular process and a nonsaturable, paracellular path. The transcellular path is a multistep process, comprised of the transfer of luminal Ca2+ into the enterocyte, the translocation of Ca2+ from point of entry (the microvillus border or membrane) to the basolateral membrane, and the active extrusion from the cell into the circulatory system. Each step in the transcellular movement of Ca2+ has a vitamin D-dependent component. The paracellular path also appears to be affected by vitamin D status. This review emphasizes some aspects of the Ca2+ absorptive process that require resolution and/or further experimental support. The following are discussed: evidence for participation in the active transport of Ca2+ by all segments of the small intestine; a hypothetical model for the feedback control of entry of luminal Ca2+; the current views on vitamin D-dependent movement of Ca2+ through the cytosolic compartment of the enterocyte; the stimulated synthesis of the plasma membrane Ca2+ pump and its gene expression by vitamin D; and the vitamin D-dependency of the paracellular transfer of Ca2+ with a comment on the physiological significance of the rapid response of the Ca2+ absorptive system in vitamin D-replete animals to 1,25-dihydroxyvitamin D.

  17. Deficient Vasoactive Intestinal Peptide Innervation in the Sweat Glands of Cystic Fibrosis Patients

    NASA Astrophysics Data System (ADS)

    Heinz-Erian, Peter; Dey, Richard D.; Flux, Marinus; Said, Sami I.

    1985-09-01

    The innervation of acini and ducts of eccrine sweat glands by immunoreactive, vasoactive intestinal peptide--containing nerve fibers was sharply reduced in seven patients with cystic fibrosis compared to eight normal subjects. The decrease in innervation by this neuropeptide, which has been shown to promote blood flow and the movement of water and chloride across epithelial surfaces in other systems, may be a basic mechanism for the decreased water content and relative impermeability of the epithelium to chloride and other ions that characterize cystic fibrosis.

  18. [Role of antimicrobial peptides (AMP) and pattern recognition receptors (PRR) in the intestinal mucosa homeostasis].

    PubMed

    Lapis, Károly

    2009-11-22

    Homeostasis and integrity of bowel mucosa is assured by well controlled mechanical, biochemical and immunological mechanisms. First line of defense is presented by the antimicrobial peptides (AMP), which form a continuous layer on the bowel surface, produced by intestinal specific (Paneth) and non-specific epithelial cells. AMPs have a significant antimicrobial, antifungal and antiviral, as well as immunomodulatory effects. Next line of defense is the pattern recognition receptors (PRR), which allows identifying conservative molecular patterns of different pathogens, and starts antimicrobial and inflammatory mechanisms through gene-expression induction. We review the most recent knowledge and studies concerning these mechanisms.

  19. A unified nomenclature of NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family members in plants.

    PubMed

    Léran, Sophie; Varala, Kranthi; Boyer, Jean-Christophe; Chiurazzi, Maurizio; Crawford, Nigel; Daniel-Vedele, Françoise; David, Laure; Dickstein, Rebecca; Fernandez, Emilio; Forde, Brian; Gassmann, Walter; Geiger, Dietmar; Gojon, Alain; Gong, Ji-Ming; Halkier, Barbara A; Harris, Jeanne M; Hedrich, Rainer; Limami, Anis M; Rentsch, Doris; Seo, Mitsunori; Tsay, Yi-Fang; Zhang, Mingyong; Coruzzi, Gloria; Lacombe, Benoît

    2014-01-01

    Members of the plant NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER (NRT1/PTR) family display protein sequence homology with the SLC15/PepT/PTR/POT family of peptide transporters in animals. In comparison to their animal and bacterial counterparts, these plant proteins transport a wide variety of substrates: nitrate, peptides, amino acids, dicarboxylates, glucosinolates, IAA, and ABA. The phylogenetic relationship of the members of the NRT1/PTR family in 31 fully sequenced plant genomes allowed the identification of unambiguous clades, defining eight subfamilies. The phylogenetic tree was used to determine a unified nomenclature of this family named NPF, for NRT1/PTR FAMILY. We propose that the members should be named accordingly: NPFX.Y, where X denotes the subfamily and Y the individual member within the species.

  20. Effect of dietary lead on intestinal nutrient transporters mRNA expression in broiler chickens.

    PubMed

    Ebrahimi, Roohollah; Faseleh Jahromi, Mohammad; Liang, Juan Boo; Soleimani Farjam, Abdoreza; Shokryazdan, Parisa; Idrus, Zulkifli

    2015-01-01

    Lead- (Pb-) induced oxidative stress is known to suppress growth performance and feed efficiency in broiler chickens. In an attempt to describe the specific underlying mechanisms of such phenomenon we carried out the current study. Ninety-six one-day-old broiler chicks were randomly assigned to 2 dietary treatment groups of 6 pen replicates, namely, (i) basal diet containing no lead supplement (control) and (ii) basal diet containing 200 mg lead acetate/kg of diet. Following 3 weeks of experimental period, jejunum samples were collected to examine the changes in gene expression of several nutrient transporters, antioxidant enzymes, and heat shock protein 70 (Hsp70) using quantitative real-time PCR. The results showed that addition of lead significantly decreased feed intake, body weight gain, and feed efficiency. Moreover, with the exception of GLUT5, the expression of all sugar, peptide, and amino acid transporters was significantly downregulated in the birds under Pb induced oxidative stress. Exposure to Pb also upregulated the antioxidant enzymes gene expression together with the downregulation of glutathione S-transferase and Hsp70. In conclusion, it appears that Pb-induced oxidative stress adversely suppresses feed efficiency and growth performance in chicken and the possible underlying mechanism for such phenomenon is downregulation of major nutrient transporter genes in small intestine.

  1. Genetic and biochemical analysis of peptide transport in Escherichia coli

    SciTech Connect

    Andrews, J.C.

    1986-01-01

    E. coli peptide transport mutants have been isolated based on their resistance to toxic tripeptides. These genetic defects were found to map in two distinct chromosomal locations. The transport systems which require expression of the trp-linked opp genes and the oppE gene(s) for activity were shown to have different substrate preferences. Growth of E. coli in medium containing leucine results in increased entry of exogenously supplied tripeptides into the bacterial cell. This leucine-mediated elevation of peptide transport required expression of the trp-linked opp operon and was accompanied by increased sensitivity to toxic tripeptides, by an enhanced capacity to utilize nutritional peptides, and by an increase in both the velocity and apparent steady-state level of L-(U-/sup 14/C)alanyl-L-alanyl-L-alanine accumulation for E. coli grown in leucine-containing medium relative to these parameters of peptide transport measured with bacteria grown in media lacking leucine. Direct measurement of opp operon expression by pulse-labeling experiments demonstrated that growth of E. coli in the presence of leucine resulted in increased synthesis of the oppA-encoded periplasmic binding protein. The transcriptional regulation of the trp-linked opp operon of E. coli was investigated using lambda placMu51-generated lac operon fusions. Synthesis of ..beta..-galactosidase by strains harboring oppA-lac, oppB-lac, and oppD-lac fusions occurred at a basal level when the fusion-containing strains were grown in minimal medium.

  2. Transport mechanisms of nicotine across the human intestinal epithelial cell line Caco-2.

    PubMed

    Fukada, Atsuko; Saito, Hideyuki; Inui, Ken-Ichi

    2002-08-01

    Ulcerative colitis is a disease more commonly seen in nonsmokers. Because nicotine was postulated to be a beneficial component of tobacco smoke for ulcerative colitis, various formulations of nicotine have been developed to improve the local bioavailability within the gastrointestinal tissue. In the present study, to characterize the disposition of nicotine in the intestines, we investigated intestinal nicotine transport using Caco-2 cells. Nicotine was predominantly transported across Caco-2 cell monolayers in a unidirectional mode, corresponding to intestinal secretion, by pH-dependent specific transport systems. The specific uptake systems appear to be distinct from organic cation transporters and the transport system for tertiary amines, in terms of its substrate specificity and the pattern of the interaction. These transport systems could play a role in the intestinal accumulation of nicotine from plasma and could also be responsible for the topical delivery of nicotine for ulcerative colitis therapy. These findings could provide useful information for the design of effective nicotine delivery.

  3. Intestinal transport of zinc and folic acid: a mutual inhibitory effect

    SciTech Connect

    Ghishan, F.K.; Said, H.M.; Wilson, P.C.; Murrell, J.E.; Greene, H.L.

    1986-02-01

    Recent observations suggest an inverse relationship between folic acid intake and zinc nutriture and indicate an interaction between folic acid and zinc at the intestinal level. To define that interaction, we designed in vivo and in vitro transport studies in which folic acid transport in the presence of zinc, as well as zinc transport in the presence of folic acid was examined. These studies show that zinc transport is significantly decreased when folate is present in the intestinal lumen. Similarly folic acid transport is significantly decreased with the presence of zinc. To determine whether this intestinal inhibition is secondary to zinc and folate-forming complexes, charcoal-binding studies were performed. These studies indicate that zinc and folate from complexes at pH 2.0, but that at pH 6.0, these complexes dissolve. Therefore, our studies suggest that under normal physiological conditions a mutual inhibition between folate and zinc exists at the site of intestinal transport.

  4. Effects of pig antibacterial peptides on growth performance and intestine mucosal immune of broiler chickens.

    PubMed

    Bao, H; She, R; Liu, T; Zhang, Y; Peng, K S; Luo, D; Yue, Z; Ding, Y; Hu, Y; Liu, W; Zhai, L

    2009-02-01

    Currently, substitutions for antibiotic growth promoters in animals are attracting interest. This study investigated the effects of pig antibacterial peptides (PABP) on growth performance and small intestine mucosal immune responses in broilers. Three hundred 1-d-old Arbor Acre male broiler chickens were randomly allocated to 5 groups with 60 birds per group. The groups were control group; PABP administered in drinking water at 20 and 30 mg/L of water; or PABP supplemented in feed at 150 and 200 mg/kg of diet. The birds were fed a corn-soybean based diet for 6 wk. Chickens were weighed weekly and killed after 42 d of feeding, and growth performance was measured. Samples of the duodenum and jejunum were collected. The villus height, mucosa thickness, alkaline phosphatase activity, and numbers of secreting IgA and goblet cells were evaluated. The PABP-treated groups had greater BW and average daily gain, greater height of villus and thickness of gut mucosa, greater activity of alkaline phosphatase, higher ratio of secreting IgA, and a greater number of goblet cells compared with the control group (P<0.05). In conclusion, PABP can improve the growth performance, increase the intestinal ability to absorb nutrients, and improve the mucosal immunity of the intestine.

  5. Functional characterization of folic acid transport in the intestine of the laying hen using the everted intestinal sac model.

    PubMed

    Tactacan, G B; Rodriguez-Lecompte, J C; Karmin, O; House, J D

    2011-01-01

    Absorption at the level of the intestine is likely a primary regulatory mechanism for the deposition of dietary supplemented folic acid into the chicken egg. Therefore, factors affecting the intestinal transport of folic acid in the laying hen may influence the level of egg folate concentrations. To this end, a series of experiments using intestinal everted sacs were conducted to characterize intestinal folic acid absorption processes in laying hens. Effects of naturally occurring folate derivatives (5-methyl and 10-formyltetrahydrofolate) as well as heme on folic acid absorption were also investigated. Folic acid absorption was measured based on the rate of uptake of (3)H-labeled folic acid in the everted sac from various segments of the small and large intestines. Folic acid concentration, incubation length, and pH condition were optimized before the performance of uptake experiments. The distribution profile of folic acid transport along the intestine was highest in the upper half of the small intestine. Maximum uptake rate (nmol·100 g tissue(-1)·min(-1)) was observed in the duodenum (20.6 ± 1.9) and jejunum (22.3 ± 2.0) and decreased significantly in the ileum (15.3 ± 1.1) and cecum (9.3 ± 0.9). Transport increased proportionately (P < 0.05) between 0.0001 and 0.1 µM folic acid. Above 0.1 µM, the slope of the regression line was not significantly different from zero (P < 0.137). Folic acid uptake in the jejunum showed a maximum rate of transport at pH 6.0, but was lowest at pH 7.5. The presence of 5-methyl and 10-formyltetrahydrofolate as well as heme impeded folic acid uptake, reducing intestinal folic acid absorption when added at concentrations ranging from 0 to 100 µM. Overall, these data indicated the presence of a folic acid transport system in the entire intestine of the laying hen. Uptake of folic acid in the cecum raises the likelihood of absorption of bacterial-derived folate.

  6. Glucose Transport into Everted Sacks of Intestine of Mice: A Model for the Study of Active Transport.

    ERIC Educational Resources Information Center

    Deyrup-Olsen, Ingrith; Linder, Alison R.

    1979-01-01

    Described is a laboratory procedure which uses the small intestines of mice as models for the transport of glucose and other solutes. Demonstrations are suitable for either introductory or advanced physiology courses. (RE)

  7. Interaction of Drug or Food with Drug Transporters in Intestine and Liver.

    PubMed

    Nakanishi, Takeo; Tamai, Ikumi

    2015-01-01

    Oral bioavailability (F) is determined as fraction of the drug dose absorbed through the gastrointestinal membranes (Fa), the unmetabolized fraction of the absorbed dose that passes through the gut into the portal blood (Fg), and the hepatic first pass availability (Fh), namely F is expressed as the product of Fa, Fg and Fh (F = Fa.Fg.Fh). Current evidence suggests that transporter proteins play a role in intestinal absorption and hepatobiliary clearance of drugs. Among those transporters, this review will focus on PEPT1 and OATP2B1 as influx transporter and p-glycoprotein (P-gp) and BCRP as efflux transporter in intestinal epithelial cells, and on OATP1B1 and 1B3 as influx transporter and MRP2 as efflux transporter in hepatocytes, respectively, because drug-drug (DDI) and -food (DFI) interactions on these transporter are considered to affect bioavailability of their substrate drugs. DDI and DFI may reduce systemic exposure to drug by blocking influx transporters in intestine, but increase it by modulating influx and efflux transporters in liver and efflux transporters in intestines. Namely, drug disposition and efficacy are likely affected by DDI and DFI, resulting in treatment failures or increase in adverse effect. Therefore, it is of significantly importance to understand precise mechanism of DDI and DFI. This review will present information about transporter-based DDI and DFI in the processes of intestinal absorption and hepatic clearance of drugs, and discuss about their clinical implication.

  8. Characteristic Analysis of Intestinal Transport in Enterocyte-Like Cells Differentiated from Human Induced Pluripotent Stem Cells.

    PubMed

    Kodama, Nao; Iwao, Takahiro; Katano, Takahiro; Ohta, Kinya; Yuasa, Hiroaki; Matsunaga, Tamihide

    2016-10-01

    We previously demonstrated that differentiated enterocytes from human induced pluripotent stem (iPS) cells exhibited drug-metabolizing activities and cytochrome P450 CYP3A4 inducibility. The aim of this study was to apply human iPS cell-derived enterocytes in pharmacokinetic studies by investigating the characteristics of drug transport into enterocyte-like cells. Human iPS cells cultured on feeder cells were differentiated into endodermal cells using activin A. These endodermal-like cells were then differentiated into intestinal stem cells by fibroblast growth factor 2. Finally, epidermal growth factor and small-molecule compounds induced the maturation of the intestinal stem cell-like cells. After differentiation, we performed transepithelial electrical resistance (TEER) measurements, immunofluorescence staining, and transport studies. TEER values increased in a time-dependent manner and reached approximately 100 Ω × cm(2) Efflux transport of Hoechst 33342, a substrate of breast cancer resistance protein (BCRP), was observed and inhibited by the BCRP inhibitor Ko143. The uptake of peptide transporter 1 substrate glycylsarcosine was also confirmed and suppressed when the temperature was lowered to 4°C. Using immunofluorescence staining, villin and Na(+)-K(+) ATPase were expressed. These results suggest that human iPS cell-derived enterocytes had loose tight junctions, polarity, as well as uptake and efflux transport functions. In addition, the rank order of apparent membrane permeability coefficient (Papp) values of these test compounds across the enterocyte-like cell membrane corresponded to the fraction absorbance (Fa) values. Therefore, differentiated enterocytes from human iPS cells may provide a useful comprehensive evaluation model of drug transport and metabolism in the small intestine.

  9. Nutrient availability, the microbiome, and intestinal transport during pregnancy.

    PubMed

    Astbury, Stuart; Mostyn, Alison; Symonds, Michael E; Bell, Rhonda C

    2015-11-01

    Adequate adaptation of the gastrointestinal tract is important during pregnancy to ensure that the increased metabolic demands by the developing fetus are met. These include changes in surface area mediated by villus hypertrophy and enhanced functional capacity of individual nutrient receptors, including those transporting glucose, fructose, leucine, and calcium. These processes are regulated either by the enhanced nutrient demand or are facilitated by changes in the secretion of pregnancy hormones. Our review also covers recent research into the microbiome, and how pregnancy could lead to microbial adaptations, which are beneficial to the mother, yet are also similar to those seen in the metabolic syndrome. The potential role of diet in modulating the microbiome during pregnancy, as well as the potential for the intestinal microbiota to induce pregnancy complications, are examined. Gaps in the current literature are highlighted, including those where only historical evidence is available, and we suggest areas that should be a priority for further research. In summary, although a significant degree of adaptation has been described, there are both well-established processes and more recent discoveries, such as changes within the maternal microbiome, that pose new questions as to how the gastrointestinal tract effectively adapts to pregnancy, especially in conjunction with maternal obesity.

  10. Molecular forms of peptide histidine isoleucine-like immunoreactivity in the gastrointestinal tract. Nonequimolar levels of peptide histidine isoleucine and vasoactive intestinal peptide in the stomach explained by the presence of a big peptide histidine isoleucine-like molecule.

    PubMed

    Yiangou, Y; Christofides, N D; Blank, M A; Yanaihara, N; Tatemoto, K; Bishop, A E; Polak, J M; Bloom, S R

    1985-09-01

    Regional specific antibodies and chromatography were used to analyze the distributions and molecular forms of peptide histidine isoleucine (PHI) and vasoactive intestinal peptide (VIP) in the porcine intestine. Both peptides were present along the entire length of the intestine, the highest concentrations occurring in the colon. Concentrations of PHI immunoreactivity, measured with three different antisera, and VIP immunoreactivity were approximately equal in all parts of the gastrointestinal tract except in the stomach. In the stomach, the concentration of PHI immunoreactivity, measured with the N-terminally directed antibody R8403, although equal to the corresponding VIP concentration, was two to four times higher than the PHI immunoreactivity detected with the two C-terminally directed PHI antisera T33 and T41. Chromatographic analysis on Sephadex G-50 superfine of gastric extracts revealed only one VIP immunoreactive peak that eluted in the same position as the porcine VIP standard, at Kav 0.53. A PHI immunoreactive peak was also detected with the C-terminally directed PHI antisera in the same position as porcine PHI standard. However, with the N-terminally directed PHI antiserum R8403, an additional PHI immunoreactive peak was detected in gastric extracts constituting the predominant form present, and this peak eluted earlier at Kav 0.37. The PHI immunoreactive material that eluted earlier was present in the rest of the intestine in only small amounts. As VIP and PHI are believed to be derived from a common precursor, it is suggested that in the stomach the posttranslational enzymic processing of the precursor is different from that in the other parts of the intestine.

  11. Intestine.

    PubMed

    Smith, J M; Skeans, M A; Horslen, S P; Edwards, E B; Harper, A M; Snyder, J J; Israni, A K; Kasiske, B L

    2016-01-01

    Intestine and intestine-liver transplant plays an important role in the treatment of intestinal failure, despite decreased morbidity associated with parenteral nutrition. In 2014, 210 new patients were added to the intestine transplant waiting list. Among prevalent patients on the list at the end of 2014, 65% were waiting for an intestine transplant and 35% were waiting for an intestine-liver transplant. The pretransplant mortality rate decreased dramatically over time for all age groups. Pretransplant mortality was highest for adult candidates, at 22.1 per 100 waitlist years compared with less than 3 per 100 waitlist years for pediatric candidates, and notably higher for candidates for intestine-liver transplant than for candidates for intestine transplant without a liver. Numbers of intestine transplants without a liver increased from a low of 51 in 2013 to 67 in 2014. Intestine-liver transplants increased from a low of 44 in 2012 to 72 in 2014. Short-gut syndrome (congenital and other) was the main cause of disease leading to both intestine and intestine-liver transplant. Graft survival improved over the past decade. Patient survival was lowest for adult intestine-liver recipients and highest for pediatric intestine recipients.

  12. Receptors for vasoactive intestinal peptide in rat anterior pituitary glands: Localization of binding to lactotropes

    SciTech Connect

    Wanke, I.E.; Rorstad, O.P. )

    1990-04-01

    Vasoactive intestinal peptide (VIP) has been implicated as a physiological PRL-releasing factor; however, characterization of VIP receptors on normal pituitaries using radioligand-binding methods has been problematic. In this study we demonstrated specific receptors for VIP in anterior pituitary glands of female rats using HPLC-purified monoiodinated (Tyr(125I)10)VIP. Binding of VIP was reversible, saturable to receptor and radioligand, regulated by guanine nucleotides, and dependent on time and temperature. Scatchard analysis of competitive binding studies indicated high and low affinity binding sites, with equilibrium dissociation constants (Kd) of 0.19 +/- 0.03 and 28 +/- 16 nM, respectively. The corresponding maximum numbers of binding sites were 158 +/- 34 fmol/mg and 11.7 +/- 6.9 pmol/mg. Binding was specific, as peptides with structural homology to VIP were less than 100th as potent as VIP. The rank order of potency of the peptides tested was VIP greater than rat (r) peptide histidine isoleucine = human (h) PHI greater than rGRF greater than bovine GRF = porcine PHI = VIP-(10-28) greater than hGRF greater than secretin greater than apamin greater than glucagon. Radioligand binding was associated primarily with lactotrope-enriched fractions prepared by unit gravity sedimentation of dispersed anterior pituitary cells. VIP stimulated PRL release from cultured rat anterior pituitary cells, with an ED50 of 1 nM. These results, comprising the first identification of specific VIP receptors in normal rat anterior pituitary tissue using radioligand-binding methods, provide additional support for a biological role of VIP in lactotrope function.

  13. Listeria monocytogenes Inhibits Serotonin Transporter in Human Intestinal Caco-2 Cells.

    PubMed

    Latorre, E; Pradilla, A; Chueca, B; Pagán, R; Layunta, E; Alcalde, A I; Mesonero, J E

    2016-10-01

    Listeria monocytogenes is a Gram-positive bacterium that can cause a serious infection. Intestinal microorganisms have been demonstrated to contribute to intestinal physiology not only through immunological responses but also by modulating the intestinal serotonergic system. Serotonin (5-HT) is a neuromodulator that is synthesized in the intestinal epithelium and regulates the whole intestinal physiology. The serotonin transporter (SERT), located in enterocytes, controls intestinal 5-HT availability and therefore serotonin's effects. Infections caused by L. monocytogenes are well described as being due to the invasion of intestinal epithelial cells; however, the effect of L. monocytogenes on the intestinal epithelium remains unknown. The main aim of this work, therefore, was to study the effect of L. monocytogenes on SERT. Caco2/TC7 cell line was used as an enterocyte-like in vitro model, and SERT functional and molecular expression assays were performed. Our results demonstrate that living L. monocytogenes inhibits serotonin uptake by reducing SERT expression at the brush border membrane. However, neither inactivated L. monocytogenes nor soluble metabolites were able to affect SERT. The results also demonstrate that L. monocytogenes yields TLR2 and TLR10 transcriptional changes in intestinal epithelial cells and suggest that TLR10 is potentially involved in the inhibitory effect observed on SERT. Therefore, L. monocytogenes, through TLR10-mediated SERT inhibition, may induce increased intestinal serotonin availability and potentially contributing to intestinal physiological changes and the initiation of the inflammatory response.

  14. Microbiota/Host Crosstalk Biomarkers: Regulatory Response of Human Intestinal Dendritic Cells Exposed to Lactobacillus Extracellular Encrypted Peptide

    PubMed Central

    Al-Hassi, Hafid O.; Mann, Elizabeth R.; Urdaci, María C.; Knight, Stella C.; Margolles, Abelardo

    2012-01-01

    The human gastrointestinal tract is exposed to a huge variety of microorganisms, either commensal or pathogenic; at this site, a balance between immunity and immune tolerance is required. Intestinal dendritic cells (DCs) control the mechanisms of immune response/tolerance in the gut. In this paper we have identified a peptide (STp) secreted by Lactobacillus plantarum, characterized by the abundance of serine and threonine residues within its sequence. STp is encoded in one of the main extracellular proteins produced by such species, which includes some probiotic strains, and lacks cleavage sites for the major intestinal proteases. When studied in vitro, STp expanded the ongoing production of regulatory IL-10 in human intestinal DCs from healthy controls. STp-primed DC induced an immunoregulatory cytokine profile and skin-homing profile on stimulated T-cells. Our data suggest that some of the molecular dialogue between intestinal bacteria and DCs may be mediated by immunomodulatory peptides, encoded in larger extracellular proteins, secreted by commensal bacteria. These peptides may be used for the development of nutraceutical products for patients with IBD. In addition, this kind of peptides seem to be absent in the gut of inflammatory bowel disease patients, suggesting a potential role as biomarker of gut homeostasis. PMID:22606249

  15. Bile acids induce glucagon-like peptide 2 secretion with limited effects on intestinal adaptation in early weaned pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Early weaning is a stressful event characterized by a transient period of intestinal atrophy that may be mediated by reduced secretion of glucagon-like peptide (GLP) 2. We tested whether enterally fed bile acids or plant sterols could increase nutrient-dependent GLP-2 secretion and improve intestina...

  16. Microbiota/host crosstalk biomarkers: regulatory response of human intestinal dendritic cells exposed to Lactobacillus extracellular encrypted peptide.

    PubMed

    Bernardo, David; Sánchez, Borja; Al-Hassi, Hafid O; Mann, Elizabeth R; Urdaci, María C; Knight, Stella C; Margolles, Abelardo

    2012-01-01

    The human gastrointestinal tract is exposed to a huge variety of microorganisms, either commensal or pathogenic; at this site, a balance between immunity and immune tolerance is required. Intestinal dendritic cells (DCs) control the mechanisms of immune response/tolerance in the gut. In this paper we have identified a peptide (STp) secreted by Lactobacillus plantarum, characterized by the abundance of serine and threonine residues within its sequence. STp is encoded in one of the main extracellular proteins produced by such species, which includes some probiotic strains, and lacks cleavage sites for the major intestinal proteases. When studied in vitro, STp expanded the ongoing production of regulatory IL-10 in human intestinal DCs from healthy controls. STp-primed DC induced an immunoregulatory cytokine profile and skin-homing profile on stimulated T-cells. Our data suggest that some of the molecular dialogue between intestinal bacteria and DCs may be mediated by immunomodulatory peptides, encoded in larger extracellular proteins, secreted by commensal bacteria. These peptides may be used for the development of nutraceutical products for patients with IBD. In addition, this kind of peptides seem to be absent in the gut of inflammatory bowel disease patients, suggesting a potential role as biomarker of gut homeostasis.

  17. Glucagon-like peptide-2 (GLP-2) increases small intestinal blood flow and mucosal growth in ruminating calves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glucagon-like peptide-2 (GLP-2), increases small intestinal mass and blood flow in non-ruminants, but its effect in ruminants is unknown. Eight Holstein calves with an ultrasonic flow probe around the superior mesenteric artery (SMA), and catheters in the carotid artery and mesenteric vein, were pa...

  18. Intestinal transport of gentamicin with a novel, glycosteroid drug transport agent

    NASA Technical Reports Server (NTRS)

    Axelrod, H. R.; Kim, J. S.; Longley, C. B.; Lipka, E.; Amidon, G. L.; Kakarla, R.; Hui, Y. W.; Weber, S. J.; Choe, S.; Sofia, M. J.

    1998-01-01

    PURPOSE: The objective was to investigate the ability of a glycosteroid (TC002) to increase the oral bioavailability of gentamicin. METHODS: Admixtures of gentamicin and TC002 were administered to the rat ileum by injection and to dogs by ileal or jejunal externalized ports, or PO. Bioavailability of gentamicin was determined by HPLC. 3H-TC002 was injected via externalized cannulas into rat ileum or jejunum, or PO and its distribution and elimination was determined. The metabolism of TC002 in rats was evaluated by solid phase extraction and HPLC analysis of plasma, urine and feces following oral or intestinal administration. RESULTS: The bioavailability of gentamicin was substantially increased in the presence of TC002 in both rats and dogs. The level of absorption was dependent on the concentration of TC002 and site of administration. Greatest absorption occurred following ileal orjejunal administration. TC002 was significantly more efficacious than sodium taurocholate, but similar in cytotoxicity. TC002 remained primarily in the GI tract following oral or intestinal administration and cleared rapidly from the body. It was only partly metabolized in the GI tract, but was rapidly and completely converted to its metabolite in plasma and urine. CONCLUSIONS: TC002 shows promise as a new drug transport agent for promoting intestinal absorption of polar molecules such as gentamicin.

  19. Dopaminergic modulation of adenylate cyclase stimulation by vasoactive intestinal peptide in anterior pituitary.

    PubMed Central

    Onali, P; Schwartz, J P; Costa, E

    1981-01-01

    The activation of adenylate cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] by vasoactive intestinal peptide (VIP) was used as a model to investigate the molecular mechanisms triggered by the occupancy of dopamine recognition sites in rat anterior pituitary. Dopamine failed to change the basal enzyme activity, but it inhibited the stimulation of adenylate cyclase elicited by VIP. Apomorphine, 2-amino-6,7-dihydroxy-1,2,3,4-tetrahydronaphthalene, and 2-bromo-alpha-ergocryptine mimicked the effect of dopamine, whereas (-)-sulpiride and and classical neuroleptics antagonized it. Dopamine failed to modulate the activation of pituitary adenylate cyclase by prostaglandin E1, which does not increase prolactin secretion. From these results we infer that stimulation of D-2 (dopamine) receptors may affect pituitary secretion by inhibiting the activation of anterior pituitary adenylate cyclase by VIP or other secretagogues. PMID:6171819

  20. The effects of vasoactive intestinal peptide on adrenal steroid hormone secretion

    SciTech Connect

    Cunningham, L.A.

    1988-01-01

    Vasoactive intestinal peptide (VIP)-immunoreactive nerve fibers have been demonstrated in the rat adrenal cortex in close association with zona glomerulosa cells. We have studied the effects of VIP on steroid hormone secretion from the outer zones of the normal rat adrenal cortex. Intact capsule-glomerulosa preparations, consisting of the capsule, zona glomerulosa, and a small portion of the zona fasciculata were perifused in vitro. The secretory responsiveness was assessed by measuring aldosterone and corticosterone release following stimulation with the physiological secretagogues ACTH and angiotensin II. The distribution of adrenal VIP receptors was assessed by in vitro autoradiography of {sup 125}I-VIP binding. {sup 125}I-VIP (0.75 and 2.0 nM) binding was concentrated in the capsule and zone glomerulosa, coincident with the distribution of VIP nerve fibers which aborize extensively in this region. The specificity of this binding was demonstrated using unlabelled VIP, ACTH and angiotensin II.

  1. Vasoactive intestinal peptide (VIP) induces malignant transformation of the human prostate epithelial cell line RWPE-1.

    PubMed

    Fernández-Martínez, Ana B; Bajo, Ana M; Isabel Arenas, M; Sánchez-Chapado, Manuel; Prieto, Juan C; Carmena, María J

    2010-12-18

    The carcinogenic potential of vasoactive intestinal peptide (VIP) was analyzed in non-tumor human prostate epithelial cells (RWPE-1) and in vivo xenografts. VIP induced morphological changes and a migratory phenotype consistent with stimulation of expression/activity of metalloproteinases MMP-2 and MMP-9, decreased E-cadherin-mediated cell-cell adhesion, and increased cell motility. VIP increased cyclin D1 expression and cell proliferation that was blocked after VPAC(1)-receptor siRNA transfection. Similar effects were seen in RWPE-1 tumors developed by subcutaneous injection of VIP-treated cells in athymic nude mice. VIP acts as a cytokine in RWPE-1 cell transformation conceivably through epithelial-mesenchymal transition (EMT), reinforcing VIP role in prostate tumorigenesis.

  2. Involvement of Concentrative Nucleoside Transporter 1 in Intestinal Absorption of Trifluridine Using Human Small Intestinal Epithelial Cells.

    PubMed

    Takahashi, Koichi; Yoshisue, Kunihiro; Chiba, Masato; Nakanishi, Takeo; Tamai, Ikumi

    2015-09-01

    TAS-102, which is effective for refractory metastatic colorectal cancer, is a combination drug of anticancer trifluridine (FTD; which is derived from pyrimidine nucleoside) and FTD-metabolizing enzyme inhibitor tipiracil hydrochloride (TPI) at a molecular ratio of 1:0.5. To evaluate the intestinal absorption mechanism of FTD, the uptake and transcellular transport of FTD by human small intestinal epithelial cell (HIEC) monolayer as a model of human intestinal epithelial cells was investigated. The uptake and membrane permeability of FTD by HIEC monolayers were saturable, Na(+) -dependent, and inhibited by nucleosides. These transport characteristics are mostly comparable with those of concentrative nucleoside transporters (CNTs). Moreover, the uptake of FTD by CNT1-expressing Xenopus oocytes was the highest among human CNT transporters. The obtained Km and Vmax values of FTD by CNT1 were 69.0 μM and 516 pmol/oocyte/30 min, respectively. The transcellular transport of FTD by Caco-2 cells, where CNT1 is heterologously expressed, from apical to basolateral side was greater than that by Mock cells. In conclusion, these results demonstrated that FTD exhibits high oral absorption by the contribution of human CNT1.

  3. The effect of atrial natriuretic peptide infusion on intestinal injury in septic shock

    PubMed Central

    Elbaradey, Ghada F.; Elshmaa, Nagat Sayed; Hodeib, Hossam

    2016-01-01

    Background and Aims: The aim of this study is to assess the effect of atrial natriuretic peptide (ANP) on intestinal ischemia-reperfusion injury in septic shock. Material and Methods: A prospective randomized controlled, observer-blinded study was carried out in surgical Intensive Care Unit (ICU), University Hospital. Forty adult patients in septic shock were randomly divided into two groups, control group (Group C) received normal saline and ANP group (Group A) patients received ANP in the form of 1.5 mg vial added to 250 ml solvent in plastic bag (1 ml = 6 micg) given at 2 mcg/kg intravenous bolus over 1 min followed by 0.01 mcg/kg/min for 24 h. The primary outcome measurements were blood marker of intestinal hypoperfusion in form of intestinal fatty acid binding protein (I-FABP), malondialdehyde (MDA), myloperoxidase enzyme activity (MPO), protein carbonyl (PC), and glutathione peroxidase activity (GPA) measured before start of ANP infusion, 6 h, 12 h, and 24 h after start of infusion. The secondary outcome measurements were the duration of noradrenaline infusion, duration of ICU stay, hospital mortality rate, and complications related to ANP. Results: In comparison with Group C, Group A showed a significant decrease (P < 0.05) in serum level of MPO, MDA, PC, and I-FABP, with a significant increase (P < 0.05) in serum level of GPA, 6 h, 12 h, and 24 h after the start of ANP infusion. There was significant decrease (P < 0.05) in mean duration of noradrenaline infusion, the length of ICU stay and mortality rate in Group A in comparison with Group C. In Group A, seven patients had mean arterial blood pressure < 65 mmHg but respond to volume resuscitation, three patients serum sodium was 125–130 mmol/L. Conclusion: In cases of septic shock, concomitant administration of ANP with noradrenaline may have a protective effect against intestinal injury through a decrease in the level of intestinal hypoperfusion owing to its anti-inflammatory and antioxidant effect. PMID

  4. Calcium uptake by intestinal brush border membrane vesicles. Comparison with in vivo calcium transport.

    PubMed Central

    Schedl, H P; Wilson, H D

    1985-01-01

    In prior studies, we examined kinetics of steady state in vivo transepithelial calcium transport in rat and hamster. The present studies related calcium uptake by the brush border to in vivo transport. We measured calcium uptake by brush border membrane vesicles from the two species. In the rat, our prior in vivo studies had shown that (a) calcium transport was mediated, (b) no nonmediated component was detectable, and (c) Vmax was 2.5 times greater in proximal than distal small intestine. In brush border membrane vesicles from the rat, Vmax for the saturable component of calcium uptake was again 2.5 times greater in proximal than distal intestine. Contrasting with in vivo studies, a major nonsaturable component was present in vesicles from proximal and distal small intestine. In the hamster, our previous in vivo studies had shown (1) both mediated and nonmediated components of calcium transport, (2) greater nonmediated transport in proximal than distal small intestines, and (3) Vmax for calcium transport twice as great in distal as in proximal small intestine. In the present study with brush border membrane vesicles from hamster, Vmax for saturable calcium transport was again twice as great in distal as in proximal small intestine. However, nonsaturable calcium transport rates relative to saturable rates were much greater with vesicles than in in vivo studies, and were greater in vesicles from distal than proximal small intestine. Since rates of saturable calcium uptake by brush border membrane vesicles parallel corresponding in vivo mediated transport rates, we conclude that the segmental rates of calcium transport in rat and hamster could be determined by brush border function. PMID:2997294

  5. Medicinal Plants Qua Glucagon-Like Peptide-1 Secretagogue via Intestinal Nutrient Sensors

    PubMed Central

    Kim, Ki-Suk; Jang, Hyeung-Jin

    2015-01-01

    Glucagon-like peptide-1 (GLP-1) participates in glucose homeostasis and feeding behavior. Because GLP-1 is rapidly inactivated by the enzymatic cleavage of dipeptidyl peptidase-4 (DPP4) long-acting GLP-1 analogues, for example, exenatide and DPP4 inhibitors, for example, liraglutide, have been developed as therapeutics for type 2 diabetes mellitus (T2DM). However, the inefficient clinical performance and the incidence of side effects reported on the existing therapeutics for T2DM have led to the development of a novel therapeutic strategy to stimulate endogenous GLP-1 secretion from enteroendocrine L cells. Since the GLP-1 secretion of enteroendocrine L cells depends on the luminal nutrient constituents, the intestinal nutrient sensors involved in GLP-1 secretion have been investigated. In particular, nutrient sensors for tastants, cannabinoids, and bile acids are able to recognize the nonnutritional chemical compounds, which are abundant in medicinal plants. These GLP-1 secretagogues derived from medicinal plants are easy to find in our surroundings, and their effectiveness has been demonstrated through traditional remedies. The finding of GLP-1 secretagogues is directly linked to understanding of the role of intestinal nutrient sensors and their recognizable nutrients. Concurrently, this study demonstrates the possibility of developing novel therapeutics for metabolic disorders such as T2DM and obesity using nutrients that are readily accessible in our surroundings. PMID:26788106

  6. Adaptations of intestinal nutrient transport to chronic caloric restriction in mice.

    PubMed

    Casirola, D M; Rifkin, B; Tsai, W; Ferraris, R P

    1996-07-01

    Lifelong caloric restriction increases median and maximum life span and retards the aging process in many organ systems of rodents. Because the small intestine absorbs a reduced amount of nutrients each day, does lifelong caloric restriction induce adaptations in intestinal nutrient transport? We initially compared intestinal transport of sugars and amino acids between 24-mo-old mice allowed free access to food [ad libitum (AL)] and those provided a calorically restricted [40% less than ad libitum (CR)] diet since 3 mo of age. We found that CR mice had significantly greater transport rates for D-glucose, D-fructose, and several amino acids and had significantly lower villus heights. Total intestinal absorptive capacities for D-glucose, D-fructose, and L-proline were each 40-50% greater in CR mice; absorptive capacity normalized to metabolic mass (body weight 0.75) was approximately 80% greater in CR mice. Comparison of uptakes in aged AL and CR mice with previously published results in young AL mice suggests that caloric restriction delays age-related decreases in nutrient transport. In contrast to published studies in hibernation and starvation, chronic caloric restriction enhances not only uptake per milligram but also uptake per centimeter. We then switched 24-mo-old AL mice to a calorie-restricted diet for 1 mo and found that short-term caloric restriction has no effect on intestinal nutrient transport, intestinal mass, and total absorptive capacity. Thus chronic but not short-term caloric restriction increases intestinal nutrient transport rates in aged mice, and the main mechanism underlying these increases is enhanced transport rates per unit intestinal tissue weight.

  7. Novel Association between Vasoactive Intestinal Peptide and CRTH2 Receptor in Recruiting Eosinophils

    PubMed Central

    El-Shazly, Amr E.; Begon, Dominique Y.; Kustermans, Gaelle; Arafa, Mohammad; Dortu, Estelle; Henket, Monique; Lefebvre, Philippe P.; Louis, Renaud; Delvenne, Philippe

    2013-01-01

    We explored the relation between vasoactive intestinal peptide (VIP), CRTH2, and eosinophil recruitment. It is shown that CRTH2 expression by eosinophils from allergic rhinitis (AR) patients and eosinophil cell line (Eol-1 cells) was up-regulated by VIP treatment. This was functional and resulted in exaggerated migratory response of cells against PGD2. Nasal challenge of AR patients resulted in a significant increase of VIP contents in nasal secretion (ELISA), and the immunohistochemical studies of allergic nasal tissues showed significant expression of VIP in association with intense eosinophil recruitment. Biochemical assays showed that VIP-induced eosinophil chemotaxis from AR patients and Eol-1 cells was mediated through the CRTH2 receptor. Cell migration against VIP was sensitive to protein kinase C (PKC) and protein kinase A (PKA) inhibition but not to tyrosine kinase or p38 MAPK inhibition or calcium chelation. Western blot demonstrated a novel CRTH2-mediated cytosol-to-membrane translocation of PKC-ϵ, PKC-δ, and PKA-α, -γ, and -IIαreg in Eol-1 cells upon stimulation with VIP. Confocal images and FACS demonstrated a strong association and co-localization between VIP peptide and CRTH2 molecules. Further, VIP induced PGD2 secretion from eosinophils. Our results demonstrate the first evidence of association between VIP and CRTH2 in recruiting eosinophils. PMID:23168411

  8. Disrupted reproduction, estrous cycle, and circadian rhythms in female mice deficient in vasoactive intestinal peptide.

    PubMed

    Loh, D H; Kuljis, D A; Azuma, L; Wu, Y; Truong, D; Wang, H B; Colwell, C S

    2014-10-01

    The female reproductive cycle is gated by the circadian timing system and may be vulnerable to disruptions in the circadian system. Prior work suggests that vasoactive intestinal peptide (VIP)-expressing neurons in the suprachiasmatic nucleus (SCN) are one pathway by which the circadian clock can influence the estrous cycle, but the impact of the loss of this peptide on reproduction has not been assessed. In the present study, we first examine the impact of the genetic loss of the neuropeptide VIP on the reproductive success of female mice. Significantly, mutant females produce about half the offspring of their wild-type sisters even when mated to the same males. We also find that VIP-deficient females exhibit a disrupted estrous cycle; that is, ovulation occurs less frequently and results in the release of fewer oocytes compared with controls. Circadian rhythms of wheel-running activity are disrupted in the female mutant mice, as is the spontaneous electrical activity of dorsal SCN neurons. On a molecular level, the VIP-deficient SCN tissue exhibits lower amplitude oscillations with altered phase relationships between the SCN and peripheral oscillators as measured by PER2-driven bioluminescence. The simplest explanation of our data is that the loss of VIP results in a weakened SCN oscillator, which reduces the synchronization of the female circadian system. These results clarify one of the mechanisms by which disruption of the circadian system reduces female reproductive success.

  9. Inhibition of cholesterol transport in an intestine cell model by pine-derived phytosterols.

    PubMed

    Yi, Jinsoo; Knudsen, Tine A; Nielsen, Anne-Louise; Duelund, Lars; Christensen, Morten; Hervella, Pablo; Needham, David; Mouritsen, Ole G

    2016-10-01

    We have quantified the inhibition of intestinal cholesterol transport by pine-derived phytosterols using an HT29-MTX intestine cell model that forms a mucus layer similar to that in the intestine. An artificial intestinal fluid consisting of digested fat, bile salt, cholesterol, and phytosterols was formulated in order to mimic the conditions in the intestine. The apparent permeability coefficient (Papp) of the positive control, i.e., 0.1mM of cholesterol solubilized in the artificial intestine fluid, was found to be 0.33 (±0.17)×10(-6)cm/s. When 0.1mM β-sitosterol was solubilized alongside, Papp was effectively zero, corresponding to a total inhibition of cholesterol transport. A similar strong inhibition was found when commercial pine-derived phytosterols, PinVita™ FSP DuPont, were co-solubilized with cholesterol in the dietary model micelles, leading to Papp=0.06 (±0.06)×10(-6)cm/s, i.e., 5.5 times lower than the cholesterol positive control. Additionally, the effect of potential oral administration formulations generated by the pine-derived phytosterols was also characterized. The formulations were produced as a liquid formulation of the cholesterol-containing artificial intestine fluid. Six liquid formulations were tested of which four displayed a Papp in the range of 0-0.09×10(-6)cm/s. The remaining two formulations did not show any inhibition effect on cholesterol transport and even enhanced cholesterol transport. It was furthermore observed that the phytosterols were found in the collected intestine cells but not transported to the basolateral region in the intestinal cell model system.

  10. High affinity receptors for vasoactive intestinal peptide on a human glioma cell line

    SciTech Connect

    Nielsen, F.C.; Gammeltoft, S.; Westermark, B.; Fahrenkrug, J. )

    1990-11-01

    Vasoactive intestinal peptide (VIP) bound with high affinity (Kd 0.13 nmol/l) to receptors on the human glioma cell line U-343 MG Cl 2:6. The receptors bound the related peptides helodermin, PHM and secretin with 10, 400 and 5000 times lower affinity, respectively. Deamidated VIP (VIP-COOH) and (des-His1)VIP bound with 10 and 100 times lower affinity. The fragment VIP(7-28) displaced 25% of the receptor-bound {sup 125}I-VIP whereas VIP(16-28) and VIP(1-22-NH2) were inactive. The binding of {sup 125}I-VIP could be completely inhibited by 10 mumol/l of the antagonists (N-Ac-Tyr1,D-Phe2)GRF(1-29)-NH2, (pCl-D-Phe6,Leu17)VIP and VIP(10-28); in contrast, the antagonist L-8-K was inactive. Affinity labeling showed that VIP bound to proteins with Mr's of 75 kDa, 66 kDa and 50 kDa, respectively. Following binding, the peptide was rapidly internalized, and at steady-state only 20% of cell-associated {sup 125}I-VIP was bound to receptors on the cell surface. The internalized {sup 125}I-VIP was completely degraded to {sup 125}I-tyrosine which was released from the cells. Degradation of internalized {sup 125}I-VIP was significantly reduced by chloroquine phenanthroline and pepstatin-A. Surface binding and internalization of {sup 125}I-VIP was increased 3 times by phenanthroline, and pepstatin-A caused a 5 times increase in surface binding. Chloroquine reduced surface-bound {sup 125}I-VIP, but caused retention of internalized {sup 125}I-VIP.

  11. Osmoregulation and epithelial water transport: lessons from the intestine of marine teleost fish.

    PubMed

    Whittamore, Jonathan M

    2012-01-01

    For teleost fish living in seawater, drinking the surrounding medium is necessary to avoid dehydration. This is a key component of their osmoregulatory strategy presenting the challenge of excreting excess salts while achieving a net retention of water. The intestine has an established role in osmoregulation, and its ability to effectively absorb fluid is crucial to compensating for water losses to the hyperosmotic environment. Despite this, the potential for the teleost intestine to serve as a comparative model for detailed, integrative experimental studies on epithelial water transport has so far gone largely untapped. The following review aims to present an assessment of the teleost intestine as a fluid-transporting epithelium. Beginning with a brief overview of marine teleost osmoregulation, emphasis shifts to the processing of ingested seawater by the gastrointestinal tract and the characteristics of intestinal ion and fluid transport. Particular attention is given to acid-base transfers by the intestine, specifically bicarbonate secretion, which creates the distinctly alkaline gut fluids responsible for the formation of solid calcium carbonate precipitates. The respective contributions of these unique features to intestinal fluid absorption, alongside other recognised ion transport processes, are then subsequently considered within the wider context of the classic physiological problem of epithelial water transport.

  12. Glucagon like peptide-2 induces intestinal restitution through VEGF release from subepithelial myofibroblasts.

    PubMed

    Bulut, Kerem; Pennartz, Christian; Felderbauer, Peter; Meier, Juris J; Banasch, Matthias; Bulut, Daniel; Schmitz, Frank; Schmidt, Wolfgang E; Hoffmann, Peter

    2008-01-14

    Glucagon like peptide-2 (GLP-2) exerts intestinotrophic actions, but the underlying mechanisms are still a matter of debate. Recent studies demonstrated the expression of the GLP-2 receptor on fibroblasts located in the subepithelial tissue, where it might induce the release of growth factors such as keratinocyte growth factor (KGF) or vascular endothelial growth factor (VEGF). Therefore, in the present studies we sought to elucidate the downstream mechanisms involved in improved intestinal adaptation by GLP-2. Human colonic fibroblasts (CCD-18Co), human colonic cancer cells (Caco-2 cells) and rat ileum IEC-18 cells were used. GLP-2 receptor mRNA expression was determined using real time RT-PCR. Conditioned media from CCD-18Co cells were obtained following incubation with GLP-2 (50-250 nM) for 24 h. Cell viability was assessed by a 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyl-tetrazolium bromide (MTT)-assay, and wound healing was determined with an established migration-assay. Transforming Growth Factor beta (TGF-beta), VEGF and KGF mRNA levels were determined by RT-PCR. Protein levels of VEGF and TGF-beta in CCD-18Co cells following GLP-2 stimulation were determined using ELISA. Neutralizing TGF-beta and VEGF-A antibodies were utilized to assess the role of TGF-beta and VEGF-A in the process of wound healing. GLP-2 receptor expression was detected in CCD-18Co cells. Conditioned media from CCD-18Co cells dose-dependently induced proliferation in Caco-2 cells, but not in IEC-18 cells. Conditioned media also enhanced cell migration in IEC-18 cells (P<0.01), while migration was even inhibited in Caco-2 cells (P<0.0012). GLP-2 significantly stimulated mRNA expression of VEGF and TGF-beta, but not of KGF in CCD-18Co. The migratory effects of GLP-2 were completely abolished in the presence of TGF-beta and VEGF-A antibodies. GLP-2 exerts differential effects on the epithelium of the small intestine and the colon. Thus, in small intestinal cells GLP-2 stimulates wound

  13. Dietary phosphorus regulates intestinal transport and plasma concentrations of phosphate in rainbow trout.

    PubMed

    Avila, E M; Tu, H; Basantes, S; Ferraris, R P

    2000-05-01

    Intestinal inorganic phosphate transport and its regulation have not been studied in fish. In this study, we initially characterized the mechanisms of intestinal inorganic phosphate transport in rainbow trout (Oncorhynchus mykiss) then determined the effects of dietary phosphorus concentrations on intestinal inorganic phosphate uptake, plasma inorganic phosphate, and intestinal luminal inorganic phosphate concentrations. In 11-g trout, the saturable mechanism of brushborder inorganic phosphate uptake had a Kt= 1.2 mmol l(-1) and a Vmax = 0.22 nmol mg(-1) min(-1), while the diffusive component had a Kd = 0.012 min(-1). Similar kinetic constants were obtained from 51-g trout, suggesting that development or size had little effect on transport. Tracer inorganic phosphate (1.18 mmol l(-1)) uptake was almost completely inhibited (>95%) by 20 mmol l(-1) unlabeled inorganic phosphate. Inorganic phosphate uptake (0.2 mmol l(-1)) was strongly inhibited (approximately 75% inhibition) by phosphonoformic acid, a competitive inhibitor of mammalian inorganic phosphate transport, as well as by the absence of Na+ (approximately 90% inhibition). Northern blot and reverse transcription-polymerase chain reaction indicated that the intestinal inorganic phosphate transporter in trout is not related to the cloned Na+ inorganic phosphate-II transporter of winter flounder. Intestinal luminal and plasma inorganic phosphate concentrations each increased with dietary P concentrations. Intestinal inorganic phosphate, but not proline, absorption rates decreased with dietary phosphorus concentrations. As in mammals and birds, a Na-dependent inorganic phosphate carrier that is tightly regulated by diet is present in trout small intestine.

  14. NisT, the transporter of the lantibiotic nisin, can transport fully modified, dehydrated, and unmodified prenisin and fusions of the leader peptide with non-lantibiotic peptides.

    PubMed

    Kuipers, Anneke; de Boef, Esther; Rink, Rick; Fekken, Susan; Kluskens, Leon D; Driessen, Arnold J M; Leenhouts, Kees; Kuipers, Oscar P; Moll, Gert N

    2004-05-21

    Lantibiotics are lanthionine-containing peptide antibiotics. Nisin, encoded by nisA, is a pentacyclic lantibiotic produced by some Lactococcus lactis strains. Its thioether rings are posttranslationally introduced by a membrane-bound enzyme complex. This complex is composed of three enzymes: NisB, which dehydrates serines and threonines; NisC, which couples these dehydrated residues to cysteines, thus forming thioether rings; and the transporter NisT. We followed the activity of various combinations of the nisin enzymes by measuring export of secreted peptides using antibodies against the leader peptide and mass spectroscopy for detection. L. lactis expressing the nisABTC genes efficiently produced fully posttranslationally modified prenisin. Strikingly, L. lactis expressing the nisBT genes could produce dehydrated prenisin without thioether rings and a dehydrated form of a non-lantibiotic peptide. In the absence of the biosynthetic NisBC enzymes, the NisT transporter was capable of excreting unmodified prenisin and fusions of the leader peptide with non-lantibiotic peptides. Our data show that NisT specifies a broad spectrum (poly)peptide transporter that can function either in conjunction with or independently from the biosynthetic genes. NisT secretes both unmodified and partially or fully posttranslationally modified forms of prenisin and non-lantibiotic peptides. These results open the way for efficient production of a wide range of peptides with increased stability or novel bioactivities.

  15. Ontogeny of Human Hepatic and Intestinal Transporter Gene Expression during Childhood: Age Matters

    PubMed Central

    Mooij, Miriam G.; Schwarz, Ute I.; de Koning, Barbara A. E.; Leeder, J. Steven; Gaedigk, Roger; Samsom, Janneke N.; Spaans, Edwin; van Goudoever, Johannes B.; Tibboel, Dick; Kim, Richard B.

    2014-01-01

    Many drugs prescribed to children are drug transporter substrates. Drug transporters are membrane-bound proteins that mediate the cellular uptake or efflux of drugs and are important to drug absorption and elimination. Very limited data are available on the effect of age on transporter expression. Our study assessed age-related gene expression of hepatic and intestinal drug transporters. Multidrug resistance protein 2 (MRP2), organic anion transporting polypeptide 1B1 (OATP1B1), and OATP1B3 expression was determined in postmortem liver samples (fetal n = 6, neonatal n = 19, infant n = 7, child n = 2, adult n = 11) and multidrug resistance 1 (MDR1) expression in 61 pediatric liver samples. Intestinal expression of MDR1, MRP2, and OATP2B1 was determined in surgical small bowel samples (neonates n = 15, infants n = 3, adults n = 14). Using real-time reverse-transcription polymerase chain reaction, we measured fetal and pediatric gene expression relative to 18S rRNA (liver) and villin (intestines), and we compared it with adults using the 2−∆∆Ct method. Hepatic expression of MRP2, OATP1B1, and OATP1B3 in all pediatric age groups was significantly lower than in adults. Hepatic MDR1 mRNA expression in fetuses, neonates, and infants was significantly lower than in adults. Neonatal intestinal expressions of MDR1 and MRP2 were comparable to those in adults. Intestinal OATP2B1 expression in neonates was significantly higher than in adults. We provide new data that show organ- and transporter-dependent differences in hepatic and intestinal drug transporter expression in an age-dependent fashion. This suggests that substrate drug absorption mediated by these transporters may be subject to age-related variation in a transporter dependent pattern. PMID:24829289

  16. IGF Binding Protein-4 is Required for the Growth Effects of Glucagon-Like Peptide-2 in Murine Intestine

    PubMed Central

    Austin, Kaori; Imam, Nuvair A.; Pintar, John E.

    2015-01-01

    Glucagon-like peptide-2 (GLP-2) is an enteroendocrine hormone that stimulates the growth of the intestinal epithelium. We have previously demonstrated that GLP-2 exerts its intestinotropic effect through an indirect mechanism that requires both IGF-1 and the intestinal epithelial IGF-1 receptor. However, the biological activity of IGF-1 is modulated by IGF binding proteins (IGFBPs), including IGFBP-4, which is highly expressed in the intestine. To determine the role of IGFBP-4 in the tropic effects of GLP-2, IGFBP-4 knockout (KO) and control mice were treated with degradation-resistant GLP-2 or vehicle for 10 days. Comparable levels of IGFBP-1–3/5–7 mRNAs were observed in the intestinal mucosa of all animals. IGFBP-4 KO mice had greater small intestinal weight and length, and deeper crypts (P < .05) as compared with controls, suggesting that IGFBP-4 has an inhibitory role in basal intestinal growth. However, small intestinal weight, crypt-villus height and crypt cell proliferation increased in response to GLP-2 in control mice (P < .05), and these changes were abrogated with IGFBP-4 KO. In contrast, pregnancy-associated plasma protein-A KO mice, which have increased levels of circulating IGFBP-4, demonstrated a normal intestinotropic response to GLP-2. Finally, GLP-2 treatment of control mice significantly increased IGFBP-4 mRNA expression in the jejunal mucosa (P < .05), a finding that was recapitulated by GLP-2 treatment of fetal rat intestinal cells in culture (10−8M for 2 h; P < .05). Collectively, these results indicate that the IGF-I-modulating protein, IGFBP-4, exerts a negative effect on basal intestinal growth but plays a positive regulatory role in the intestinotropic actions of GLP-2. PMID:25514089

  17. Roles of different peptide transporters in nutrient acquisition in Candida albicans.

    PubMed

    Dunkel, Nico; Hertlein, Tobias; Franz, Renate; Reuß, Oliver; Sasse, Christoph; Schäfer, Tina; Ohlsen, Knut; Morschhäuser, Joachim

    2013-04-01

    Fungi possess two distinct proton-coupled peptide transport systems, the dipeptide/tripeptide transporters (PTR) and the oligopeptide transporters (OPT), which enable them to utilize peptides as nutrients. In the pathogenic yeast Candida albicans, peptide transporters are encoded by gene families consisting of two PTR genes and eight OPT genes. To gain insight into the functions and importance of specific peptide transporters, we generated mutants lacking the two dipeptide/tripeptide transporters Ptr2 and Ptr22, as well as the five major oligopeptide transporters Opt1 to Opt5. These mutants were unable to grow in media containing peptides as the sole nitrogen source. Forced expression of individual peptide transporters in the septuple mutants showed that Ptr2 and Ptr22 could utilize all tested dipeptides as substrates but differed in their abilities to transport specific tripeptides. Interestingly, several oligopeptide transporters, which are thought to transport peptides consisting of more than three amino acids, also mediated the uptake of tripeptides. Opt1 especially turned out to be a highly flexible transporter that enabled growth on all tripeptides tested and could even utilize a dipeptide, a function that has never been ascribed to this family of peptide transporters. Despite their inability to grow on proteins or peptides, the opt1Δ opt2Δ opt3Δ opt4Δ opt5Δ ptr2Δ ptr22Δ septuple mutants had no in vivo fitness defect in a mouse model of gastrointestinal colonization. Therefore, the nutritional versatility of C. albicans enables it to utilize alternative nitrogen sources in this host niche, which probably contributes to its success as a commensal and pathogen in mammalian hosts.

  18. Roles of Different Peptide Transporters in Nutrient Acquisition in Candida albicans

    PubMed Central

    Dunkel, Nico; Hertlein, Tobias; Franz, Renate; Reuß, Oliver; Sasse, Christoph; Schäfer, Tina; Ohlsen, Knut

    2013-01-01

    Fungi possess two distinct proton-coupled peptide transport systems, the dipeptide/tripeptide transporters (PTR) and the oligopeptide transporters (OPT), which enable them to utilize peptides as nutrients. In the pathogenic yeast Candida albicans, peptide transporters are encoded by gene families consisting of two PTR genes and eight OPT genes. To gain insight into the functions and importance of specific peptide transporters, we generated mutants lacking the two dipeptide/tripeptide transporters Ptr2 and Ptr22, as well as the five major oligopeptide transporters Opt1 to Opt5. These mutants were unable to grow in media containing peptides as the sole nitrogen source. Forced expression of individual peptide transporters in the septuple mutants showed that Ptr2 and Ptr22 could utilize all tested dipeptides as substrates but differed in their abilities to transport specific tripeptides. Interestingly, several oligopeptide transporters, which are thought to transport peptides consisting of more than three amino acids, also mediated the uptake of tripeptides. Opt1 especially turned out to be a highly flexible transporter that enabled growth on all tripeptides tested and could even utilize a dipeptide, a function that has never been ascribed to this family of peptide transporters. Despite their inability to grow on proteins or peptides, the opt1Δ opt2Δ opt3Δ opt4Δ opt5Δ ptr2Δ ptr22Δ septuple mutants had no in vivo fitness defect in a mouse model of gastrointestinal colonization. Therefore, the nutritional versatility of C. albicans enables it to utilize alternative nitrogen sources in this host niche, which probably contributes to its success as a commensal and pathogen in mammalian hosts. PMID:23376942

  19. Green tea formulations with vitamin C and xylitol on enhanced intestinal transport of green tea catechins.

    PubMed

    Chung, Jae-Hwan; Kim, Sol; Lee, Sang-Jun; Chung, Jin-Oh; Oh, Yu-Jin; Shim, Soon-Mi

    2013-05-01

    The effect of green tea formulated with vitamin C and xylitol on intestinal cell transport of gallated and nongallated catechin was studied. The transport of catechins from both apical to basolateral and basolateral to apical directions was measured. The effect of vitamin C (4, 10, 20 ppm), xylitol (11, 27.5, 55 ppm), and combinations of both on the intestinal transport rate of catechins was examined. The efflux value (Pb→a/Pa→b) of (-)-epigallocatechin (EGC), (-)-epigallocatechin gallate (EGCG), (-)-epicatechin (EC), and (-)-epicatechin gallate (ECG) was 0.26, 0.22, 1.22, and 0.17, respectively, indicating that EC appeared to be less absorbed compared with other catechins. The addition of xylitol (11, 27.5, 55 ppm) and vitamin C (4, 10, 20 ppm) and in combination enhanced transport rate of nongallated catechins such as EC and EGC. For EC, vitamin C was revealed to be the most effective on intestinal transport, implying the inhibition of the efflux transport mechanism of EC. Intestinal transport of gallated catechins significantly increased from catechins formulated with vitamin C and xylitol in a dose-dependent manner compared to the catechin-only formulation. Results provide a potential strategy to enhance the delivery and bioavailability of catechins in humans by modulating green tea formulation with vitamin C and xylitol.

  20. Glucagon-like peptide-2 modulates neurally evoked mucosal chloride secretion in guinea pig small intestine in vitro

    PubMed Central

    Baldassano, Sara; Liu, Sumei; Qu, Mei-Hu; Mulè, Flavia

    2009-01-01

    Glucagon-like peptide-2 (GLP-2) is an important neuroendocrine peptide in intestinal physiology. It influences digestion, absorption, epithelial growth, motility, and blood flow. We studied involvement of GLP-2 in intestinal mucosal secretory behavior. Submucosal-mucosal preparations from guinea pig ileum were mounted in Ussing chambers for measurement of short-circuit current (Isc) as a surrogate for chloride secretion. GLP-2 action on neuronal release of acetylcholine was determined with ELISA. Enteric neuronal expression of the GLP-2 receptor (GLP-2R) was studied with immunohistochemical methods. Application of GLP-2 (0.1–100 nM) to the serosal or mucosal side of the preparations evoked no change in baseline Isc and did not alter transepithelial ionic conductance. Transmural electrical field stimulation (EFS) evoked characteristic biphasic increases in Isc, with an initially rapid rising phase followed by a sustained phase. Application of GLP-2 reduced the EFS-evoked biphasic responses in a concentration-dependent manner. The GLP-2R antagonist GLP-2-(3-33) significantly reversed suppression of the EFS-evoked responses by GLP-2. Tetrodotoxin, scopolamine, and hexamethonium, but not vasoactive intestinal peptide type 1 receptor (VPAC1) antagonist abolished or reduced to near zero the EFS-evoked responses. GLP-2 suppressed EFS-evoked acetylcholine release as measured by ELISA. Pretreatment with GLP-2-(3-33) offset this action of GLP-2. In the submucosal plexus, GLP-2R immunoreactivity (-IR) was expressed in choline acetyltransferase-IR neurons, somatostatin-IR neurons, neuropeptide Y-IR neurons, and vasoactive intestinal peptide-IR neurons. We conclude that submucosal neurons in the guinea pig ileum express GLP-2R. Activation of GLP-2R decreases neuronally evoked epithelial chloride secretion by suppressing acetylcholine release from secretomotor neurons. PMID:19628655

  1. Growth factor based therapies and intestinal disease: is glucagon-like peptide-2 the new way forward?

    PubMed

    Yazbeck, Roger; Howarth, Gordon S; Abbott, Catherine A

    2009-04-01

    Inflammatory bowel disease (IBD) is a chronic, debilitating disease associated with severe damage to the intestinal mucosa. Glucagon-like peptide-2 (GLP-2) is a potent and specific gastrointestinal growth factor that is demonstrating therapeutic potential for the prevention or treatment of an expanding number of intestinal diseases, including short bowel syndrome (SBS), small bowel enteritis and IBD. The biological activity of GLP-2 is limited due to proteolytic inactivation by the protease dipeptidyl peptidase (DP)IV. Inhibitors of DPIV activity may represent a novel strategy to prolong the growth promoting actions of GLP-2. This review outlines evidence for the clinical application of GLP-2, its degradation resistant analogue, Teduglutide, and novel DPIV inhibitors in efficacy studies utilizing pre-clinical models of intestinal damage, in particular IBD.

  2. Neuropeptide Y-like immunoreactivity in rat cranial parasympathetic neurons: coexistence with vasoactive intestinal peptide and choline acetyltransferase

    SciTech Connect

    Leblanc, G.C.; Trimmer, B.A.; Landis, S.C.

    1987-05-01

    Neuropeptide Y (NPY) is widely distributed in the sympathetic nervous system, where it is colocalized with norepinephrine. The authors report here that NPY-immunoreactive neurons are also abundant in three cranial parasympathetic ganglia, the otic, sphenopalatine, and ciliary, in the rat measured by radioimmunoassay. High-performance liquid chromatographic analysis of the immunoreactive material present in the otic ganglion indicates that this material is very similar to porcine NPY and indistinguishable from the NPY-like immunoreactivity present in rat sympathetic neurons. These findings raise the possibility that NPY acts as a neuromodulator in the parasympathetic as well as the sympathetic nervous system. In contrast to what had been observed for sympathetic neurons, NPY-immunoreactive neurons in cranial parasympathetic ganglia do not contain detectable catecholamines or tyrosine hydroxylase immunoreactivity, and many do contain immunoreactivity for vasoactive intestinal peptide and/or choline acetyltransferase. These findings suggest that there is no simple rule governing coexpression of NPY with norepinephrine, acetylcholine, or vasoactive intestinal peptide in autonomic neurons. Further, while functional studies have indicated that NPY exerts actions on the peripheral vasculature which are antagonistic to those of acetylcholine and vasoactive intestinal peptide, the present results raise the possibility that these three substances may have complementary effects on other target tissues.

  3. Enteral peptide formulas inhibit radiation induced enteritis and apoptosis in intestinal epithelial cells and suppress the expression and function of Alzheimer's and cell division control gene products

    SciTech Connect

    Cope, F.O. ); Issinger, O.G. ); McArdle, A.H. ); Shapiro, J.; Tomei, L.D. )

    1991-03-15

    Studies have shown that patients receiving enteral peptide formulas prior to irradiation have a significantly reduced incidence of enteritis and express a profound increase in intestinal cellularity. Two conceptual approaches were taken to describe this response. First was the evaluation in changes in programmed intestinal cell death and secondly the evaluation of a gene product controlling cell division cycling. This study provided a relationship between the ratio of cell death to cell formulations. The results indicate that in the canine and murine models, irradiation induces expression of the Alzheimer's gene in intestinal crypt cells, while the incidence of apoptosis in apical cells is significantly increased. The use of peptide enteral formulations suppresses the expression of the Alzheimer's gene in crypt cells, while apoptosis is eliminated in the apical cells of the intestine. Concomitantly, enteral peptide formulations suppress the function of the CK-II gene product in the basal and baso-lateral cells of the intestine. These data indicate that although the mitotic index is significantly reduced in enterocytes, this phenomenon alone is not sufficient to account for the peptide-induced radio-resistance of the intestine. The data also indicate a significant reduction of normal apoptosis in the upper lateral and apical cells of the intestinal villi. Thus, the ratio of cell death to cell replacement is significantly decreased resulting in an increase in villus height and hypertrophy of the apical villus cells. Thus, peptide solutions should be considered as an adjunct treatment both in radio- and chemotherapy.

  4. Effect of Glucagon-Like Peptide 2 on Hepatic, Renal, and Intestinal Disposition of 1-Chloro-2,4-dinitrobenzene

    PubMed Central

    Villanueva, Silvina S. M.; Perdomo, Virginia G.; Ruiz, María L.; Rigalli, Juan P.; Arias, Agostina; Luquita, Marcelo G.; Vore, Mary; Catania, Viviana A.

    2012-01-01

    The ability of the liver, small intestine, and kidney to synthesize and subsequently eliminate dinitrophenyl-S-glutathione (DNP-SG), a substrate for multidrug resistance-associated protein 2 (Mrp2), was assessed in rats treated with glucagon-like peptide 2 (GLP-2, 12 μg/100 g b.wt. s.c. every 12 h for 5 consecutive days). An in vivo perfused jejunum model with simultaneous bile and urine collection was used. A single intravenous dose of 30 μmol/kg b.wt. 1-chloro-2,4-dinitrobenzene (CDNB) was administered, and its conjugate, DNP-SG, and dinitrophenyl cysteinyl glycine (DNP-CG), resulting from the action of γ-glutamyltransferase on DNP-SG, were determined in bile, intestinal perfusate, and urine by high-performance liquid chromatography. Tissue content of DNP-SG was also assessed in liver, intestine, and kidneys. Biliary excretion of DNP-SG+DNP-CG was decreased in GLP-2 rats with respect to controls. In contrast, their intestinal excretion was substantially increased, whereas urinary elimination was not affected. Western blot and real-time polymerase chain reaction studies revealed preserved levels of Mrp2 protein and mRNA in liver and renal cortex and a significant increase in intestine in response to GLP-2 treatment. Tissue content of DNP-SG detected 5 min after CDNB administration was decreased in liver, increased in intestine, and unchanged in kidney in GLP-2 versus control group, consistent with GLP-2-induced down-regulation of expression of glutathione transferase (GST) Mu in liver and up-regulation of GST-Alpha in intestine at both protein and mRNA levels. In conclusion, GLP-2 induced selective changes in hepatic and intestinal disposition of a common GST and Mrp2 substrate administered systemically that could be of pharmacological or toxicological relevance under therapeutic treatment conditions. PMID:22453052

  5. Effects of vasoactive intestinal peptide on vascular conductance are unaffected by anesthesia

    SciTech Connect

    Bouder, T.G.; Huffman, L.J.; Hedge, G.A. )

    1988-12-01

    In rats anesthetized with ketamine and pentobarbital (KET/PB), vasoactive intestinal peptide (VIP) increases vascular conductance (VC) in the salivary gland, pancreas, and thyroid gland, whereas no changes in VC are observed in a number of other organs. Because anesthesia may alter the responsiveness of physiological systems, we compared the effects of VIP on organ VC in conscious or anesthetized rats. Chronically catheterized rats were studied in the conscious state or 30 min after induction of anesthesia with KET/PB, isoflurane, or Inactin. Blood flows were measured by the reference sample version of the radioactive microsphere (MS) technique using two MS injections ({sup 141}Ce-MS/{sup 85}Sr-MS). Mean arterial blood pressure was monitored and used in the calculation of VC. Organ VCs were similar under basal conditions in conscious and anesthetized rats. VIP infusion caused systemic hypotension and increased VCs in the salivary gland, pancreas, and thyroid gland, and these responses were largely unaffected by anesthesia. These results indicate that the anesthetics used do not alter basal VC or the responsiveness of the vasculature to exogenous VIP.

  6. Distribution of hypothalamic vasoactive intestinal peptide immunoreactive neurons in the male native Thai chicken.

    PubMed

    Kamkrathok, Boonyarit; Sartsoongnoen, Natagarn; Prakobsaeng, Nattiya; Rozenboim, Israel; Porter, Tom E; Chaiseha, Yupaporn

    2016-08-01

    Avian prolactin (PRL) secretion is under stimulatory control by the PRL-releasing factor (PRF), vasoactive intestinal peptide (VIP). The neuroendocrine regulation of the avian reproductive system has been extensively studied in females. However, there are limited data in males. The aim of this study was to elucidate the VIPergic system and its relationship to PRL and testosterone (T) in the male native Thai chicken. The distributions of VIP-immunoreactive (-ir) neurons and fibers were determined by immunohistochemistry. Changes in VIP-ir neurons within the nucleus inferioris hypothalami (IH) and nucleus infundibuli hypothalami (IN) areas were compared across the reproductive stages. Plasma levels of PRL and T were determined by enzyme-linked immunosorbent assay and then compared across the reproductive stages. The results revealed that the highest accumulations of VIP-ir neurons were concentrated only within the IH-IN, and VIP-ir neurons were not detected within other hypothalamic nuclei. Within the IH-IN, VIP-ir neurons were low in premature and aging males and markedly increased in mature males. Changes in VIP-ir neurons within the IH-IN were directly mirrored with changes in PRL and T levels across the reproductive stages. These results suggested that VIP neurons in the IH-IN play a regulatory role in year-round reproductive activity in males. The present study also provides additional evidence that VIP is the PRF in non-seasonal, continuously breeding equatorial species.

  7. Acute effects of the glucagon-like peptide 2 analogue, teduglutide, on intestinal adaptation in short bowel syndrome.

    PubMed

    Thymann, Thomas; Stoll, Barbara; Mecklenburg, Lars; Burrin, Douglas G; Vegge, Andreas; Qvist, Niels; Eriksen, Thomas; Jeppesen, Palle B; Sangild, Per T

    2014-06-01

    Neonatal short bowel syndrome following massive gut resection is associated with malabsorption of nutrients. The intestinotrophic factor glucagon-like peptide 2 (GLP-2) improves gut function in adult patients with short bowel syndrome, but its effect in pediatric patients remains unknown. Our objective was to test the efficacy of the long-acting synthetic human GLP-2 analogue, teduglutide (ALX-0600), in a neonatal piglet jejunostomy model. Two-day-old pigs were subjected to resection of 50% of the small intestine (distal part), and the remnant intestine was exteriorized on the abdominal wall as a jejunostomy. All pigs were given total parenteral nutrition for 7 days and a single daily injection of the following doses of teduglutide: 0.01 (n = 6), 0.02 (n = 6), 0.1 (n = 5), or 0.2 mg · kg · day (n = 6), and compared with placebo (n = 9). Body weight increment was similar for all 4 teduglutide groups but higher than placebo (P < 0.05). There was a dose-dependent increase in weight per length of the remnant intestine (P < 0.01) and fractional protein synthesis rate in the intestine was increased in the 0.2 mg · kg · day group versus placebo (P < 0.001); however, functional and structural endpoints including activity of digestive enzymes, absorption of enteral nutrients, and immunohistochemistry (Ki67, villin, FABP2, ChgA, and GLP-2R) were not affected by the treatment. Teduglutide induces trophicity on the remnant intestine but has limited acute effects on functional endpoints. Significant effects of teduglutide on gut function may require a longer adaptation period and/or a more frequent administration of the peptide. In perspective, GLP-2 or its analogues may be relevant to improve intestinal adaptation in pediatric patients with short bowel syndrome.

  8. Feed Withdrawal and Transport Interactions with Intestinal and Peripheral Immunity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Multiple stressors associated with transporting finishing pigs to slaughter can result in increased shedding of pathogens. Previously we found feed withdrawal by itself or followed by transportation increased Salmonella concentrations in ileal contents. However, no difference was found among treatm...

  9. Fatty acid transport protein 4 is dispensable for intestinal lipid absorption in mice.

    PubMed

    Shim, Jien; Moulson, Casey L; Newberry, Elizabeth P; Lin, Meei-Hua; Xie, Yan; Kennedy, Susan M; Miner, Jeffrey H; Davidson, Nicholas O

    2009-03-01

    FA transport protein 4 (FATP4), one member of a multigene family of FA transporters, was proposed as a major FA transporter in intestinal lipid absorption. Due to the fact that Fatp4(-/-) mice die because of a perinatal skin defect, we rescued the skin phenotype using an FATP4 transgene driven by a keratinocyte-specific promoter (Fatp4(-/-);Ivl-Fatp4(tg/+) mice) to elucidate the role of intestinal FATP4 in dietary lipid absorption. Fatp4(-/-);Ivl-Fatp4(tg/+) mice and wild-type littermates displayed indistinguishable food consumption, growth, and weight gain on either low or high fat (Western) diets, with no differences in intestinal triglyceride (TG) absorption or fecal fat losses. Cholesterol absorption and intestinal TG absorption kinetics were indistinguishable between the genotypes, although Western diet fed Fatp4(-/-);Ivl-Fatp4(tg/+) mice showed a significant increase in enterocyte TG and FA content. There was no compensatory upregulation of other FATP family members or any other FA or cholesterol transporters in Fatp4(-/-);Ivl-Fatp4(tg/+) mice. Furthermore, although serum cholesterol levels were lower in Fatp4(-/-);Ivl-Fatp4(tg/+) mice, there was no difference in hepatic VLDL secretion in-vivo or in hepatic lipid content on either a chow or Western diet. Taken together, our studies find no evidence for a physiological role of intestinal FATP4 in dietary lipid absorption in mice.

  10. In vitro study of transporters involved in intestinal absorption of inorganic arsenic.

    PubMed

    Calatayud, Marta; Barrios, Julio A; Vélez, Dinoraz; Devesa, Vicenta

    2012-02-20

    Inorganic arsenic (iAs) [As(III)+As(V)] is a drinking water contaminant, and human exposure to these arsenic species has been linked with a wide range of health effects. The main path of exposure is the oral route, and the intestinal epithelium is the first physiological barrier that iAs must cross in order to be absorbed. However, there is a lack of information about intestinal iAs absorption. The aim of this study was to evaluate the participation of certain transporters [glucose transporters (GLUT and SGLT), organic anion transporting polypeptides (OATPs), aquaporins (AQPs), and phosphate transporters (NaPi and PiT)] in intestinal absorption of As(V) and As(III), using the Caco-2 cell line as a model of the intestinal epithelium. For this purpose, the effects of chemical inhibition and gene silencing of the transporters of interest on iAs uptake were evaluated, and also the differential expression of these transporters after treatment with iAs. The results show that chemical inhibition using rifamycin SV (OATP inhibitor), phloridzin (SGLT inhibitor), phloretin (GLUT and AQP inhibitor), and copper sulfate (AQP inhibitor) leads to a significant reduction in the apparent permeability and cellular retention of As(III). RT-qPCR indicates up-regulation of GLUT2, GLUT5, OATPB, AQP3, and AQP10 after exposure to As(III), while exposure to As(V) increases the expression of sodium-dependent phosphate transporters, especially NaPiIIb. Gene silencing of OATPB, AQP10, and GLUT5 for As(III) and NaPiIIb for As(V) significantly reduces uptake of the inorganic forms. These results indicate that these transporters may be involved in intestinal absorption of iAs.

  11. Peptides actively transported across the tympanic membrane: Functional and structural properties

    PubMed Central

    Kurabi, Arwa; Beasley, Kerry A.; Chang, Lisa; McCann, James; Pak, Kwang; Ryan, Allen F.

    2017-01-01

    Otitis media (OM) is the most common infectious disease of children under six, causing more antibiotic prescriptions and surgical procedures than any other pediatric condition. By screening a bacteriophage (phage) library genetically engineered to express random peptides on their surfaces, we discovered unique peptides that actively transport phage particles across the intact tympanic membrane (TM) and into the middle ear (ME). Herein our goals were to characterize the physiochemical peptide features that may underlie trans-TM phage transport; assess morphological and functional effects of phage peptides on the ME and inner ear (IE); and determine whether peptide-bearing phage transmigrate from the ME into the IE. Incubation of five peptide-bearing phage on the TM for over 4hrs resulted in demonstrably superior transport of one peptide, in level and in exponential increase over time. This suggests a preferred peptide motif for TM active transport. Functional and structural comparisons revealed unique features of this peptide: These include a central lysine residue, isoelectric point of 0.0 at physiological pH and a hydrophobic C-terminus. When the optimal peptide was applied to the TM independent of phage, similar transport was observed, indicating that integration into phage is not required. When 109 particles of the four different trans-TM phage were applied directly into the ME, no morphological effects were detected in the ME or IE when compared to saline or wild-type (WT) phage controls. Comparable, reversible hearing loss was observed for saline controls, WT phage and trans-TM peptide phage, suggesting a mild conductive hearing loss due to ME fluid. Perilymph titers after ME incubation established that few copies of trans-TM peptide phage crossed into the IE. The results suggest that, within the parameters tested, trans-TM peptides are safe and could be used as potential agents for noninvasive delivery of drugs, particles and gene therapy vectors to the ME

  12. Intestinal Serotonin Transporter Inhibition by Toll-Like Receptor 2 Activation. A Feedback Modulation

    PubMed Central

    Layunta, Elena; Grasa, Laura; Castro, Marta; Pardo, Julián; Gomollón, Fernando; Mesonero, José E.

    2016-01-01

    TLR2 is a microbiota recognition receptor that has been described to contribute to intestinal homeostasis and to ameliorate inflammatory intestinal injury. In this context, serotonin (5-HT) has shown to be an essential intestinal physiological neuromodulator that is also involved in intestinal inflammatory diseases. Since the interaction between TLR2 activation and the intestinal serotoninergic system remains non-investigated, our main aim was to analyze the effect of TLR2 on intestinal serotonin transporter (SERT) activity and expression and the intracellular pathways involved. Caco-2/TC7 cells were used to analyze SERT and TLR2 molecular expression and SERT activity by measuring 5-HT uptake. The results showed that apical TLR2 activation inhibits SERT activity in Caco-2/TC7 cells mainly by reducing SERT protein level either in the plasma membrane, after short-term TLR2 activation or in both the plasma membrane and cell lysate, after long-term activation. cAMP/PKA pathway appears to mediate short-term inhibitory effect of TLR2 on SERT; however, p38 MAPK pathway has been shown to be involved in both short- and long-term TLR2 effect. Reciprocally, 5-HT long-term treatment yielded TLR2 down regulation in Caco-2/TC7 cells. Finally, results from in vivo showed an augmented intestinal SERT expression in mice Tlr2-/-, thus confirming our inhibitory effect of TLR2 on intestinal SERT in vitro. The present work infers that TLR2 may act in intestinal pathophysiology, not only by its inherent innate immune role, but also by regulating the intestinal serotoninergic system. PMID:28033388

  13. Intestinal Serotonin Transporter Inhibition by Toll-Like Receptor 2 Activation. A Feedback Modulation.

    PubMed

    Latorre, Eva; Layunta, Elena; Grasa, Laura; Castro, Marta; Pardo, Julián; Gomollón, Fernando; Alcalde, Ana I; Mesonero, José E

    2016-01-01

    TLR2 is a microbiota recognition receptor that has been described to contribute to intestinal homeostasis and to ameliorate inflammatory intestinal injury. In this context, serotonin (5-HT) has shown to be an essential intestinal physiological neuromodulator that is also involved in intestinal inflammatory diseases. Since the interaction between TLR2 activation and the intestinal serotoninergic system remains non-investigated, our main aim was to analyze the effect of TLR2 on intestinal serotonin transporter (SERT) activity and expression and the intracellular pathways involved. Caco-2/TC7 cells were used to analyze SERT and TLR2 molecular expression and SERT activity by measuring 5-HT uptake. The results showed that apical TLR2 activation inhibits SERT activity in Caco-2/TC7 cells mainly by reducing SERT protein level either in the plasma membrane, after short-term TLR2 activation or in both the plasma membrane and cell lysate, after long-term activation. cAMP/PKA pathway appears to mediate short-term inhibitory effect of TLR2 on SERT; however, p38 MAPK pathway has been shown to be involved in both short- and long-term TLR2 effect. Reciprocally, 5-HT long-term treatment yielded TLR2 down regulation in Caco-2/TC7 cells. Finally, results from in vivo showed an augmented intestinal SERT expression in mice Tlr2-/-, thus confirming our inhibitory effect of TLR2 on intestinal SERT in vitro. The present work infers that TLR2 may act in intestinal pathophysiology, not only by its inherent innate immune role, but also by regulating the intestinal serotoninergic system.

  14. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )

    1990-05-01

    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  15. Effects of phorbol esters on fluid transport and blood flow in the small intestine

    SciTech Connect

    Sjoeqvist, A.; Henderson, L.S.; Fondacaro, J.D.

    1986-07-01

    Studies were designed to examine the effects of phorbol esters on intestinal fluid transport and blood flow in the anesthetized cat and enteropooling in the conscious rat. Intraluminal administration of phorbol ester into a segment of isolated small bowel produced a copious intestinal secretion and a concomitant mesenteric hyperemia in the cat. Net fluid movement in the intestine was converted from absorption in the control state to secretion following phorbol ester administration. Intravenous atropine reduced the phorbol ester-induced secretion by 56%; clonidine abolished the remaining secretory response. In the rat, intragastric administration of phorbol ester produced enteropooling comparable to that of other potent intestinal secretagogues. Since phorbol esters are known to activate protein kinase C, these suggest that activation of protein kinase C in the small intestine may lead to a full secretory response. The evidence suggests that this secretion is accompanied by a metabolic hyperemia. These results suggest that protein kinase C plays an important role in the regulation of intestinal fluid transport.

  16. A pilot study examining the relationship among Crohn disease activity, glucagon-like peptide-2 signalling and intestinal function in pediatric patients

    PubMed Central

    Sigalet, David L; Kravarusic, Dragan; Butzner, Decker; Hartmann, Bolette; Holst, Jens J; Meddings, Jon

    2013-01-01

    BACKGROUND/OBJECTIVES: The relationship between the enteroendocrine hormone glucagon-like peptide 2 (GLP-2) and intestinal inflammation is unclear. GLP-2 promotes mucosal growth, decreases permeability and reduces inflammation in the intestine; physiological stimulation of GLP-2 release is triggered by nutrient contact. The authors hypothesized that ileal Crohn disease (CD) affects GLP-2 release. METHODS: With ethics board approval, pediatric patients hospitalized with CD were studied; controls were recruited from local schools. Inclusion criteria were endoscopy-confirmed CD (primarily of the small intestine) with a disease activity index >150. Fasting and post-prandial GLP-2 levels and quantitative urinary recovery of orally administered 3-O-methyl-glucose (active transport) and lactulose/mannitol (passive) were quantified during the acute and remission phases. RESULTS: Seven patients (mean [± SD] age 15.3±1.3 years) and 10 controls (10.3±1.6 years) were studied. In patients with active disease, fasting levels of GLP-2 remained stable but postprandial levels were reduced. Patients with active disease exhibited reduced glucose absorption and increased lactulose/mannitol recovery; all normalized with disease remission. The change in the lactulose/mannitol ratio was due to both reduced lactulose and increased mannitol absorption. CONCLUSIONS: These findings suggest that pediatric patients with acute ileal CD have decreased postprandial GLP-2 release, reduced glucose absorption and increased intestinal permeability. Healing of CD resulted in normalization of postprandial GLP-2 release and mucosal functioning (nutrient absorption and permeability), the latter due to an increase in mucosal surface area. These findings have implications for the use of GLP-2 and feeding strategies as a therapy in CD patients; further studies of the effects of inflammation and the GLP-2 axis are recommended. PMID:24106731

  17. Glucagon-Like Peptide-2 Regulates Release of Chylomicrons From the Intestine

    PubMed Central

    Dash, Satya; Xiao, Changting; Morgantini, Cecilia; Connelly, Philip W.; Patterson, Bruce W.; Lewis, Gary F.

    2015-01-01

    BACKGROUND & AIMS The intestine efficiently incorporates and rapidly secretes dietary fat as chylomicrons (lipoprotein particles comprising triglycerides, phospholipids, cholesterol, and proteins) that contain the apolipoprotein isoform apoB-48. The gut can store lipids for many hours after their ingestion, and release them in chylomicrons in response to oral glucose, sham feeding, or unidentified stimuli. The gut hormone glucagon-like peptide-2 (GLP-2) facilitates intestinal absorption of lipids, but its role in chylomicron secretion in human beings is unknown. METHODS We performed a randomized, single-blind, cross-over study, with 2 study visits 4 weeks apart, to assess the effects of GLP-2 administration on triglyceride-rich lipoprotein (TRL) apoB-48 in 6 healthy men compared with placebo. Subjects underwent constant intraduodenal feeding, with a pancreatic clamp and primed constant infusion of deuterated leucine. In a separate randomized, single-blind, cross-over validation study, 6 additional healthy men ingested a high-fat meal containing retinyl palmitate and were given either GLP-2 or placebo 7 hours later with measurement of TRL triglyceride, TRL retinyl palmitate, and TRL apoB-48 levels. RESULTS GLP-2 administration resulted in a rapid (within 30 minutes) and transient increase in the concentration of TRL apoB-48, compared with placebo (P = .03). Mathematic modeling of stable isotope enrichment and the mass of the TRL apoB-48 suggested that the increase resulted from the release of stored, presynthesized apoB-48 from the gut. In the validation study, administration of GLP-2 at 7 hours after the meal, in the absence of additional food intake, robustly increased levels of TRL triglycerides (P = .007), TRL retinyl palmitate (P = .002), and TRL apoB-48 (P = .04) compared with placebo. CONCLUSIONS Administration of GLP-2 to men causes the release of chylomicrons that comprise previously synthesized and stored apoB-48 and lipids. This transiently increases TRL

  18. Adaptation of intestinal nutrient transport in health and disease. Part I.

    PubMed

    Thomson, A B; Wild, G

    1997-03-01

    Why is it important to understand the mechanisms controlling intestinal adaptation? There are two major answers to this question. Firstly, in establishing the cellular and molecular events associated with intestinal adaptation, we will formulate a general framework that may be applied to the understanding of adaptation of other cell membranes. For example, alterations in the synthesis of glucose carriers and their subsequent insertion into membranes may alter sugar entry across the intestinal brush border membrane (BBM) using the sodium-dependent D-glucose transporter, SGLT1, or the BBM sodium-independent facultative fructose transporter, GLUT5, and may alter facilitated sugar exit across the basolateral membrane (BLM) using GLUT2. The precise role of transcriptional and translational processes in the up- or down-regulation of sugar transport requires further definition. Alterations in enterocyte microsomal lipid metabolic enzyme expression occurring during the course of intestinal adaptation will direct the synthesis of lipids destined for trafficking to the BBM and BLM domains of the enterocyte. This will subsequently alter the passive permeability properties of these membranes and ultimately influence lipid absorption. Therefore, establishing the physiological, cellular and molecular mechanisms of adaptation in the intestine will define principles that may be applied to other epithelia. Secondly, enterocyte membrane adaptation is subject to dietary modification, and these may be exploited as a means to enhance a beneficial or to reduce a detrimental aspect of the intestinal adaptive process in disease states. Alterations in membrane function occur in association with changes in dietary lipids, and these are observed in a variety of cells and tissues including lymphocytes, testes, liver, adipocytes, nerve tissue, nuclear envelope and mitochondria. Therefore, the elucidation of the mechanisms of intestinal adaptation and the manner whereby dietary manipulation

  19. Protein abundance of clinically relevant multidrug transporters along the entire length of the human intestine.

    PubMed

    Drozdzik, Marek; Gröer, Christian; Penski, Jette; Lapczuk, Joanna; Ostrowski, Marek; Lai, Yurong; Prasad, Bhagwat; Unadkat, Jashvant D; Siegmund, Werner; Oswald, Stefan

    2014-10-06

    Intestinal transporters are crucial determinants in the oral absorption of many drugs. We therefore studied the mRNA expression (N = 33) and absolute protein content (N = 10) of clinically relevant transporters in healthy epithelium of the duodenum, the proximal and distal jejunum and ileum, and the ascending, transversal, descending, and sigmoidal colon of six organ donors (24-54 years). In the small intestine, the abundance of nearly all studied proteins ranged between 0.2 and 1.6 pmol/mg with the exception of those of OCT3 (<0.1 pmol/mg) and PEPT1 (2.6-4.9 pmol/mg) that accounted for ∼50% of all measured transporters. OATP1A2 was not detected in any intestinal segment. ABCB1, ABCG2, PEPT1, and ASBT were significantly more abundant in jejunum and ileum than in colon. In contrast to this, the level of expression of ABCC2, ABCC3, and OCT3 was found to be highest in colon. Site-dependent differences in the levels of gene and protein expression were observed for ABCB1 and ASBT. Significant correlations between mRNA and protein levels have been found for ABCG2, ASBT, OCT3, and PEPT1 in the small intestine. Our data provide further physiological pieces of the puzzle required to predict intestinal drug absorption in humans.

  20. Aboral changes in D-glucose transport by human intestinal brush-border membrane vesicles.

    PubMed Central

    Bluett, M K; Abumrad, N N; Arab, N; Ghishan, F K

    1986-01-01

    D-Glucose transport was investigated in isolated brush-border membrane vesicles from human small intestine. Characteristics of D-glucose transport from the jejunum were compared with that in the mid and terminal ileum. Jejunal and mid-ileal D-glucose transport was Na+-dependent and electrogenic. The transient overshoot of jejunal D-glucose transport was significantly greater than corresponding values in mid-ileum. The terminal ileum did not exhibit Na+-dependent D-glucose transport, but did exhibit Na+-dependent taurocholate transport. Na+-glucose co-transport activity as measured by tracer-exchange experiments was greatest in the jejunum, and diminished aborally. We conclude that D-glucose transport in man is Na+-dependent and electrogenic in the proximal intestine and directly related to the activity of D-glucose-Na+ transporters present in the brush-border membranes. D-Glucose transport in the terminal ileum resembles colonic transport of D-glucose. PMID:3800877

  1. Chemical form of selenium affects its uptake, transport and glutathione peroxidase activity in the human intestinal Caco-2 cell model

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Determining the effect of selenium (Se) chemical form on uptake and transport in human intestinal cells is critical to assess Se bioavailability. In the present study, we measured the uptake and transport of various Se compounds in the human intestinal Caco-2 cell model. We found that two sources...

  2. Crystal Structures of the Extracellular Domain from PepT1 and PepT2 Provide Novel Insights into Mammalian Peptide Transport.

    PubMed

    Beale, John H; Parker, Joanne L; Samsudin, Firdaus; Barrett, Anne L; Senan, Anish; Bird, Louise E; Scott, David; Owens, Raymond J; Sansom, Mark S P; Tucker, Stephen J; Meredith, David; Fowler, Philip W; Newstead, Simon

    2015-10-06

    Mammals obtain nitrogen via the uptake of di- and tri-peptides in the gastrointestinal tract through the action of PepT1 and PepT2, which are members of the POT family of proton-coupled oligopeptide transporters. PepT1 and PepT2 also play an important role in drug transport in the human body. Recent crystal structures of bacterial homologs revealed a conserved peptide-binding site and mechanism of transport. However, a key structural difference exists between bacterial and mammalian homologs with only the latter containing a large extracellular domain, the function of which is currently unknown. Here, we present the crystal structure of the extracellular domain from both PepT1 and PepT2 that reveal two immunoglobulin-like folds connected in tandem, providing structural insight into mammalian peptide transport. Functional and biophysical studies demonstrate that these domains interact with the intestinal protease trypsin, suggesting a role in clustering proteolytic activity to the site of peptide transport in eukaryotic cells.

  3. Effect of vasoactive intestinal peptide on the wound healing of alkali-burned corneas

    PubMed Central

    Tuncel, Nese; Yildirim, Nilgun; Gurer, Firdevs; Basmak, Hikmet; Uzuner, Kubilay; Sahinturk, Varol; Gursoy, Huseyin

    2016-01-01

    AIM To study the effect of vasoactive intestinal peptide (VIP) on wound healing in experimental alkali burns of the cornea. METHODS Twenty-seven albino rabbits, weighing 3.2±0.75 kg were used. Alkali burns were induced on corneas by applying 10 mm Whatman paper No:50 soaked in 1 mol/L NaOH. They have further classified into 5 groups as follows: 1) control group given no treatment (n=5); 2) VIP given subconjunctivally (n=6); 3) VIP injected into anterior chamber (n=6); 4) NaCl 0.9% given subconjunctivally (n=5); 5) NaCl 0.9% given into the anterior chamber (n=5). All treatment protocols except control group were followed by topical eye drops composed of VIP at two hourly intervals for one week from 8 a.m. to 6 p.m. RESULTS VIP treated groups of rabbits with alkali burns were found to have better wound healing findings histo-pathologically when compared to those of control group who have received no treatment on day 30. No differences were observed between groups in respect to degree of polymorphonuclear leukocytes (PMNL) infiltration and degree of loss of amorphous substrate on day 15. However, PMNL infiltration and degree of loss of amorphous substrate were lower in Groups 2 and 3 when compared to that of control group on day 30 (P<0.05). CONCLUSION We have shown that VIP has positive effects on alkali induced corneal burns. VIP may inhibit PMNL migration to cornea through an immunomodulatory effect. Inhibition of PMNL migration might reduce the release of collagenases and this might prevent the extracellular amorphous substance loss. PMID:26949636

  4. Modulation of Corpus Striatal Neurochemistry by Astrocytes and Vasoactive Intestinal Peptide (VIP) in Parkinsonian Rats.

    PubMed

    Yelkenli, İbrahim Halil; Ulupinar, Emel; Korkmaz, Orhan Tansel; Şener, Erol; Kuş, Gökhan; Filiz, Zeynep; Tunçel, Neşe

    2016-06-01

    The neurotoxin 6-hydroxydopamine (6-OHDA) is widely used in animal models of Parkinson's disease. In various neurodegenerative diseases, astrocytes play direct, active, and critical roles in mediating neuronal survival and functions. Vasoactive intestinal peptide (VIP) has neurotrophic actions and modulates a number of astrocytic activities. In this study, the effects of VIP on the striatal neurochemistry were investigated in parkinsonian rats. Adult Sprague-Dawley rats were divided into sham-operated, unilaterally 6-OHDA-lesioned, and lesioned + VIP-administered (25 ng/kg i.p.) groups. VIP was first injected 1 h after the intrastriatal 6-OHDA microinjection and then every 2 days throughout 15 days. Extracellular striatal concentration of glutathione (GSH), gamma-aminobutyric acid (GABA), glutamate (GLU), and lactate were measured in microdialysates by high-performance liquid chromatography (HPLC). Quantification of GABA and activity dependent neuroprotective protein (ADNP)-expressing cells were determined by glutamic acid decarboxylase (GAD)/ADNP + glial fibrillary acidic protein (GFAP) double immunohistochemistry. Our results demonstrated that a 6-OHDA lesion significantly increased the density of astrocytes in the striatum and VIP treatment slightly reduced the gliosis. Extracellular concentration of GABA, GLU, and lactate levels did not change, but GSH level significantly increased in the striatum of parkinsonian rats. VIP treatment reduced GSH level comparable to sham-operated groups, but enhanced GABA and GLU levels. Our double labeling results showed that VIP primarily acts on neurons to increase ADNP and GAD expression for protection. These results suggest that, in the 6-OHDA-induced neurodegeneration model, astrocytes were possibly activated for forefront defensiveness by modulating striatal neurochemistry.

  5. Serum Levels of Vasoactive Intestinal Peptide as a Prognostic Marker in Early Arthritis

    PubMed Central

    Martínez, Carmen; Ortiz, Ana M.; Juarranz, Yasmina; Lamana, Amalia; Seoane, Iria V.; Leceta, Javier; García-Vicuña, Rosario

    2014-01-01

    Objective Suitable biomarkers are essential for the design of therapeutic strategies in personalized medicine. Vasoactive intestinal peptide (VIP) has demonstrated immunomodulatory properties in autoimmune murine and ex vivo human models. Our aim was to study serum levels of VIP during the follow-up of an early arthritis (EA) cohort and to analyze its value as a biomarker predicting severity and therapeutic requirements. Methods Data from 91 patients on an EA register were analyzed (76% rheumatoid arthritis (RA), 24% undifferentiated arthritis, 73% women, and median age 54 years; median disease duration at entry, 5.4 months). We collected per protocol sociodemographic, clinical, and therapeutic data. VIP levels were determined by enzyme immunoassay in sera harvested from the 91 patients (353 visits; 3.9 visit/patient) and from 100 healthy controls. VIP values below the 25th percentile of those assessed in healthy population were considered low. To determine the effect of independent variables on VIP levels, we performed a longitudinal multivariate analysis nested by patient and visit. A multivariate ordered logistic regression was modeled to determine the effect of low VIP serum levels on disease activity at the end of follow-up. Results VIP concentrations varied considerably across EA patients. Those fulfilling the criteria for RA had the lowest values in the whole sample, although no significant differences were observed compared with healthy donors. Disease activity, which was assessed using DAS28, inversely correlated with VIP levels. After a two-year follow-up, those patients with low baseline levels of VIP displayed higher disease activity and received more intensive treatment. Conclusion Patients who are unable to up-regulate VIP seem to have a worse clinical course despite receiving more intense treatment. Therefore, measurement of VIP levels may be suitable as a prognostic biomarker. PMID:24409325

  6. Corneal Endothelial Cell Integrity in Precut Human Donor Corneas Enhanced by Autocrine Vasoactive Intestinal Peptide

    PubMed Central

    Coll, Timothy; Gloria, Dante; Sprehe, Nicholas

    2017-01-01

    Purpose: To demonstrate that vasoactive intestinal peptide (VIP), a corneal endothelial (CE) cell autocrine factor, maintains the integrity of corneal endothelium in human donor corneoscleral explants precut for endothelial keratoplasty. Methods: Twelve paired human donor corneoscleral explants used as control versus VIP-treated explants (10 nM, 30 minutes, 37°C) were shipped (4°C) to the Lions Eye Institute for Transplantation and Research for precutting (Moria CBM-ALTK Keratome), shipped back to the laboratory, and cultured in ciliary neurotrophic factor (CNTF, 0.83 nM, 37°C, 24 hours). Trephined endothelial discs (8–8.5 mm) were analyzed for differentiation markers (N-cadherin, CNTF receptor α subunit [CNTFRα], and connexin 43) by Western blot after a quarter of the discs from 4 paired explants were cut away and stained with alizarin red S for microscopic damage analysis. Two additional paired explants (6 days in culture) were stained for panoramic view of central CE damage. Results: VIP treatment increased N-cadherin and CNTFRα levels (mean ± SEM) to 1.38 ± 0.11-fold (P = 0.003) and 1.46 ± 0.22-fold (P = 0.03) of paired controls, respectively, whereas CE cell CNTF responsiveness in upregulation of connexin 43 increased to 2.02 ± 0.5 (mean ± SEM)-fold of the controls (P = 0.04). CE damage decreased from (mean ± SEM) 10.0% ± 1.2% to 1.6% ± 0.3% (P < 0.0001) and 9.1% ± 1.1% to 2.4% ± 1.0% (P = 0.0006). After 6 days in culture, the damage in whole CE discs decreased from 20.0% (control) to 5.5% (VIP treated). Conclusions: VIP treatment before precut enhanced the preservation of corneal endothelium. PMID:28181929

  7. Roles of sphincter of Oddi motility and serum vasoactive intestinal peptide, gastrin and cholecystokinin octapeptide

    PubMed Central

    Zhang, Zhen-Hai; Qin, Cheng-Kun; Wu, Shuo-Dong; Xu, Jian; Cui, Xian-Ping; Wang, Zhi-Yi; Xian, Guo-Zhe

    2014-01-01

    AIM: To investigate roles of sphincter of Oddi (SO) motility played in pigment gallbladder stone formation in model of guinea pigs. METHODS: Thirty-four adult male Hartley guinea pigs were divided randomly into two groups: the control group and pigment stone group. The pigment stone group was divided into 4 subgroups with 6 guinea pigs each according to time of sacrifice, and were fed a pigment lithogenic diet and sacrificed after 3, 6, 9 and 12 wk. SO manometry and recording of myoelectric activity of the guinea pigs were obtained by multifunctional physiograph at each stage. Serum vasoactive intestinal peptide (VIP), gastrin and cholecystokinin octapeptide (CCK-8) were detected at each stage in the process of pigment gallbladder stone formation by enzyme-linked immunosorbent assay. RESULTS: The incidence of pigment gallstone formation was 0%, 0%, 16.7% and 66.7% in the 3-, 6-, 9- and 12-wk group, respectively. The frequency of myoelectric activity decreased in the 3-wk group. The amplitude of myoelectric activity had a tendency to decrease but not significantly. The frequency of the SO decreased significantly in the 9-wk group. The SO basal pressure and common bile duct pressure increased in the 12-wk group (25.19 ± 7.77 mmHg vs 40.56 ± 11.81 mmHg, 22.35 ± 7.60 mmHg vs 38.51 ± 11.57 mmHg, P < 0.05). Serum VIP was significantly elevated in the 6- and 12-wk groups and serum CCK-8 was decreased significantly in the 12-wk group. CONCLUSION: Pigment gallstone-causing diet may induce SO dysfunction. The tension of the SO increased. The disturbance in SO motility may play a role in pigment gallstone formation, and changes in serum VIP and CCK-8 may be important causes of SO dysfunction. PMID:24782626

  8. Correlation between electrophysiological phenomena and transport of macromolecules in intestinal epithelium.

    PubMed

    Groot, J A

    1998-01-01

    This review discuss some recent findings in the study of the regulation of the permeability of the intestinal epithelial layer. Comparison of electrical phenomena and transport of macromolecules suggests that secretory activity and increased transepithelial transport of macromolecules are related when secretion is mediated by the Ca2+ and PKC dependent pathways. The transport of the macromolecules is via the transcellular and via the paracellular route. The barrier function of the intestinal epithelium may be diminished during nervous (acetylcholine)- and immuno-(histamine) mediated secretion. It is hypothesised that some bacterial toxins may also induce Ca2+ and PKC dependent secretion and thereby can reduce the epithelial barrier. The cAMP and cGMP mediated secretion, which can be recognised by their long-lasting transepithelial potential changes, are not coupled to increased transepithelial transport of macromolecules. Some forms of secretory diarrhea may therefore be related to the development of food-allergy or inflammation.

  9. Newly identified PcToll4 regulates antimicrobial peptide expression in intestine of red swamp crayfish Procambarus clarkii.

    PubMed

    Huang, Ying; Li, Tingting; Jin, Min; Yin, Shaowu; Hui, Kai-Min; Ren, Qian

    2017-02-14

    Tolls or Toll-like receptors (TLRs) have an essential role in initiating innate immune responses against pathogens. In this study, a novel Toll gene, PcToll4, was first identified from the intestinal transcriptome of the freshwater crayfish, Procambarus clarkii. The PcToll4 cDNA is 4849bp long with a 3036bp open reading frame that encodes a 1011-amino acid protein. PcToll4 contains a signal peptide, 13 LRR domains, 3 LRR TYP domains, 2 LRR CT domains, an LRR NT domain, a transmembrane region, and a TIR domain. Quantitative RT-PCR analysis revealed that PcToll4 mRNA was detected in all tested tissues, and the expression of PcToll4 in the intestine was significantly upregulated after white spot syndrome virus (WSSV) challenge. Overexpression of PcToll4 in Drosophila Schneider 2 (S2) cells activates the antimicrobial peptides (AMPs) of Drosophila, including metchnikowin, drosomycin, attacin A, and shrimp Penaeidin-4. Results of RNA interference by siRNA also showed that PcToll4 regulates the expressions of 5 anti-lipopolysaccharide factors (ALFs) in the intestine of crayfish. Our findings suggest that PcToll4 is important for the innate immune responses of P. clarkii because this gene regulates the expressions of AMPs against WSSV.

  10. Reversible Opening of Intercellular Junctions of Intestinal Epithelial and Brain Endothelial Cells With Tight Junction Modulator Peptides.

    PubMed

    Bocsik, Alexandra; Walter, Fruzsina R; Gyebrovszki, Andrea; Fülöp, Lívia; Blasig, Ingolf; Dabrowski, Sebastian; Ötvös, Ferenc; Tóth, András; Rákhely, Gábor; Veszelka, Szilvia; Vastag, Monika; Szabó-Révész, Piroska; Deli, Mária A

    2016-02-01

    The intercellular junctions restrict the free passage of hydrophilic compounds through the paracellular clefts. Reversible opening of the tight junctions of biological barriers is investigated as one of the ways to increase drug delivery to the systemic circulation or the central nervous system. Six peptides, ADT-6, HAV-6, C-CPE, 7-mer (FDFWITP, PN-78), AT-1002, and PN-159, acting on different integral membrane and linker junctional proteins were tested on Caco-2 intestinal epithelial cell line and a coculture model of the blood-brain barrier. All peptides tested in nontoxic concentrations showed a reversible tight junctions modulating effect and were effective to open the paracellular pathway for the marker molecules fluorescein and albumin. The change in the structure of cell-cell junctions was verified by immunostaining for occludin, claudin-4,-5, ZO-1, β-catenin, and E-cadherin. Expression levels of occludin and claudins were measured in both models. We could demonstrate a selectivity of C-CPE, ADT-6, and HAV-6 peptides for epithelial cells and 7-mer and AT-1002 peptides for brain endothelial cells. PN-159 was the most effective modulator of junctional permeability in both models possibly acting via claudin-1 and -5. Our results indicate that these peptides can be effectively and selectively used as potential pharmaceutical excipients to improve drug delivery across biological barriers.

  11. Isolation and characterisation of a novel antibacterial peptide from a native swine intestinal tract-derived bacterium.

    PubMed

    Xin, Haiyun; Ji, Shengyue; Peng, Jiayin; Han, Peng; An, Xiaopeng; Wang, Shan; Cao, Binyun

    2017-02-27

    Antimicrobial peptides (AMPs) are highly associated with antipathogenic activity, without generating drug resistance in targeted bacteria. In this study, the existence of AMPs in the Tibetan swine, a China-native, cold-resistant and seldom-sick breed of pig, was investigated. A peptide secreted by a Tibetan swine intestinal tract-derived Bacillus strain was isolated using reversed-phase chromatography (RPC), ultrafiltration and reversed-phase high-performance liquid chromatography (RP-HPLC). The peptide was identified by mass spectrometry and was characterised for activity against Escherichia coli and Staphylococcus aureus. The 16-amino acid peptide (ASVVNKLTGGVAGLLK), named TP, had a molecular mass of 1568.919 Da and exhibited inhibitory activity against Gram-positive and Gram-negative bacteria [minimum inhibitory concentrations (MICs) of 2.5-5 µM and 10-20 µM for E. coli and S. aureus, respectively] as well as human MKN-45 and NB4 tumour cell lines [50% inhibitory concentration (IC50) = 4.686 µM and 11.479 µM, respectively]. TP also exhibited weak haemolytic activity. Furthermore, TP enhanced cell membrane permeability and K(+) outflow, bound with E. coli genomic DNA in vitro and inhibited E. coli growth. Thus, TP represents a strong candidate as an antibacterial peptide.

  12. Glucose Transport into Everted Sacs of the Small Intestine of Mice

    ERIC Educational Resources Information Center

    Hamilton, Kirk L.; Butt, A. Grant

    2013-01-01

    The Na[superscript +]-glucose cotransporter is a key transport protein that is responsible for absorbing Na[superscript +] and glucose from the luminal contents of the small intestine and reabsorption by the proximal straight tubule of the nephron. Robert K. Crane originally described the cellular model of absorption of Na[superscript +] and…

  13. Yeast culture supplement during nursing and transport affects immunity and intestinal microbial ecology of weanling pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weaning and transport stress can have a negative impact on the piglet's immune system and intestinal microbiota. The objective of this study was to determine the influence of a yeast product on innate immunity and microbial ecology of the gastrointestinal tract following stress of weaning and trans...

  14. Intestinal microbial affects of yeast products on weaned and transport stressed pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Study objectives were to determine effects of a commercially available yeast product (XPC, Diamond-V Mills) and stress of transportation on total Enterobacteriaceae, Escherichia coli, coliforms, and Lactobacilli populations in the intestine of weaning pigs. In a RCB design with a 2 x 2 factorial ar...

  15. Protein Restriction with Amino Acid-Balanced Diets Shrinks Circulating Pool Size of Amino Acid by Decreasing Expression of Specific Transporters in the Small Intestine

    PubMed Central

    Luo, Min; Zhang, Xin; Sun, Wen Juan; Jiao, Ning; Li, De Fa; Yin, Jing Dong

    2016-01-01

    Dietary protein restriction is not only beneficial to health and longevity in humans, but also protects against air pollution and minimizes feeding cost in livestock production. However, its impact on amino acid (AA) absorption and metabolism is not quite understood. Therefore, the study aimed to explore the effect of protein restriction on nitrogen balance, circulating AA pool size, and AA absorption using a pig model. In Exp.1, 72 gilts weighting 29.9 ± 1.5 kg were allocated to 1 of the 3 diets containing 14, 16, or 18% CP for a 28-d trial. Growth (n = 24), nitrogen balance (n = 6), and the expression of small intestinal AA and peptide transporters (n = 6) were evaluated. In Exp.2, 12 barrows weighting 22.7 ± 1.3 kg were surgically fitted with catheters in the portal and jejunal veins as well as the carotid artery and assigned to a diet containing 14 or 18% CP. A series of blood samples were collected before and after feeding for determining the pool size of circulating AA and AA absorption in the portal vein, respectively. Protein restriction did not sacrifice body weight gain and protein retention, since nitrogen digestibility was increased as dietary protein content reduced. However, the pool size of circulating AA except for lysine and threonine, and most AA flux through the portal vein were reduced in pigs fed the low protein diet. Meanwhile, the expression of peptide transporter 1 (PepT-1) was stimulated, but the expression of the neutral and cationic AA transporter systems was depressed. These results evidenced that protein restriction with essential AA-balanced diets, decreased AA absorption and reduced circulating AA pool size. Increased expression of small intestinal peptide transporter PepT-1 could not compensate for the depressed expression of jejunal AA transporters for AA absorption. PMID:27611307

  16. Intestinal cell targeting of a stable recombinant Cu-Zn SOD from Cucumis melo fused to a gliadin peptide.

    PubMed

    Intes, Laurent; Bahut, Muriel; Nicole, Pascal; Couvineau, Alain; Guette, Catherine; Calenda, Alphonse

    2012-05-31

    The mRNA encoding full length chloroplastic Cu-Zn SOD (superoxide dismutase) of Cucumis melo (Cantaloupe melon) was cloned. This sequence was then used to generate a mature recombinant SOD by deleting the first 64 codons expected to encode a chloroplastic peptide signal. A second hybrid SOD was created by inserting ten codons to encode a gliadin peptide at the N-terminal end of the mature SOD. Taking account of codon bias, both recombinant proteins were successfully expressed and produced in Escherichia coli. Both recombinant SODs display an enzymatic activity of ~5000U mg(-1) and were shown to be stable for at least 4h at 37°C in biological fluids mimicking the conditions of intestinal transit. These recombinant proteins were capable in vitro, albeit at different levels, of reducing ROS-induced-apoptosis of human epithelial cells. They also stimulated production and release in a time-dependent manner of an autologous SOD activity from cells located into jejunum biopsies. Nevertheless, the fused gliadin peptide enable the recombinant Cu-Zn SOD to maintain a sufficiently sustained interaction with the intestinal cells membrane in vivo rather than being eliminated with the flow. According to these observations, the new hybrid Cu-Zn SOD should show promise in applications for managing inflammatory bowel diseases.

  17. Sustained glucagon-like peptide-2 infusion is required for intestinal adaptation, and cessation reverses increased cellularity in rats with intestinal failure

    PubMed Central

    Koopmann, Matthew C.; Chen, Xueyan; Holst, Jens J.

    2010-01-01

    Glucagon-like peptide-2 (GLP-2) is a nutrient-dependent, proglucagon-derived hormone that is a proposed treatment for human short bowel syndrome (SBS). The objective was to determine how the timing, duration, and cessation of GLP-2 administration affect intestinal adaptation and enterocyte kinetics in a rat model of human SBS that results in intestinal failure requiring total parenteral nutrition (TPN). Rats underwent 60% jejunoileal resection plus cecectomy and jugular vein cannulation and were maintained exclusively with TPN for 18 days in these treatments: TPN control (no GLP-2); sustained GLP-2 (1–18 days); early GLP-2 (1–7 days, killed at 7 or 18 days); and delayed GLP-2 (12–18 days). Body weight gain was similar across groups, and plasma bioactive GLP-2 was significantly increased with coinfusion of GLP-2 (100 μg·kg−1·day−1) with TPN. GLP-2-treated rats showed significant increases in duodenum and jejunum mucosal dry mass, protein, DNA, and sucrase activity compared with TPN control. The increased jejunum cellularity reflected significantly decreased apoptosis and increased crypt mitosis and crypt fission due to GLP-2. When GLP-2 infusion stopped at 7 days, these effects were reversed at 18 days. Sustained GLP-2 infusion significantly increased duodenum length and decreased 18-day mortality to 0% from 37.5% deaths in TPN control (P = 0.08). Colon proglucagon expression quantified by real-time RT-qPCR was increased in TPN controls and attenuated by GLP-2 infusion; jejunal expression of the GLP-2 receptor did not differ among groups. In summary, early, sustained GLP-2 infusion reduces mortality, induces crypt fission, and is required for intestinal adaptation, whereas cessation of GLP-2 reverses gains in mucosal cellularity in a rat model of intestinal failure. PMID:20864657

  18. Region-Dependent Role of Cell-Penetrating Peptides in Insulin Absorption Across the Rat Small Intestinal Membrane.

    PubMed

    Khafagy, El-Sayed; Iwamae, Ruisha; Kamei, Noriyasu; Takeda-Morishita, Mariko

    2015-11-01

    We have reported that the cell-penetrating peptide (CPP) penetratin acts as a potential absorption enhancer in oral insulin delivery systems and that this action occurs through noncovalent intermolecular interactions. However, the region-dependent role of CPPs in intestinal insulin absorption has not been clarified. To identify the intestinal region where CPPs have the most effect in increasing insulin absorption, the region-dependent action of penetratin was investigated using in situ closed intestinal loops in rats. The order of the insulin area under the insulin concentration-time curve (AUC) increase effect by L-penetratin was ileum > jejunum > duodenum > colon. By contrast, the AUC order after coadministration of insulin with D-penetratin was colon > duodenum ≥ jejunum and ileum. We also compared the effects of the L- and D-forms of penetratin, R8, and PenetraMax on ileal insulin absorption. Along with the CPPs used in this study, L- and D-PenetraMax produced the largest insulin AUCs. An absorption study using ilea pretreated with CPPs showed that PenetraMax had no irreversible effect on the intestinal epithelial membrane. The degradation of insulin in the presence of CPPs was assessed in rat intestinal enzymatic fluid. The half-life (t 1/2) of insulin increased from 14.5 to 23.7 and 184.7 min in the presence of L- and D-PenetraMax, respectively. These enzymatic degradation-resistant effects might contribute partly to the increased ileal absorption of insulin induced by D-PenetraMax. In conclusion, this study demonstrated that the ability of the L- and D-forms of penetratin to increase intestinal insulin absorption was maximal in the ileum and the colon, respectively, and that D-PenetraMax is a powerful but transient enhancer of oral insulin absorption.

  19. Role of intestinal lymphatics in interstitial volume regulation and transmucosal water transport

    PubMed Central

    Kvietys, Peter R.; Granger, D. Neil

    2010-01-01

    Two of the principal functions of intestinal lymphatics are to assist in 1) maintaining interstitial volume within relatively normal limits during alterations in capillary filtration (e.g., acute portal hypertension) and 2) removal of absorbed water and chylomicrons. The contribution of lymphatics to the prevention of interstitial over-hydration or dehydration during alterations in transcapillary filtration is similar in the small intestine and colon. While the lymphatics of the small intestine contribute substantially to the removal of absorbed water (particularly at low and moderate absorption rates), the contribution of colonic lymphatics to the removal of the fluid absorbate is negligible. This difference is attributed to the relative caliber and location of lymphatics in the mucosal layer of the small and large intestines. In the small intestine, large lacteals lie in close proximity to transporting epithelium, while colonic lymph vessels are rather sparse and confined to the basal portion of the mucosa. In the small intestine, the lymphatics assume a more important role in removing absorbed water during lipid absorption than during glucose absorption. PMID:20961304

  20. Oral Toxicity and Intestinal Transport Mechanism of Colloidal Gold Nanoparticle-Treated Red Ginseng

    PubMed Central

    Bae, Song-Hwa; Yu, Jin; Go, Mi-Ran; Kim, Hyun-Jin; Hwang, Yun-Gu; Choi, Soo-Jin

    2016-01-01

    (1) Background: Application of nanotechnology or nanomaterials in agricultural food crops has attracted increasing attention with regard to improving crop production, quality, and nutrient utilization. Gold nanoparticles (Au-NPs) have been reported to enhance seed yield, germination rate, and anti-oxidant potential in food crops, raising concerns about their toxicity potential. In this study, we evaluated the oral toxicity of red ginseng exposed to colloidal Au-NPs during cultivation (G-red ginseng) in rats and their intestinal transport mechanism. (2) Methods: 14-day repeated oral administration of G-red ginseng extract to rats was performed, and body weight, hematological, serum biochemical, and histopathological values were analyzed. An in vitro model of human intestinal follicle-associated epithelium (FAE) and an intestinal epithelial monolayer system were used for intestinal transport mechanistic study. (3) Results: No remarkable oral toxicity of G-red ginseng extract in rats was found, and Au-NPs did not accumulate in any organ, although Au-NP transfer to G-red ginseng and some increased saponin levels were confirmed. Au-NPs were transcytozed by microfold (M) cells, but not by a paracellular pathway in the intestinal epithelium. (4) Conclusion: These findings suggest great potential of Au-NPs for agricultural food crops at safe levels. Further study is required to elucidate the functional effects of Au-NPs on ginseng and long-term toxicity. PMID:28335336

  1. Effects of copper and ceruloplasmin on iron transport in the Caco 2 cell intestinal model.

    PubMed

    Zerounian, Nora R.; Linder, Maria C.

    2002-03-01

    Previous studies have implicated copper proteins, including ceruloplasmin, in intestinal iron transport. Polarized Caco2 cells with tight junctions were used to examine the possibilities that (a) ceruloplasmin promotes iron absorption by enhancing release at the basolateral cell surface and (b) copper deficiency reduces intestinal iron transport. Iron uptake and overall transport were followed for 90 min with 1 &mgr;M 59Fe(II) applied to the apical surface of Caco2 cell monolayers. Apotransferrin (38 &mgr;M) was in the basolateral chamber. Induction of iron deficiency with desferrioxamine (100 &mgr;M; 18 h) markedly increased uptake and overall transport of iron. Uptake increased from about 20% to about 65% of dose, and overall 59Fe transport from <1% to 60% of dose. On the basis of actual iron released into the basal chamber (measured with bathophenanthroline), transport increased 8-fold. Desferrioxamine pretreatment reduced cellular Fe by 55%. The addition of freshly isolated, enzymatically active human ceruloplasmin to the basolateral chamber during absorption had no effect on uptake or transport of iron by the cells. Unexpectedly, pretreatment with three different chelators of copper (18 h), which reduced cellular levels about 40%, more than doubled iron uptake and raised overall transport to 20%. This was so, whether or not cells were also made iron deficient with desferrioxamine. Acute addition of 1 &mgr;M Cu(II) to the apical chamber had no significant effect upon iron uptake, retention, or transport in iron deficient or normal cells, in the presence of absence of ascorbate. We conclude that intestinal absorption of Fe(II) is unlikely to depend upon plasma ceruloplasmin, and that cuproproteins involved in this form of iron transport must be binding copper tightly.

  2. Activation of CFTR trafficking and gating by vasoactive intestinal peptide in human bronchial epithelial cells.

    PubMed

    Qu, Fei; Liu, Hui-Jun; Xiang, Yang; Tan, Yu-Rong; Liu, Chi; Zhu, Xiao-Lin; Qin, Xiao-Qun

    2011-03-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an apical membrane chloride channel critical to the regulation of fluid, chloride, and bicarbonate transport in epithelia and other cell types. The most common cause of cystic fibrosis (CF) is the abnormal trafficking of CFTR mutants. Therefore, understanding the cellular machineries that transit CFTR from the endoplasmic reticulum to the cell surface is important. Vasoactive intestinal polypeptide (VIP) plays an important role in CFTR-dependent chloride transport. The present study was designed to observe the affection of VIP on the trafficking of CFTR, and channel gating in human bronchial epithelium cells (HBEC). Confocal microscopy revealed CFTR immunofluorescence extending from the apical membrane deeply into the cell cytoplasm. After VIP treatment, apical extension of CFTR immunofluorescence into the cell was reduced and the peak intensity of CFTR fluorescence shifted towards the apical membrane. Western blot showed VIP increased cell surface and total CFTR. Compared with the augmented level of total CFTR, the surface CFTR increased more markedly. Immunoprecipitation founded that the mature form of CFTR had a marked increase in HBEC treated with VIP. VIP led to a threefold increase in Cl(-) efflux in HBEC. Glibenclamide-sensitive and DIDS-insensitive CFTR Cl(-) currents were consistently observed after stimulation with VIP (10(-8) mol/L). The augmentation of CFTR Cl(-) currents enhanced by VIP (10(-8) mol/L) was reversed, at least in part, by the protein kinase A (PKA) inhibitor, H-89 and the protein kinase C (PKC) inhibitor, H-7, suggesting PKA and PKC participate in the VIP-promoted CFTR Cl(-) currents.

  3. Glucagon-like peptide 1 (1–37) converts intestinal epithelial cells into insulin-producing cells

    PubMed Central

    Suzuki, Atsushi; Nakauchi, Hiromitsu; Taniguchi, Hideki

    2003-01-01

    Glucagon-like peptide (GLP) 1 is produced through posttranslational processing of proglucagon and acts as a regulator of various homeostatic events. Among its analogs, however, the function of GLP-1-(1–37), synthesized in small amounts in the pancreas, has been unclear. Here, we find that GLP-1-(1–37) induces insulin production in developing and, to a lesser extent, adult intestinal epithelial cells in vitro and in vivo, a process mediated by up-regulation of the Notch-related gene ngn3 and its downstream targets, which are involved in pancreatic endocrine differentiation. These cells became responsive to glucose challenge in vitro and reverse insulin-dependent diabetes after implantation into diabetic mice. Our findings suggest that efficient induction of insulin production in intestinal epithelial cells by GLP-1-(1–37) could represent a new therapeutic approach to diabetes mellitus. PMID:12702762

  4. Temperature Modulates the Effects of Ocean Acidification on Intestinal Ion Transport in Atlantic Cod, Gadus morhua

    PubMed Central

    Hu, Marian Y.; Michael, Katharina; Kreiss, Cornelia M.; Stumpp, Meike; Dupont, Sam; Tseng, Yung-Che; Lucassen, Magnus

    2016-01-01

    CO2-driven seawater acidification has been demonstrated to enhance intestinal bicarbonate secretion rates in teleosts, leading to an increased release of CaCO3 under simulated ocean acidification scenarios. In this study, we investigated if increasing CO2 levels stimulate the intestinal acid–base regulatory machinery of Atlantic cod (Gadus morhua) and whether temperatures at the upper limit of thermal tolerance stimulate or counteract ion regulatory capacities. Juvenile G. morhua were acclimated for 4 weeks to three CO2 levels (550, 1200, and 2200 μatm) covering present and near-future natural variability, at optimum (10°C) and summer maximum temperature (18°C), respectively. Immunohistochemical analyses revealed the subcellular localization of ion transporters, including Na+/K+-ATPase (NKA), Na+/H+-exchanger 3 (NHE3), Na+/HCO3− cotransporter (NBC1), pendrin-like Cl−/HCO3− exchanger (SLC26a6), V-type H+-ATPase subunit a (VHA), and Cl− channel 3 (CLC3) in epithelial cells of the anterior intestine. At 10°C, proteins and mRNA were generally up-regulated for most transporters in the intestinal epithelium after acclimation to higher CO2 levels. This supports recent findings demonstrating increased intestinal HCO3− secretion rates in response to CO2 induced seawater acidification. At 18°C, mRNA expression and protein concentrations of most ion transporters remained unchanged or were even decreased, suggesting thermal compensation. This response may be energetically favorable to retain blood HCO3− levels to stabilize pHe, but may negatively affect intestinal salt and water resorption of marine teleosts in future oceans. PMID:27313538

  5. Temperature Modulates the Effects of Ocean Acidification on Intestinal Ion Transport in Atlantic Cod, Gadus morhua.

    PubMed

    Hu, Marian Y; Michael, Katharina; Kreiss, Cornelia M; Stumpp, Meike; Dupont, Sam; Tseng, Yung-Che; Lucassen, Magnus

    2016-01-01

    CO2-driven seawater acidification has been demonstrated to enhance intestinal bicarbonate secretion rates in teleosts, leading to an increased release of CaCO3 under simulated ocean acidification scenarios. In this study, we investigated if increasing CO2 levels stimulate the intestinal acid-base regulatory machinery of Atlantic cod (Gadus morhua) and whether temperatures at the upper limit of thermal tolerance stimulate or counteract ion regulatory capacities. Juvenile G. morhua were acclimated for 4 weeks to three CO2 levels (550, 1200, and 2200 μatm) covering present and near-future natural variability, at optimum (10°C) and summer maximum temperature (18°C), respectively. Immunohistochemical analyses revealed the subcellular localization of ion transporters, including Na(+)/K(+)-ATPase (NKA), Na(+)/H(+)-exchanger 3 (NHE3), Na(+)/[Formula: see text] cotransporter (NBC1), pendrin-like Cl(-)/[Formula: see text] exchanger (SLC26a6), V-type H(+)-ATPase subunit a (VHA), and Cl(-) channel 3 (CLC3) in epithelial cells of the anterior intestine. At 10°C, proteins and mRNA were generally up-regulated for most transporters in the intestinal epithelium after acclimation to higher CO2 levels. This supports recent findings demonstrating increased intestinal [Formula: see text] secretion rates in response to CO2 induced seawater acidification. At 18°C, mRNA expression and protein concentrations of most ion transporters remained unchanged or were even decreased, suggesting thermal compensation. This response may be energetically favorable to retain blood [Formula: see text] levels to stabilize pHe, but may negatively affect intestinal salt and water resorption of marine teleosts in future oceans.

  6. Human, rat and chicken small intestinal Na+-Cl−-creatine transporter: functional, molecular characterization and localization

    PubMed Central

    Peral, M J; García-Delgado, M; Calonge, M L; Durán, J M; De La Horra, M C; Wallimann, T; Speer, O; Ilundáin, A A

    2002-01-01

    In spite of all the fascinating properties of oral creatine supplementation, the mechanism(s) mediating its intestinal absorption has(have) not been investigated. The purpose of this study was to characterize intestinal creatine transport. [14C]Creatine uptake was measured in chicken enterocytes and rat ileum, and expression of the creatine transporter CRT was examined in human, rat and chicken small intestine by reverse transcription-polymerase chain reaction, Northern blot, in situ hybridization, immunoblotting and immunohistochemistry. Results show that enterocytes accumulate creatine against its concentration gradient. This accumulation was electrogenic, Na+- and Cl−-dependent, with a probable stoichiometry of 2 Na+: 1 Cl−: 1 creatine, and inhibited by ouabain and iodoacetic acid. The kinetic study revealed a Km for creatine of 29 μm. [14C]Creatine uptake was efficiently antagonized by non-labelled creatine, guanidinopropionic acid and cyclocreatine. More distant structural analogues of creatine, such as GABA, choline, glycine, β-alanine, taurine and betaine, had no effect on intestinal creatine uptake, indicating a high substrate specificity of the creatine transporter. Consistent with these functional data, messenger RNA for CRT was detected only in the cells lining the intestinal villus. The sequences of partial clones, and of the full-length cDNA clone, isolated from human and rat small intestine were identical to previously cloned CRT cDNAs. Immunological analysis revealed that CRT protein was mainly associated with the apical membrane of the enterocytes. This study reports for the first time that mammalian and avian enterocytes express CRT along the villus, where it mediates high-affinity, Na+- and Cl−-dependent, apical creatine uptake. PMID:12433955

  7. Mass balance approaches for estimating the intestinal absorption and metabolism of peptides and analogues: theoretical development and applications

    NASA Technical Reports Server (NTRS)

    Sinko, P. J.; Leesman, G. D.; Amidon, G. L.

    1993-01-01

    A theoretical analysis for estimating the extent of intestinal peptide and peptide analogue absorption was developed on the basis of a mass balance approach that incorporates convection, permeability, and reaction. The macroscopic mass balance analysis (MMBA) was extended to include chemical and enzymatic degradation. A microscopic mass balance analysis, a numerical approach, was also developed and the results compared to the MMBA. The mass balance equations for the fraction of a drug absorbed and reacted in the tube were derived from the general steady state mass balance in a tube: [formula: see text] where M is mass, z is the length of the tube, R is the tube radius, Pw is the intestinal wall permeability, kr is the reaction rate constant, C is the concentration of drug in the volume element over which the mass balance is taken, VL is the volume of the tube, and vz is the axial velocity of drug. The theory was first applied to the oral absorption of two tripeptide analogues, cefaclor (CCL) and cefatrizine (CZN), which degrade and dimerize in the intestine. Simulations using the mass balance equations, the experimental absorption parameters, and the literature stability rate constants yielded a mean estimated extent of CCL (250-mg dose) and CZN (1000-mg dose) absorption of 89 and 51%, respectively, which was similar to the mean extent of absorption reported in humans (90 and 50%). It was proposed previously that 15% of the CCL dose spontaneously degraded systematically; however, our simulations suggest that significant CCL degradation occurs (8 to 17%) presystemically in the intestinal lumen.(ABSTRACT TRUNCATED AT 250 WORDS).

  8. Epithelial transport and deamidation of gliadin peptides: a role for coeliac disease patient immunoglobulin A

    PubMed Central

    Rauhavirta, T; Qiao, S-W; Jiang, Z; Myrsky, E; Loponen, J; Korponay-Szabó, I R; Salovaara, H; Garcia-Horsman, J A; Venäläinen, J; Männistö, P T; Collighan, R; Mongeot, A; Griffin, M; Mäki, M; Kaukinen, K; Lindfors, K

    2011-01-01

    In coeliac disease, the intake of dietary gluten induces small-bowel mucosal damage and the production of immunoglobulin (Ig)A class autoantibodies against transglutaminase 2 (TG2). We examined the effect of coeliac patient IgA on the apical-to-basal passage of gluten-derived gliadin peptides p31–43 and p57–68 in intestinal epithelial cells. We demonstrate that coeliac IgA enhances the passage of gliadin peptides, which could be abolished by inhibition of TG2 enzymatic activity. Moreover, we also found that both the apical and the basal cell culture media containing the immunogenic gliadin peptides were able to induce the proliferation of deamidation-dependent coeliac patient-derived T cells even in the absence of exogenous TG2. Our results suggest that coeliac patient IgA could play a role in the transepithelial passage of gliadin peptides, a process during which they might be deamidated. PMID:21235541

  9. The transport of uric acid across mouse small intestine in vitro.

    PubMed Central

    Bronk, J R; Shaw, M I

    1986-01-01

    The in vitro recirculation technique was used to study the uptake and transport of uric acid by the jejunum of mouse small intestine. Three components of the serosal secretions appeared to be endogenously derived nucleic acid derivatives; two of these were identified as uric acid and uracil. There was no detectable metabolism of uric acid by the intestine. Uric acid transported from the lumen appeared in the serosal fluid at a concentration higher than that in the lumen. The final serosal/luminal concentration ratio of about 1.18 for exogenous uric acid was found to be constant over the concentration range studied (0.01-0.1 mM). The presence of exogenous uric acid in the lumen did not affect the production of endogenous uric acid by the intestine and its release into the serosal secretions. Mucosal concentration of exogenous uric acid was below, but the total mucosal concentration (exogenous+endogenous) was above, that in the lumen. There was no evidence for the secretion of endogenous uric acid into the lumen. Oxypurinol significantly decreased the rate of serosal appearance of exogenous uric acid. Allopurinol did not affect the transport of exogenous uric acid from the lumen and there was negligible metabolism of allopurinol to oxypurinol by the tissue. Uracil did not affect the transport of exogenous uric acid from the lumen, or the serosal appearance of endogenous uric acid. Likewise uracil transport was unaffected by luminal uric acid. PMID:3795104

  10. Transport characteristics of isorhamnetin across intestinal Caco-2 cell monolayers and the effects of transporters on it.

    PubMed

    Duan, Jingze; Xie, Yan; Luo, Huilin; Li, Guowen; Wu, Tao; Zhang, Tong

    2014-04-01

    Flavonoid isorhamnetin occurs in various plants and herbs, and demonstrates various biological effects in humans. This work will clarify the isorhamnetin absorption mechanism using the Caco-2 monolayer cell model. The isorhamnetin transport characteristics at different concentrations, pHs, temperatures, tight junctions and potential transporters were systemically investigated. Isorhamnetin was poorly absorbed by both passive diffusion and active transport mechanisms. Both trans- and paracellular pathways were involved during isorhamnetin transport. Active transport under an ATP-dependent transport mechanism was mediated by the organic anion transporting peptide (OATP); isorhamnetin's permeability from the apical to the basolateral side significantly decreased after estrone-3-sulfate was added (p<0.01). Efflux transporters, P-glycoproteins (P-gp), breast cancer resistance proteins (BCRP) and multidrug resistance proteins (MRPs) participated in the isorhamnetin transport process. Among them, the MRPs (especially MRP2) were the main efflux transporters for isorhamnetin; transport from the apical to the basolateral side increased 10.8-fold after adding an MRP inhibitor (MK571). This study details isorhamnetin's cellular transport and elaborates isorhamnetin's absorption mechanisms to provide a foundation for further studies.

  11. Distinct Firing Properties of Vasoactive Intestinal Peptide-Expressing Neurons in the Suprachiasmatic Nucleus

    PubMed Central

    Hermanstyne, Tracey O.; Simms, Carrie L.; Carrasquillo, Yarimar; Herzog, Erik D.; Nerbonne, Jeanne M.

    2016-01-01

    The suprachiasmatic nucleus (SCN) regulates daily rhythms in physiology and behavior. Previous studies suggest a critical role for neurons expressing vasoactive intestinal peptide (VIP) in coordinating rhythmicity and synchronization in the SCN. Here we examined the firing properties of VIP-expressing SCN neurons in acute brain slices. Active and passive membrane properties were measured in VIP and in non-VIP neurons during the day and at night. Current-clamp recordings revealed that both VIP and non-VIP neurons were spontaneously active, with higher firing rates during the day than at night. Average firing frequencies, however, were higher in VIP neurons (3.1 ± 0.2 Hz, day and 2.4 ± 0.2 Hz, night) than in non-VIP neurons (1.8 ± 0.2 Hz, day and 0.9 ± 0.2 Hz, night), both day and night. The waveforms of individual action potentials in VIP and non-VIP neurons were also distinct. Action potential durations (APD50) were shorter in VIP neurons (3.6 ± 0.1 ms, day and 2.9 ± 0.1 ms, night) than in non-VIP neurons (4.4 ± 0.3 ms, day and 3.5 ± 0.2 ms, night) throughout the light-dark cycle. In addition, after hyper polarization (AHP) amplitudes were larger in VIP neurons (21 ± 0.8 mV, day and 24.9 ± 0.9 mV, night) than in non-VIP neurons (17.2 ± 1.1 mV, day and 20.5 ± 1.2 mV, night) during the day and at night. Furthermore, significant day/night differences were observed in APD50 and AHP amplitudes in both VIP and non-VIP SCN neurons, consistent with rhythmic changes in ionic conductances that contribute to shaping the firing properties of both cell types. The higher day and night firing rates of VIP neurons likely contribute to synchronizing electrical activity in the SCN. PMID:26712166

  12. Helix stabilization of amphipathic peptides by hydrocarbon stapling increases cholesterol efflux by the ABCA1 transporter.

    PubMed

    Sviridov, D O; Ikpot, I Z; Stonik, J; Drake, S K; Amar, M; Osei-Hwedieh, D O; Piszczek, G; Turner, S; Remaley, A T

    2011-07-08

    Apolipoprotein mimetic peptides are short amphipathic peptides that efflux cholesterol from cells by the ABCA1 transporter and are being investigated as therapeutic agents for cardiovascular disease. We examined the role of helix stabilization of these peptides in cholesterol efflux. A 23-amino acid long peptide (Ac-VLEDSFKVSFLSALEEYTKKLNTQ-NH2) based on the last helix of apoA-I (A10) was synthesized, as well as two variants, S1A10 and S2A10, in which the third and fourth and third and fifth turn of each peptide, respectively, were covalently joined by hydrocarbon staples. By CD spectroscopy, the stapled variants at 24 °C were more helical in aqueous buffer than A10 (A10 17%, S1A10 62%, S2A10 97%). S1A10 and S2A10 unlike A10 were resistant to proteolysis by pepsin and chymotrypsin. S1A10 and S2A10 showed more than a 10-fold increase in cholesterol efflux by the ABCA1 transporter compared to A10. In summary, hydrocarbon stapling of amphipathic peptides increases their helicity, makes them resistant to proteolysis and enhances their ability to promote cholesterol efflux by the ABCA1 transporter, indicating that this peptide modification may be useful in the development of apolipoprotein mimetic peptides.

  13. Interaction of Peptide Transporter 1 With D-Glucose and L-Glutamic Acid; Possible Involvement of Taste Receptors.

    PubMed

    Arakawa, Hiroshi; Ohmachi, Taichi; Ichiba, Kiko; Kamioka, Hiroki; Tomono, Takumi; Kanagawa, Masahiko; Idota, Yoko; Hatano, Yasuko; Yano, Kentaro; Morimoto, Kaori; Ogihara, Takuo

    2016-01-01

    We investigated the influence of sweet and umami (savory) tastants on the intestinal absorption of cephalexin (CEX), a substrate of peptide transporter 1 (PEPT1, SLC15A1) in rats. After oral administration of glucose or mannitol to rats, CEX was administered together with a second dose of glucose or mannitol. Western blot analysis indicated that expression of PEPT1 in rat jejunum membrane was decreased by glucose, compared to mannitol. Furthermore, the maximum plasma concentration (Cmax) of orally administered CEX was reduced by glucose compared to mannitol. The effect of glucose was diminished by nifedipine, a L-type Ca(2+) channel blocker. We also found that Cmax of orally administered CEX was reduced by treatment with L-glutamic acid, compared to D-glutamic acid. Thus, excessive intake of glucose and L-glutamic acid may impair oral absorption of PEPT1 substrates.

  14. Effects of the mucoadhesive polymer polycarbophil on the intestinal absorption of a peptide drug in the rat.

    PubMed

    Lehr, C M; Bouwstra, J A; Kok, W; De Boer, A G; Tukker, J J; Verhoef, J C; Breimer, D D; Junginger, H E

    1992-05-01

    The absorption across rat intestinal tissue of the model peptide drug 9-desglycinamide, 8-arginine vasopressin from bioadhesive formulations was studied in-vitro, in a chronically isolated internal loop in-situ and after intraduodenal administration in-vivo. A controlled-release bioadhesive drug delivery system was tested, consisting of microspheres of poly(2-hydroxyethyl methacrylate) with a mucoadhesive Polycarbophil-coating, as well as fast-release formulation consisting of an aqueous solution of the peptide in a suspension of Polycarbophil particles. Using the controlled-release system, a slight improvement of peptide absorption was found in-vitro in comparison with a non-adhesive control system, but not in-situ or in-vivo. In contrast, bioavailability was significantly increased in all three models from the Polycarbophil suspension in comparison with a solution of the drug in saline. The effect appeared to be dose-dependent, indicative of intrinsic penetration-enhancing properties of the mucoadhesive polymer. A prolongation of the absorption phase in-vitro and in the chronically isolated loop in-situ suggested that the polymer was able to protect the peptide from proteolytic degradation. This could be confirmed by degradation studies in-vitro. The duration of the penetration enhancing/enzyme inhibiting effect was diminished with increasing complexity of the test model, in the same way as was previously found for the bioadhesive effect. This interrelationship suggests that the observed improvement in peptide absorption and the mucoadhesive properties of this polymer are associated. The development of a fast-release oral dosage form for peptide drugs on the basis of Polycarbophil appears to be possible.

  15. New mechanisms that regulate Saccharomyces cerevisiae short peptide transporter achieve balanced intracellular amino acid concentrations.

    PubMed

    Melnykov, Artem V

    2016-01-01

    The budding yeast Saccharomyces cerevisiae is able to take up large quantities of amino acids in the form of di- and tripeptides via a short peptide transporter, Ptr2p. It is known that PTR2 can be induced by certain peptides and amino acids, and the mechanisms governing this upregulation are understood at the molecular level. We describe two new opposing mechanisms of regulation that emphasize potential toxicity of amino acids: the first is upregulation of PTR2 in a population of cells, caused by amino acid secretion that accompanies peptide uptake; the second is loss of Ptr2p activity, due to transporter internalization following peptide uptake. Our findings emphasize the importance of proper amino acid balance in the cell and extend understanding of peptide import regulation in yeast.

  16. Differential responses of intestinal glucose transporter mRNA transcripts to levels of dietary sugars.

    PubMed

    Miyamoto, K; Hase, K; Takagi, T; Fujii, T; Taketani, Y; Minami, H; Oka, T; Nakabou, Y

    1993-10-01

    Dietary sugars are known to stimulate intestinal glucose transport activity, but the specific signals involved are unknown. The Na(+)-dependent glucose co-transporter (SGLT1), the liver-type facilitative glucose transporter (GLUT2) and the intestinal-type facilitative glucose transporter (GLUT5) are all expressed in rat jejunum [Miyamoto, Hase, Taketani, Minami, Oka, Nakabou and Hagihira (1991) Biochem. Biophys. Res. Commun. 181, 1110-1117]. In the present study we have investigated the effects of dietary sugars on these glucose transporter genes. A high-glucose diet stimulated glucose transport activity and increased the levels of SGLT1 and GLUT2 mRNAs in rat jejunum. 3-O-Methylglucose, D-galactose, D-fructose, D-mannose and D-xylose can mimic the regulatory effect of glucose on the SGLT1 mRNA level in rat jejunum. However, only D-galactose and D-fructose increased the levels of GLUT2 mRNA. The GLUT5 mRNA level was increased significantly only by D-fructose. Our results suggest that the increase in intestinal transport activity in rats caused by dietary glucose is due to an increase in the levels of SGLT1 and GLUT2 mRNAs, and that these increases in mRNA may be caused by an enhancement of the transcriptional rate. Furthermore, for expression of the SGLT1 gene, the signal need not be a metabolizable or transportable substrate whereas, for expression of the GLUT2 gene, metabolism of the substrate in the liver may be necessary for signalling. Only D-fructose is an effective signal for expression of the GLUT5 gene.

  17. Intestinal absorptive transport of Genkwanin from Flos genkwa using a single-pass intestinal perfusion rat model.

    PubMed

    Jiang, Cui-Ping; He, Xin; Yang, Xiao-Lin; Zhang, Su-Li; Li, Hui; Song, Zi-Jing; Zhang, Chun-Feng; Yang, Zhong-Lin; Li, Ping

    2014-01-01

    To investigate the absorptive transport behavior of genkwanin and the beneficial effects of monoterpene enhancers with different functional groups, the single-pass intestinal perfusion (SPIP) of rats was used. The results showed that genkwanin was segmentally-dependent and the best absorptive site was the duodenum. The effective permeability coefficient (P eff ) was 1.97 × 10(-4) cm/s and the absorption rate constant (Ka) was 0.62 × 10(-2) s(-1). Transepithelial transportation descended with increasing concentrations of genkwanin. This was a 1.4-fold increase in P eff by probenecid, whereas a 1.4-fold or 1.6-fold decrease was observed by verapamil and pantoprazole, respectively. Furthermore, among the absorption enhancers, the enhancement with carbonyl (camphor and menthone) was higher than that with hydroxyl (borneol and menthol). The concentration-independent permeability and enhancement by coperfusion of probenecid indicated that genkwanin was transported by both passive diffusion and multidrug resistance protein (MDR)-mediated efflux mechanisms.

  18. Carrier-mediated system for transport of biotin in rat intestine in vitro

    SciTech Connect

    Said, H.M.; Redha, R.

    1987-01-01

    Transport of biotin was examined in rat intestine using the everted sac technique. Transport of 0.1 ..mu..M biotin was linear with time for at least 30 min of incubation and occurred at a rate 3.7 pmol g initial tissue wet wt/sup -1/ min/sup -1/. Transport of biotin was higher in the jejunum than the ileum and was minimum in the colon (85 +/- 6, 36 +/- 6, and 2.8 +/- 0.6 pmol x g initial tissue wet wt/sup -1/ x 25 min/sup -1/, respectively). In the jejunum, transport of biotin was saturable at low concentrations but linear at higher concentrations. The transport of low concentrations of biotin was 1) inhibited by structural analogues (desthiobiotin, biotin methyl ester, diaminobiotin, and biocytin), 2) Na/sup +/ dependent, 3) energy dependent, 4) temperature dependent, and 5) proceeded against a concentration gradient in the serosal compartment. No metabolic alteration occurs to the biotin molecule during transport. This study demonstrates that biotin transport in rat intestine occurs by a carrier-mediated process at low concentrations and by simple diffusion at high concentrations. Furthermore, the carrier-mediated process is Na/sup +/, energy, and temperature dependent.

  19. A carrier-mediated transport for folate in basolateral membrane vesicles of rat small intestine.

    PubMed Central

    Said, H M; Redha, R

    1987-01-01

    The mechanism of exit of folate from the enterocyte, i.e. transport across the basolateral membrane, is not known. In this study we examined, using basolateral membrane vesicles, the transport of folic acid across the basolateral membrane of rat intestine. Uptake of folic acid by these vesicles represents transport of the substrate into the intravesicular compartment and not binding to the membrane surface. The rate of folic acid transport was linear for the first 1 min of incubation but decreased thereafter, reaching equilibrium after 5 min of incubation. The transport of folic acid was: (1) saturable as a function of concentration with an apparent Km of 0.6 +/- 0.17 microM and Vmax. of 1.01 +/- 0.11 pmol/30 s per mg of protein; (2) inhibited in a competitive manner by the structural analogues 5-methyltetrahydrofolate and methotrexate (Ki = 2 and 1.4 microM, respectively); (4) electroneutral; (5) Na+-independent; (6) sensitive to the effect of the anion exchange inhibitor 4,4'-di-isothiocyanatostilbene-2,2'-disulphonic acid (DIDS). These data indicate the existence of a carrier-mediated transport system for folic acid in rat intestinal basolateral membrane and demonstrate that the transport process is electroneutral, Na+-independent and sensitive to the effect of anion exchange inhibition. PMID:3689340

  20. Conditional (intestinal-specific) knockout of the riboflavin transporter-3 (RFVT-3) impairs riboflavin absorption.

    PubMed

    Subramanian, Veedamali S; Lambrecht, Nils; Lytle, Christian; Said, Hamid M

    2016-02-15

    Riboflavin (RF) is indispensable for normal cell metabolism, proliferation, and growth. The RFVT-3 protein (product of the Slc52a3 gene) is expressed in the gut with the expression being restricted to the apical membrane domain of the polarized intestinal epithelial cells. The relative contribution of RFVT-3 to total carrier-mediated RF uptake in the native intestine, however, is not clear. We addressed this issue in the current investigation using a conditional (intestinal-specific) RFVT-3 knockout (cKO) mouse model developed by the Cre/Lox approach. All RFVT-3 cKO mice were found to be RF deficient and showed a significant growth and development retardation; also, nearly two-thirds of them died prematurely between the age of 6 and 12 wk. In vivo (intestinal and colonic loops) and in vitro (native isolated intestinal epithelial cells) uptake studies showed a severe inhibition in carrier-mediated RF uptake in the cKO mice compared with control littermates. We also observed a significant increase in the level of expression of oxidative stress-responsive genes in the intestine of the cKO mice compared with control littermates. Supplementation of the RFVT-3 cKO mice with pharmacological doses of RF led to a complete correction of the growth retardation and to normalization in the level of expression of the oxidative stress-responsive genes in the gut. These results show, for the first time, that the RFVT-3 system is the main transporter involved in carrier-mediated RF uptake in the native mouse small and large intestine, and that its dysfunction impairs normal RF body homeostasis.

  1. Transport phenomena of microbial flora in the small intestine with peristalsis.

    PubMed

    Ishikawa, T; Sato, T; Mohit, G; Imai, Y; Yamaguchi, T

    2011-06-21

    The gastrointestinal tract of humans is colonized by indigenous prokaryotic and eukaryotic microbial cells that form a complex ecological system called microbial flora. Although the microbial flora has diverse functions, its homeostasis inside the gastrointestinal tract is still largely unknown. Therefore, creating a model for investigating microbial flora in the gastrointestinal tract is important. In this study, we developed a novel numerical model to explore the transport phenomena of microbial flora in the small intestine. By simultaneously solving the flow field generated by peristalsis, the concentrations of oxygen and nutrient, and the densities of moderate anaerobes and aerobes, the effects of fluid mechanics on the transport phenomena of microbial flora are discussed. The results clearly illustrated that fluid mechanics have considerable influence not only on the bacterial population, but also on the concentration distributions of oxygen and nutrient. Especially, the flow field enhances the radial variation of the concentration fields. We also show scaling arguments for bacterial growth and oxygen consumption, which capture the main features of the results. Additionally, we investigated the transport phenomena of microbial flora in a long tube with 40 constrictions. The results showed a high growth rate of aerobes in the upstream side and a high growth rate of anaerobes in the downstream side, which qualitatively agrees with experimental observations of human intestines. These new findings provide the fundamental basis for a better understanding of the transport phenomena of microbial flora in the intestine.

  2. A permeation enhancer for increasing transport of therapeutic macromolecules across the intestine.

    PubMed

    Gupta, Vivek; Hwang, Byeong Hee; Doshi, Nishit; Mitragotri, Samir

    2013-12-10

    Delivery of therapeutic macromolecules is limited by the physiological limitations of the gastrointestinal tract including poor intestinal permeability, low pH and enzymatic activity. Several permeation enhancers have been proposed to enhance intestinal permeability of macromolecules; however their utility is often hindered by toxicity and limited potency. Here, we report on a novel permeation enhancer, Dimethyl palmitoyl ammonio propanesulfonate (PPS), with excellent enhancement potential and minimal toxicity. PPS was tested for dose- and time-dependent cytotoxicity, delivery of two model fluorescent molecules, sulforhodamine-B and FITC-insulin in vitro, and absorption enhancement of salmon calcitonin (sCT) in vivo. Caco-2 studies revealed that PPS is an effective enhancer of macromolecular transport while being minimally toxic. TEER measurements in Caco-2 monolayers confirmed the reversibility of the effect of PPS. Confocal microscopy studies revealed that molecules permeate via both paracellular and transcellular pathways in the presence of PPS. In vivo studies in rats showed that PPS enhanced relative bioavailability of sCT by 45-fold after intestinal administration. Histological studies showed that PPS does not induce damage to the intestine. PPS is an excellent permeation enhancer which provides new opportunities for developing efficacious oral/intestinal delivery systems for therapeutic macromolecules.

  3. Suppression by Trypanosoma brucei of anaphylaxis-mediated ion transport in the small intestine of rats.

    PubMed Central

    Gould, S S; Castro, G A

    1994-01-01

    The hypothesis that failure of hosts infected with Trypanosoma brucei to express type 1 hypersensitivity is related to this parasite's ability to down-regulate IgE production, and not to an innate lack of allergenicity of T. brucei antigens, was tested by studying anaphylaxis-induced changes in net epithelial ion transport in rats. Transport changes were quantified electrophysiologically in vitro, as a change in transmural short-circuit current when sensitized intestine was challenged with homologous antigen. Rats injected parenterally with trypanosome antigen elicited intestinal anaphylaxis in response to antigenic challenge, whereas the intestine of rats infected with T. brucei failed to respond. Infection with T. brucei also suppressed the anaphylactic response in rats sensitized to and challenged with ovalbumin and T. spiralis-derived antigens. In these cases suppression was related to the ability of T. brucei to block production of IgE, and not to the physiological failure of the epithelial response. However, in rats sensitized by infection with T. spiralis, neither the anaphylactic response nor IgE production were inhibited by T. brucei. Furthermore, intestinal mastocytosis normally associated with trichinosis was unaffected by the trypanosome infection. Results support the conclusion that the failure to express anaphylaxis in T. brucei-infected rats is due to the inhibition of IgE production and not to the lack of allergenicity of trypanosome antigens. PMID:8206518

  4. Zinc Transporter SLC39A7/ZIP7 Promotes Intestinal Epithelial Self-Renewal by Resolving ER Stress

    PubMed Central

    Ohashi, Wakana; Kimura, Shunsuke; Iwanaga, Toshihiko; Furusawa, Yukihiro; Irié, Tarou; Izumi, Hironori; Watanabe, Takashi; Hara, Takafumi; Ohara, Osamu; Koseki, Haruhiko; Sato, Toshiro; Robine, Sylvie; Mori, Hisashi; Hattori, Yuichi; Mishima, Kenji; Ohno, Hiroshi; Hase, Koji; Fukada, Toshiyuki

    2016-01-01

    Zinc transporters play a critical role in spatiotemporal regulation of zinc homeostasis. Although disruption of zinc homeostasis has been implicated in disorders such as intestinal inflammation and aberrant epithelial morphology, it is largely unknown which zinc transporters are responsible for the intestinal epithelial homeostasis. Here, we show that Zrt-Irt-like protein (ZIP) transporter ZIP7, which is highly expressed in the intestinal crypt, is essential for intestinal epithelial proliferation. Mice lacking Zip7 in intestinal epithelium triggered endoplasmic reticulum (ER) stress in proliferative progenitor cells, leading to significant cell death of progenitor cells. Zip7 deficiency led to the loss of Olfm4+ intestinal stem cells and the degeneration of post-mitotic Paneth cells, indicating a fundamental requirement for Zip7 in homeostatic intestinal regeneration. Taken together, these findings provide evidence for the importance of ZIP7 in maintenance of intestinal epithelial homeostasis through the regulation of ER function in proliferative progenitor cells and maintenance of intestinal stem cells. Therapeutic targeting of ZIP7 could lead to effective treatment of gastrointestinal disorders. PMID:27736879

  5. Characterization of loxoprofen transport in Caco-2 cells: the involvement of a proton-dependent transport system in the intestinal transport of loxoprofen.

    PubMed

    Narumi, Katsuya; Kobayashi, Masaki; Kondo, Ayuko; Furugen, Ayako; Yamada, Takehiro; Takahashi, Natsuko; Iseki, Ken

    2016-11-01

    Loxoprofen, a propionate non-steroidal anti-inflammatory drug (NSAID), is used widely in East Asian countries. However, little is known about the transport mechanisms contributing to its intestinal absorption. The objectives of this study were to characterize the intestinal transport of loxoprofen using the human intestinal Caco-2 cell model. The transport of loxoprofen was investigated in cellular uptake studies. The uptake of loxoprofen into Caco-2 cells was pH- and concentration-dependent, and was described by a Michaelis-Menten equation with passive diffusion (Km : 4.8 mm, Vmax : 142 nmol/mg protein/30 s, and Kd : 2.2 μl/mg protein/30 s). Moreover, the uptake of loxoprofen was inhibited by a typical monocarboxylate transporter (MCT) inhibitor as well as by various monocarboxylates. The uptake of [(14) C] l-lactic acid, a typical MCT substrate, in Caco-2 cells was saturable with relatively high affinity for MCT. Because loxoprofen inhibited the uptake of [(14) C] l-lactic acid in a noncompetitive manner, it was unlikely that loxoprofen uptake was mediated by high-affinity MCT(s). Our results suggest that transport of loxoprofen in Caco-2 cells is, at least in part, mediated by a proton-dependent transport system. Copyright © 2016 John Wiley & Sons, Ltd.

  6. Modulation of intestinal glucose transport in response to reduced nitrogen supply in young goats.

    PubMed

    Muscher-Banse, A S; Piechotta, M; Schröder, B; Breves, G

    2012-12-01

    The reduction of dietary protein is a common approach in ruminants to decrease the excretion of N because ruminants are able to recycle N efficiently by the rumino-hepatic circulation. In nonruminant species an impact on other metabolic pathways such as glucose metabolism was observed when dietary protein intake was reduced. However, an impact of dietary N reduction in goats on glucose metabolism especially on intestinal glucose absorption is questionable because ruminants have very efficient endogenous recycling mechanisms. Therefore, the aim of the present study was to characterize the intestinal absorption of glucose in growing goats kept on different N supply under isoenergetic conditions. The different CP concentrations (20, 16, 10, 9, and 7% CP) of the experimental diets were adjusted by adding urea to the rations. Intestinal flux rates of glucose were determined by Ussing chamber experiments. For a more mechanistic approach, the Na(+)-dependent uptake of glucose into intestinal brush-border membrane vesicles (BBMV) and the expression patterns of the Na(+)-dependent glucose transporter SGLT1 and the glucose transporter 2 (GLUT2) were determined. Reduced N intake resulted in a decrease of plasma glucose (P < 0.001) and insulin (P = 0.004) concentrations whereas the intestinal flux rates of glucose were elevated (P < 0.001), which were inhibited by phlorizin. However, the uptake of glucose into intestinal BBMV was not changed whereas the expression of SGLT1 on mRNA (P < 0.05) and protein abundance (P = 0.03) was decreased in response to a reduced N intake. The mRNA expression of GLUT2 was not affected. From these data, it can be concluded that the intestinal absorption of glucose was modulated by changes in dietary N intake. It is suggested that intracellular metabolism or basolateral transport systems or both might be activated during this feeding regimen because the apical located SGLT1 might not be involved. Therefore, an impact of dietary N reduction on

  7. Perinatal upregulation of intestinal transport of carnitine (C) in newborn pigs

    SciTech Connect

    Li, B.U.K.; Murray, R.D.; Heitlinger, L.A.; McClung, H.J.; Hughes, A.M.; O'Dorisio, T.M.; Sloan, H.R. Ohio State Univ., Columbus )

    1990-02-26

    Since C facilitates the perinatal transition from carbohydrate to lipid-derived energy, the authors examined the contribution of intestinal transport of dietary C to this process by determining (C)'s in sow's milk, pig jejunum and liver, and C flux across the jejunum (J{sub m-s}) as a function of postnatal age. The authors measured portal venous glucagon (G) and insulin (l) as potential regulatory signals and attempted to alter intestinal transport of C by infusing G. Pigs at days 1-7 (NB-newborn), 14-16 (SU-suckling) and 33-35 (WN-weanling) were studied. (C)'s in sow milk, piglet jejunum, and liver were determined. Fluxes were measured in an Ussing chamber and in an in situ recirculating jejunal perfusion. The effect of an IV infusion of G on ({sup 3}H)C absorption was evaluated in a single animal; an adjacent jejunal segment received saline. Sow's milk and liver (C)'s, and jejunal C transport were highest following birth and declined towards weaning. Plasma (G) and the G:I ratio demonstrated a parallel temporal pattern. The G-stimulated jejunal segment removed 53% of the C and the non-stimulated control segment, 8%. It was concluded that during the perinatal metabolic transition, enhanced intestinal nutrient assimilation promotes the transfer of dietary C to the liver where it could facilitate fatty acid oxidation. This pattern of upregulated intestinal transport immediately after birth may be mediated by pancreatic G and I secretion.

  8. Modulatory Effects of Vasoactive Intestinal Peptide on Intestinal Mucosal Immunity and Microbial Community of Weaned Piglets Challenged by an Enterotoxigenic Escherichia coli (K88)

    PubMed Central

    Xu, Chunlan; Wang, Youming; Sun, Rui; Qiao, Xiangjin; Shang, Xiaoya; Niu, Weining

    2014-01-01

    Toll-like receptors (TLRs) recognize microbial pathogens and trigger immune response, but their regulation by neuropeptide-vasoactive intestinal peptide (VIP) in weaned piglets infected by enterotoxigenic Escherichia coli (ETEC) K88 remains unexplored. Therefore, the study was conducted to investigate its role using a model of early weaned piglets infected by ETEC K88. Male Duroc×Landrace×Yorkshire piglets (n = 24) were randomly divided into control, ETEC K88, VIP, and ETEC K88+VIP groups. On the first three days, ETEC K88 and ETEC K88+VIP groups were orally administrated with ETEC K88, other two groups were given sterile medium. Then each piglet from VIP and ETEC K88+VIP group received 10 nmol VIP intraperitoneally (i.p.) once daily, on day four and six. On the seventh day, the piglets were sacrificed. The results indicated that administration of VIP improved the growth performance, reduced diarrhea incidence of ETEC K88 challenged pigs, and mitigated the histopathological changes of intestine. Serum levels of IL-2, IL-6, IL-12p40, IFN-γ and TNF-α in the ETEC K88+ VIP group were significantly reduced compared with those in the ETEC group. VIP significantly increased IL-4, IL-10, TGF-β and S-IgA production compared with the ETEC K88 group. Besides, VIP could inhibit the expression of TLR2, TLR4, MyD88, NF-κB p65 and the phosphorylation of IκB-α, p-ERK, p-JNK, and p-38 induced by ETEC K88. Moreover, VIP could upregulate the expression of occludin in the ileum mucosa compared with the ETEC K88 group. Colon and caecum content bacterial richness and diversity were lower for pigs in the ETEC group than the unchallenged groups. These results demonstrate that VIP is beneficial for the maturation of the intestinal mucosal immune system and elicited local immunomodulatory activities. The TLR2/4-MyD88 mediated NF-κB and MAPK signaling pathway may be critical to the mechanism underlying the modulatory effect of VIP on intestinal mucosal immune function and

  9. Molecular mechanism(s) involved in differential expression of vitamin C transporters along the intestinal tract.

    PubMed

    Subramanian, Veedamali S; Srinivasan, Padmanabhan; Wildman, Alexis J; Marchant, Jonathan S; Said, Hamid M

    2017-04-01

    Mammalian cells utilize two transporters for the uptake of ascorbic acid (AA), Na(+)-dependent vitamin C transporter SVCT-1 and SVCT-2. In the intestine, these transporters are involved in AA absorption and are expressed at the apical and basolateral membrane domains of the polarized epithelia, respectively. Little is known about the differential expression of these two transporters along the anterior-posterior axis of the intestinal tract and the molecular mechanism(s) that dictate this pattern of expression. We used mouse and human intestinal cDNAs to address these issues. The results showed a significantly lower rate of carrier-mediated AA uptake by mouse colon than jejunum. This was associated with a significantly lower level of expression of SVCT-1 and SVCT-2 at the protein, mRNA, and heterogeneous nuclear RNA (hnRNA) levels in the colon than the jejunum, implying the involvement of transcriptional mechanism(s). Similarly, expression levels of SVCT-1 and SVCT-2 mRNA and hnRNA were significantly lower in human colon. We also examined the levels of expression of hepatocyte nuclear factor 1α and specificity protein 1, which drive transcription of the Slc23a1 and Slc23a2 promoters, respectively, and found them to be markedly lower in the colon. Furthermore, significantly lower levels of the activating markers for histone (H3) modifications [H3 trimethylation of lysine 4 (H3K4me3) and H3 triacetylation of lysine 9 (H3K9ac)] were observed in the Slc23a1 and Slc23a2 promoters in the colon. These findings show, for the first time, that SVCT-1 and SVCT-2 are differentially expressed along the intestinal tract and that this pattern of expression is, at least in part, mediated via transcriptional/epigenetic mechanisms.NEW & NOTEWORTHY Our findings show, for the first time, that transporters of the water-soluble vitamin ascorbic acid (i.e., the vitamin C transporters SVCT-1 and SVCT-2) are differentially expressed along the length of the intestinal tract and that the

  10. Effect of abdominal surgery on the intestinal absorption of lipophilic drugs: possible role of the lymphatic transport.

    PubMed

    Gershkovich, Pavel; Itin, Constantin; Yacovan, Avihai; Amselem, Shimon; Hoffman, Amnon

    2009-06-01

    Although abdominal surgery is a routine procedure in clinical practice and in preclinical investigation, little is known regarding its effect on the intestinal absorption of drugs. The aim of this study was to investigate the effect of abdominal surgery on the intestinal absorption of highly lipophilic compounds with different absorption mechanisms following oral administration. The 2 compounds that were tested were biopharmaceutical classification system (BCS) class 2 model lipophilic cannabinoid derivatives, dexanabinol and PRS-211,220. Although dexanabinol is mostly absorbed via passive diffusion to the portal blood, PRS-211,220 is absorbed mostly via lymphatic transport. In this work, we compared the absorption of these compounds after abdominal surgery in rat with the absorption data obtained from naïve animals. The outcomes of this investigation showed that the abdominal surgery mostly affected the absorption process on the preenterocyte level, as indicated by the 2-fold increase in the extent of intestinal absorption of dexanabinol, which is a compound with a low degree of intestinal lymphatic transport. However, the lymphatic transport was not affected by the surgical procedure as evident by the absence of change in the extent of absorption of PRS-211,220, which is transported to the systemic circulation mainly by intestinal lymphatics. In conclusion, abdominal surgery can significantly affect the intestinal absorption of lipophilic drugs; however, intestinal lymphatic transport seems to be less affected by the abdominal surgery.

  11. Stereospecific transport of Tyr-MIF-1 across the blood-brain barrier by peptide transport system-1

    SciTech Connect

    Banks, W.A.; Kastin, A.J.; Michals, E.A.; Barrera, C.M. )

    1990-10-01

    Previous studies have suggested that peptide transport system-1 (PTS-1), the saturable system that transports Tyr-MIF-1, the enkephalins, and related peptides out of the central nervous system (CNS), exhibits stereospecificity. In the present studies, we showed that {sup 125}I-L-Tyr-MIF-1, but not {sup 131}I-D-Tyr-MIF-1, was cleared from the CNS more rapidly than could be accounted for by nonspecific mechanisms. Such clearance was inhibited by a 1.0 nmol dose of L-Tyr-MIF-1, but not by D-Tyr-MIF-1. Neither L- nor D-Tyr-MIF-1 altered the much lower clearance of I-D-Tyr-MIF-1 from the brain. Radioactivity recovered from the vascular space after the injection of {sup 125}I-Tyr-MIF-1 into the lateral ventricle of the brain eluted by HPLC primarily as intact peptide, demonstrating that most of the Tyr-MIF-1 was not degraded during transport. By contrast, the nonsaturable unidirectional influx of Tyr-MIF-1 into the CNS did not distinguish between the isomers. These studies confirm and extend the observations that Tyr-MIF-1 is transported out of the CNS by a saturable, stereospecific transport system as an intact peptide while the influx into the CNS is by a nonsaturable mechanism that does not distinguish between the isomers.

  12. Glugacon-like peptide-2: broad receptor expression, limited therapeutic effect on intestinal inflammation and novel role in liver regeneration.

    PubMed

    El-Jamal, Noura; Erdual, Edmone; Neunlist, Michel; Koriche, Dine; Dubuquoy, Caroline; Maggiotto, Francois; Chevalier, Julien; Berrebi, Dominique; Dubuquoy, Laurent; Boulanger, Eric; Cortot, Antoine; Desreumaux, Pierre

    2014-08-01

    The glucagon-like peptide 2 (GLP-2) is an intestinotrophic hormone with growth promoting and anti-inflammatory actions. However, the full biological functions of GLP-2 and the localization of its receptor (GLP-2R) remain controversial. Among cell lines tested, the expression of GLP-2R transcript was detected in human colonic myofibroblasts (CCD-18Co) and in primary culture of rat enteric nervous system but not in intestinal epithelial cell lines, lymphocytes, monocytes, or endothelial cells. Surprisingly, GLP-2R was expressed in murine (GLUTag), but not human (NCI-H716) enteroendocrine cells. The screening of GLP-2R mRNA in mice organs revealed an increasing gradient of GLP-2R toward the distal gut. An unexpected expression was detected in the mesenteric fat, mesenteric lymph nodes, bladder, spleen, and liver, particularly in hepatocytes. In two mice models of trinitrobenzene sulfonic acid (TNBS)- and dextran sulfate sodium (DSS)-induced colitis, the colonic expression of GLP-2R mRNA was decreased by 60% compared with control mice. Also, GLP-2R mRNA was significantly downregulated in intestinal tissues of inflammatory bowel disease patients. Therapeutically, GLP-2 showed a weak restorative effect on intestinal inflammation during TNBS-induced colitis as assessed by macroscopic score and inflammatory markers. Finally, GLP-2 treatment accelerated mouse liver regeneration following partial hepatectomy as assessed by histological and molecular analyses. In conclusion, the limited therapeutic effect of GLP-2 on colonic inflammation dampens its utility in the management of severe inflammatory intestinal disorders. However, the role of GLP-2 in liver regeneration is a novelty that might introduce GLP-2 into the management of liver diseases and emphasizes on the importance of elucidating other extraintestinal functions of GLP-2.

  13. Vesicular transport and apotransferrin in intestinal iron absorption, as shown in the Caco-2 cell model.

    PubMed

    Moriya, Mizue; Linder, Maria C

    2006-02-01

    The potential roles of vesicular transport and apotransferrin (entering from the blood) in intestinal Fe absorption were investigated using Caco-2 cell monolayers with tight junctions in bicameral chambers as a model. As shown previously, addition of 39 microM apotransferrin (apoTf) to the basolateral fluid during absorption studies markedly stimulated overall transport of 1 microM (59)Fe from the apical to the basal chamber and stimulated its basolateral release from prelabeled cells, implicating endo- and exocytosis. Rates of transport more than doubled. Uptake was also stimulated, but only 20%. Specific inhibitors of aspects of vesicular trafficking were applied to determine their potential effects on uptake, retention, and basolateral (overall) transport of (59)Fe. Nocodazole and 5'-(4-fluorosulfonylbenzoyl)-adenosine each reduced uptake and basolateral transport up to 50%. Brefeldin A inhibited about 10%. Tyrphostin A8 (AG10) reduced uptake 35% but markedly stimulated basolateral efflux, particularly that dependent on apoTf. Cooling of cells to 4 degrees C (which causes depolymerization of microtubules and lowers energy availability) profoundly inhibited uptake and basolateral transfer of Fe (7- to 12-fold). Apical efflux (which was substantial) was not temperature affected. Our results support the involvement of apoTf cycling in intestinal Fe absorption and indicate that as much as half of the iron uses apoTf and non-apoTf-dependent vesicular pathways to cross the basolateral membrane and brush border of enterocytes.

  14. Effect of anaerobiosis, dinitrophenol and fluoride on the active intestinal transport of galactose in snail.

    PubMed

    Barber, A; Jordana, R; Ponz, F

    1975-06-01

    The active transport of galactose across the intestinal wall (everted sacs) of the snail Cryptomphalus hortensis Müller has been studied in vitro, under several metabolic conditions. Anaerobiosis does not change the serosal/mucosal galactose gradients which are developed in oxygen atmosphere. Dinitrophenol (10(-4) M) greatly increased the O2 uptake by the tissue and clearly inhibits the sugar transport. At 5 times 10(-4) M concentration, DNP totally prevents the uphill transport while the O2 uptake is normal. The inhibition produced by DNP does not increase by anaerobiosis. Fluoride inhibits the galactose transport and also the O2 uptake. It is deduced that in snail intestine the energy for the active transport of galactose can be supplied by aerobic as much as by anaerobic metabolism. The inhibition by dinitrophenol seems to be independent of its uncoupling action on the oxidative phosphorylation. The inhibitory effect of NaF may be due both to glycolisis inhibition and to alteration of the digestive epithelium.

  15. Transepithelial transport of ambroxol hydrochloride across human intestinal Caco-2 cell monolayers.

    PubMed

    Stetinová, Vera; Smetanová, Libuse; Kholová, Dagmar; Svoboda, Zbynek; Kvetina, Jaroslav

    2009-09-01

    This study aimed i) to characterize the transepithelial transport of the mucolytic agent ambroxol hydrochloride across the intestinal barrier, ii) to classify the ambroxol according to Biopharmaceutics Classification System (BCS) and iii) to predict ambroxol absorption in humans. Transport of ambroxol (100, 300 and 1000 micromol/l) was studied in a human colon carcinoma cell line Caco-2 in apical to basolateral and basolateral to apical direction, under iso-pH 7.4 and pH-gradient (6 vs. 7.4) conditions. The relative contribution of the paracellular route was estimated using Ca2+-free transport medium. Ambroxol samples from receiver compartments were analysed by HPLC with UV detection (242 nm). Results showed that ambroxol transport is linear with time, pH-dependent and direction-independent, displays non-saturable (first-order) kinetics. Thus, the transport seems to be transcellular mediated by passive diffusion. Estimated high solubility and high permeability (P(app) = 45 x 10(-6) cm/s) of ambroxol rank it among well absorbed compounds and class I of BCS. It can be expected that the oral dose fraction of ambroxol absorbed in human intestine is high.

  16. Transporters for ammonium, amino acids and peptides are expressed in pitchers of the carnivorous plant Nepenthes.

    PubMed

    Schulze, W; Frommer, W B; Ward, J M

    1999-03-01

    Insect capture and digestion contribute substantially to the nitrogen budget of carnivorous plants. In Nepenthes, insect-derived nitrogenous compounds are imported from the pitcher fluid and transported throughout the plant via the vascular tissue to support growth. Import and distribution of nutrients may require transmembrane nitrogen transporters. Representatives of three classes of genes encoding transporters for the nitrogenous compounds ammonium, amino acids and peptides were identified in Nepenthes pitchers. The expression at the cellular level of an ammonium transporter gene, three amino acid transporter genes, and one peptide transporter gene were investigated in the insect trapping organs of Nepenthes. Expression of the ammonium transporter gene NaAMT1 was detected in the head cells of digestive glands in the lower part of the pitcher where NaAMT1 may function in ammonium uptake from the pitcher fluid. One amino acid transporter gene, NaAAP1, was expressed in bundle sheath cells surrounding the vascular tissue. To understand the locations where transmembrane transport could be required within the pitcher, symplasmic and apoplasmic continuity was probed using fluorescent dyes. Symplasmic connections were not found between cortical cells and vascular bundles. Therefore, the amino acid transporter encoded by NaAAP1 may be involved in transport of amino acids into the vascular tissue. In contrast, expression of the peptide transporter gene NaNTR1 was detected in phloem cells of the vascular tissue within pitchers. NaNTR1 may function in the export of nitrogen from the pitcher by loading peptides into the phloem.

  17. Changes in vasoactive intestinal peptide, pituitary adenylate cyclase-activating polypeptide and neuropeptide Y-ergic structures of the enteric nervous system in the carcinoma of the human large intestine.

    PubMed

    Godlewski, Janusz; Łakomy, Ireneusz Mirosław

    2010-01-01

    This investigation was aimed at immunohistochemical analysis of potential changes in the enteric nervous system caused by cancer of the large intestine. In this purpose, neurons and nerve fibers of intestinal plexuses containing neuropeptides: vasoactive intestinal peptide (VIP), pituitary adenylate cyclase-activating polypeptide (PACAP) and neuropeptide Y (NPY), in pathologically changed part of the large intestine were microscpically observed and compared. Samples were taken from patients operated due to cancer of the sigmoid colon and rectum. The number of neurons and density of nerve fibres containing neuropeptides found in sections with cancer tissues were compared to those observed in sections from the uninvolved intestinal wall. Changes relating to reductions in the number of NPY-ergic neurons and density of nerve fibres in submucous and myenteric plexuses in the sections with cancer tissues (pathological sections) were statistically significant. A statistically similar presence of VIP-ergic and PACAP-ergic neurons in the submucosal and myenteric plexuses was observed in both the pathological and control sections. On the other hand, in the pathological sections, VIP-ergic nerve fibres in the myenteric plexuses and PACAP-ergic nerve fibres in the submucosal and myenteric plexuses were found to be less dense. Analysis revealed changes in pathologically affected part of the large intestine may caused disruption of proper intestinal function. Observed changes in the neural elements which are responsible for relaxation of the intestine may suggest dysfunction in the innervation of this part of the colon.

  18. Role of sodium ion in transport of folic acid in the small intestine

    SciTech Connect

    Zimmerman, J.; Selhub, J.; Rosenberg, I.H.

    1986-08-01

    The effect of sodium on folate transport across the intestinal luminal membrane was analyzed using two techniques: the influx chamber and isoalted brush-border membrane vesicles. Preincubation of tissue in Na -free medium did not have a consistent effect on folic acid influx provided that Na was present in the test solution. Replacement of Na in the test solution by choline resulted in a significant reduction of folic acid influx. However, when intestinal sheets that had been equilibrated in Na -free solution were exposed to test solutions containing either Na , Li , K , Rb , Cs , Tris , or guanidinium as main cations, folic acid influx was not significantly decreased. Concentration-dependence studies showed that replacement of Na by Rb did not affect the saturable mechanism of folate transport. Rather, a decrease in nonsaturable folic acid uptake accounted for the slightly reduced influx observed in the presence of Rb . Experiments with brush-border membrane vesicles revealed that methotrexate uptake was significantly higher in the presence of external Na than in the presence of K , but was not different from uptake in the presence of K plus valinomycin. These data suggest that 1) the saturable component of folate transport is not Na dependent, and 2) nonsaturable transport of folic acid across the luminal membrane occurs in part through a conductive pathway that involves a negatively charged species of folate and a cation whose membrane permeability affects the rate of folate transport. The importance of Na in this process in vivo derives from the fact that Na is the most permeant cation available at the absorptive site in the small intestine.

  19. Cargo Delivery into the Brain by in vivo identified Transport Peptides

    PubMed Central

    Urich, Eduard; Schmucki, Roland; Ruderisch, Nadine; Kitas, Eric; Certa, Ulrich; Jacobsen, Helmut; Schweitzer, Christophe; Bergadano, Alessandra; Ebeling, Martin; Loetscher, Hansruedi; Freskgård, Per-Ola

    2015-01-01

    The blood-brain barrier and the blood-cerebrospinal fluid barrier prevent access of biotherapeutics to their targets in the central nervous system and therefore prohibit the effective treatment of neurological disorders. In an attempt to discover novel brain transport vectors in vivo, we injected a T7 phage peptide library and continuously collected blood and cerebrospinal fluid (CSF) using a cisterna magna cannulated conscious rat model. Specific phage clones were highly enriched in the CSF after four rounds of selection. Validation of individual peptide candidates showed CSF enrichments of greater than 1000-fold. The biological activity of peptide-mediated delivery to the brain was confirmed using a BACE1 peptide inhibitor linked to an identified novel transport peptide which led to a 40% reduction of Amyloid-β in CSF. These results indicate that the peptides identified by the in vivo phage selection approach could be useful transporters for systemically administrated large molecules into the brain with therapeutic benefits. PMID:26411801

  20. Neural regulation of intestinal nutrient absorption.

    PubMed

    Mourad, Fadi H; Saadé, Nayef E

    2011-10-01

    The nervous system and the gastrointestinal (GI) tract share several common features including reciprocal interconnections and several neurotransmitters and peptides known as gut peptides, neuropeptides or hormones. The processes of digestion, secretion of digestive enzymes and then absorption are regulated by the neuro-endocrine system. Luminal glucose enhances its own absorption through a neuronal reflex that involves capsaicin sensitive primary afferent (CSPA) fibres. Absorbed glucose stimulates insulin release that activates hepatoenteric neural pathways leading to an increase in the expression of glucose transporters. Adrenergic innervation increases glucose absorption through α1 and β receptors and decreases absorption through activation of α2 receptors. The vagus nerve plays an important role in the regulation of diurnal variation in transporter expression and in anticipation to food intake. Vagal CSPAs exert tonic inhibitory effects on amino acid absorption. It also plays an important role in the mediation of the inhibitory effect of intestinal amino acids on their own absorption at the level of proximal or distal segment. However, chronic extrinsic denervation leads to a decrease in intestinal amino acid absorption. Conversely, adrenergic agonists as well as activation of CSPA fibres enhance peptides uptake through the peptide transporter PEPT1. Finally, intestinal innervation plays a minimal role in the absorption of fat digestion products. Intestinal absorption of nutrients is a basic vital mechanism that depends essentially on the function of intestinal mucosa. However, intrinsic and extrinsic neural mechanisms that rely on several redundant loops are involved in immediate and long-term control of the outcome of intestinal function.

  1. The Intestinal Transport of Bovine Milk Exosomes Is Mediated by Endocytosis in Human Colon Carcinoma Caco-2 Cells and Rat Small Intestinal IEC-6 Cells123

    PubMed Central

    Wolf, Tovah; Baier, Scott R; Zempleni, Janos

    2015-01-01

    Background: MicroRNAs play essential roles in gene regulation. A substantial fraction of microRNAs in tissues and body fluids is encapsulated in exosomes, thereby conferring protection against degradation and a pathway for intestinal transport. MicroRNAs in cow milk are bioavailable in humans. Objective: This research assessed the transport mechanism of bovine milk exosomes, and therefore microRNAs, in human and rodent intestinal cells. Methods: The intestinal transport of bovine milk exosomes and microRNAs was assessed using fluorophore-labeled bovine milk exosomes in human colon carcinoma Caco-2 cells and rat small intestinal IEC-6 cells. Transport kinetics and mechanisms were characterized using dose-response studies, inhibitors of vesicle transport, carbohydrate competitors, proteolysis of surface proteins on cells and exosomes, and transepithelial transport in transwell plates. Results: Exosome transport exhibited saturation kinetics at 37°C [Michaelis constant (Km) = 55.5 ± 48.6 μg exosomal protein/200 μL of media; maximal transport rate = 0.083 ± 0.057 ng of exosomal protein · 81,750 cells−1 · h−1] and decreased by 64% when transport was measured at 4°C, consistent with carrier-mediated transport in Caco-2 cells. Exosome uptake decreased by 61–85% under the following conditions compared with controls in Caco-2 cells: removal of exosome and cell surface proteins by proteinase K, inhibition of endocytosis and vesicle trafficking by synthetic inhibitors, and inhibition of glycoprotein binding by carbohydrate competitors. When milk exosomes, at a concentration of 5 times the Km, were added to the upper chamber in transwell plates, Caco-2 cells accumulated miR-29b and miR-200c in the lower chamber, and reverse transport was minor. Transport characteristics were similar in IEC-6 cells and Caco-2 cells, except that substrate affinity and transporter capacity were lower and higher, respectively. Conclusion: The uptake of bovine milk exosomes is

  2. Intestinal ammonia transport in freshwater and seawater acclimated rainbow trout (Oncorhynchus mykiss): evidence for a Na+ coupled uptake mechanism.

    PubMed

    Rubino, Julian G; Zimmer, Alex M; Wood, Chris M

    2015-05-01

    In vitro gut sac experiments were performed on freshwater and 60% seawater acclimated trout (Oncorhynchus mykiss) under treatments designed to discern possible mechanisms of intestinal ammonia transport. Seawater acclimation increased ammonia flux rate into the serosal saline (Jsamm) in the anterior intestine, however it did not alter Jsamm in the mid- or posterior intestine suggesting similar mechanisms of ammonia handling in freshwater and seawater fish. Both fluid transport rate (FTR) and Jsamm were inhibited in response to basolateral ouabain treatment, suggesting a linkage of ammonia uptake to active transport, possibly coupled to fluid transport processes via solvent drag. Furthermore, decreases in FTR and Jsamm caused by low Na(+) treatment indicated a Na(+) linked transport mechanism. Mucosal bumetanide (10(-4) M) had no impact on FTR, yet decreased Jsamm in the anterior and mid-intestine, suggesting NH4(+) substitution for K(+) on an apical NKCC, and at least a partial uncoupling of ammonia transport from fluid transport. Additional treatments (amiloride, 5-(N-ethyl-N-isopropyl)amiloride (EIPA), phenamil, bafilomycin, 4',6-diamidino-2-phenylindole (DAPI), high sodium) intended to disrupt alternative routes of Na(+) uptake yielded no change in FTR or Jsamm, suggesting the absence of direct competition between Na(+) and ammonia for transport. Finally, [(14)C]methylamine permeability (PMA) measurements indicated the likely presence of an intestinal Rh-mediated ammonia transport system, as increasing NH4Cl (0, 1, 5 mmol l(-1)) concentrations reduced PMA, suggesting competition for transport through Rh proteins. Overall, the data presented in this paper provide some of the first insights into mechanisms of teleost intestinal ammonia transport.

  3. Peptide Transport through the Blood-Brain Barrier

    DTIC Science & Technology

    1989-01-01

    analogues for treatment of membiry,.ACIH analogues for treatmen of post-traumatic epilepsy), should these peptides be capable of traversing the BBB...thus far. In addition, since cationization does not destroy immunoglobulin G antigenicity, the use of cationized immunoglobulins may be used for... aerosolized insulin. Mixed-meal studies and long-term use in Type I diabetes. N. Engl. J. Med. 312:1078-1084. 12. Pardridge, W.M. (1988): Recent advances in

  4. Abundant distribution of locustatachykinin-like peptide in the nervous system and intestine of the cockroach Leucophaea maderae.

    PubMed

    Muren, J E; Lundquist, C T; Nässel, D R

    1995-06-29

    An antiserum raised to the locust neuropeptide locustatachykinin I (LomTK I) was used for analysis of the distribution of tachykinin-related peptide in the cockroach Leucophaea maderae. Extracts of dissected brains, suboesophageal ganglia, thoracic ganglia and midguts were separated by high performance liquid chromatography and the fractions analysed in enzyme-linked immunosorbent assay with use of the LomTK antiserum. Each of the tissues was found to contain LomTK-like immunoreactive (LomTK-LI) components with retention times corresponding approximately to synthetic LomTK I and II and callitachykinins I and II. The LomTK antiserum was also used for immunocytochemical mapping of peptide in the nervous system and intestine of L. maderae. A large number of LomTK-LI interneurons were detected in the proto-, deuto- and tritocerebrum of the brain and in the suboesophaegeal ganglion. The immunoreactive neurons supply processes to most parts of the brain: the central body, protocerebral bridge, mushroom body calyces, antennal lobes, optic lobe and most regions of the non-glomerular neuropil. A few protocerebral neurons send LomTK-LI processes to the glandular lobe of the corpora cardiaca. In each of the thoracic ganglia there are six LomTK-LI interneurons and in each of the unfused abdominal ones there are two interneurons. The fused terminal ganglion contains some additional cell bodies in the posterior neuromers. LomTK-LI cell bodies were detected in the frontal ganglion and fibres were seen in this ganglion as well as in the hypocerebral ganglion. The frontal ganglion supplies LomTK-LI processes to the muscle layer of the pharynx. The muscle layer of the midgut is innervated by LomTK-LI fibres from the stomatogastric system (oesophageal nerve and associated ganglia). Additionally the midgut contains numerous LomTK-LI endocrine cells. A number of the pharyngeal dilator muscles were also found to be innervated by LomTK-LI fibres, probably derived from cell bodies in the

  5. Evidence of lactoferrin transportation into blood circulation from intestine via lymphatic pathway in adult rats.

    PubMed

    Takeuchi, Takashi; Kitagawa, Hiroshi; Harada, Etsumori

    2004-05-01

    Using adult rats, the characteristic transporting system for lactoferrin (LF) from intestinal lumen into the blood circulation was investigated. The rats were randomly divided into two groups, a non-collected thoracic lymph (NC) group and a collected thoracic lymph (LC) group. Peripheral blood and thoracic lymph were collected from a jugular vein and a thoracic lymph duct, respectively, under anaesthesia. Bovine LF (bLF) was infused into the duodenal lumen by needle over a 1-min period at a dose of 1 g kg(-1). The transported bLF in the plasma and lymph was assayed quantitatively by double-antibody enzyme-linked immunosorbent assay (ELISA). Morphological investigation was also carried out in the intestine, lymph node, and liver. Following intraduodenal administration of bLF, the transported bLF in the NC group was detected in the plasma, and reached a peak value at 2 h. Furthermore, the bLF concentration in the thoracic duct lymph fluid in the LC group increased significantly, and peaked 2 h after the administration. In addition, bLF was not detected in the plasma of the LC group. Immunohistochemical analysis clearly showed anti-bLF positive particles in the epithelial cells of the apical villi. The striated border and baso-lateral membrane were also bLF positive. These results suggest that intraduodenally infused bLF is transported into the blood circulation via the lymphatic pathway, not via portal circulation in adult rats.

  6. Mixing and Transport in the Small Intestine: A Lattice-Boltzmann Model

    NASA Astrophysics Data System (ADS)

    Banco, Gino; Brasseur, James; Wang, Yanxing; Aliani, Amit; Webb, Andrew

    2007-11-01

    The two primary functions of the small intestine are absorption of nutrients into the blood stream and transport of material along the gut for eventual evacuation. The primary transport mechanism is peristalsis. The time scales for absorption, however, rely on mixing and transport of molecules between the bulk flow and epithelial surface. Two basic motions contribute to mixing: peristalsis and repetitive segmental contraction of short segments of the gut. In this study we evaluate the relative roles of peristalsis vs. segmental contraction on the degree of mixing and time scales of nutrient transport to the epithelium using a two-dimensional model of flow and mixing in the small intestine. The model uses the lattice-Boltzmann framework with second-order moving boundary conditions and passive scalar (Sc = 10). Segmental and peristaltic contractions were parameterized using magnetic resonance imaging data from rat models. The Reynolds numbers (1.9), segment lengths (33 mm), max radii (2.75 mm) and occlusion ratios (0.33) were matched for direct comparison. Mixing is quantified by the rate of dispersion of scalar from an initial concentration in the center of the segment. We find that radial mixing is more rapid with segmental than peristaltic motion, that radial dispersion is much more rapid than axial, and that axial is comparable between the motions.

  7. Transport, metabolism, and endosomal trafficking-dependent regulation of intestinal fructose absorption

    PubMed Central

    Patel, Chirag; Douard, Veronique; Yu, Shiyan; Gao, Nan; Ferraris, Ronaldo P.

    2015-01-01

    Dietary fructose that is linked to metabolic abnormalities can up-regulate its own absorption, but the underlying regulatory mechanisms are not known. We hypothesized that glucose transporter (GLUT) protein, member 5 (GLUT5) is the primary fructose transporter and that fructose absorption via GLUT5, metabolism via ketohexokinase (KHK), as well as GLUT5 trafficking to the apical membrane via the Ras-related protein-in-brain 11 (Rab11)a-dependent endosomes are each required for regulation. Introducing fructose but not lysine and glucose solutions into the lumen increased by 2- to 10-fold the heterogeneous nuclear RNA, mRNA, protein, and activity levels of GLUT5 in adult wild-type mice consuming chow. Levels of GLUT5 were >100-fold that of candidate apical fructose transporters GLUTs 7, 8, and 12 whose expression, and that of GLUT 2 and the sodium-dependent glucose transporter protein 1 (SGLT1), was not regulated by luminal fructose. GLUT5-knockout (KO) mice exhibited no facilitative fructose transport and no compensatory increases in activity and expression of SGLT1 and other GLUTs. Fructose could not up-regulate GLUT5 in GLUT5-KO, KHK-KO, and intestinal epithelial cell-specific Rab11a-KO mice. The fructose-specific metabolite glyceraldehyde did not increase GLUT5 expression. GLUT5 is the primary transporter responsible for facilitative absorption of fructose, and its regulation specifically requires fructose uptake and metabolism and normal GLUT5 trafficking to the apical membrane.—Patel, C., Douard, V., Yu, S., Gao, N., Ferraris, R. P. Transport, metabolism, and endosomal trafficking-dependent regulation of intestinal fructose absorption. PMID:26071406

  8. Differential cellular expression of organic anion transporting peptides OATP1A2 and OATP2B1 in the human retina and brain: implications for carrier-mediated transport of neuropeptides and neurosteriods in the CNS.

    PubMed

    Gao, Bo; Vavricka, Stephan R; Meier, Peter J; Stieger, Bruno

    2015-07-01

    Organic anion transporting polypeptides (OATPs) are polyspecific organic anion transporters, which are expressed in the blood-brain barrier, the choroid plexus, and other organs. The physiologic function of OATPs in extrahepatic tissues remains ambiguous. In rat retina, members of the OATP family are expressed. We therefore investigated the human retina for the expression of OATP1A2 and OATP2B1 and extended the study to human brain. Furthermore, we searched for peptide neurotransmitters as novel OATP substrates. OATP1A2 displayed a broad expression pattern in human retina as assessed by immunofluorescence localization. It is expressed in photoreceptor bodies and somas of amacrine cells. OATP1B2 expression is restricted to the inner nuclear layer and to the inner plexiform layer. Using paraffin sections from human cortex, cerebellum, and hippocampus, OATP1A2 was localized to neurons and neuronal processes, while OATP2B1 is expressed in endothelial cells of brain capillaries. Substance P and vasoactive intestinal peptide were identified as substrates for OATP1A2 and OATP2B1. Double-labeling immunofluorescence of human retina demonstrated the presence of substance P and of vasoactive intestinal peptides in neurons expressing OATP1A2 and OATP2B1, respectively. The expression of OATP1A2 and OATP2B1 in retinal neurons implies a role of these transporters in the reuptake of peptide neurotransmitters released from retinal neurons. The abundant expression of OATP1A2 in brain neurons points to the possibility that OATP1A2 could be involved in the homeostasis of neurosteroids. The high expression of OATP2B1 in brain capillaries supports an important function of OATPs in substance penetration across the blood-brain barrier.

  9. Absorption-enhancing effects of gemini surfactant on the intestinal absorption of poorly absorbed hydrophilic drugs including peptide and protein drugs in rats.

    PubMed

    Alama, Tammam; Kusamori, Kosuke; Katsumi, Hidemasa; Sakane, Toshiyasu; Yamamoto, Akira

    2016-02-29

    In general, the intestinal absorption of small hydrophilic molecules and macromolecules like peptides, after oral administration is very poor. Absorption enhancers are considered to be one of the most promising agents to enhance the intestinal absorption of drugs. In this research, we focused on a gemini surfactant, a new type of absorption enhancer. The intestinal absorption of drugs, with or without sodium dilauramidoglutamide lysine (SLG-30), a gemini surfactant, was examined by an in situ closed-loop method in rats. The intestinal absorption of 5(6)-carboxyfluorescein (CF) and fluorescein isothiocyanate-dextrans (FDs) was significantly enhanced in the presence of SLG-30, such effect being reversible. Furthermore, the calcium levels in the plasma significantly decreased when calcitonin was co-administered with SLG-30, suggestive of the increased intestinal absorption of calcitonin. In addition, no significant increase in the of lactate dehydrogenase (LDH) activity or in protein release from the intestinal epithelium was observed in the presence of SLG-30, suggestive of the safety of this compound. These findings indicate that SLG-30 is an effective absorption-enhancer for improving the intestinal absorption of poorly absorbed drugs, without causing serious damage to the intestinal epithelium.

  10. Phorbol esters alter adenylate cyclase responses to vasoactive intestinal peptide and forskolin in the GH cell line

    SciTech Connect

    Summers, S.; Florio, T.; Cronin, M.

    1986-05-01

    Activation of protein kinase C with phorbol ester modifies cyclic AMP production in several anterior pituitary cell systems. In the GH cell line from a rat pituitary tumor, exposure to phorbol 12-myristate 13-acetate (PMA: 100 nM) for 30 minutes significantly reduces vasoactive intestinal peptide (VIP: 100 nM) stimulated adenylate cyclase (AC) activity in subsequent membrane preparations to 62 + 4% of control (n = 6 independent studies). In contrast, these same membrane preparations respond to forskolin (1 ..mu..M) with significantly more activity, 130 +/- 6% of controls (n = 6 independent studies). Finally, phorbol ester does not block an inhibitory hormone input into the AC system; somatostatin (100 nM) reduction of VIP-stimulated AC activity is not significantly different in membrane preparations from PMA treated and control cells (n = 3 independent studies). These other findings lead the authors to propose that protein kinase C can modify several sites in the AC complex in anterior pituitary cells.

  11. Na+/glucose co-transporter abundance and activity in the small intestine of lambs: enhancement by abomasal infusion of casein.

    PubMed

    Mabjeesh, Sameer J; Guy, Dafna; Sklan, David

    2003-05-01

    The purpose of the present study was to determine the effect of abomasal casein infusion on glucose uptake and abundance of the Na+/glucose co-transporter (SGLT1) 1 in the ovine small intestine. Lambs (body weight 35 (sem 1.0) kg) were surgically fitted with abomasal infusion catheters and were fed diets containing equal portions of wheat hay and cracked maize. Lambs were infused with either 500 g water/d or with 500 g water containing 35 g casein/d. The infusion period lasted 10 d, after which lambs were killed, exsanguinated and eviscerated. Brush border membrane vesicles (BBMV) were prepared using mucosa from different small intestinal regions. Intake and total tract digestibility of nutrients were similar between treatments and averaged 1134, 1142 and 486 g/d and 67, 70, and 94 % for DM, organic matter and non-structural carbohydrates respectively. Crude protein (Nx6.25) digestibility was 15 % greater in the casein-infused than control lambs. Glucose uptake to BBMV ranged from 101 to 337 pmol/mg protein per s along the small intestine and was greatest in the mid-section of the small intestine. In the mid-jejunum, glucose uptake was greater (P<0.07) in lambs infused with casein and averaged 120 pmol/mg protein per s compared with 68 pmol/mg protein per s in the control group. SGLT1 affinity was similar between treatments and averaged 104 microm in the different segments of the small intestine of lambs. However, lambs infused with casein exhibited similar values along the small intestine and affinity averaged 106 microm, while in the control group a greater affinity (85 microm) was measured in the mid-jejunum. SGLT1 protein abundance was correlated with glucose uptake in the BBMV in the casein-treated lambs, but not in the control group. These results suggest that glucose uptake along the small intestine of lambs is influenced by casein or its derivatives in the small intestine via SGLT1 affinity and activity at the brush border membrane, and that SGLT1 activity

  12. Characterization and Regulation of the Amino Acid Transporter SNAT2 in the Small Intestine of Piglets

    PubMed Central

    Tan, Bie; Wang, Jing; Kong, Xiangfeng; Guan, Guiping; Li, Fengna; Yin, Yulong

    2015-01-01

    The sodium-dependent neutral amino acid transporter 2 (SNAT2), which has dual transport/receptor functions, is well documented in eukaryotes and some mammalian systems, but has not yet been verified in piglets. The objective of this study was to investigate the characteristics and regulation of SNAT2 in the small intestine of piglets. The 1,521-bp porcine full cDNA sequence of SNAT2 (KC769999) from the small intestine of piglets was cloned. The open reading frame of cDNA encodes 506 deduced amino acid residues with a calculated molecular mass of 56.08 kDa and an isoelectric point (pI) of 7.16. Sequence alignment and phylogenetic analysis revealed that SNAT2 is highly evolutionarily conserved in mammals. SNAT2 mRNA can be detected in the duodenum, jejunum and ileum by real-time quantitative PCR. During the suckling period from days 1 to 21, the duodenum had the highest abundance of SNAT2 mRNA among the three segments of the small intestine. There was a significant decrease in the expression of SNAT2 mRNA in the duodenal and jejunal mucosa and in the expression of SNAT2 protein in the jejunal and ileal mucosa on day 1 after weaning (P < 0.05). Studies with enterocytes in vitro showed that amino acid starvation and supplementation with glutamate, arginine or leucine enhanced, while supplementation with glutamine reduced, SNAT2 mRNA expression (P < 0.05). These results regarding the characteristics and regulation of SNAT2 should help to provide some information to further clarify its roles in the absorption of amino acids and signal transduction in the porcine small intestine. PMID:26107628

  13. Intestinal peptides as circulating hormones: release of tachykinin-related peptide from the locust and cockroach midgut.

    PubMed

    Winther, A M; Nässel, D R

    2001-04-01

    Tachykinin-related peptides (TRPs) in the locust Locusta migratoria and the cockroach Leucophaea maderae have stimulatory effects on some muscles that are not innervated by TRP-containing neurons. Thus, these tissues may be affected by circulating TRPs. Here, we have investigated whether the midgut is the source of circulating TRPs. TRP-immunoreactive material in the locust midgut is found only in the endocrine cells of the gut epithelium. In both species of insect, the endocrine cells contain several isoforms of TRPs, as determined by immunocytochemistry and a combination of chromatography (HPLC) and enzyme immunoassay (ELISA). The release of TRPs was investigated by ELISA using isolated midguts of the locust and cockroach. Elevated levels of K(+) in the bathing saline induced the release of TRP from the midgut of both species. To examine the release of TRPs into the circulation in vivo, we measured haemolymph levels of TRPs in fed and starved locusts. The concentration of TRP-immunoreactive material in fed locusts was estimated to be 0.15 nmol l(-1), and this increased approximately fourfold in insects starved for 24 h. In accordance with this observation, the content of TRP-immunoreactive material in the midgut was lower in starved locusts than in fed locusts. Although part of the increased blood concentration of TRPs may be due to reduced blood volume, our data suggest that TRPs are released as hormones from the midgut of the locust and cockroach and that this release may be linked to nutritional status.

  14. F-18 Labeled Vasoactive Intestinal Peptide Analogue in the PET Imaging of Colon Carcinoma in Nude Mice

    PubMed Central

    Liu, Yuxia; Shen, Hua; Pang, Lifang; Yin, Duanzhi; Wang, Yongxian; Li, Shanqun; Shi, Hongcheng

    2013-01-01

    As large amount of vasoactive intestinal peptide (VIP) receptors are expressed in various tumors and VIP-related diseases, radiolabeled VIP provides a potential PET imaging agent for VIP receptor. However, structural modification of VIP is required before being radiolabeled and used for VIP receptor imaging due to its poor in vivo stability. As a VIP analogue, [R8, 15, 21, L17]-VIP exhibited improved stability and receptor specificity in preliminary studies. In this study, F-18 labeled [R8,15,21, L17]-VIP was produced with the radiochemical yield being as high as 33.6% ± 3% (decay-for-corrected, n = 5) achieved within 100 min, a specific activity of 255 GBq/μmol, and a radiochemical purity as high as 99% as characterized by radioactive HPLC, TLC, and SDS-Page radioautography. A biodistribution study in normal mice also demonstrated fast elimination of F-18 labeled [R8,15,21, L17]-VIP in the blood, liver, and gastrointestinal tracts. A further micro-PET imaging study in C26 colon carcinoma bearing mice confirmed the high tumor specificity, with the tumor/muscle radioactivity uptake ratio being as high as 3.03 at 60 min following injection, and no apparent radioactivity concentration in the intestinal tracts. In addition, blocking experiment and Western Blot test further confirmed its potential in PET imaging of VIP receptor-positive tumor. PMID:24459669

  15. Protective effect of quercetin on pig intestinal integrity after transport stress is associated with regulation oxidative status and inflammation

    PubMed Central

    ZOU, Yi; WEI, Hong Kui; XIANG, Quan-Hang; WANG, Jun; ZHOU, Yuan-Fei; PENG, Jian

    2016-01-01

    This experiment was conducted to evaluate the effects of quercetin supplementation on intestinal integrity, intestinal reactive oxygen species (ROS) levels and intestinal inflammation in pigs under transport stress. A total of 170 finishing pigs were randomly assigned into two groups. Animals in the control group consumed a basal diet, while those in the treatment group consumed the same diet supplemented with 25 mg quercetin per kg feed. After a 4-week period, pigs were transported for 5 hr. The quercetin-supplemented pigs showed decreased serum levels of endotoxin (P<0.05), increased height of jejunum villi (P<0.05), and increased occludin and zonula occudens-1 (ZO-1) mRNA expression in the jejunum (P<0.05). These parameters are associated with intestinal health and were markedly improved by quercetin supplementation. Pigs consuming the quercetin-supplemented diet had lower intestinal levels of ROS and malondialdehyde (MDA) compared with the control group (P<0.05). This finding coincided with greater inhibition of the innate immune system (P<0.05), including mitogen-activated protein kinase (MAPK), protein kinase B (Akt) and nuclear factor κB (NF-κB) signaling pathways, as well as decreased expression of inflammatory cytokines in the jejunum. These results indicate that quercetin alleviates intestinal injury in pigs during transport, probably through modulation of intestinal oxidative status and inflammation. PMID:27301842

  16. Dysfunction of Organic Anion Transporting Polypeptide 1a1 Alters Intestinal Bacteria and Bile Acid Metabolism in Mice

    PubMed Central

    Zhang, Youcai; Limaye, Pallavi B.; Lehman-McKeeman, Lois D.; Klaassen, Curtis D.

    2012-01-01

    Organic anion transporting polypeptide 1a1 (Oatp1a1) is predominantly expressed in liver and is able to transport bile acids (BAs) in vitro. Male Oatp1a1-null mice have increased concentrations of taurodeoxycholic acid (TDCA), a secondary BA generated by intestinal bacteria, in both serum and livers. Therefore, in the present study, BA concentrations and intestinal bacteria in wild-type (WT) and Oatp1a1-null mice were quantified to investigate whether the increase of secondary BAs in Oatp1a1-null mice is due to alterations in intestinal bacteria. The data demonstrate that Oatp1a1-null mice : (1) have similar bile flow and BA concentrations in bile as WT mice; (2) have a markedly different BA composition in the intestinal contents, with a decrease in conjugated BAs and an increase in unconjugated BAs; (3) have BAs in the feces that are more deconjugated, desulfated, 7-dehydroxylated, 3-epimerized, and oxidized, but less 7-epimerized; (4) have 10-fold more bacteria in the small intestine, and 2-fold more bacteria in the large intestine which is majorly due to a 200% increase in Bacteroides and a 30% reduction in Firmicutes; and (5) have a different urinary excretion of bacteria-related metabolites than WT mice. In conclusion, the present study for the first time established that lack of a liver transporter (Oatp1a1) markedly alters the intestinal environment in mice, namely the bacteria composition. PMID:22496825

  17. Transport and uptake effects of marine complex lipid liposomes in small intestinal epithelial cell models.

    PubMed

    Du, Lei; Yang, Yu-Hong; Xu, Jie; Wang, Yu-Ming; Xue, Chang-Hu; Kurihara, Hideyuki; Takahashi, Koretaro

    2016-04-01

    Nowadays, marine complex lipids, including starfish phospholipids (SFP) and cerebrosides (SFC) separated from Asterias amurensis as well as sea cucumber phospholipids (SCP) and cerebrosides (SCC) isolated from Cucumaria frondosa, have received much attention because of their potent biological activities. However, little information is known on the transport and uptake of these lipids in liposome forms in small intestinal cells. Therefore, this study was undertaken to investigate the effects of these complex lipid liposomes on transport and uptake in Caco-2 and M cell monolayer models. The results revealed that SFP and SCP contained 42% and 47.9% eicosapentaenoic acid (EPA), respectively. The average particle sizes of liposomes prepared in this study were from 169 to 189 nm. We found that the transport of the liposomes across the M cell monolayer model was much higher than the Caco-2 cell monolayer model. The liposomes consisting of SFP or SCP showed significantly higher transport and uptake than soy phospholipid (soy-PL) liposomes in both Caco-2 and M cell monolayer models. Our results also exhibited that treatment with 1 mM liposomes composed of SFP or SCP for 3 h tended to increase the EPA content in phospholipid fractions of both differentiated Caco-2 and M cells. Moreover, it was also found that the hybrid liposomes consisting of SFP/SFC/cholesterol (Chol) revealed higher transport and uptake across the M cell monolayer in comparison with other liposomes. Furthermore, treatment with SFP/SFC/Chol liposomes could notably decrease the trans-epithelial electrical resistance (TEER) values of Caco-2 and M cell monolayers. The present data also showed that the cell viability of differentiated Caco-2 and M cells was not affected after the treatment with marine complex lipids or soy-PL liposomes. Based on the data in this study, it was suggested that marine complex lipid liposomes exhibit prominent transport and uptake in small intestinal epithelial cell models.

  18. Amphipathic polyproline peptides stimulate cholesterol efflux by the ABCA1 transporter.

    PubMed

    Sviridov, D O; Drake, S K; Freeman, L A; Remaley, A T

    2016-03-18

    ApoA-I mimetics are short synthetic peptides that contain an amphipathic α-helix and stimulate cholesterol efflux by the ABCA1 transporter in a detergent-like extraction mechanism. We investigated the use of amphipathic peptides with a polypro helix for stimulating cholesterol efflux by ABCA1. Polypro peptides were synthesized with modified prolines, containing either a hydrophobic phenyl group (Prop) or a polar N-acetylgalactosamine (Prog) attached to the pyrrolidine ring and were designated as either PP-2, 3, 4, or 5, depending on the number of 3 amino acid repeat units (Prop-Prog-Prop). Based on molecular modeling, these peptides were predicted to be relatively rigid and to bind to a phospholipid bilayer. By CD spectroscopy, PP peptides formed a Type-II polypro helix in an aqueous solution. PP-2 was inactive in promoting cholesterol efflux, but peptides with more than 2 repeat units were active. PP-4 showed a similar Vmax as a much longer amphipathic α-helical peptide, containing 37 amino acids, but had a Km that was approximately 20-fold lower. PP peptides were specific in that they did not stimulate cholesterol efflux from cells not expressing ABCA1 and were also non-cytotoxic. Addition of PP-3, 4 and 5 to serum promoted the formation of smaller size HDL species (7 nM) and increased its capacity for ABCA1-dependent cholesterol efflux by approximately 20-35% (p < 0.05). Because of their relatively small size and increased potency, amphipathic peptides with a polypro helix may represent an alternative structural motif for the development of apoA-I mimetic peptides.

  19. Utilization of peptide carrier system to improve intestinal absorption: targeting prolidase as a prodrug-converting enzyme

    NASA Technical Reports Server (NTRS)

    Bai, J. P.; Hu, M.; Subramanian, P.; Mosberg, H. I.; Amidon, G. L.

    1992-01-01

    The feasibility of targeting prolidase as a peptide prodrug-converting enzyme has been examined. The enzymatic hydrolysis by prolidase of substrates for the peptide transporter L-alpha-methyldopa-pro and several dipeptide analogues without an N-terminal alpha-amino group (phenylpropionylproline, phenylacetylproline, N-benzoylproline, and N-acetylproline) was investigated. The Michaelis-Menten parameters Km and Vmax for L-alpha-methyldopa-pro are 0.09 +/- 0.02 mM and 3.98 +/- 0.25 mumol/min/mg protein, respectively. However, no hydrolysis of the dipeptide analogues without an N-terminal alpha-amino group is observed, suggesting that an N-terminal alpha-amino group is required for prolidase activity. These results demonstrate that prolidase may serve as a prodrug-converting enzyme for the dipeptide-type prodrugs, utilizing the peptide carrier for transport of prodrugs into the mucosal cells and prolidase, a cytosolic enzyme, to release the drug. However, a free alpha-amino group appears to be necessary for prolidase hydrolysis.

  20. Influence of renovascular hypertension on the distribution of vasoactive intestinal peptide in the stomach and heart of rats.

    PubMed

    Kasacka, Irena; Piotrowska, Żaneta; Janiuk, Izabela

    2015-11-01

    Arterial hypertension is associated with serious dysfunction of the cardiovascular system and digestive system. Given the relevant role of vasoactive intestinal peptide (VIP) in the regulation of digestion process, control of blood pressure and heart rate as well as cardio- and gastro-protective character of the peptide, it appeared worthwhile to undertake the research aimed at immunohistochemical identification and evaluation of VIP-positive structures in the pylorus and heart of hypertensive rats. Up to now, this issue has not been investigated. The experimental model of hypertension in rats according to Goldblatt (two-kidney one clip model of hypertension) was used in the study. The experimental material (pylorus and heart) was collected in the sixth week of the study. VIP-containing structures were evaluated using immunohistochemical and morphometric methods. The analysis of the results showed a significant increase in the number of immunoreactive VIP structures and in the intensity of immunohistochemical staining in the stomach and in the heart of hypertensive rats. Our findings indicate that VIP is an important regulator of cardiovascular and digestive system in physiological and pathological conditions. However, to better understand the exact role of VIP in hypertension further studies need to be carried out.

  1. Vasoactive intestinal peptide binding sites and fibers in the brain of the pigeon Columba livia: An autoradiographic and immunohistochemical study

    SciTech Connect

    Hof, P.R.; Dietl, M.M.; Charnay, Y.; Martin, J.L.; Bouras, C.; Palacios, J.M.; Magistretti, P.J. )

    1991-03-15

    The distribution of vasoactive intestinal peptide (VIP) binding sites in the pigeon brain was examined by in vitro autoradiography on slide-mounted sections. A fully characterized monoiodinated form of VIP, which maintains the biological activity of the native peptide, was used throughout this study. The highest densities of binding sites were observed in the hyperstriatum dorsale, archistriatum, auditory field L of neostriatum, area corticoidea dorsolateralis and temporo-parieto-occipitalis, area parahippocampalis, tectum opticum, nucleus dorsomedialis anterior thalami, and in the periventricular area of the hypothalamus. Lower densities of specific binding occurred in the neostriatum, hyperstriatum ventrale and nucleus septi lateralis, dorsolateral area of the thalamus, and lateral and posteromedial hypothalamus. Very low to background levels of VIP binding were detected in the ectostriatum, paleostriatum primitivum, paleostriatum augmentatum, lobus parolfactorius, nucleus accumbens, most of the brainstem, and the cerebellum. The distribution of VIP-containing fibers and terminals was examined by indirect immunofluorescence using a polyclonal antibody against porcine VIP. Fibers and terminals were observed in the area corticoidea dorsolateralis, area parahippocampalis, hippocampus, hyperstriatum accessorium, hyperstriatum dorsale, archistriatum, tuberculum olfactorium, nuclei dorsolateralis and dorsomedialis of the thalamus, and throughout the hypothalamus and the median eminence. Long projecting fibers were visualized in the tractus septohippocampalis. In the brainstem VIP immunoreactive fibers and terminals were observed mainly in the substantia grisea centralis, fasciculus longitudinalis medialis, lemniscus lateralis, and in the area surrounding the nuclei of the 7th, 9th, and 10th cranial nerves.

  2. Collagen peptides ameliorate intestinal epithelial barrier dysfunction in immunostimulatory Caco-2 cell monolayers via enhancing tight junctions.

    PubMed

    Chen, Qianru; Chen, Oliver; Martins, Isabela M; Hou, Hu; Zhao, Xue; Blumberg, Jeffrey B; Li, Bafang

    2017-03-22

    Dysfunction of the intestinal barrier plays a key role in the pathogenesis of inflammatory bowel disease (IBD) and multiple organ failure. The effect of Alaska pollock skin-derived collagen and its 3 tryptic hydrolytic fractions, HCP (6 kDa retentate), MCP (3 kDa retentate) and LCP (3 kDa permeate) on TNF-α induced barrier dysfunction was investigated in Caco-2 cell monolayers. TNF-α induced barrier dysfunction was significantly attenuated by the collagen and its peptide fractions, especially LCP, compared to TNF-α treated controls (P < 0.05). Compared to a negative control, 24 h pre-incubation with 2 mg mL(-1) LCP significantly alleviated the TNF-α induced breakdown of the tight junction protein ZO-1 and occludin and inhibited MLC phosphorylation and MLCK expression. The activation of NFκB and Elk-1 was suppressed by LCP. Thus, collagen peptides may attenuate TNF-α induced barrier dysfunction of Caco-2 cells by inhibiting the NFκB and ERK1/2-mediated MLCK pathway with associated decreases in ZO-1 and occludin protein expression.

  3. Amino acid and peptide absorption after proximal small intestinal resection in the rat.

    PubMed Central

    Garrido, A B; Freeman, H J; Chung, Y C; Kim, Y S

    1979-01-01

    In experimental animals with massive proximal intestinal resection, in vivo ileal absorption of an amino acid mixture containing L-leucine and glycine as well as two different dipeptides, L-leucyl-glycine and glycyl-L-leucine, were compared. Both amino acid and dipeptide absorption were markedly enhanced in the ileal segments. However, the absorption rates from the two perfused dipeptides differed. L-leucine absorption from L-leucyl-glycine was much greater than from glycyl-L-leucine. Brush border amino-peptidase activities after resection were also increased but dissociation between absorption and hydrolytic activity occurred. This study indicates that certain dipeptides are handled differently by adapting ileal segments. Furthermore, the changes observed probably reflect mucosal cellular hyperplasia occurring in association with intestinal adaptation. PMID:428822

  4. Calcium transport from the intestine and into bone in a rat model simulating weightlessness

    NASA Technical Reports Server (NTRS)

    Bikle, D. D.; Globus, R. K.; Morey, E. R.

    1982-01-01

    The objective of this study was to determine whether a defect in transport of calcium in the duodenum was related to decreased bone formation in the suspended rat. Rats were suspended by the tail at a 40 deg angle for up to 15 days. Ca-45 was injected into the ligated duodenum in situ 15 minutes prior to sacrific. Blood, tibia, vertebra and humerus were obtained for total calcium and Ca-45 analyses. Intestinal calcium transport did not appear to be significantly altered by suspension. However, by 5 days of suspension a significant decrease in accumulation of Ca-45 into tibia and vertebra was observed. A trend of decreasing bone mineral and mass was established in tibia and vertebra by the fifth day of suspension. The humerus failed to demonstrate a significant weight decrease or change in Ca-45 accumulation after 15 days of suspension. Results from this simulated weightlessness model suggest that transport of calcium from intestine into bone is decreased within 5 days of suspension. This deficiency appears to be associated with a progressive decrease in total mass of non-weightbearing bones.

  5. Transport and function of syntaxin 3 in human epithelial intestinal cells.

    PubMed

    Breuza, L; Fransen, J; Le Bivic, A

    2000-10-01

    To follow the transport of human syntaxin (Syn) 3 to the apical surface of intestinal cells, we produced and expressed in Caco-2 cells a chimera made of the entire Syn3 coding sequence and the extracellular domain of the human transferrin receptor (TfR). This chimera (Syn3TfR) was localized to the apical membrane and was transported along the direct apical pathway, suggesting that this is also the case for endogenous Syn3. To test the potential role of Syn3 in apical transport, we overexpressed it in Caco-2 cells and measured the efficiency of apical and basolateral delivery of several endogenous markers. We observed a strong inhibition of apical delivery of sucrase-isomaltase (SI), an apical transmembrane protein, and of alpha-glucosidase, an apically secreted protein. No effect was observed on the basolateral delivery of Ag525, a basolateral antigen, strongly suggesting that Syn3 is necessary for efficient delivery of proteins to the apical surface of intestinal cells.

  6. Active Transport of Phosphorylated Carbohydrates Promotes Intestinal Colonization and Transmission of a Bacterial Pathogen

    PubMed Central

    Sit, Brandon; Crowley, Shauna M.; Bhullar, Kirandeep; Lai, Christine Chieh-Lin; Tang, Calvin; Hooda, Yogesh; Calmettes, Charles; Khambati, Husain; Ma, Caixia; Brumell, John H.; Schryvers, Anthony B.; Vallance, Bruce A.; Moraes, Trevor F.

    2015-01-01

    Efficient acquisition of extracellular nutrients is essential for bacterial pathogenesis, however the identities and mechanisms for transport of many of these substrates remain unclear. Here, we investigate the predicted iron-binding transporter AfuABC and its role in bacterial pathogenesis in vivo. By crystallographic, biophysical and in vivo approaches, we show that AfuABC is in fact a cyclic hexose/heptose-phosphate transporter with high selectivity and specificity for a set of ubiquitous metabolites (glucose-6-phosphate, fructose-6-phosphate and sedoheptulose-7-phosphate). AfuABC is conserved across a wide range of bacterial genera, including the enteric pathogens EHEC O157:H7 and its murine-specific relative Citrobacter rodentium, where it lies adjacent to genes implicated in sugar sensing and acquisition. C. rodentium ΔafuA was significantly impaired in an in vivo murine competitive assay as well as its ability to transmit infection from an afflicted to a naïve murine host. Sugar-phosphates were present in normal and infected intestinal mucus and stool samples, indicating that these metabolites are available within the intestinal lumen for enteric bacteria to import during infection. Our study shows that AfuABC-dependent uptake of sugar-phosphates plays a critical role during enteric bacterial infection and uncovers previously unrecognized roles for these metabolites as important contributors to successful pathogenesis. PMID:26295949

  7. Bifidobacteria inhibit the inflammatory response induced by gliadins in intestinal epithelial cells via modifications of toxic peptide generation during digestion.

    PubMed

    Laparra, J M; Sanz, Y

    2010-03-01

    Celiac disease (CD) is a chronic enteropathy triggered by intake of gliadin, the toxic component of gluten. This study aims at evaluating the capacity of different Bifidobacterium strains to counteract the inflammatory effects of gliadin-derived peptides in intestinal epithelial (Caco-2) cells. A commercial extract of several gliadin (Gld) types (alpha, beta, gamma, [symbol: see text] ) was subjected to in vitro gastrointestinal digestion (pepsin at pH 3, pancreatin-bile at pH 6), inoculated or not with cell suspensions (10(8) colony forming units/ml) of either B. animalis IATA-A2, B. longum IATA-ES1, or B. bifidum IATA-ES2, in a bicameral system. The generated gliadin-derived peptides were identified by reverse phase-HPLC-ESI-MS/MS. Caco-2 cell cultures were exposed to the different gliadin peptide digestions (0.25 mg protein/ml), and the mRNA expression of nuclear factor kappa-B (NF-kappaB), tumor necrosis factor alpha (TNF-alpha), and chemokine CXCR3 receptor were analyzed by semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) in stimulated cells. The production of the pro-inflammatory markers NF-kappaB p50, TNF-alpha, and IL-1beta (interleukine 1beta) by Caco-2 cells was also determined by ELISA. The peptides from gliadin digestions inoculated with bifidobacteria did not exhibit the toxic amino acid sequences identified in those noninoculated (alpha/beta-Gld [158-164] and alpha/beta-Gld [122-141]). The RT-PCR analysis evidenced a down-regulation in mRNA expression of pro-inflammatory biomarkers. Consistent with these results the production of NF-kappaB, TNF-alpha, and IL-1beta was reduced (18.2-22.4%, 28.0-64.8%, and abolished, respectively) in cell cultures exposed to gliadin digestions inoculated with bifidobacteria. Therefore, bifidobacteria change the gliadin-derived peptide pattern and, thereby, attenuate their pro-inflammatory effects on Caco-2 cells.

  8. [Important application of intestinal transporters and metabolism enzymes on gastrointestinal disposal of active ingredients of Chinese materia medica].

    PubMed

    Bi, Xiaolin; Du, Qiu; Di, Liuqing

    2010-02-01

    Oral drug bioavailability depends on gastrointestinal absorption, intestinal transporters and metabolism enzymes are the important factors in drug gastrointestinal absorption and they can also be induced or inhibited by the active ingredients of Chinese materia medica. This article presents important application of intestinal transporters and metabolism enzymes on gastrointestinal disposal of the active ingredients of Chinese materia medica, and points out the importance of research on transport and metabolism of the active ingredients of Chinese materia medica in Chinese extract and Chinese medicinal formulae.

  9. Representing intestinal drug transport in silico: an agent-oriented approach.

    PubMed

    Liu, Yu; Hunt, C Anthony

    2004-01-01

    A prototype Epithelio-Mimetic Device (EMD) was developed and tested. EMD components are designed to map logically to biological components at multiple levels of resolution. Those components are engineered to represent actual components within an in vitro cellular system used to study intestinal drug transport. Our goal is that the behaviors of the EMD closely match observed behaviors of the in vitro systems for a wide variety of drugs. Early stage system verification is achieved. The general patterns of experimental results from the EMD for a set of hypothetical drugs having a variety of physicochemical properties reasonably match observed patterns for a wide range of experimental conditions.

  10. Diet effects on glucose absorption in the small intestine of neonatal calves: importance of intestinal mucosal growth, lactase activity, and glucose transporters.

    PubMed

    Steinhoff-Wagner, Julia; Zitnan, Rudolf; Schönhusen, Ulrike; Pfannkuche, Helga; Hudakova, Monika; Metges, Cornelia C; Hammon, Harald M

    2014-10-01

    Colostrum (C) feeding in neonatal calves improves glucose status and stimulates intestinal absorptive capacity, leading to greater glucose absorption when compared with milk-based formula feeding. In this study, diet effects on gut growth, lactase activity, and glucose transporters were investigated in several gut segments of the small intestine. Fourteen male German Holstein calves received either C of milkings 1, 3, and 5 (d 1, 2, and 3 in milk) or respective formulas (F) twice daily from d 1 to d 3 after birth. Nutrient content, and especially lactose content, of C and respective F were the same. On d 4, calves were fed C of milking 5 or respective F and calves were slaughtered 2h after feeding. Tissue samples from duodenum and proximal, mid-, and distal jejunum were taken to measure villus size and crypt depth, mucosa and brush border membrane vesicles (BBMV) were taken to determine protein content, and mRNA expression and activity of lactase and mRNA expression of sodium-dependent glucose co-transporter-1 (SGLT1) and facilitative glucose transporter (GLUT2) were determined from mucosal tissue. Additionally, protein expression of SGLT1 in BBMV and GLUT2 in crude mucosal membranes and BBMV were determined, as well as immunochemically localized GLUT2 in the intestinal mucosa. Villus circumference, area, and height were greater, whereas crypt depth was smaller in C than in F. Lactase activity tended to be greater in C than in F. Protein expression of SGLT1 was greater in F than in C. Parameters of villus size, lactase activity, SGLT1 protein expression, as well as apical and basolateral GLUT2 localization in the enterocytes differed among gut segments. In conclusion, C feeding, when compared with F feeding, enhances glucose absorption in neonatal calves primarily by stimulating mucosal growth and increasing absorptive capacity in the small intestine, but not by stimulating abundance of intestinal glucose transporters.

  11. Transport, metabolism, and endosomal trafficking-dependent regulation of intestinal fructose absorption.

    PubMed

    Patel, Chirag; Douard, Veronique; Yu, Shiyan; Gao, Nan; Ferraris, Ronaldo P

    2015-09-01

    Dietary fructose that is linked to metabolic abnormalities can up-regulate its own absorption, but the underlying regulatory mechanisms are not known. We hypothesized that glucose transporter (GLUT) protein, member 5 (GLUT5) is the primary fructose transporter and that fructose absorption via GLUT5, metabolism via ketohexokinase (KHK), as well as GLUT5 trafficking to the apical membrane via the Ras-related protein-in-brain 11 (Rab11)a-dependent endosomes are each required for regulation. Introducing fructose but not lysine and glucose solutions into the lumen increased by 2- to 10-fold the heterogeneous nuclear RNA, mRNA, protein, and activity levels of GLUT5 in adult wild-type mice consuming chow. Levels of GLUT5 were >100-fold that of candidate apical fructose transporters GLUTs 7, 8, and 12 whose expression, and that of GLUT 2 and the sodium-dependent glucose transporter protein 1 (SGLT1), was not regulated by luminal fructose. GLUT5-knockout (KO) mice exhibited no facilitative fructose transport and no compensatory increases in activity and expression of SGLT1 and other GLUTs. Fructose could not up-regulate GLUT5 in GLUT5-KO, KHK-KO, and intestinal epithelial cell-specific Rab11a-KO mice. The fructose-specific metabolite glyceraldehyde did not increase GLUT5 expression. GLUT5 is the primary transporter responsible for facilitative absorption of fructose, and its regulation specifically requires fructose uptake and metabolism and normal GLUT5 trafficking to the apical membrane.

  12. EAAT3 promotes amino acid transport and proliferation of porcine intestinal epithelial cells.

    PubMed

    Ye, Jin-Ling; Gao, Chun-Qi; Li, Xiang-Guang; Jin, Cheng-Long; Wang, Dan; Shu, Gang; Wang, Wen-Ce; Kong, Xiang-Feng; Yao, Kang; Yan, Hui-Chao; Wang, Xiu-Qi

    2016-06-21

    Excitatory amino acid transporter 3 (EAAT3, encoded by SLC1A1) is an epithelial type high-affinity anionic amino acid transporter, and glutamate is the major oxidative fuel for intestinal epithelial cells. This study investigated the effects of EAAT3 on amino acid transport and cell proliferation through activation of the mammalian target of the rapamycin (mTOR) pathway in porcine jejunal epithelial cells (IPEC-J2). Anionic amino acid and cystine (Cys) transport were increased (P<0.05) by EAAT3 overexpression and decreased (P<0.05) by EAAT3 knockdown rather than other amino acids. MTT and cell counting assays suggested that IPEC-J2 cell proliferation increased (P<0.05) with EAAT3 overexpression. Phosphorylation of mTOR (Ser2448), ribosomal protein S6 kinase-1 (S6K1, Thr389) and eukaryotic initiation factor 4E-binding protein-1 (4EBP1, Thr70) was increased by EAAT3 overexpression and decreased by EAAT3 knockdown (P<0.05), as were levels of activating transcription factor 4 (ATF4) and cystine/glutamate antiporter (xCT) (P<0.05). Our results demonstrate for the first time that EAAT3 facilitates anionic amino acid transport and activates the mTOR pathway, promoting Cys transport and IPEC-J2 cell proliferation.

  13. EAAT3 promotes amino acid transport and proliferation of porcine intestinal epithelial cells

    PubMed Central

    Jin, Cheng-long; Wang, Dan; Shu, Gang; Wang, Wen-ce; Kong, Xiang-feng; Yao, Kang; Yan, Hui-chao; Wang, Xiu-qi

    2016-01-01

    Excitatory amino acid transporter 3 (EAAT3, encoded by SLC1A1) is an epithelial type high-affinity anionic amino acid transporter, and glutamate is the major oxidative fuel for intestinal epithelial cells. This study investigated the effects of EAAT3 on amino acid transport and cell proliferation through activation of the mammalian target of the rapamycin (mTOR) pathway in porcine jejunal epithelial cells (IPEC-J2). Anionic amino acid and cystine (Cys) transport were increased (P<0.05) by EAAT3 overexpression and decreased (P<0.05) by EAAT3 knockdown rather than other amino acids. MTT and cell counting assays suggested that IPEC-J2 cell proliferation increased (P<0.05) with EAAT3 overexpression. Phosphorylation of mTOR (Ser2448), ribosomal protein S6 kinase-1 (S6K1, Thr389) and eukaryotic initiation factor 4E-binding protein-1 (4EBP1, Thr70) was increased by EAAT3 overexpression and decreased by EAAT3 knockdown (P<0.05), as were levels of activating transcription factor 4 (ATF4) and cystine/glutamate antiporter (xCT) (P<0.05). Our results demonstrate for the first time that EAAT3 facilitates anionic amino acid transport and activates the mTOR pathway, promoting Cys transport and IPEC-J2 cell proliferation. PMID:27231847

  14. Transepithelial transports of rare sugar D-psicose in human intestine.

    PubMed

    Hishiike, Takashi; Ogawa, Masahiro; Hayakawa, Shigeru; Nakajima, Daichi; O'Charoen, Siwaporn; Ooshima, Hisaka; Sun, Yuanxia

    2013-07-31

    D-Psicose (Psi), the C3-epimer of D-fructose (Fru), is a noncalorie sugar with a lower glycemic response. The trans-cellular pathway of Psi in human enterocytes was investigated using a Caco-2 cell monolayer. The permeation rate of Psi across the monolayer was not affected by the addition of phlorizin, an inhibitor of sugar transporter SGLT1, whereas it was accelerated by treatment with forskolin, a GLUT5-gene inducer, clearly showing that GLUT5 is involved in the transport of Psi. The permeability of Psi was suppressed in the presence of D-glucose (Glc) and Fru, suggesting that the three monosaccharides are transported via the same transporter. Since GLUT2, the predominant sugar transporter on the basolateral membrane of enterocytes, mediates the transport of Glc and Fru, Psi might be mediated by GLUT2. The present study shows that Psi is incorporated from the intestinal lumen into enterocytes via GLUT5 and is released to the lamina propria via GLUT2.

  15. Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus)

    PubMed Central

    Blanco, Ayelén Melisa; Bertucci, Juan Ignacio; Ramesh, Naresh; Delgado, María Jesús; Valenciano, Ana Isabel; Unniappan, Suraj

    2017-01-01

    Glucose homeostasis is an important biological process that involves a variety of regulatory mechanisms. This study aimed to determine whether ghrelin, a multifunctional gut-brain hormone, modulates intestinal glucose transport in goldfish (Carassius auratus). Three intestinal glucose transporters, the facilitative glucose transporter 2 (GLUT2), and the sodium/glucose co-transporters 1 (SGLT1) and 2 (SGLT2), were studied. Immunostaining of intestinal sections found colocalization of ghrelin and GLUT2 and SGLT2 in mucosal cells. Some cells containing GLUT2, SGLT1 and SGLT2 coexpressed the ghrelin/growth hormone secretagogue receptor 1a (GHS-R1a). Intraperitoneal glucose administration led to a significant increase in serum ghrelin levels, as well as an upregulation of intestinal preproghrelin, ghrelin O-acyltransferase and ghs-r1 expression. In vivo and in vitro ghrelin treatment caused a concentration- and time-dependent modulation (mainly stimulatory) of GLUT2, SGLT1 and SGLT2. These effects were abolished by the GHS-R1a antagonist [D-Lys3]-GHRP-6 and the phospholipase C inhibitor U73122, suggesting that ghrelin actions on glucose transporters are mediated by GHS-R1a via the PLC/PKC signaling pathway. Finally, ghrelin stimulated the translocation of GLUT2 into the plasma membrane of goldfish primary intestinal cells. Overall, data reported here indicate an important role for ghrelin in the modulation of glucoregulatory machinery and glucose homeostasis in fish. PMID:28338019

  16. Ghrelin Facilitates GLUT2-, SGLT1- and SGLT2-mediated Intestinal Glucose Transport in Goldfish (Carassius auratus).

    PubMed

    Blanco, Ayelén Melisa; Bertucci, Juan Ignacio; Ramesh, Naresh; Delgado, María Jesús; Valenciano, Ana Isabel; Unniappan, Suraj

    2017-03-24

    Glucose homeostasis is an important biological process that involves a variety of regulatory mechanisms. This study aimed to determine whether ghrelin, a multifunctional gut-brain hormone, modulates intestinal glucose transport in goldfish (Carassius auratus). Three intestinal glucose transporters, the facilitative glucose transporter 2 (GLUT2), and the sodium/glucose co-transporters 1 (SGLT1) and 2 (SGLT2), were studied. Immunostaining of intestinal sections found colocalization of ghrelin and GLUT2 and SGLT2 in mucosal cells. Some cells containing GLUT2, SGLT1 and SGLT2 coexpressed the ghrelin/growth hormone secretagogue receptor 1a (GHS-R1a). Intraperitoneal glucose administration led to a significant increase in serum ghrelin levels, as well as an upregulation of intestinal preproghrelin, ghrelin O-acyltransferase and ghs-r1 expression. In vivo and in vitro ghrelin treatment caused a concentration- and time-dependent modulation (mainly stimulatory) of GLUT2, SGLT1 and SGLT2. These effects were abolished by the GHS-R1a antagonist [D-Lys3]-GHRP-6 and the phospholipase C inhibitor U73122, suggesting that ghrelin actions on glucose transporters are mediated by GHS-R1a via the PLC/PKC signaling pathway. Finally, ghrelin stimulated the translocation of GLUT2 into the plasma membrane of goldfish primary intestinal cells. Overall, data reported here indicate an important role for ghrelin in the modulation of glucoregulatory machinery and glucose homeostasis in fish.

  17. Novel GM1 ganglioside-like peptide mimics prevent the association of cholera toxin to human intestinal epithelial cells in vitro.

    PubMed

    Yu, Robert K; Usuki, Seigo; Itokazu, Yutaka; Wu, Han-Chung

    2016-01-01

    Cholera is an acute diarrheal disease caused by infection in the gastrointestinal tract by the gram-negative bacterium, Vibrio cholerae, and is a serious public health threat worldwide. There has not been any effective treatment for this infectious disease. Cholera toxin (CT), which is secreted by V. cholerae, can enter host cells by binding to GM1, a monosialoganglioside widely distributed on the plasma membrane surface of various animal epithelial cells. The present study was undertaken to generate peptides that are conformationally similar to the carbohydrate epitope of GM1 for use in the treatment of cholera and related bacterial infection. For this purpose, we used cholera toxin B (CTB) subunit to select CTB-binding peptides that structurally mimic GM1 from a dodecamer phage-display library. Six GM1-replica peptides were selected by biopanning based on CTB recognition. Five of the six peptides showed inhibitory activity for GM1 binding to CTB. To test the potential of employing the peptide mimics for intervening with the bacterial infection, those peptides were examined for their binding capacity, functional inhibitory activity and in vitro effects using a human intestinal epithelial cell line, Caco-2 cells. One of the peptides, P3 (IPQVWRDWFKLP), was most effective in inhibiting cellular uptake of CTB and suppressing CT-stimulated cyclic adenosine monophosphate production in the cells. Our results thus provide convincing evidence that GM1-replica peptides could serve as novel agents to block CTB binding on epithelial cells and prevent the ensuing physiological effects of CT.

  18. Stimulatory effect of the intestinal peptide PHI on glycogenolysis and gluconeogenesis in isolated rat hepatocytes.

    PubMed Central

    Felíu, J E; Marco, J

    1983-01-01

    The newly isolated peptide PHI provoked a dose-dependent stimulation of glycogenolysis and gluconeogenesis in isolated rat hepatocytes; at 1 microM-PHI, both processes were increased 1.6-fold as compared with basal values. These PHI-mediated effects were accompanied by the activation of glycogen phosphorylase and the inactivation of pyruvate kinase. PHI (1 microM) also caused a 2-fold increase in hepatocyte cyclic AMP. PMID:6312969

  19. Determination of the optimal cell-penetrating peptide sequence for intestinal insulin delivery based on molecular orbital analysis with self-organizing maps.

    PubMed

    Kamei, Noriyasu; Kikuchi, Shingo; Takeda-Morishita, Mariko; Terasawa, Yoshiaki; Yasuda, Akihito; Yamamoto, Shuichi; Ida, Nobuo; Nishio, Reiji; Takayama, Kozo

    2013-02-01

    Our recent work has shown that the intestinal absorption of insulin can be improved significantly by coadministration of cell-penetrating peptides (CPPs), especially penetratin. However, a relatively high dose of penetratin is required to adequately stimulate the intestinal absorption of insulin. Therefore, in this study, we sought to determine the CPP that most effectively enhanced intestinal insulin absorption. An in situ loop absorption study using 26 penetratin analogues suggested that the chain length, hydrophobicity, and amphipathicity of the CPPs, as well as their basicity, contribute to their absorption-enhancing efficiency. Moreover, a molecular orbital method with self-organizing maps (SOMs) classification suggested that multiple factors, including the molecular weight, basicity, the lowest unoccupied molecular orbital energy, absolute hardness, and chemical potential of CPPs, are associated with their effects on intestinal insulin absorption. Furthermore, the new CPPs proposed by SOM clustering had a marked capacity to interact with insulin, and their ability to enhance insulin absorption was much stronger than that of the original penetratin. Therefore, the peptide sequence that optimally enhances intestinal insulin absorption could be defined by SOM with the molecular orbital method, and our present work emphasizes the utility of such methodologies in the development of effective drug delivery systems.

  20. Acquisition of dietary copper: a role for anion transporters in intestinal apical copper uptake.

    PubMed

    Zimnicka, Adriana M; Ivy, Kristin; Kaplan, Jack H

    2011-03-01

    Copper is an essential micronutrient in humans and is required for a wide range of physiological processes, including neurotransmitter biosynthesis, oxidative metabolism, protection against reactive oxygen species, and angiogenesis. The first step in the acquisition of dietary copper is absorption from the intestinal lumen. The major human high-affinity copper uptake protein, human copper transporter hCTR1, was recently shown to be at the basolateral or blood side of both intestinal and renal epithelial cell lines and thus does not play a direct role in this initial step. We sought to functionally identify the major transport pathways available for the absorption of dietary copper across the apical intestinal membrane using Caco2 cells, a well-established model for human enterocytes. The initial rate of apical copper uptake into confluent monolayers of Caco2 cells is greatly elevated if amino acids and serum proteins are removed from the growth media. Uptake from buffered saline solutions at neutral pH (but not at lower pH) is inhibited by either d- or l-histidine, unaltered by the removal of sodium ions, and inhibited by ∼90% when chloride ions are replaced by gluconate or sulfate. Chloride-dependent copper uptake occurs with Cu(II) or Cu(I), although Cu(I) uptake is not inhibited by histidine, nor by silver ions. A well-characterized inhibitor of anion exchange systems, DIDS, inhibited apical copper uptake by 60-70%, while the addition of Mn(II) or Fe(II), competitive substrates for the divalent metal transporter DMT1, had no effect on copper uptake. We propose that anion exchangers play an unexpected role in copper absorption, utilizing copper-chloride complexes as pseudo-substrates. This pathway is also observed in mouse embryonic fibroblasts, human embryonic kidney cells, and Cos-7 cells. The special environment of low pH, low concentration of protein, and protonation of amino acids in the early intestinal lumen make this pathway especially important in

  1. Intestinal transport of 3,6'-disinapoylsucrose, a major active component of Polygala tenuifolia, using Caco-2 cell monolayer and in situ rat intestinal perfusion models.

    PubMed

    Chen, Ying; Liu, Xinmin; Pan, Ruile; Zhu, Xiaoxin; Steinmetz, André; Liao, Yonghong; Wang, Ning; Peng, Bo; Chang, Qi

    2013-10-01

    3,6'-Disinapoylsucrose is a major active component of the herb Polygala tenuifolia which has long been used for relieving tranquilization, uneasiness of the mind, and improving learning and memory. Our previous study found that 3,6'-disinapoylsucrose had a very low oral bioavailability. Its mechanisms of absorption in the small intestine have so far been unclear. In the present study, the absorption mechanisms of 3,6'-disinapoylsucrose were investigated by using the Caco-2 cell monolayer and in situ rat intestinal perfusion models. The 3,6'-disinapoylsucrose concentration was determined by an LC/MS/MS method. In a Caco-2 cell transport study, the results showed that 3,6'-disinapoylsucrose had very limited intestinal permeability with average apparent permeability coefficient values around (1.11-1.34) × 10(-7) cm/s from the apical (A) to the basolateral (B) side and (1.37-1.42) × 10(-7) cm/s from B to A, at concentrations of 5, 20, and 33 µM. No concentration dependence in the 3,6'-disinapoylsucrose transport was observed. The apparent permeability coefficient value of 3,6'-disinapoylsucrose (5 µM) from A to B greatly increased to 4.49 × 10(-7) and 1.81 × 10(-7) cm/s, respectively, when the cells were preincubated with EDTA (17 mM) and sodium caprate (5.14 mM). No significant effect on the 3,6'-disinapoylsucrose transport by the inhibitors including verapamil, cyclosporine A, and sodium azide was observed. Similar results were found in the small intestinal perfusion study. The apparent permeability coefficient value of 3,6'-disinapoylsucrose greatly increased from 3.97 × 10(-6) to 23.4 × 10(-6) and 20.0 × 10(-6) cm/s in the presence of EDTA (17 mM) and sodium caprate (5.14 mM), respectively, in perfusion buffer. An in vitro stability evaluation of 3,6'-disinapoylsucrose in the gastrointestinal tract showed that it was relatively stable both in the stomach and small intestine contents, while it was found to be more instable in the colon contents. All of the

  2. The transepithelial transport mechanism of polybrominated diphenyl ethers in human intestine determined using a Caco-2 cell monolayer.

    PubMed

    Yu, Yingxin; Wang, Mengmeng; Zhang, Kaiqiong; Yang, Dan; Zhong, Yufang; An, Jing; Lei, Bingli; Zhang, Xinyu

    2017-04-01

    Oral ingestion plays an important role in human exposure to polybrominated diphenyl ethers (PBDEs). The uptake of PBDEs primarily occurs in the small intestine. The aim of the present study is to investigate the transepithelial transport characteristics and mechanisms of PBDEs in the small intestine using a Caco-2 cell monolayer model. The apparent permeability coefficients of PBDEs indicated that tri- to hepta-BDEs were poorly absorbed compounds. A linear increase in transepithelial transport was observed with various concentrations of PBDEs, which suggested that passive diffusion dominated their transport at the concentration range tested. In addition, the pseudo-first-order kinetics equation can be applied to the transepithelial transport of PBDEs. The rate-determining step in transepithelial transport of PBDEs was trans-cell transport including the trans-pore process. The significantly lower transepithelial transport rates at low temperature for bidirectional transepithelial transport suggested that an energy-dependent transport mechanism was involved. The efflux transporters (P-glycoprotein, multidrug resistance-associated protein, and breast cancer resistance protein) and influx transporters (organic cation transporters) participated in the transepithelial transport of PBDEs. In addition, the transepithelial transport of PBDEs was pH sensitive; however, more information is required to understand the influence of pH.

  3. Very low density lipoproteins in intestinal lymph: role in triglyceride and cholesterol transport during fat absorption

    PubMed Central

    Ockner, Robert K.; Hughes, Faith B.; Isselbacher, Kurt J.

    1969-01-01

    The role of nonchylomicron very low density lipoproteins (VLDL, Sf 20-400) in the transport of triglyceride and cholesterol was studied during lipid absorption. Various long chain fatty acids were infused intraduodenally in the form of mixed fatty acid—mono-olein-taurocholate micelles; control animals received saline or taurocholate. As compared with controls, all fatty acids (palmitic, oleic, linoleic) resulted in significant increases in chylomicron (Sf > 400) triglyceride. In addition, palmitic acid resulted in a twofold increase in VLDL triglyceride, whereas with the absorption of oleic or linoleic acid VLDL triglyceride did not change significantly. Differences in triglyceride fatty acid composition between chylomicrons and VLDL were observed during lipid absorption. Although the absolute amount of endogenous cholesterol in intestinal lymph was not significantly affected by lipid absorption under these conditions, its lipoprotein distribution differed substantially among the lipid-infused groups. During palmitate absorption, VLDL cholesterol was similar to that in the taurocholate-infused controls, and was equal to chylomicron cholesterol. In contrast, during oleate and linoleate absorption the VLDL cholesterol fell markedly, and was less than half of the chylomicron cholesterol in these groups. The half-time of plasma survival of VLDL cholesterol-14C was found to be twice that of chylomicron cholesterol-14C. These studies demonstrate that dietary long chain fatty acids differ significantly in their effects upon the transport of triglyceride and cholesterol by lipoproteins of rat intestinal lymph. These findings, together with the observed differences in rates of removal of chylomicrons and VLDL from plasma, suggest that variations in lipoprotein production at the intestinal level may be reflected in differences in the subsequent metabolism of absorbed dietary and endogenous lipids. PMID:5355348

  4. Tween 20 increases intestinal transport of doxorubicin in vitro but not in vivo.

    PubMed

    Al-Saraf, Amal; Holm, René; Nielsen, Carsten Uhd

    2016-02-10

    The chemotherapeutic drug substance doxorubicin has been reported to be a substrate of P-gp, which induces a barrier for oral administration and leads to a bioavailability of 3% in male Sprague Dawley rats. Literature studies have reported increased transport of P-pg substrates, like digoxin, when co-administered with P-gp inhibitors (non-ionic surfactants) in vitro and in vivo . The aim of the present study was thus to investigate if different non-ionic surfactants would have a similar effect on the in vitro and in vivo absorption of doxorubicin. This was investigated in vitro in Caco-2 cells and by oral co-administration of doxorubicin together with tween 20 to male Sprague Dawley rats. 200 μM (0.025%) tween 20 increased the intestinal absorptive permeability of doxorubicin in vitro by 48 ± 4% from 8.8 × 10(-6)cm/s to 13.0 × 10(-6)cm/s. Further, the efflux ratio was reduced from 2.2 ± 0.06 to 1.2 ± 0.03 (n=3-7). In vivo, co-administration of doxorubicin and 0-25% tween 20 did not yield detectable doxorubicin plasma concentrations, probably due to extensive intestinal metabolism. In conclusion, the present study demonstrated that non-ionic surfactants increased the transport of doxorubicin in vitro, most likely by inhibition of the efflux activity. However, this effect was not transferable to the in vivo situation.

  5. Development of intestinal ion-transporting mechanisms during smoltification and seawater acclimation in Atlantic salmon Salmo salar

    USGS Publications Warehouse

    Sundh, Henrik; Nilsen, Tom O.; Lindström, Jenny; Hasselberg-Frank, Linda; Stefansson, Sigurd O.; McCormick, Stephen D.; Sundell, K.

    2014-01-01

    This study investigated the expression of ion transporters involved in intestinal fluid absorption and presents evidence for developmental changes in abundance and tissue distribution of these transporters during smoltification and seawater (SW) acclimation of Atlantic salmonSalmo salar. Emphasis was placed on Na+, K+-ATPase (NKA) and Na+, K+, Cl− co-transporter (NKCC) isoforms, at both transcriptional and protein levels, together with transcription of chloride channel genes. The nka α1c was the dominant isoform at the transcript level in both proximal and distal intestines; also, it was the most abundant isoform expressed in the basolateral membrane of enterocytes in the proximal intestine. This isoform was also abundantly expressed in the distal intestine in the lower part of the mucosal folds. The protein expression of intestinal Nkaα1c increased during smoltification. Immunostaining was localized to the basal membrane of the enterocytes in freshwater (FW) fish, and re-distributed to a lateral position after SW entry. Two other Nka isoforms, α1a and α1b, were expressed in the intestine but were not regulated to the same extent during smoltification and subsequent SW transfer. Their localization in the intestinal wall indicates a house-keeping function in excitatory tissues. The absorptive form of the NKCC-like isoform (sub-apically located NKCC2 and/or Na+, Cl−co-transporter) increased during smoltification and further after SW transfer. The cellular distribution changed from a diffuse expression in the sub-apical regions during smoltification to clustering of the transporters closer to the apical membrane after entry to SW. Furthermore, transcript abundance indicates that the mechanisms necessary for exit of chloride ions across the basolateral membrane and into the lateral intercellular space are present in the form of one or more of three different chloride channels: cystic fibrosis transmembrane conductance regulator I and II and chloride channel

  6. Characterization of butyrate transport across the luminal membranes of equine large intestine.

    PubMed

    Nedjadi, Taoufik; Moran, Andrew W; Al-Rammahi, Miran A; Shirazi-Beechey, Soraya P

    2014-10-01

    The diet of the horse, pasture forage (grass), is fermented by the equine colonic microbiota to short-chain fatty acids, notably acetate, propionate and butyrate. Short-chain fatty acids provide a major source of energy for the horse and contribute to many vital physiological processes. We aimed to determine both the mechanism of butyrate uptake across the luminal membrane of equine colon and the nature of the protein involved. To this end, we isolated equine colonic luminal membrane vesicles. The abundance and activity of cysteine-sensitive alkaline phosphatase and villin, intestinal luminal membrane markers, were significantly enriched in membrane vesicles compared with the original homogenates. In contrast, the abundance of GLUT2 protein and the activity of Na(+)-K(+)-ATPase, known markers of the intestinal basolateral membrane, were hardly detectable. We demonstrated, by immunohistochemistry, that monocarboxylate transporter 1 (MCT1) protein is expressed on the luminal membrane of equine colonocytes. We showed that butyrate transport into luminal membrane vesicles is energized by a pH gradient (out < in) and is not Na(+) dependent. Moreover, butyrate uptake is time and concentration dependent, with a Michaelis-Menten constant of 5.6 ± 0.45 mm and maximal velocity of 614 ± 55 pmol s(-1) (mg protein)(-1). Butyrate transport is significantly inhibited by p-chloromercuribenzoate, phloretin and α-cyano-4-hydroxycinnamic acid, all potent inhibitors of MCT1. Moreover, acetate and propionate, as well as the monocarboxylates pyruvate and lactate, also inhibit butyrate uptake. Data presented here support the conclusion that transport of butyrate across the equine colonic luminal membrane is predominantly accomplished by MCT1.

  7. Charge transport in vertically aligned, self-assembled peptide nanotube junctions

    NASA Astrophysics Data System (ADS)

    Mizrahi, Mordechay; Zakrassov, Alexander; Lerner-Yardeni, Jenny; Ashkenasy, Nurit

    2012-01-01

    The self-assembly propensity of peptides has been extensively utilized in recent years for the formation of supramolecular nanostructures. In particular, the self-assembly of peptides into fibrils and nanotubes makes them promising building blocks for electronic and electro-optic applications. However, the mechanisms of charge transfer in these wire-like structures, especially in ambient conditions, are not yet fully understood. We describe here a layer-by-layer deposition methodology of short self-assembled cyclic peptide nanotubes, which results in vertically oriented nanotubes on gold substrates. Using this novel deposition methodology, we have fabricated molecular junctions with a conductive atomic force microscopy tip as a second electrode. Studies of the junctions' current-voltage characteristics as a function of the nanotube length revealed an efficient charge transfer in these supramolecular structures, with a low current attenuation constant of 0.1 Å-1, which indicate that electron transfer is dominated by hopping. Moreover, the threshold voltage to field-emission dominated transport was found to increase with peptide length in a manner that depends on the nature of the contact with the electrodes. The flexibility in the design of the peptide monomers and the ability to control their sequential order over the nanotube by means of the layer-by-layer assembly process, which is demonstrated in this work, can be used to engineer the electronic properties of self-assembled peptide nanotubes toward device applications.

  8. Charge transport in vertically aligned, self-assembled peptide nanotube junctions.

    PubMed

    Mizrahi, Mordechay; Zakrassov, Alexander; Lerner-Yardeni, Jenny; Ashkenasy, Nurit

    2012-01-21

    The self-assembly propensity of peptides has been extensively utilized in recent years for the formation of supramolecular nanostructures. In particular, the self-assembly of peptides into fibrils and nanotubes makes them promising building blocks for electronic and electro-optic applications. However, the mechanisms of charge transfer in these wire-like structures, especially in ambient conditions, are not yet fully understood. We describe here a layer-by-layer deposition methodology of short self-assembled cyclic peptide nanotubes, which results in vertically oriented nanotubes on gold substrates. Using this novel deposition methodology, we have fabricated molecular junctions with a conductive atomic force microscopy tip as a second electrode. Studies of the junctions' current-voltage characteristics as a function of the nanotube length revealed an efficient charge transfer in these supramolecular structures, with a low current attenuation constant of 0.1 Å(-1), which indicate that electron transfer is dominated by hopping. Moreover, the threshold voltage to field-emission dominated transport was found to increase with peptide length in a manner that depends on the nature of the contact with the electrodes. The flexibility in the design of the peptide monomers and the ability to control their sequential order over the nanotube by means of the layer-by-layer assembly process, which is demonstrated in this work, can be used to engineer the electronic properties of self-assembled peptide nanotubes toward device applications.

  9. Peptide influences the folding and intracellular transport of free major histocompatibility complex class I heavy chains

    PubMed Central

    1995-01-01

    Class I major histocompatibility complex molecules require both beta 2- microglobulin (beta 2m) and peptide for efficient intracellular transport. With the exception of H-2Db and Ld, class I heavy chains have not been detectable at the surface of cells lacking beta 2m. We show that properly conformed class I heavy chains can be detected in a terminally glycosylated form indicative of cell surface expression in H- 2b, H-2d, and H-2s beta 2m-/- concanavalin A (Con A)-stimulated splenocytes incubated at reduced temperature. Furthermore, we demonstrate the presence of Kb molecules at the surface of beta 2m-/- cells cultured at 37 degrees C. The mode of assembly of class I molecules encompasses two major pathways: binding of peptide to preformed "empty" heterodimers, and binding of peptide to free heavy chains, followed by recruitment of beta 2m. In support of the existence of the latter pathway, we provide evidence for a role of peptide in intracellular transport of free class I heavy chains, through analysis of Con A-stimulated splenocytes from transporter associated with antigen processing 1 (TAP1)-/-, beta 2m-/-, and double-mutant TAP1/beta 2m-/- mice. PMID:7869032

  10. Release of angiotensin converting enzyme-inhibitor peptides during in vitro gastrointestinal digestion of Parmigiano Reggiano PDO cheese and their absorption through an in vitro model of intestinal epithelium.

    PubMed

    Basiricò, L; Catalani, E; Morera, P; Cattaneo, S; Stuknytė, M; Bernabucci, U; De Noni, I; Nardone, A

    2015-11-01

    The occurrence of 8 bovine casein-derived peptides (VPP, IPP, RYLGY, RYLG, AYFYPEL, AYFYPE, LHLPLP, and HLPLP) reported as angiotensin converting enzyme-inhibitors (ACE-I) was investigated in the 3-kDa ultrafiltered water-soluble extract (WSE) of Parmigiano Reggiano (PR) cheese samples by ultra-performance liquid chromatography coupled to high-resolution mass spectrometry via an electrospray ionization source. Only VPP, IPP, LHLPLP, and HLPLP were revealed in the WSE, and their total amount was in the range of 8.46 to 21.55 mg/kg of cheese. Following in vitro static gastrointestinal digestion, the same ACE-I peptides along with the newly formed AYFYPEL and AYFYPE were found in the 3 kDa WSE of PR digestates. Digestates presented high amounts (1,880-3,053 mg/kg) of LHLPLP, whereas the remaining peptides accounted for 69.24 to 82.82 mg/kg. The half-maximal inhibitory concentration (IC50) values decreased from 7.92 ± 2.08 in undigested cheese to 3.20 ± 1.69 after in vitro gastrointestinal digestion. The 3-kDa WSE of digested cheeses were used to study the transport of the 8 ACE-I peptides across the monolayers of the Caco-2 cell culture grown on a semipermeable membrane of the transwells. After 1h of incubation, 649.20 ± 148.85 mg/kg of LHLPLP remained in the apical compartment, whereas VPP, IPP, AYFYPEL, AYFYPE, and HLPLP accounted in total for less than 36.78 mg/kg. On average, 0.6% of LHLPLP initially present in the digestates added to the apical compartment were transported intact to the basolateral chamber after the same incubation time. Higher transport rate (2.9%) was ascertained for the peptide HLPLP. No other intact ACE-I peptides were revealed in the basolateral compartment. For the first time, these results demonstrated that the ACE-I peptides HLPLP and LHLPLP present in the in vitro digestates of PR cheese are partially absorbed through an in vitro model of human intestinal epithelium.

  11. Linking Gene Expression in the Intestine to Production of Gametes Through the Phosphate Transporter PITR-1 in Caenorhabditis elegans

    PubMed Central

    Balklava, Zita; Rathnakumar, Navin D.; Vashist, Shilpa; Schweinsberg, Peter J.; Grant, Barth D.

    2016-01-01

    Inorganic phosphate is an essential mineral for both prokaryotic and eukaryotic cell metabolism and structure. Its uptake into the cell is mediated by membrane-bound transporters and coupled to Na+ transport. Mammalian sodium-dependent Pi cotransporters have been grouped into three families NaPi-I, NaPi-II, and NaPi-III. Despite being discovered more than two decades ago, very little is known about requirements for NaPi-III transporters in vivo, in the context of intact animal models. Here we find that impaired function of the Caenorhabditis elegans NaPi-III transporter, pitr-1, results in decreased brood size and dramatically increased expression of vitellogenin by the worm intestine. Unexpectedly, we found that the effects of pitr-1 mutation on vitellogenin expression in the intestine could only be rescued by expression of pitr-1 in the germline, and not by expression of pitr-1 in the intestine itself. Our results indicate the existence of a signal from the germline that regulates gene expression in the intestine, perhaps linking nutrient export from the intestine to production of gametes by the germline. PMID:27449055

  12. Effects of the antimicrobial peptide cecropin AD on performance and intestinal health in weaned piglets challenged with Escherichia coli.

    PubMed

    Wu, Shudan; Zhang, Fengrui; Huang, Zhimin; Liu, Hong; Xie, Chunyuan; Zhang, Jiang; Thacker, Philip A; Qiao, Shiyan

    2012-06-01

    This study was conducted to determine the effects of the antimicrobial peptide cecropin on performance and intestinal health in piglets. Newly weaned barrows were randomly assigned to one of three treatments (n=8), including a corn-soybean basal diet or similar diets supplemented with antibiotics (100 mg/kg kitasamycin plus 800 mg/kg colistin sulfate) or 400 mg/kg cecropin AD. On day 13, all piglets were orally challenged with 10(9)CFU/mL of Escherichia coli K88. On day 19, all piglets were euthanized and sampled. Before challenge, piglets fed antibiotics had greater weight gain, feed efficiency, nitrogen and energy retention than the control (P<0.05). E. coli challenge decreased weight gain, feed intake and feed efficiency for the control piglets (P<0.05) but not for the antibiotic or cecropin AD treated piglets. The incidence of diarrhea post-challenge in the antibiotic and cecropin AD treatments decreased compared with the control piglets. The total viable counts of cecal E. coli were lower while the Lactobacilli counts were higher in the antibiotic and cecropin AD treatments compared with the control (P<0.05). Cecropin AD treatment decreased total aerobes while increasing total anaerobes in the ileum (P<0.05). A higher villus height to crypt depth ratio in the jejunum and ileum as well as a deeper crypt depth in the jejunum and higher villus height in the ileum were observed in piglets fed antibiotics or cecropin AD compared with control piglets (P<0.05). Piglets fed the control diet had lower levels of secretory IgA in their jejunum and lower serum IgA, IgG, interleukin-1β and interleukin-6 compared with the other treatments (P<0.05). Overall, these data suggest that cecropin AD enhances pig performance through increasing immune status and nitrogen and energy retention as well as reducing intestinal pathogens in weaned piglets.

  13. Modulation of intestinal calcium and phosphate transport in young goats fed a nitrogen- and/or calcium-reduced diet.

    PubMed

    Elfers, Kristin; Wilkens, Mirja R; Breves, Gerhard; Muscher-Banse, Alexandra S

    2015-12-28

    Feeding ruminants a reduced N diet is a common approach to reduce N output based on rumino-hepatic circulation. However, a reduction in N intake caused massive changes in Ca and inorganic phosphate (Pi) homoeostasis in goats. Although a single dietary Ca reduction stimulated intestinal Ca absorption in a calcitriol-dependent manner, a concomitant reduction of Ca and N supply led to a decrease in calcitriol, and therefore a modulation of intestinal Ca and Pi absorption. The aim of this study was to examine the potential effects of dietary N or Ca reduction separately on intestinal Ca and Pi transport in young goats. Animals were allocated to a control, N-reduced, Ca-reduced or combined N- and Ca-reduced diet for about 6-8 weeks, whereby N content was reduced by 25 % compared with recommendations. In Ussing chamber experiments, intestinal Ca flux rates significantly decreased in goats fed a reduced N diet, whereas Pi flux rates were unaffected. In contrast, a dietary Ca reduction stimulated Ca flux rates and decreased Pi flux rates. The combined dietary N and Ca reduction withdrew the stimulating effect of dietary Ca reduction on Ca flux rates. The expression of Ca-transporting proteins decreased with a reduced N diet too, whereas Pi-transporting proteins were unaffected. In conclusion, a dietary N reduction decreased intestinal Ca transport by diminishing Ca-transporting proteins, which became clear during simultaneous N and Ca reduction. Therefore, N supply in young ruminant nutrition is of special concern for intestinal Ca transport.

  14. Antibacterial drug treatment increases intestinal bile acid absorption via elevated levels of ileal apical sodium-dependent bile acid transporter but not organic solute transporter α protein.

    PubMed

    Miyata, Masaaki; Hayashi, Kenjiro; Yamakawa, Hiroki; Yamazoe, Yasushi; Yoshinari, Kouichi

    2015-01-01

    Antibacterial drug treatment increases the bile acid pool size and hepatic bile acid concentration through the elevation of hepatic bile acid synthesis. However, the involvement of intestinal bile acid absorption in the increased bile acid pool size remains unclear. To determine whether intestinal bile acid absorption contributes to the increased bile acid pool in mice treated with antibacterial drugs, we evaluated the levels of bile acid transporter proteins and the capacity of intestinal bile acid absorption. Ileal apical sodium-dependent bile acid transporter (ASBT) mRNA and protein levels were significantly increased in ampicillin (ABPC)-treated mice, whereas organic solute transporter α (OSTα) mRNA levels, but not protein levels, significantly decreased in mice. Similar alterations in the expression levels of bile acid transporters were observed in mice treated with bacitracin/neomycin/streptomycin. The capacity for intestinal bile acid absorption was evaluated by an in situ loop method. Increased ileal absorption of taurochenodeoxycholic acid was observed in mice treated with ABPC. These results suggest that intestinal bile acid absorption is elevated in an ASBT-dependent manner in mice treated with antibacterial drugs.

  15. Intestinal adaptation following resection.

    PubMed

    Tappenden, Kelly A

    2014-05-01

    Intestinal adaptation is a natural compensatory process that occurs following extensive intestinal resection, whereby structural and functional changes in the intestine improve nutrient and fluid absorption in the remnant bowel. In animal studies, postresection structural adaptations include bowel lengthening and thickening and increases in villus height and crypt depth. Functional changes include increased nutrient transporter expression, accelerated crypt cell differentiation, and slowed transit time. In adult humans, data regarding adaptive changes are sparse, and the mechanisms underlying intestinal adaptation remain to be fully elucidated. Several factors influence the degree of intestinal adaptation that occurs post resection, including site and extent of resection, luminal stimulation with enteral nutrients, and intestinotrophic factors. Two intestinotrophic growth factors, the glucagon-like peptide 2 analog teduglutide and recombinant growth hormone (somatropin), are now approved for clinical use in patients with short bowel syndrome (SBS). Both agents enhance fluid absorption and decrease requirements for parenteral nutrition (PN) and/or intravenous fluid. Intestinal adaptation has been thought to be limited to the first 1-2 years following resection in humans. However, recent data suggest that a significant proportion of adult patients with SBS can achieve enteral autonomy, even after many years of PN dependence, particularly with trophic stimulation.

  16. A chimeric peptide of intestinal trefoil factor containing cholesteryl ester transfer protein B cell epitope significantly inhibits atherosclerosis in rabbits after oral administration.

    PubMed

    Qi, Gaofu; Li, Jingjing; Wang, Shengying; Xin, Shanshan; Du, Peng; Zhang, Qingye; Zhao, Xiuyun

    2011-04-01

    Vaccination against cholesteryl ester transfer protein (CETP) is proven to be effective for inhibiting atherosclerosis in animal models. In this study, the proteases-resistant intestinal trefoil factor (TFF3) was used as a molecular vehicle to construct chimeric TFF3 (cTFF3) containing CETP B cell epitope and tetanus toxin helper T cell epitope. It was found that cTFF3 still preserved a trefoil structure, and can resist proteases digestion in vitro. After oral immunization with cTFF3, the CETP-specific IgA and IgG could be found in intestine lavage fluid and serum, and the anti-CETP antibodies could inhibit partial CETP activity to increase high-density lipoprotein cholesterol, decrease low-density lipoprotein cholesterol, and inhibit atherosclerosis in animals. Therefore, TFF3 is a potential molecular vehicle for developing oral peptide vaccines. Our research highlights a novel strategy for developing oral peptide vaccines in the future.

  17. Effects of epithelium removal on relaxation of airway smooth muscle induced by vasoactive intestinal peptide and electrical field stimulation.

    PubMed Central

    Farmer, S. G.; Togo, J.

    1990-01-01

    1. We have studied the effect of epithelium removal on relaxation of guinea-pig isolated tracheal smooth muscle induced by vasoactive intestinal peptide (VIP) or stimulation of non-adrenergic, non-cholinergic (NANC) inhibitory nerves. Also examined were the effects of inhibitors of neutral endopeptidase (NEP) and angiotensin-converting enzyme (ACE). 2. Epithelium removal produced a 3.6 +/- 0.4 fold leftward shift in the VIP concentration-response curve. The supersensitivity to VIP, following epithelium removal was abolished by phosphoramidon or thiorphan (NEP inhibitors), but unaffected by captopril (an ACE inhibitor). In intact trachea, the NEP inhibitors produced leftward shifts in the VIP curves similar to those produced by epithelium removal. 3. In contrast to responses to exogenous VIP, neurogenic NANC inhibitory responses to electrical field stimulation were affected neither by epithelial denudation nor by the peptidase inhibitors. 4. As in previous studies, epithelium removal increased tracheal sensitivity to isoprenaline. This was not altered by pretreatment with a cocktail of peptidase inhibitors. Thus, the effect of the NEP inhibitors on responses to VIP appears to be relatively specific. 5. These data indicate that exogenous VIP is a substrate for airway NEP, since inhibition of the enzyme potentiates the peptide. This is further evidence that the airway epithelium provides a source for the metabolism of mediators. 6. In guinea-pig trachea the NEP responsible for cleaving VIP may be located largely in the epithelial layer, since NEP inhibition was without effect on sensitivity to VIP in epithelium-denuded preparations. If VIP is a NANC inhibitory neurotransmitter in this tissue its degradation endogenously does not appear to involve epithelial NEP. PMID:2196967

  18. Mechanisms Underlying Food-Drug Interactions: Inhibition of Intestinal Metabolism and Transport

    PubMed Central

    Won, Christina S.; Oberlies, Nicholas H.; Paine, Mary F.

    2012-01-01

    Food-drug interaction studies are critical to evaluate appropriate dosing, timing, and formulation of new drug candidates. These interactions often reflect prandial-associated changes in the extent and/or rate of systemic drug exposure. Physiologic and physicochemical mechanisms underlying food effects on drug disposition are well-characterized. However, biochemical mechanisms involving drug metabolizing enzymes and transport proteins remain underexplored. Several plant-derived beverages have been shown to modulate enzymes and transporters in the intestine, leading to altered pharmacokinetic (PK) and potentially negative pharmacodynamic (PD) outcomes. Commonly consumed fruit juices, teas, and alcoholic drinks contain phytochemicals that inhibit intestinal cytochrome P450 and phase II conjugation enzymes, as well as uptake and efflux transport proteins. Whereas myriad phytochemicals have been shown to inhibit these processes in vitro, translation to the clinic has been deemed insignificant or undetermined. An overlooked prerequisite for elucidating food effects on drug PK is thorough knowledge of causative bioactive ingredients. Substantial variability in bioactive ingredient composition and activity of a given dietary substance poses a challenge in conducting robust food-drug interaction studies. This confounding factor can be addressed by identifying and characterizing specific components, which could be used as marker compounds to improve clinical trial design and quantitatively predict food effects. Interpretation and integration of data from in vitro, in vivo, and in silico studies require collaborative expertise from multiple disciplines, from botany to clinical pharmacology (i.e., plant to patient). Development of more systematic methods and guidelines is needed to address the general lack of information on examining drug-dietary substance interactions prospectively. PMID:22884524

  19. Mechanisms underlying food-drug interactions: inhibition of intestinal metabolism and transport.

    PubMed

    Won, Christina S; Oberlies, Nicholas H; Paine, Mary F

    2012-11-01

    Food-drug interaction studies are critical to evaluate appropriate dosing, timing, and formulation of new drug candidates. These interactions often reflect prandial-associated changes in the extent and/or rate of systemic drug exposure. Physiologic and physicochemical mechanisms underlying food effects on drug disposition are well-characterized. However, biochemical mechanisms involving drug metabolizing enzymes and transport proteins remain underexplored. Several plant-derived beverages have been shown to modulate enzymes and transporters in the intestine, leading to altered pharmacokinetic (PK) and potentially negative pharmacodynamic (PD) outcomes. Commonly consumed fruit juices, teas, and alcoholic drinks contain phytochemicals that inhibit intestinal cytochrome P450 and phase II conjugation enzymes, as well as uptake and efflux transport proteins. Whereas myriad phytochemicals have been shown to inhibit these processes in vitro, translation to the clinic has been deemed insignificant or undetermined. An overlooked prerequisite for elucidating food effects on drug PK is thorough knowledge of causative bioactive ingredients. Substantial variability in bioactive ingredient composition and activity of a given dietary substance poses a challenge in conducting robust food-drug interaction studies. This confounding factor can be addressed by identifying and characterizing specific components, which could be used as marker compounds to improve clinical trial design and quantitatively predict food effects. Interpretation and integration of data from in vitro, in vivo, and in silico studies require collaborative expertise from multiple disciplines, from botany to clinical pharmacology (i.e., plant to patient). Development of more systematic methods and guidelines is needed to address the general lack of information on examining drug-dietary substance interactions prospectively.

  20. Modulation of small intestinal phosphate transporter by dietary supplements of mineral phosphorus and phytase in broilers.

    PubMed

    Huber, Korinna; Zeller, Ellen; Rodehutscord, Markus

    2015-05-01

    Dietary phosphorus (P) is known as a main modulator of phosphate (Pi) transporter expression. The effect of supplemented mineral P with or without phytase on protein expression of two sodium-dependent Pi (NaPi) transporters and a calcium channel was studied in the small intestine of broilers. Thirty-six broilers were randomly assigned to six different diets at 15 days of age. Two levels of total P (tP, adjusted by monocalcium phosphate (MCP) supplementation), 0.39% (BD-) and 0.47% (BD+) were fed until day 25; and at each tP level, three levels of phytase were used with 0, 500, and 12,500 FTU/kg of an E. coli phytase. Mucosa samples from jejunum and ileum were taken and apical membranes were isolated by MgCl2 precipitation. Protein expression of NaPi IIb, NaPi type III (PiT1) and the calcium channel TRPV6 were semiquantitatively measured by Western blotting and jejunal mucosal phytase activity by measurement of Pi release. The jejunal NaPi IIb transporter was expressed with two distinct bands, which were modulated differently by diet. NaPi IIb Band1 increased (P < 0.05) and Band2 decreased (P < 0.05) with phytase supplementation but was not affected by MCP supplementation. This inverse modulation of Band1 and Band2 was significantly related to the amount of net absorbed P with higher expression of Band1 at higher amounts of net absorbed P. In addition, a second Pi transporter, PiT1, was detected in which ileal expression decreased (P < 0.05) in response to higher phytase supplementation. The expression of the calcium channel TRPV6 was increased in BD+ groups. A trend for an interaction between MCP and phytase supplementation on mucosal phytase activity was observed (P = 0.079) with a decrease in activity when BD+ with 12,500 FTU/kg phytase was fed. Chicken intestinal epithelial cells responded to dietary supplemented phytase and MCP by changing the Pi transporter expression in apical membranes. In conclusion, availability of Pi is most likely the key modulator of

  1. Peptide modules for overcoming barriers of nucleic acids transport to cells.

    PubMed

    Egorova, Anna A; Kiselev, Anton V

    2016-01-01

    Absence of safe and efficient methods of nucleic acids delivery is one of the major issues which limits the development of human gene therapy. Highly efficient viral vectors raise questions due to safety reasons. Among non-viral vectors peptide-based carriers can be considered as good candidates for the development of "artificial viruses"--multifunctional polyplexes that mimic viruses. Suggested strategy to obtain multifunctionality is to combine several peptide modules into one modular carrier. Different kinds of peptide modules are needed for successful overcoming barriers of nucleic acids transport into the cells. Design of such modules and establishment of structure-function relationships are issues of importance to researchers working in the field of nucleic acids delivery.

  2. Role of glucose transporters in the intestinal absorption of gastrodin, a highly water-soluble drug with good oral bioavailability.

    PubMed

    Cai, Zheng; Huang, Juan; Luo, Hui; Lei, Xiaolu; Yang, Zhaoxiang; Mai, Yang; Liu, Zhongqiu

    2013-07-01

    Gastrodin, a sedative drug, is a highly water-soluble phenolic glucoside with poor liposolubility but exhibits good oral bioavailability. The current study aims to investigate whether glucose transporters (GLTs) are involved in the intestinal absorption of gastrodin. The intestinal absorption kinetics of gastrodin was determined using the rat everted gut sac model, the Caco-2 cell culture model and the perfused rat intestinal model. In vivo pharmacokinetic studies using diabetic rats with high GLT expression were performed. Saturable intestinal absorption of gastrodin was observed in rat everted gut sacs. The apparent permeability (Papp) of gastrodin from the apical (A) to basolateral (B) side in Caco-2 cells was two-fold higher than that from B to A. Glucose or phlorizin, a sodium-dependent GLT (SGLT) inhibitor, reduced the absorption rates of gastrodin from perfused rat intestines. In vivo pharmacokinetic studies showed that the time of maximum plasma gastrodin concentration (Tmax) was prolonged from 28 to 72 min when orally co-administered with four times higher dose of glucose. However, the Tmax of gastrodin in diabetic rats was significantly lowered to 20 min because of the high intestinal SGLT1 level. In conclusion, our findings indicate that SGLT1 can facilitate the intestinal absorption of gastrodin.

  3. Effects of age on intestinal phosphate transport and biochemical values of broiler chickens

    PubMed Central

    Li, Jianhui; Yuan, Jianmin; Miao, Zhiqiang; Guo, Yuming

    2017-01-01

    Objective The objective of this experiment was to characterize the mRNA expression profile of type IIb sodium-inorganic phosphate cotransporter (NaPi-IIb) and the biochemical values of serum alkaline phosphatase (AKP), calcium, inorganic phosphorus, tibial ash and minerals of broiler chickens with aging. Methods A total of 56 one-day-old Arbor Acres male broiler chickens were used. Broiler chickens were weighed and samples were collected weekly from day 1. Results The result showed that before the growth inflection point, ash, calcium, and phosphorus content in the tibia of broiler chickens increased with growth (before 3 weeks of age), although there were no significant differences in chicks at different ages in the later period of the experiment and weight gain rate was relatively slow at this stage (4 to 6 weeks). NaPi-IIb gene expression in the small intestine in the early growth stage was higher than that in the later growth stage. Expression of calbindin and the vitamin D receptor protein in the intestinal mucosa increased with age in the duodenum and jejunum. Serum AKP activity first increased and subsequently decreased after peaking at 1 week of age, but there was no significant difference after 3 weeks of age. Conclusion These results show that compared with the early growth stage, the weight-gain rate of broiler chickens in the late growth stage gradually decreased with gradual tibia maturation, along with weaker positive transport of phosphorus in the intestine and reinforced re-absorption of phosphorus in the kidney, which might be the reason that phosphorus requirement in the late growth stage was decreased. PMID:27703131

  4. Protease-activated receptor-2 stimulates intestinal epithelial chloride transport through activation of PLC and selective PKC isoforms.

    PubMed

    van der Merwe, Jacques Q; Moreau, France; MacNaughton, Wallace K

    2009-06-01

    Serine proteases play important physiological roles through their activity at G protein-coupled protease-activated receptors (PARs). We examined the roles that specific phospholipase (PL) C and protein kinase (PK) C (PKC) isoforms play in the regulation of PAR(2)-stimulated chloride secretion in intestinal epithelial cells. Confluent SCBN epithelial monolayers were grown on Snapwell supports and mounted in modified Ussing chambers. Short-circuit current (I(sc)) responses to basolateral application of the selective PAR(2) activating peptide, SLIGRL-NH(2), were monitored as a measure of net electrogenic ion transport caused by PAR(2) activation. SLIGRL-NH(2) induced a transient I(sc) response that was significantly reduced by inhibitors of PLC (U73122), phosphoinositol-PLC (ET-18), phosphatidylcholine-PLC (D609), and phosphatidylinositol 3-kinase (PI3K; LY294002). Immunoblot analysis revealed the phosphorylation of both PLCbeta and PLCgamma following PAR(2) activation. Pretreatment of the cells with inhibitors of PKC (GF 109203X), PKCalpha/betaI (Gö6976), and PKCdelta (rottlerin), but not PKCzeta (selective pseudosubstrate inhibitor), also attenuated this response. Cellular fractionation and immunoblot analysis, as well as confocal immunocytochemistry, revealed increases of PKCbetaI, PKCdelta, and PKCepsilon, but not PKCalpha or PKCzeta, in membrane fractions following PAR(2) activation. Pretreatment of the cells with U73122, ET-18, or D609 inhibited PKC activation. Inhibition of PI3K activity only prevented PKCdelta translocation. Immunoblots revealed that PAR(2) activation induced phosphorylation of both cRaf and ERK1/2 via PKCdelta. Inhibition of PKCbetaI and PI3K had only a partial effect on this response. We conclude that basolateral PAR(2)-induced chloride secretion involves activation of PKCbetaI and PKCdelta via a PLC-dependent mechanism resulting in the stimulation of cRaf and ERK1/2 signaling.

  5. Ndel1-derived peptides modulate bidirectional transport of injected beads in the squid giant axon

    PubMed Central

    Segal, Michal; Soifer, Ilya; Petzold, Heike; Howard, Jonathon; Elbaum, Michael; Reiner, Orly

    2012-01-01

    Summary Bidirectional transport is a key issue in cellular biology. It requires coordination between microtubule-associated molecular motors that work in opposing directions. The major retrograde and anterograde motors involved in bidirectional transport are cytoplasmic dynein and conventional kinesin, respectively. It is clear that failures in molecular motor activity bear severe consequences, especially in the nervous system. Neuronal migration may be impaired during brain development, and impaired molecular motor activity in the adult is one of the hallmarks of neurodegenerative diseases leading to neuronal cell death. The mechanisms that regulate or coordinate kinesin and dynein activity to generate bidirectional transport of the same cargo are of utmost importance. We examined how Ndel1, a cytoplasmic dynein binding protein, may regulate non-vesicular bidirectional transport. Soluble Ndel1 protein, Ndel1-derived peptides or control proteins were mixed with fluorescent beads, injected into the squid giant axon, and the bead movements were recorded using time-lapse microscopy. Automated tracking allowed for extraction and unbiased analysis of a large data set. Beads moved in both directions with a clear bias to the anterograde direction. Velocities were distributed over a broad range and were typically slower than those associated with fast vesicle transport. Ironically, the main effect of Ndel1 and its derived peptides was an enhancement of anterograde motion. We propose that they may function primarily by inhibition of dynein-dependent resistance, which suggests that both dynein and kinesin motors may remain engaged with microtubules during bidirectional transport. PMID:23213412

  6. Measurement of vasoactive intestinal peptide using a competitive fluorescent microsphere immunoassay or ELISA in human blood samples.

    PubMed

    Song, Eun Young; VanDunk, Cassandra; Kuddo, Thea; Nelson, Phillip G

    2005-05-01

    The concentration of Vasoactive Intestinal Peptide (VIP) as measured by recycling immunoaffinity chromatography (RIC) has been reported to be elevated in the blood of patients with autism as compared with normal subjects. In this study, we have developed a "Competitive Fluorescent Microsphere Immunoassay" (cFMI) in which VIP competes with biotinylated VIP in binding to polyclonal antibodies on microspheres. The results were obtained using the Luminex100 system. We measured VIP in serum, plasma, and material eluted from dried blood spots on filter paper with both the cFMI and an ELISA procedure. We found that a purification procedure was necessary for obtaining useful results from plasma and serum, however, a preincubation step was required with the blood eluates. This newly developed cFMI was more sensitive (2.5 vs. 20.0 pg/ml), and more reproducible than the ELISA. To get accurate measurements of VIP in eluted material high sensitivity is especially important. Thus, the cFMI using the Luminex system has definite advantages over a conventional ELISA including the possibility that samples can be assayed at higher dilutions. We have determined that the VIP concentrations of serum, plasma, and dried blood spot eluate specimens as measured with the cFMI assay system were similar to those measured with ELISA. Thus, the new cFMI using Luminex system may be useful for detection of VIP in human blood samples.

  7. Vasoactive Intestinal Peptide modulates trophoblast-derived cell line function and interaction with phagocytic cells through autocrine pathways

    PubMed Central

    Vota, Daiana; Paparini, Daniel; Hauk, Vanesa; Toro, Ayelén; Merech, Fatima; Varone, Cecilia; Ramhorst, Rosanna; Pérez Leirós, Claudia

    2016-01-01

    Trophoblast cells migrate and invade the decidual stroma in a tightly regulated process to maintain immune homeostasis at the maternal-placental interface during the first weeks of pregnancy. Locally synthesized factors modulate trophoblast cell function and their interaction with maternal leukocytes to promote the silent clearance of apoptotic cells. The vasoactive intestinal peptide (VIP) is a pleiotropic polypeptide with trophic and anti-inflammatory effects in murine pregnancy models. We explored the effect of VIP on two human first trimester trophoblast cell lines, particularly on their migration, invasiveness and interaction with phagocytic cells, and the signalling and regulatory pathways involved. We found that VIP enhanced trophoblast cell migration and invasion through the activation of high affinity VPAC receptors and PKA-CRE signalling pathways. VIP knocked-down trophoblast cells showed reduced migration in basal and leukemic inhibitor factor (LIF)-elicited conditions. In parallel, VIP-silenced trophoblast cells failed to induce the phagocytosis of apoptotic bodies and the expression of immunosuppressant markers by human monocytes. Our results suggest that VIP-mediated autocrine pathways regulate trophoblast cell function and contribute to immune homeostasis maintenance at placentation and may provide new clues for therapeutic intervention in pregnancies complicated by defective deep placentation. PMID:27212399

  8. The effect of ice-slushy consumption on plasma vasoactive intestinal peptide during prolonged exercise in the heat.

    PubMed

    Burdon, Catriona A; Ruell, Patricia; Johnson, Nathan; Chapman, Phillip; O'Brien, Sinead; O'Connor, Helen T

    2015-01-01

    The aim of this study was to determine the effect of exercise in the heat on thermoregulatory responses and plasma vasoactive intestinal peptide concentration (VIP) and whether it is modulated by ice-slushy consumption. Ten male participants cycled at 62% V̇O2max for 90min in 32°C and 40% relative humidity. A thermoneutral (37°C) or ice-slushy (-1°C) sports drink was given at 3.5mlkg(-1) body mass every 15min during exercise. VIP and rectal temperature increased during exercise (mean±standard deviation: 4.6±4.4pmolL(-1), P=0.005; and 1.3±0.4°C, P<0.001 respectively) and were moderately associated (r=0.35, P=0.008). While rectal temperature and VIP were not different between trials, ice-slushy significantly reduced heat storage (P=0.010) and skin temperature (time×trial interaction P=0.038). It appears that VIP does not provide the signal linking cold beverage ingestion and lower skin temperature in the heat.

  9. D-(Ala1)-peptide T-amide is transported from blood to brain by a saturable system

    SciTech Connect

    Barrera, C.M.; Kastin, A.J.; Banks, W.A.

    1987-12-01

    It is becoming increasingly evident that peptides can cross the blood-brain barrier. The entry into the central nervous system of a commercially available analog of Peptide T, an octapeptide derived from the human immunodeficiency virus envelope glycoprotein 120, was studied in several experiments. It was found that /sup 125/I-Peptide T analog given intravenously in the periphery entered the brain in an intact form, as confirmed by HPLC, to a greater extent than did the labeled albumin control. This entry occurred despite the very low lipid solubility, measured by the octanol/buffer partition coefficient, for the iodinated analog. The rate of entry was decreased by unlabeled Peptide T analog, but not by iodo-tyrosine. Saturable transport out of the brain was not observed after intraventricular administration. Thus, results with /sup 125/I-Peptide T analog indicate that saturable systems can transport peptides from the blood into the central nervous system.

  10. D-[Ala1]-peptide T-amide is transported from blood to brain by a saturable system.

    PubMed

    Barrera, C M; Kastin, A J; Banks, W A

    1987-12-01

    It is becoming increasingly evident that peptides can cross the blood-brain barrier. The entry into the central nervous system of a commercially available analog of Peptide T, an octapeptide derived from the human immunodeficiency virus envelope glycoprotein 120, was studied in several experiments. It was found that 125I-Peptide T analog given intravenously in the periphery entered the brain in an intact form, as confirmed by HPLC, to a greater extent than did the labeled albumin control. This entry occurred despite the very low lipid solubility, measured by the octanol/buffer partition coefficient, for the iodinated analog. The rate of entry was decreased by unlabeled Peptide T analog, but not by iodo-tyrosine. Saturable transport out of the brain was not observed after intraventricular administration. Thus, results with 125I-Peptide T analog indicate that saturable systems can transport peptides from the blood into the central nervous system.

  11. The Small Intestinal Epithelia of Beef Steers Differentially Express Sugar Transporter Messenger Ribonucleic Acid in Response to Abomasal Versus Ruminal Infusion of Starch Hydrolysate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In mammals, the absorption of mono¬saccharides from small intestinal lumen involves at least 3 sugar transporters (SugT): sodium-dependent glucose transporter 1 (SGLT1; gene SLC5A1) transports glucose and galactose, whereas glucose transporter (GLUT) 5 (GLUT5; gene SLC2A5) transports fructose, acros...

  12. Blood-brain barrier transport of short proline-rich antimicrobial peptides.

    PubMed

    Stalmans, Sofie; Wynendaele, Evelien; Bracke, Nathalie; Knappe, Daniel; Hoffmann, Ralf; Peremans, Kathelijne; Polis, Ingeborgh; Burvenich, Christian; De Spiegeleer, Bart

    2014-04-01

    Infections by antibiotic-resistant bacteria are becoming a great risk for human health, leading to an urgent need for new efficient antibacterial therapies. The short, proline-rich antimicrobial peptides from insects gained a lot of interest as a potential antibacterial treatment, having a low toxicity profile and being mainly active against Gram-negative bacteria. To know whether these antimicrobial peptides can be used for the treatment of cerebral infections, the blood-brain barrier transport characteristics of these peptides were investigated. This study describes the results of the in vivo blood-brain barrier experiments in mice, as well as the in vitro metabolic stability in mouse plasma and brain of apidaecin Api137, oncocin, drosocin and drosocin Pro5Hyp. The four investigated peptides showed a significant influx into the brain with a K(in) ranging between 0.37 and 0.86 µL/g x min and brain distribution volumes of 19.6 to 25.8 µL/g. Only for drosocin, a significant efflux was determined, with a k(out) of 0.22 min(-1). After entering the brain, oncocin was for approximately 80% trapped in the endothelial cells, while the other peptides reached the brain parenchyma for about 70%. All peptides were stable in plasma and brain during the experiments, with estimated metabolic half-lives ranging between 47 min and 637 min. We conclude that the investigated short, proline-rich antimicrobial peptides show an influx into the brain, which make them a promising antibacterial treatment of cerebral infections.

  13. Tuning electronic transport via hepta-alanine peptides junction by tryptophan doping

    PubMed Central

    Guo, Cunlan; Yu, Xi; Refaely-Abramson, Sivan; Sepunaru, Lior; Bendikov, Tatyana; Pecht, Israel; Kronik, Leeor; Vilan, Ayelet; Sheves, Mordechai; Cahen, David

    2016-01-01

    Charge migration for electron transfer via the polypeptide matrix of proteins is a key process in biological energy conversion and signaling systems. It is sensitive to the sequence of amino acids composing the protein and, therefore, offers a tool for chemical control of charge transport across biomaterial-based devices. We designed a series of linear oligoalanine peptides with a single tryptophan substitution that acts as a “dopant,” introducing an energy level closer to the electrodes’ Fermi level than that of the alanine homopeptide. We investigated the solid-state electron transport (ETp) across a self-assembled monolayer of these peptides between gold contacts. The single tryptophan “doping” markedly increased the conductance of the peptide chain, especially when its location in the sequence is close to the electrodes. Combining inelastic tunneling spectroscopy, UV photoelectron spectroscopy, electronic structure calculations by advanced density-functional theory, and dc current–voltage analysis, the role of tryptophan in ETp is rationalized by charge tunneling across a heterogeneous energy barrier, via electronic states of alanine and tryptophan, and by relatively efficient direct coupling of tryptophan to a Au electrode. These results reveal a controlled way of modulating the electrical properties of molecular junctions by tailor-made “building block” peptides. PMID:27621456

  14. Somatostatin and the intestinal transport of glucose and other nutrients in the anaesthetised rat.

    PubMed Central

    Daumerie, C; Henquin, J C

    1982-01-01

    The effects of somatostatin on oral glucose tolerance and on intestinal absorption of glucose and other nutrients have been studied in anaesthetised rats. Intravenous somatostatin (0.1-0.6 nmol/min) increased the rate of gastric emptying. After intraduodenal administration of glucose, the rise in peripheral plasma levels of the sugar was delayed, but finally exaggerated by somatostatin, which inhibited the insulin response. Absorption was evaluated by measuring the disappearance of radioactive nutrients from the lumen of a 'tied duodenojejunal loop'. At a luminal concentration of 4 mmol/l of 3-0-methylglucose, neither disappearance of the sugar from the lumen nor its appearance in plasma was affected by somatostatin. Passive transport of 3-0-methylglucose (100 mmol/l) was not significantly modified by somatostatin, although the appearance of the labelled tracer in plasma was delayed. Somatostatin had no significant effect on absorption of galactose (4 mmol/l), sucrose (40 mmol/l), leucine (4 mmol/l) or palmitate (0.1 and 0.4 mmol/l). These results show that somatostatin delays appearance of ingested sugars in peripheral plasma without direct effect on the absorption sites; this delay may result from changes in intestinal motility, enzyme secretion and splanchnic blood flow. PMID:6121743

  15. Mechanisms of improvement of intestinal transport of baicalin and puerarin by extracts of Radix Angelicae Dahuricae.

    PubMed

    Liang, Xin-Li; Zhang, Jing; Zhao, Guo-Wei; Li, Zhe; Luo, Yun; Liao, Zheng-Gen; Yan, Dong-Mei

    2015-02-01

    Radix Angelicae Dahuricae is the dried root of Angelicae Dahurica (Fisch.ex Hoffm.)Benth.et Hook.f. var.formosana (Boiss.) Shan et Yuan (Fam.Umbelliferae). The total coumarins (Cou) and volatile oil (VO) were main active components that drived from Radix Angelicae Dahuricae. Our previous studies have shown that Cou and VO could increase intestinal absorption for transmucosal drug delivery with unknown mechanism. The aim of this study was to investigate the molecular mechanism of Radix Angelicae Dahuricae for improving drug intestinal transport. Caco-2 cell model was used to study the effect of Radix Angelicae Dahurica on transepithelial electrical resistance. Western blot was used to study its effect on the expression of the actin and ZO-1, tight junction proteins. The effect of Radix Angelicae Dahurica on the expression of P-gp protein was investigated using flow cytometry. VO (0.036-2.88 μL/mL) and Cou (0.027-0.54 mg/mL) caused a reversible, time- and dose-dependent decrease in transepithelial electrical resistance. VO and/or Cou could inhibit the expression of the tight junction protein, ZO-1 and actin. VO and/or Cou also could inhibit the expression of P-gp. These data suggested that Radix Angelicae Dahurica increased cell permeability by affecting the expression of actin, ZO-1 or P-gp, opening the tight junction or inhibiting the efflux induced by P-gp.

  16. Improvements in growth performance, bone mineral status and nutrient digestibility in pigs following the dietary inclusion of phytase are accompanied by modifications in intestinal nutrient transporter gene expression.

    PubMed

    Vigors, Stafford; Sweeney, Torres; O'Shea, Cormac J; Browne, John A; O'Doherty, John V

    2014-09-14

    Phytase (PHY) improves growth performance, nutrient digestibility and bone structure in pigs; however, little is known about its effects on intestinal nutrient transporter gene expression. In the present study, a 44 d experiment was carried out using forty-eight pigs (11·76 (sem 0·75) kg) assigned to one of three dietary treatment groups to measure growth performance, coefficient of apparent ileal digestibility (CAID), coefficient of apparent total tract nutrient digestibility (CATTD) and intestinal nutrient transporter gene expression. Dietary treatments during the experimental period were as follows: (1) a high-P (HP) diet containing 3·4 g/kg available P and 7·0 g/kg Ca; (2) a low-P (LP) diet containing 1·9 g/kg available P and 5·9 g/kg Ca; (3) a PHY diet containing LP diet ingredients+1000 phytase units (FTU)/kg of PHY. The PHY diet increased the average daily gain (P< 0·05) and final body weight (P< 0·01) and decreased the feed conversion ratio (P< 0·05) compared with the LP diet. Pigs fed the PHY diet had a higher CAID of gross energy compared with those fed the HP and LP diets (P< 0·001). Pigs fed the PHY diet had increased CAID of P (P< 0·01) and CATTD of Ca and P (P< 0·001) compared with those fed the LP diet. The PHY diet increased the gene expression of the peptide transporter 1 (PEPT1/SLC15A1) (P< 0·05) in the ileum compared with the LP diet. The LP diet decreased the gene expression of the sodium-glucose-linked transporter 1 (SGLT1/SLC5A1) and GLUT2/SLC2A2 (P< 0·05) and increased the expression of membrane Ca channel (TRPV6) and calbindin compared with the HP diet (P< 0·001). In conclusion, feeding a diet supplemented with PHY improves growth performance and nutrient digestibility as well as increases the gene expression of the peptide transporter PEPT1.

  17. Intestinal permeability and P-glycoprotein-mediated efflux transport of ticagrelor in Caco-2 monolayer cells.

    PubMed

    Marsousi, Niloufar; Doffey-Lazeyras, Fabienne; Rudaz, Serge; Desmeules, Jules A; Daali, Youssef

    2016-12-01

    Ticagrelor is the unique reversible oral antiplatelet drug commercialized today. During this study, the intestinal permeability of ticagrelor and its potential P-glycoprotein (P-gp)-mediated active transport were assessed. To this end, bidirectional transport of ticagrelor was performed across Caco-2 (human epithelial colorectal adenocarcinoma) monolayer model in the presence and absence of potent P-gp inhibitor valspodar. Ticagrelor presented an apical-basolateral apparent permeability coefficient (Papp ) of 6.0 × 10(-6) cm/s. On the other hand, mean efflux ratio (ER) of 2.71 was observed for ticagrelor describing a higher efflux permeability compared to the influx component. Valspodar showed a significant inhibitory effect on the efflux of ticagrelor suggesting involvement of P-gp in its oral disposition. Co-incubation of the P-gp inhibitor decreased the efflux Papp of ticagrelor from 1.60 × 10(-5) to 1.13 × 10(-5) cm/s and decreased its ER by 70%. Results suggest a modest active transport of ticagrelor by P-gp across the Caco-2 cell monolayer. The co-administration of ticagrelor with a P-gp inhibitor seems altogether unlikely to have an extended impact on pharmacokinetics of ticagrelor and cause bleeding events in patients.

  18. Transport of aspalathin, a Rooibos tea flavonoid, across the skin and intestinal epithelium.

    PubMed

    Huang, Miao; du Plessis, Jeanetta; du Preez, Jan; Hamman, Josias; Viljoen, Alvaro

    2008-05-01

    Since Rooibos tea contains high levels of flavonoid antioxidants with potential health benefits when taken orally or applied topically, the quantity of the antioxidants crossing the physiological barriers is of scientific, clinical and commercial importance. This study investigated the in vitro transport of aspalathin, a unique flavonoid constituent of Rooibos tea, across intestinal epithelial cells and the human skin. The transport studies were conducted for both pure aspalathin solutions and extracts from unfermented (or green) Rooibos (Aspalathus linearis) aerial plant material across human abdominal skin in vertical Franz diffusion cells and Caco-2 cell monolayers in Transwell 6-well plates. The results obtained from the percutaneous permeation studies demonstrated that only 0.01% of the initial aspalathin dose from both the test solution and extract permeated through the skin, which was in accordance with the prediction from its log P value of -0.347. A portion of 0.07% of the initial aspalathin dose penetrated the different layers of the skin for the green Rooibos extract solution and 0.08% for the pure aspalathin solution. The transport of aspalathin across Caco-2 cell monolayers was concentration dependent and reached almost 100% (P(app) = 20.93 x 10(-6) cm/s) of the initial dose in the highest concentration tested for the extract, while it was only 79.03% (P(app) = 15.34 x 10(-6) cm/s) of the initial dose for the highest concentration of the aspalathin solution.

  19. Quercetin inhibits intestinal iron absorption and ferroportin transporter expression in vivo and in vitro.

    PubMed

    Lesjak, Marija; Hoque, Rukshana; Balesaria, Sara; Skinner, Vernon; Debnam, Edward S; Srai, Surjit K S; Sharp, Paul A

    2014-01-01

    Balancing systemic iron levels within narrow limits is critical for maintaining human health. There are no known pathways to eliminate excess iron from the body and therefore iron homeostasis is maintained by modifying dietary absorption so that it matches daily obligatory losses. Several dietary factors can modify iron absorption. Polyphenols are plentiful in human diet and many compounds, including quercetin--the most abundant dietary polyphenol--are potent iron chelators. The aim of this study was to investigate the acute and longer-term effects of quercetin on intestinal iron metabolism. Acute exposure of rat duodenal mucosa to quercetin increased apical iron uptake but decreased subsequent basolateral iron efflux into the circulation. Quercetin binds iron between its 3-hydroxyl and 4-carbonyl groups and methylation of the 3-hydroxyl group negated both the increase in apical uptake and the inhibition of basolateral iron release, suggesting that the acute effects of quercetin on iron transport were due to iron chelation. In longer-term studies, rats were administered quercetin by a single gavage and iron transporter expression measured 18 h later. Duodenal FPN expression was decreased in quercetin-treated rats. This effect was recapitulated in Caco-2 cells exposed to quercetin for 18 h. Reporter assays in Caco-2 cells indicated that repression of FPN by quercetin was not a transcriptional event but might be mediated by miRNA interaction with the FPN 3'UTR. Our study highlights a novel mechanism for the regulation of iron bioavailability by dietary polyphenols. Potentially, diets rich in polyphenols might be beneficial for patients groups at risk of iron loading by limiting the rate of intestinal iron absorption.

  20. New advances in the pathophysiology of intestinal ion transport and barrier function in diarrhea and the impact on therapy.

    PubMed

    Hoque, Kazi Mirajul; Chakraborty, Subhra; Sheikh, Irshad Ali; Woodward, Owen M

    2012-06-01

    Diarrhea remains a continuous threat to human health worldwide. Scaling up the best practices for diarrhea prevention requires improved therapies. Diarrhea results from dysregulation of normal intestinal ion transport functions. Host-microbe contact is a key determinant of this response. Underlying mechanisms in the disease state are regulated by intracellular signals that modulate the activity of individual transport proteins responsible for ion transport and barrier function. Similarly, virulence factors of pathogens and their complex interaction with the host has shed light on the mechanism of enteric infection. Great advances in our understanding of the pathophysiologic mechanisms of epithelial transport, and host-microbe interaction have been made in recent years. Application of these new advances may represent strategies to decrease pathogen attachment, enhance intestinal cation absorption, decrease anion secretion and repair barrier function. This review highlights the new advances and better understanding in the pathophysiology of diarrheal diseases and their impact on therapy.

  1. Expression of digestive enzymes and nutrient transporters in the small intestine of Eimeria acervulina-infected chickens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Coccidiosis is a major disease of poultry caused by the intestinal protozoa Eimeria. Eimeria acervulina mainly infects the duodenum, causing lesions in epithelial tissue. The objective of this study was to investigate the effect of E. acervulina infection on the expression of 18 nutrient transport...

  2. Yeast culture supplement during nursing and transport affects immunity and intestinal microbial ecology of weanling pigs.

    PubMed

    Weedman, S M; Rostagno, M H; Patterson, J A; Yoon, I; Fitzner, G; Eicher, S D

    2011-06-01

    The objectives of this study were to determine the influence of a Saccharomyces cerevisiae fermentation product on innate immunity and intestinal microbial ecology after weaning and transport stress. In a randomized complete block design, before weaning and in a split-plot analysis of a 2 × 2 factorial arrangement of yeast culture (YY) and transport (TT) after weaning, 3-d-old pigs (n = 108) were randomly assigned within litter (block) to either a control (NY, milk only) or yeast culture diet (YY; delivered in milk to provide 0.1 g of yeast culture product/kg of BW) from d 4 to 21. At weaning (d 21), randomly, one-half of the NY and YY pigs were assigned to a 6-h transport (NY-TT and YY-TT) before being moved to nursery housing, and the other one-half were moved directly to nursery housing (NY-NT and YY-NT, where NT is no transport). The yeast treatment was a 0.2% S. cerevisiae fermentation product and the control treatment was a 0.2% grain blank in feed for 2 wk. On d 1 before transport and on d 1, 4, 7, and 14 after transport, blood was collected for leukocyte assays, and mesenteric lymph node, jejunal, and ileal tissue, and jejunal, ileal, and cecal contents were collected for Toll-like receptor expression (TLR); enumeration of Escherichia coli, total coliforms, and lactobacilli; detection of Salmonella; and microbial analysis. After weaning, a yeast × transport interaction for ADG was seen (P = 0.05). Transport affected (P = 0.09) ADFI after weaning. Yeast treatment decreased hematocrit (P = 0.04). A yeast × transport interaction was found for counts of white blood cells (P = 0.01) and neutrophils (P = 0.02) and for the neutrophil-to-lymphocyte ratio (P = 0.02). Monocyte counts revealed a transport (P = 0.01) effect. Interactions of yeast × transport (P = 0.001) and yeast × transport × day (P = 0.09) for TLR2 and yeast × transport (P = 0.08) for TLR4 expression in the mesenteric lymph node were detected. Day affected lactobacilli, total coliform, and E

  3. Structural Determinants for Transport Across the Intestinal Bile Acid Transporter Using C-24 Bile Acid Conjugates

    PubMed Central

    Rais, Rana; Acharya, Chayan; MacKerell, Alexander D.; Polli, James E.

    2010-01-01

    The human apical sodium dependent bile acid transporter (hASBT) re-absorbs gram quantities of bile acid daily and is a potential prodrug target to increase oral drug absorption. In the absence of a high resolution hASBT crystal structure, 3D-QSAR modeling may prove beneficial in designing prodrug targets to hASBT. The objective was to derive a conformationally sampled pharmacophore 3D–QSAR (CSP-SAR) model for the uptake of bile acid conjugates by hASBT. A series of bile acid conjugates of glutamyl chenodeoxycholate were evaluated in terms of Km and normalized Vmax(normVmax) using hASBT-MDCK cells. All mono-anionic conjugates were potent substrates. Dianions, cations and zwitterions, which bound with a high affinity, were not substrates. CSP-SAR models were derived using structural and physicochemical descriptors, and evaluated via cross-validation. The best CSP-SAR model for Km included two structural and two physiochemical descriptors, where substrate hydrophobicity enhanced affinity. A best CSP-SAR model for Km/normVmax employed one structural and three physicochemical descriptors, also indicating hydrophobicity enhanced efficiency. Overall, the bile acid C-24 region accommodated a range of substituted anilines, provided a single negative charge was present near C-24. In comparing uptake findings to prior inhibition results, increased hydrophobicity enhanced activity, with dianions and zwitterions hindering activity. PMID:20939504

  4. Role of phosphatidylinositol-3 kinase-gamma in the actions of glucagon-like peptide-2 on the murine small intestine.

    PubMed

    Anini, Younes; Izzo, Angelo; Oudit, Gavin Y; Backx, Peter H; Brubaker, Patricia L

    2007-06-01

    Glucagon-like peptide-2 (GLP-2) enhances intestinal growth and function through a cAMP-linked G protein-coupled receptor (GPCR) expressed in the mucosal layer and enteric nervous system. Because the type 1B gamma-isoform of phosphatidylinositol 3-kinase (PI3-K) is activated by GPCRs, we determined whether this enzyme plays a role in the intestinal actions of GLP-2 by using PI3-Kgamma knockout (KO) mice. Wild-type (WT), heterozygous, and KO mice were treated with vehicle or 1 microg Gly2-GLP-2 (a long-acting analog) twice daily for 10 days and analyzed for changes in intestinal growth, motility, and cAMP production. Basal small intestinal wet weight was increased in KO mice in association with enhanced crypt-villus height and crypt cell proliferation (P < 0.05-0.01). However, the GLP-2-induced changes in these parameters were not different between KO and WT animals. GLP-2 treatment also enhanced the number of mucous cells in the intestinal epithelium, but this effect was lost in the PI3-Kgamma KO mice. Both basal and GLP-2-induced suppression of intestinal transit were normal in KO mice. In contrast, the ability of GLP-2 to stimulate cAMP levels in isolated muscle strips was abrogated by loss of PI3-Kgamma, despite the expression of GLP-2 receptor mRNA transcripts in this tissue. Together, the results of this study demonstrate a role for PI3-Kgamma in basal but not GLP-2-induced small intestinal mucosal growth. However, PI3-Kgamma is important for the enhancement of mucous cell number by GLP-2 and in the ability of the GLP-2 receptor to couple to cAMP in the enteric nervous system.

  5. Mitochondrial localization of P-glycoprotein and peptide transporters in corneal epithelial cells--novel strategies for intracellular drug targeting.

    PubMed

    Barot, Megha; Gokulgandhi, Mitan R; Pal, Dhananjay; Mitra, Ashim K

    2013-01-01

    This study was designed to investigate functional localization of both efflux (P-glycoprotein, P-gp) and influx (peptide) transporters in the mitochondrial membrane of cultured rabbit primary corneal epithelial cells (rPCECs). Isolation and purification of mitochondria was performed by optimized cell fractionation method. Mitochondrial integrity was measured by JC-1 uptake experiment. The efflux activity of P-gp was assessed by performing in vitro uptake studies on isolated mitochondria with Rhodamine 123 (Rho-123) alone and in the presence of P-gp inhibitors (quinidine and cyclosporine A) using fluorimetry and flow cytometry analysis. Functional activity of peptide transporter was assessed by performing in vitro uptake studies of [3H] Gly-sar on isolated mitochondria in the presence or absence of peptide transporter substrate (Val-Val). Molecular characterization of P-gp and peptide transporter was assessed by western blot and confocal analysis. Enhanced JC-1 accumulation in the isolated fraction confirmed mitochondrial membrane integrity. Significantly higher uptake of Rho-123 on isolated mitochondria was observed in the presence of quinidine (75 and 100 μM) and cyclosporine A (10 μM). Significantly lower uptake of [3H] Gly-sar was observed in the presence of val-val due to competitive inhibition of peptide transporter on isolated mitochondria. Western blot and confocal analysis further confirmed the presence of P-gp and peptide transporter on the mitochondrial membrane of rPCECs. The present study demonstrates the functional and molecular characterization of P-gp and peptide transporters in the mitochondrial membranes of rPCECs. This knowledge of mitochondrial existence of P-gp and peptide transporter will aid in the development of subcellular ocular drug delivery strategies.

  6. Impact of dextran sulphate sodium-induced colitis on the intestinal transport of the colon carcinogen PhIP.

    PubMed

    Nicken, Petra; von Keutz, Anne; Willenberg, Ina; Ostermann, Annika I; Schebb, Nils Helge; Giovannini, Samoa; Kershaw, Olivia; Breves, Gerhard; Steinberg, Pablo

    2016-05-01

    Colorectal cancer is one of the most frequent cancers in Western countries. Chronic intestinal diseases such as Crohn's disease and ulcerative colitis, in which the intestinal barrier is massively disturbed, significantly raise the risk of developing a colorectal tumour. 2-Amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) is a genotoxic heterocyclic aromatic amine that is formed after strongly heating fish and meat. In this study, the hypothesis that PhIP uptake in the gut is increased during chronic colitis was tested. Chronic colitis was induced by oral administration of dextran sulphate sodium (DSS) to Fischer 344 rats. The transport of PhIP in eight different rat intestinal segments was examined in Ussing chambers. The tissues were incubated with 10 µM PhIP for 90 min, and the concentration of PhIP was determined in the mucosal and serosal compartments of the Ussing chambers as well as in the clamped tissues by LC-MS. Although chronic colitis was clearly induced in the rats, no differences in the intestinal transport of PhIP were observed between control and DSS-treated animals. The hypothesis that in the course of chronic colitis more PhIP is taken up by the intestinal epithelium, thereby increasing the risk of developing colorectal cancer, could not be confirmed in the present report.

  7. Carrier-mediated γ-aminobutyric acid transport across the basolateral membrane of human intestinal Caco-2 cell monolayers.

    PubMed

    Nielsen, Carsten Uhd; Carstensen, Mette; Brodin, Birger

    2012-06-01

    The aim of the present study was to investigate the transport of γ-aminobutyric acid (GABA) across the basolateral membrane of intestinal cells. The proton-coupled amino acid transporter, hPAT1, mediates the influx of GABA and GABA mimetic drug substances such as vigabatrin and gaboxadol and the anticancer prodrug δ-aminolevulinic acid across the apical membrane of small intestinal enterocytes. Little is however known about the basolateral transport of these substances. We investigated basolateral transport of GABA in mature Caco-2 cell monolayers using isotope studies. Here we report that, at least two transporters seem to be involved in the basolateral transport of GABA. The basolateral uptake consisted of a high-affinity system with a K(m) of 290 μM and V(max) of 75 pmol cm(-2) min(-1) and a low affinity system with a K(m) of approximately 64 mM and V(max) of 1.6 nmol cm(-2) min(-1). The high-affinity transporter is Na(+) and Cl(-) dependent. The substrate specificity of the high-affinity transporter was further studied and Gly-Sar, Leucine, gaboxadol, sarcosine, lysine, betaine, 5-hydroxythryptophan, proline and glycine reduced the GABA uptake to approximately 44-70% of the GABA uptake in the absence of inhibitor. Other substances such as β-alanine, GABA, 5-aminovaleric acid, taurine and δ-aminolevulinic acid reduced the basolateral GABA uptake to 6-25% of the uptake in the absence of inhibitor. Our results indicate that the distance between the charged amino- and acid-groups is particular important for inhibition of basolateral GABA uptake. Thus, there seems to be a partial substrate overlap between the basolateral GABA transporter and hPAT1, which may prove important for understanding drug interactions at the level of intestinal transport.

  8. Novel GM1 ganglioside-like peptide mimics prevent the association of cholera toxin to human intestinal epithelial cells in vitro

    PubMed Central

    Yu, Robert K; Usuki, Seigo; Itokazu, Yutaka; Wu, Han-Chung

    2016-01-01

    Cholera is an acute diarrheal disease caused by infection in the gastrointestinal tract by the gram-negative bacterium, Vibrio cholerae, and is a serious public health threat worldwide. There has not been any effective treatment for this infectious disease. Cholera toxin (CT), which is secreted by V. cholerae, can enter host cells by binding to GM1, a monosialoganglioside widely distributed on the plasma membrane surface of various animal epithelial cells. The present study was undertaken to generate peptides that are conformationally similar to the carbohydrate epitope of GM1 for use in the treatment of cholera and related bacterial infection. For this purpose, we used cholera toxin B (CTB) subunit to select CTB-binding peptides that structurally mimic GM1 from a dodecamer phage-display library. Six GM1-replica peptides were selected by biopanning based on CTB recognition. Five of the six peptides showed inhibitory activity for GM1 binding to CTB. To test the potential of employing the peptide mimics for intervening with the bacterial infection, those peptides were examined for their binding capacity, functional inhibitory activity and in vitro effects using a human intestinal epithelial cell line, Caco-2 cells. One of the peptides, P3 (IPQVWRDWFKLP), was most effective in inhibiting cellular uptake of CTB and suppressing CT-stimulated cyclic adenosine monophosphate production in the cells. Our results thus provide convincing evidence that GM1-replica peptides could serve as novel agents to block CTB binding on epithelial cells and prevent the ensuing physiological effects of CT. PMID:26405107

  9. Characterizing drug-metabolizing enzymes and transporters that are bona fide CAR-target genes in mouse intestine.

    PubMed

    Park, Shinhee; Cheng, Sunny Lihua; Cui, Julia Yue

    2016-09-01

    Intestine is responsible for the biotransformation of many orally-exposed chemicals. The constitutive androstane receptor (CAR/Nr1i3) is known to up-regulate many genes encoding drug-metabolizing enzymes and transporters (drug-processing genes/DPGs) in liver, but less is known regarding its effect in intestine. Sixty-day-old wild-type and Car(-/-) mice were administered the CAR-ligand TCPOBOP or vehicle once daily for 4 days. In wild-type mice, Car mRNA was down-regulated by TCPOBOP in liver and duodenum. Car(-/-) mice had altered basal intestinal expression of many DPGs in a section-specific manner. Consistent with the liver data (Aleksunes and Klaassen, 2012), TCPOBOP up-regulated many DPGs (Cyp2b10, Cyp3a11, Aldh1a1, Aldh1a7, Gsta1, Gsta4, Gstm1-m4, Gstt1, Ugt1a1, Ugt2b34, Ugt2b36, and Mrp2-4) in specific sections of small intestine in a CAR-dependent manner. However, the mRNAs of Nqo1 and Papss2 were previously known to be up-regulated by TCPOBOP in liver but were not altered in intestine. Interestingly, many known CAR-target genes were highest expressed in colon where CAR is minimally expressed, suggesting that additional regulators are involved in regulating their expression. In conclusion, CAR regulates the basal expression of many DPGs in intestine, and although many hepatic CAR-targeted DPGs were bona fide CAR-targets in intestine, pharmacological activation of CAR in liver and intestine are not identical.

  10. Characterization of the effects of Enterococcus faecium on intestinal epithelial transport properties in piglets.

    PubMed

    Klingspor, S; Martens, H; Caushi, D; Twardziok, S; Aschenbach, J R; Lodemann, U

    2013-04-01

    Probiotics have been shown to have positive effects on growth performance traits and the health of farm animals. The objective of the study was to examine whether the probiotic strain Enterococcus faecium NCIMB 10415 (E. faecium) changes the absorptive and secretory transport and barrier properties of piglet jejunum in vitro and thereby to verify tendencies observed in a former feeding trial with E. faecium. Further aims were to assess a potential mechanism of probiotics by testing effects of IL-α, which is upregulated in the peripheral blood mononuclear cells of E. faecium-supplemented piglets, and to test the hypothesis that IL-1α induces a change in ion transport. Sows and their piglets were randomly assigned to a control group and a probiotic group supplemented with E. faecium. The sows received the probiotic supplemented feed from d 28 before parturition and the piglets from d 12 after birth. Piglets were killed at the age of 12 ± 1, 26 ± 1, 34 ± 1, and 54 ± 1 d. Ussing chamber studies were conducted with isolated mucosae from the mid jejunum. Samples were taken for mRNA expression analysis of sodium-glucose-linked transporter 1 (SGLT1) and cystic fibrosis transmembrane conductance regulator (CFTR). The Na(+)/glucose cotransport was increased in the probiotic group compared with the control group at 26 (P = 0.04) and 54 d of age (P = 0.01). The PGE2-induced short circuit current (Isc) was greater at 54 d of age in the probiotic group compared with the control group (P = 0.03). In addition, effects of age on the absorptive (P < 0.01) and secretory (P < 0.01) capacities were observed. Neither SGLT1 nor CFTR mRNA expression was changed by probiotic supplementation. Mannitol flux rates as a marker of paracellular permeability decreased in both groups with increasing age and were less in the probiotic group at the 26 d of age (P = 0.04), indicating a tighter intestinal barrier. The ΔIsc induced by IL-1α was inhibited by bumetanide (P < 0.01), indicating an

  11. Computational Studies of Drug Release, Transport and Absorption in the Human Intestines

    NASA Astrophysics Data System (ADS)

    Behafarid, Farhad; Brasseur, J. G.; Vijayakumar, G.; Jayaraman, B.; Wang, Y.

    2016-11-01

    Following disintegration of a drug tablet, a cloud of particles 10-200 μm in diameter enters the small intestine where drug molecules are absorbed into the blood. Drug release rate depends on particle size, solubility and hydrodynamic enhancements driven by gut motility. To quantify the interrelationships among dissolution, transport and wall permeability, we apply lattice Boltzmann method to simulate the drug concentration field in the 3D gut released from polydisperse distributions of drug particles in the "fasting" vs. "fed" motility states. Generalized boundary conditions allow for both solubility and gut wall permeability to be systematically varied. We apply a local 'quasi-steady state' approximation for drug dissolution using a mathematical model generalized for hydrodynamic enhancements and heterogeneity in drug release rate. We observe fundamental differences resulting from the interplay among release, transport and absorption in relationship to particle size distribution, luminal volume, motility, solubility and permeability. For example, whereas smaller volume encourages higher bulk concentrations and reduced release rate, it also encourages higher absorption rate, making it difficult to generalize predictions. Supported by FDA.

  12. An ABC Transporter Is Required for Secretion of Peptide Sex Pheromones in Enterococcus faecalis

    PubMed Central

    Varahan, Sriram; Harms, Nathan; Gilmore, Michael S.; Tomich, John M.

    2014-01-01

    ABSTRACT Enterococci are leading causes of hospital-acquired infection in the United States and continue to develop resistances to new antibiotics. Many Enterococcus faecalis isolates harbor pheromone-responsive plasmids that mediate horizontal transfer of even large blocks of chromosomal genes, resulting in hospital-adapted strains over a quarter of whose genomes consist of mobile elements. Pheromones to which the donor cells respond derive from lipoprotein signal peptides. Using a novel bacterial killing assay dependent on the presence of sex pheromones, we screened a transposon mutant library for functions that relate to the production and/or activity of the effector pheromone. Here we describe a previously uncharacterized, but well-conserved, ABC transporter that contributes to pheromone production. Using three distinct pheromone-dependent mating systems, we show that mutants defective in expressing this transporter display a 5- to 6-order-of-magnitude reduction in conjugation efficiency. In addition, we demonstrate that the ABC transporter mutant displays an altered biofilm architecture, with a significant reduction in biofilm biomass compared to that of its isogenic parent, suggesting that pheromone activity also influences biofilm development. The conservation of this peptide transporter across the Firmicutes suggests that it may also play an important role in cell-cell communication in other species within this important phylum. PMID:25249282

  13. Effects of borneol on the intestinal transport and absorption of two P-glycoprotein substrates in rats.

    PubMed

    He, Huijuan; Shen, Qi; Li, Jian

    2011-07-01

    As the most prevalent route of delivery, oral administration has the challenge of potentially low bioavailability in part because P-glycoprotein (P-gp) in the intestinal tract affects absorption. Therefore, absorption enhancers or P-gp inhibitors are strategies to solve this problem. The aim of the present study was to investigate the effects of borneol on transportation of colchicine and rhodamine123, two P-gp substrates, in rats. In vitro transportation was assessed with a diffusion chamber system with isolated rat intestines. Different concentrations of borneol (10, 40 and 80 μg/mL) were prepared in solutions with two P-gp substrates compared with blank solutions. The in vivo effects on colchicine were assessed by a pharmacokinetic study. Borneol enhanced the absorptive transport of two P-gp substrates, which was relevant to the concentration. A pharmacokinetic study showed that in the presence of borneol, a significant increase in C(max) and AUC(0→8) of colchicine occurred when compared to colchicine alone. The study showed that borneol affected two P-gp substrates in the intestine, possibly by inhibiting the effects of P-gp and enhancing intestinal absorption of drugs. Therefore, borneol could be developed as a P-gp inhibitor and absorptive enhancer.

  14. The role of intestinal oxalate transport in hyperoxaluria and the formation of kidney stones in animals and man.

    PubMed

    Whittamore, Jonathan M; Hatch, Marguerite

    2017-02-01

    The intestine exerts a considerable influence over urinary oxalate in two ways, through the absorption of dietary oxalate and by serving as an adaptive extra-renal pathway for elimination of this waste metabolite. Knowledge of the mechanisms responsible for oxalate absorption and secretion by the intestine therefore have significant implications for understanding the etiology of hyperoxaluria, as well as offering potential targets for future treatment strategies for calcium oxalate kidney stone disease. In this review, we present the recent developments and advances in this area over the past 10 years, and put to the test some of the new ideas that have emerged during this time, using human and mouse models. A key focus for our discussion are the membrane-bound anion exchangers, belonging to the SLC26 gene family, some of which have been shown to participate in transcellular oxalate absorption and secretion. This has offered the opportunity to not only examine the roles of these specific transporters, revealing their importance to oxalate homeostasis, but to also probe the relative contributions made by the active transcellular and passive paracellular components of oxalate transport across the intestine. We also discuss some of the various physiological stimuli and signaling pathways which have been suggested to participate in the adaptation and regulation of intestinal oxalate transport. Finally, we offer an update on research into Oxalobacter formigenes, alongside recent investigations of other oxalate-degrading gut bacteria, in both laboratory animals and humans.

  15. Peptide transport through the blood-brain barrier. Final report 1 Jul 87-31 Dec 90

    SciTech Connect

    Partridge, W.M.

    1991-01-15

    Most neuropeptides are incapable of entering the brain from blood owing to the presence of unique anatomical structures in the brain capillary wall, which makes up the blood-brain barrier (BBB). Such neuropeptides could be introduced into the bloodstream by intranasal insufflation and, thus, could have powerful medicinal properties (e.g., Beta-endorphin for the treatment of pain, vasopressin analogues for treatment of memory, ACTH analogues for treatment of post-traumatic epilepsy), should these peptides be capable of traversing the BBB. One such strategy for peptide delivery through the BBB is the development of chimeric peptides, which is the basis of the present contract. The production of chimeric peptides involves the covalent coupling of a nontransportable peptide (e.g., Beta-endorphin, vasopressin) to a transportable vector peptide (e.g., insulin, transferrin, cationized albumin, histone). The transportable peptide is capable of penetrating the BBB via receptor-mediated or absorptive-mediated transcytosis. Therefore, the introduction of chimeric peptides allows the nontransportable peptide to traverse the BBB via a physiologic piggy back mechanism.

  16. Extracellular nucleotides inhibit oxalate transport by human intestinal Caco-2-BBe cells through PKC-δ activation.

    PubMed

    Amin, Ruhul; Sharma, Sapna; Ratakonda, Sireesha; Hassan, Hatim A

    2013-07-01

    Nephrolithiasis remains a major health problem in Western countries. Seventy to 80% of kidney stones are composed of calcium oxalate, and small changes in urinary oxalate affect risk of kidney stone formation. Intestinal oxalate secretion mediated by the anion exchanger SLC26A6 plays an essential role in preventing hyperoxaluria and calcium oxalate nephrolithiasis, indicating that understanding the mechanisms regulating intestinal oxalate transport is critical for management of hyperoxaluria. Purinergic signaling modulates several intestinal processes through pathways including PKC activation, which we previously found to inhibit Slc26a6 activity in mouse duodenal tissue. We therefore examined whether purinergic stimulation with ATP and UTP affects oxalate transport by human intestinal Caco-2-BBe (C2) cells. We measured [¹⁴C]oxalate uptake in the presence of an outward Cl⁻ gradient as an assay of Cl⁻/oxalate exchange activity, ≥50% of which is mediated by SLC26A6. We found that ATP and UTP significantly inhibited oxalate transport by C2 cells, an effect blocked by the PKC inhibitor Gö-6983. Utilizing pharmacological agonists and antagonists, as well as PKC-δ knockdown studies, we observed that ATP inhibits oxalate transport through the P2Y₂ receptor, PLC, and PKC-δ. Biotinylation studies showed that ATP inhibits oxalate transport by lowering SLC26A6 surface expression. These findings are of potential relevance to pathophysiology of inflammatory bowel disease-associated hyperoxaluria, where supraphysiological levels of ATP/UTP are expected and overexpression of the P2Y₂ receptor has been reported. We conclude that ATP and UTP inhibit oxalate transport by lowering SLC26A6 surface expression in C2 cells through signaling pathways including the P2Y₂ purinergic receptor, PLC, and PKC-δ.

  17. The effect of gastric inhibitory polypeptide on intestinal glucose absorption and intestinal motility in mice

    SciTech Connect

    Ogawa, Eiichi; Hosokawa, Masaya; Harada, Norio; Yamane, Shunsuke; Hamasaki, Akihiro; Toyoda, Kentaro; Fujimoto, Shimpei; Fujita, Yoshihito; Fukuda, Kazuhito; Tsukiyama, Katsushi; Yamada, Yuichiro; Seino, Yutaka; Inagaki, Nobuya

    2011-01-07

    Research highlights: {yields} Exogenous GIP inhibits intestinal motility through a somatostatin-mediated pathway. {yields} Exogenous GIP inhibits intestinal glucose absorption by reducing intestinal motility. {yields} The GIP-receptor-mediated action in intestine does not involve in GLP-1-mediated pathway. -- Abstract: Gastric inhibitory polypeptide (GIP) is released from the small intestine upon meal ingestion and increases insulin secretion from pancreatic {beta} cells. Although the GIP receptor is known to be expressed in small intestine, the effects of GIP in small intestine are not fully understood. This study was designed to clarify the effect of GIP on intestinal glucose absorption and intestinal motility. Intestinal glucose absorption in vivo was measured by single-pass perfusion method. Incorporation of [{sup 14}C]-glucose into everted jejunal rings in vitro was used to evaluate the effect of GIP on sodium-glucose co-transporter (SGLT). Motility of small intestine was measured by intestinal transit after oral administration of a non-absorbed marker. Intraperitoneal administration of GIP inhibited glucose absorption in wild-type mice in a concentration-dependent manner, showing maximum decrease at the dosage of 50 nmol/kg body weight. In glucagon-like-peptide-1 (GLP-1) receptor-deficient mice, GIP inhibited glucose absorption as in wild-type mice. In vitro examination of [{sup 14}C]-glucose uptake revealed that 100 nM GIP did not change SGLT-dependent glucose uptake in wild-type mice. After intraperitoneal administration of GIP (50 nmol/kg body weight), small intestinal transit was inhibited to 40% in both wild-type and GLP-1 receptor-deficient mice. Furthermore, a somatostatin receptor antagonist, cyclosomatostatin, reduced the inhibitory effect of GIP on both intestinal transit and glucose absorption in wild-type mice. These results demonstrate that exogenous GIP inhibits intestinal glucose absorption by reducing intestinal motility through a somatostatin

  18. A synthetic peptide shows retro- and anterograde neuronal transport before disrupting the chemosensation of plant-pathogenic nematodes.

    PubMed

    Wang, Dong; Jones, Laura M; Urwin, Peter E; Atkinson, Howard J

    2011-03-07

    Cyst nematodes are a group of plant pathogens each with a defined host range that cause major losses to crops including potato, soybean and sugar beet. The infective mobile stage hatches from dormant eggs and moves a short distance through the soil to plant roots, which it then invades. A novel strategy for control has recently been proposed in which the plant is able to secrete a peptide which disorientates the infective stage and prevents invasion of the pathogen. This study provides indirect evidence to support the mechanism by which one such peptide disrupts chemosensory function in nematodes. The peptide is a disulphide-constrained 7-mer with the amino acid sequence CTTMHPRLC that binds to nicotinic acetylcholine receptors. A fluorescently tagged version of this peptide with both epifluorescent and confocal microscopy was used to demonstrate that retrograde transport occurs from an aqueous environment along bare-ending primary cilia of chemoreceptive sensilla. The peptide is transported to the cell bodies of these neurons and on to a limited number of other neurons to which they connect. It appears to be localised in both neuronal processes and organelles adjacent to nuclei of some neurons suggesting it could be transported through the Golgi apparatus. The peptide takes 2.5 h to reach the neuronal cell bodies. Comparative studies established that similar but less abundant uptake occurs for Caenorhabditis elegans along its well studied dye-filling chemoreceptive neurons. Incubation in peptide solution or root-exudate from transgenic plants that secrete the peptide disrupted normal orientation of infective cyst nematodes to host root diffusate. The peptide probably undergoes transport along the dye-filling non-cholinergic chemoreceptive neurons to their synapses where it is taken up by the interneurons to which they connect. Coordinated responses to chemoreception are disrupted when the sub-set of cholinergic interneurons secrete the peptide at synapses that

  19. Modulating molecular transport across peptide-modified nanoporous alumina membranes with light

    NASA Astrophysics Data System (ADS)

    Kumeria, Tushar; Yu, Jingxian; Alsawat, Mohammed; Kurkuri, Mahaveer D.; Santos, Abel; Abell, Andrew D.; Losic, Dusan

    2016-12-01

    We designed and fabricated a smart and stimuli responsive membrane to cater on demand molecular transporting applications. A novel photoswitchable peptide (PSP) was synthesized and attached inside nanoporous anodic alumina membranes (NAAMs) pores. The PSP specifically switched between its cis and trans photostationary states on exposure to 364 nm and 440 nm wavelength lights respectively, which not only provided the ability to control its pore diameter but also the surface chemistry. The switchable molecular transport properties of the PSP-NAAMs have been shown as a function of the light exposure. Most importantly, the molecular transport across PSP-NAAMs could be repeatedly switched between on and off state, which is highly significant for on-demand triggered drug release systems.

  20. Regulating Ion Transport in Peptide Nanotubes by Tailoring the Nanotube Lumen Chemistry.

    PubMed

    Ruiz, Luis; Benjamin, Ari; Sullivan, Matthew; Keten, Sinan

    2015-05-07

    We use atomistic nonequilibrium molecular dynamics simulations to demonstrate how specific ionic flux in peptide nanotubes can be regulated by tailoring the lumen chemistry through single amino acid substitutions. By varying the size and polarity of the functional group inserted into the nanotube interior, we are able to adjust the Na(+) flux by over an order of magnitude. Cl(-) is consistently denied passage. Bulky, nonpolar groups encourage interactions between the Na(+) and the peptide backbone carbonyl groups, disrupting the Na(+) solvation shell and slowing the transport of Na(+). Small groups have the opposite effect and accelerate flow. These results suggest that relative ion flux and selectivity can be precisely regulated in subnanometer pores by molecularly defining the lumen according to biological principles.

  1. Functional Characterization Of Peptide Transporters In MDCKII -MDR1 Cell line As A Model For Oral Absorption Studies

    PubMed Central

    Agarwal, Sheetal; Jain, Ritesh; Pal, Dhananjay; K.Mitra, Ashim

    2007-01-01

    MDCKII-MDR1 cell line has been extensively selected as a model to study P-gp-mediated drug efflux. Recently, investigators have employed this cell line for studying influx of peptide prodrug derivatives of parent compounds which are P-gp substrates. Therefore, the objective of this study is to functionally characterize the peptide mediated uptake and transport of [3H] Glycylsarcosine ([3H] Gly-Sar), a model peptide substrate across MDCKII-MDR1 cells. [3H] Gly-Sar uptake from apical (AP) and basolateral (BL) membranes was found to be time dependent and saturable. Michaelis-Menten (Km) constants of [3H] Gly-Sar uptake across the AP and BL directions in MDCKII-MDR1 cell line were found to be 457 ± 37 μM and 464 ± 85 μM respectively. Vmax values in AP and BL directions for the peptide transporters in MDCKII-MDR1 cell line were calculated to be 0.035 ± 0.001 and 0.35 ± 0.034 pmol/min/mg protein respectively. Uptake of [3H] Gly-Sar was significantly inhibited in the presence of aminocephalosporins and ACE-Inhibitors, known substrates for peptide transporters in both the AP and BL directions. Permeability of [3H] Gly-Sar in the BL direction was maximal at pH 4 as compared to pH 5, 6 and 7.4 whereas such permeability in the AP direction was optimal at pH 7.4. Transepithelial transport of [3H] Gly-Sar in the AP-BL direction was significantly lower than from BL-AP direction at all observed pHs. No statistical difference was observed in the transepithelial permeability of [3H] Gly-Sar across both AP and BL directions over 4–10 days of growth period. The present study indicates that peptide transporters are effectively involved in the bidirectional transport of Gly-Sar across MDCKII-MDR1 cell line; the BL peptide transporter can transport Gly-Sar at a greater rate as compared to the AP peptide transporter. Results from these studies suggest the application of MDCKII-MDR1 cell line as a rapid effective tool to study peptide mediated influx of compounds that may be

  2. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  3. The use of polyion complex micelles to enhance the oral delivery of salmon calcitonin and transport mechanism across the intestinal epithelial barrier.

    PubMed

    Li, Na; Li, Xin-Ru; Zhou, Yan-Xia; Li, Wen-Jing; Zhao, Yong; Ma, Shu-Jin; Li, Jin-Wen; Gao, Ya-Jie; Liu, Yan; Wang, Xing-Lin; Yin, Dong-Dong

    2012-12-01

    The objective of the present study was to demonstrate the effect of polyanionic copolymer mPEG-grafted-alginic acid (mPEG-g-AA)-based polyion complex (PIC) micelles on enhancing the oral absorption of salmon calcitonin (sCT) in vivo and in vitro and identify the transepithelial transport mechanism of PIC micelles across the intestinal barrier. mPEG-g-AA was first successfully synthesized and characterized in cytotoxicity. The PIC micelles were approximately of 72 nm in diameter with a narrow distribution. The extremely significant enhancement of hypocalcemia efficacy of sCT-loaded PIC micelles in rats was evidenced by intraduodenal administration in comparison with sCT solution. The presence of mPEG-grafted-chitosan in PIC micelles had no favorable effect on this action in the referred content. In the Caco-2 transport studies, PIC micelles could significantly increase the permeability of sCT across Caco-2 monolayers without significantly affecting transepithelial electrical resistance values during the transport study. No evident alterations in the F-actin cytoskeleton were detected by confocal microscope observation following treatment of the cell monolayers with PIC micelles, which further certified the incapacity of PIC micelles to open the intercellular tight junctions. In addition, TEM observations showed that the intact PIC micelles were transported across the everted gut sac. These suggested that the transport of PIC micelles across Caco-2 cell monolayers involve a predominant transcytosis mechanism via endocytosis rather than paracellular pathway. Furthermore, PIC micelles were localized in both the cytoplasm and the nuclei observed by CLSM. Therefore, PIC micelles might be a potentially applicable tool for enhancing the oral absorption of cationic peptide and protein drugs.

  4. Egg storage duration and hatch window affect gene expression of nutrient transporters and intestine morphological parameters of early hatched broiler chicks.

    PubMed

    Yalcin, S; Gursel, I; Bilgen, G; Izzetoglu, G T; Horuluoglu, B H; Gucluer, G

    2016-05-01

    In recent years, researchers have given emphasis on the differences in physiological parameters between early and late hatched chicks within a hatch window. Considering the importance of intestine development in newly hatched chicks, however, changes in gene expression of nutrient transporters in the jejunum of early hatched chicks within a hatch window have not been studied yet. This study was conducted to determine the effects of egg storage duration before incubation and hatch window on intestinal development and expression of PepT1 (H+-dependent peptide transporter) and SGLT1 (sodium-glucose co-transporter) genes in the jejunum of early hatched broiler chicks within a 30 h of hatch window. A total of 1218 eggs obtained from 38-week-old Ross 308 broiler breeder flocks were stored for 3 (ES3) or 14 days (ES14) and incubated at the same conditions. Eggs were checked between 475 and 480 h of incubation and 40 chicks from each egg storage duration were weighed; chick length and rectal temperature were measured. The chicks were sampled to evaluate morphological parameters and PepT1 and SGLT1 expression. The remaining chicks that hatched between 475 and 480 h were placed back in the incubator and the same measurements were conducted with those chicks at the end of hatch window at 510 h of incubation. Chick length, chick dry matter content, rectal temperature and weight of small intestine segments increased, whereas chick weight decreased during the hatch window. The increase in the jejunum length and villus width and area during the hatch window were higher for ES3 than ES14 chicks. PepT1 expression was higher for ES3 chicks compared with ES14. There was a 10.2 and 17.6-fold increase in PepT1 and SGLT1 expression of ES3 chicks at the end of hatch window, whereas it was only 2.3 and 3.3-fold, respectively, for ES14 chicks. These results suggested that egg storage duration affected development of early hatched chicks during 30 h of hatch window. It can be concluded that

  5. Isolation and characterization of secretory granules storing a vasoactive intestinal polypeptide-like peptide in Torpedo cholinergic electromotor neurones.

    PubMed

    Agoston, D V; Dowe, G H; Whittaker, V P

    1989-06-01

    Previous immunocytochemical work showed that the cholinergic electromotor neurones of Torpedo marmorata contain a vasoactive intestinal polypeptide-like immunoreactivity (VIPLI) that is conveyed to the terminals by axonal transport from the cell bodies where it is presumably synthesized. In extension of this work, we have now succeeded in isolating the VIPLI storage granules from both the terminals and the axons of these neurones and characterizing them morphologically and biochemically. They were readily separated from synaptic vesicles but contained several components in common that had previously been regarded as specific for synaptic vesicles. Among these were a heparan sulphate type of proteoglycan, synaptophysin, and a Mg2+-dependent ATPase. The VIPLI concentration in lobe tissue and the amount of tissue available were both insufficient to permit the isolation of granules from the electromotor cell bodies by the same technique but it was possible to establish the presence of such granules by particle-exclusion chromatography, using the stable markers mentioned above. In contrast to the VIPLI-containing granules, axonal synaptic vesicles differed from their terminal counterparts in having a very low acetylcholine content relative to stable vesicle markers: they presumably fill up on reaching the terminal where they are exposed to higher concentrations of cytoplasmic acetylcholine.

  6. Bradyrhizobium BclA Is a Peptide Transporter Required for Bacterial Differentiation in Symbiosis with Aeschynomene Legumes.

    PubMed

    Guefrachi, Ibtissem; Pierre, Olivier; Timchenko, Tatiana; Alunni, Benoît; Barrière, Quentin; Czernic, Pierre; Villaécija-Aguilar, José-Antonio; Verly, Camille; Bourge, Mickaël; Fardoux, Joël; Mars, Mohamed; Kondorosi, Eva; Giraud, Eric; Mergaert, Peter

    2015-11-01

    Nodules of legume plants are highly integrated symbiotic systems shaped by millions of years of evolution. They harbor nitrogen-fixing rhizobium bacteria called bacteroids. Several legume species produce peptides called nodule-specific cysteine-rich (NCR) peptides in the symbiotic nodule cells which house the bacteroids. NCR peptides are related to antimicrobial peptides of innate immunity. They induce the endosymbionts into a differentiated, enlarged, and polyploid state. The bacterial symbionts, on their side, evolved functions for the response to the NCR peptides. Here, we identified the bclA gene of Bradyrhizobium sp. strains ORS278 and ORS285, which is required for the formation of differentiated and functional bacteroids in the nodules of the NCR peptide-producing Aeschynomene legumes. The BclA ABC transporter promotes the import of NCR peptides and provides protection against the antimicrobial activity of these peptides. Moreover, BclA can complement the role of the related BacA transporter of Sinorhizobium meliloti, which has a similar symbiotic function in the interaction with Medicago legumes.

  7. Peristaltic transport of a generalized Burgers’ fluid: Application to the movement of chyme in small intestine

    NASA Astrophysics Data System (ADS)

    Tripathi, Dharmendra; Pandey, S. K.; Das, S.

    2011-07-01

    The present investigation deals with the peristaltic transport of generalized Burgers' fluid with fractional element model in a channel. The analysis is carried out under long wavelength and low Reynolds number assumptions. An efficient mathematical tool, namely, Adomian decomposition method, is used to obtain the analytical approximate solutions of the fractional differential equation. The channel is governed by the propagation of sinusoidal waves that help the walls contract and relax but not expand beyond the natural boundary. The expressions of axial velocity, volume flow rate and pressure gradient are obtained. The effects of the fractional parameters and the material constants are discussed on pressure difference and the friction force across one wavelength. The comparative studies for various models of viscoelastic fluids such as fractional generalized Burgers' model, generalized Burgers' model, fractional Burgers' model and Burgers' model are performed. It is inferred that the movement of viscoelastic chyme with generalized Burgers' model through the small intestine is favorable in comparison to the movement of viscoelastic chyme with fractional generalized Burgers' model.

  8. Vasoactive intestinal peptide synergistically stimulates DNA synthesis in mouse 3T3 cells: Role of cAMP, Ca sup 2+ , and protein kinase C

    SciTech Connect

    Zurier, B.B.; Kozma, M.; Sinnett-Smith, J.; Rozengurt, E. )

    1988-05-01

    Vasoactive intestinal peptide synergistically stimulated initiation of DNA synthesis in Swiss 3T3 cells. The peptide stimulated ({sup 3}H)thymidine incorporation in the presence of insulin and either forskolin or an inhibitor of cAMP phosphodiesterase in a concentration-dependent manner. Half-maximal effect was obtained at 1 nM. At mitogenic concentrations, VIP stimulated a marked accumulation (eightfold) of cAMP. In contrast to other growth-promoting neuropeptides, VIP did not induce an increase in cytosolic free Ca{sup 2+} or the activation of protein kinase C. The authors conclude that neuropeptides can modulate long-term cell proliferation through multiple signaling pathways.

  9. Differential effect of aluminum on the blood-brain barrier transport of peptides, technetium and albumin

    SciTech Connect

    Banks, W.A.; Kastin, A.J.; Fasold, M.B.

    1988-02-01

    Aluminum is a neurotoxin capable of altering membrane structure and function. We investigated whether aluminum also can affect saturable transport across membranes using the blood-brain barrier as our model. Mice were given i.p. or i.v. aluminum (up to 100 mg/kg) as the chloride salt and the disappearance from the brain of several centrally administered substances was measured. We found that aluminum rapidly and profoundly inhibited the saturable system that transports the small, N-tyrosinated peptides Tyr-MIF-1 and the enkephalins from the brain to the blood by acting as a noncompetitive inhibitor. In contrast, the disappearance from the brain of technetium pertechnetate (a substance also transported out of the brain by a different saturable system), albumin or D-Tyr-MIF-1 (a stereoisomer of Tyr-MIF-1 that was confirmed not to be transported by the carrier system) was not affected by aluminum. Aluminum also did not alter either the saturable or nonsaturable component of the uptake of Tyr-MIF-1 by erythrocytes. These findings suggest that one mechanism by which aluminum may induce neurotoxicity is by selective alteration of the transport systems of the blood-brain barrier.

  10. Vasoactive intestinal peptide induces CD14+HLA-DR‑/low myeloid-derived suppressor cells in gastric cancer.

    PubMed

    Li, Gang; Wu, Ke; Tao, Kaixiong; Lu, Xiaoming; Ma, Jianhua; Mao, Zhengqiang; Li, Hang; Shi, Liang; Li, Jing; Niu, Yanfeng; Xiang, Fan; Wang, Guobin

    2015-07-01

    Myeloid-derived suppressor cells (MDSCs) are a heterogeneous group of cells, which have been revealed to inhibit T-cell responses in tumor-bearing mice. In addition, a number of immune suppressive mechanisms have linked MDSCs and the development of human cancer. However, the role of MDSCs in human gastric cancer tissue remains to be elucidated as specific markers are lacking. Therefore, the aim of the present study was to investigate the frequency and immune suppressive function of MDSCs denoted in the present study as cluster of differentiation 14 (CD14)+human leukocyte antigen (HLA)-DR-/low in gastric cancer patients. In the present study, MDSCs were directly isolated and characterized from the tumor and adjacent normal tissue of gastric cancer patients. Functional analysis of the CD14+HLA-DR-/low MDSCs co-cultured with allogeneic CD4+ T cells were performed and compared with controls. In addition, the interferon-γ (IFN-γ) and interleukin (IL)-2 production was compared in order to investigate the capacity of vasoactive intestinal peptide (VIP) to induce CD14+HLA-DR(-/low) MDSC-mediated CD4+ T-cell dysfunction and whether IL-10 secretion is involved in this mechanism. As a result, the quantity of CD14+HLA-DR(-/low) cells in tumor tissue from gastric cancer patients was significantly higher than that in the adjacent normal tissue. In addition, CD14+HLA-DR-/low MDSCs isolated from tumor tissue were observed to inhibit the CD4+ T-cells' immune responses in comparison with those from the adjacent normal tissue. Furthermore, VIP was able to induce the differentiation of CD14+ mononuclear cells isolated from healthy donor peripheral blood mononuclear cells into activated MDSC cells. Of note, the immunosuppressive effect of VIP-induced CD14+HLA-DR(-/low) MDSCs on CD4+ T cells was mediated by IL-10 secretion, which was demonstrated in the subsequent decrease of IFN-γ and IL-2 production. In conclusion, CD14+HLA-DR(-/low) cells were significantly increased in gastric

  11. Large-scale multiplex absolute protein quantification of drug-metabolizing enzymes and transporters in human intestine, liver, and kidney microsomes by SWATH-MS: Comparison with MRM/SRM and HR-MRM/PRM.

    PubMed

    Nakamura, Kenji; Hirayama-Kurogi, Mio; Ito, Shingo; Kuno, Takuya; Yoneyama, Toshihiro; Obuchi, Wataru; Terasaki, Tetsuya; Ohtsuki, Sumio

    2016-08-01

    The purpose of the present study was to examine simultaneously the absolute protein amounts of 152 membrane and membrane-associated proteins, including 30 metabolizing enzymes and 107 transporters, in pooled microsomal fractions of human liver, kidney, and intestine by means of SWATH-MS with stable isotope-labeled internal standard peptides, and to compare the results with those obtained by MRM/SRM and high resolution (HR)-MRM/PRM. The protein expression levels of 27 metabolizing enzymes, 54 transporters, and six other membrane proteins were quantitated by SWATH-MS; other targets were below the lower limits of quantitation. Most of the values determined by SWATH-MS differed by less than 50% from those obtained by MRM/SRM or HR-MRM/PRM. Various metabolizing enzymes were expressed in liver microsomes more abundantly than in other microsomes. Ten, 13, and eight transporters listed as important for drugs by International Transporter Consortium were quantified in liver, kidney, and intestinal microsomes, respectively. Our results indicate that SWATH-MS enables large-scale multiplex absolute protein quantification while retaining similar quantitative capability to MRM/SRM or HR-MRM/PRM. SWATH-MS is expected to be useful methodology in the context of drug development for elucidating the molecular mechanisms of drug absorption, metabolism, and excretion in the human body based on protein profile information.

  12. Vasoactive intestinal peptide test

    MedlinePlus

    ... the pancreas, gut, and hypothalamus, and increasing the amount of water and electrolytes secreted from the pancreas and gut. VIPomas produce and release VIP into the blood. This blood test checks the amount of VIP in the blood to see if ...

  13. Involvement of concentrative nucleoside transporter 1 in intestinal absorption of trifluorothymidine, a novel antitumor nucleoside, in rats.

    PubMed

    Okayama, Takashige; Yoshisue, Kunihiro; Kuwata, Keizo; Komuro, Masahito; Ohta, Shigeru; Nagayama, Sekio

    2012-02-01

    ααα-Trifluorothymidine (TFT), an anticancer nucleoside analog, is a potent thymidylate synthase inhibitor. TFT exerts its antitumor activity primarily by inducing DNA fragmentation after incorporation of the triphosphate form of TFT into the DNA. Although an oral combination of TFT and a thymidine phosphorylase inhibitor has been clinically developed, there is little information regarding TFT absorption. Therefore, we investigated TFT absorption in the rat small intestine. After oral administration of TFT in rats, more than 75% of the TFT was absorbed. To identify the uptake transport system, uptake studies were conducted by using everted sacs prepared from rat small intestines. TFT uptake was saturable, significantly reduced under Na(+)-free conditions, and strongly inhibited by the addition of an endogenous pyrimidine nucleoside. From these results, we suggested the involvement of concentrative nucleoside transporters (CNTs) in TFT absorption into rat small intestine. In rat small intestines, the mRNAs coding for rat CNT1 (rCNT1) and rCNT2, but not for rCNT3, were predominantly expressed. To investigate the roles of rCNT1 and rCNT2 in TFT uptake, we conducted uptake assays by using Xenopus laevis oocytes injected with rCNT1 complementary RNA (cRNA) and rCNT2 cRNA. TFT uptake by X. laevis oocytes injected with rCNT1 cRNA, and not rCNT2 cRNA, was significantly greater than that by water-injected oocytes. In addition, in situ single-pass perfusion experiments performed using rat jejunum regions showed that thymidine, a substrate for CNT1, strongly inhibited TFT uptake. In conclusion, TFT is absorbed via rCNT1 in the intestinal lumen in rats.

  14. Expression of thirty-six drug transporter genes in human intestine, liver, kidney, and organotypic cell lines.

    PubMed

    Hilgendorf, Constanze; Ahlin, Gustav; Seithel, Annick; Artursson, Per; Ungell, Anna-Lena; Karlsson, Johan

    2007-08-01

    This study was designed to quantitatively assess the mRNA expression of 36 important drug transporters in human jejunum, colon, liver, and kidney. Expression of these transporters in human organs was compared with expression in commonly used cell lines (Caco-2, HepG2, and Caki-1) originating from these organs to assess their value as in vitro transporter system models, and was also compared with data obtained from the literature on expression in rat tissues to assess species differences. Transporters that were highly expressed in the intestine included HPT1, PEPT1, BCRP, MRP2, and MDR1, whereas, in the liver, OCT1, MRP2, OATP-C, NTCP and BSEP were the main transporters. In the kidney, OAT1 was expressed at the highest levels, followed by OAT3, OAT4, MCT5, MDR1, MRP2, OCT2, and OCTN2. The best agreement between human tissue and the representative cell line was observed for human jejunum and Caco-2 cells. Expression in liver and kidney ortholog cell lines was not correlated with that in the associated tissue. Comparisons with rat transporter gene expression revealed significant species differences. Our results allowed a comprehensive quantitative comparison of drug transporter expression in human intestine, liver, and kidney. We suggest that it would be beneficial for predictive pharmacokinetic research to focus on the most highly expressed transporters. We hope that our comparison of rat and human tissue will help to explain the observed species differences in in vivo models, increase understanding of the impact of active transport processes on pharmacokinetics and distribution, and improve the quality of predictions from animal studies to humans.

  15. Mechanisms of provitamin A (carotenoid) and vitamin A (retinol) transport into and out of intestinal Caco-2 cells.

    PubMed

    During, Alexandrine; Harrison, Earl H

    2007-10-01

    The purpose of this study was to compare the mechanisms of intestinal retinol (ROL) and carotenoid transport. When differentiated Caco-2 cells were incubated with ROL for varying times, cellular ROL plateaued within 2 h, whereas retinyl ester (RE) formation increased continuously. ROL and RE efflux into basolateral medium (BM) increased linearly with time, ROL in the nonlipoprotein fraction and REs in chylomicrons (CMs). In contrast to carotenoids, ROL uptake was proportional to ROL concentration (0.5-110 microM). ROL efflux into BM occurred via two processes: a) a saturable process at low concentrations (<10 microM) and b) a nonsaturable process at higher concentrations. When ROL-loaded cells were maintained on retinoid-free medium, free ROL, but not REs, was secreted into BM. Glyburide significantly reduced ROL efflux but not ROL uptake. Inhibition of ABCA1 protein expression by small interfering RNAs decreased ROL efflux but not carotenoid efflux. Scavenger receptor class B type I (SR-BI) inhibition did not affect ROL transport but decreased carotenoid uptake. The present data suggest that a) ROL enters intestinal cells by diffusion, b) ROL efflux is partly facilitated, probably by the basolateral transporter ABCA1, and c) newly synthesized REs, but not preformed esters, are incorporated into CM and secreted. In contrast to ROL transport, carotenoid uptake is mediated by the apical transporter SR-BI, and carotenoid efflux occurs exclusively via their secretion in CM.

  16. Polyphenols and phenolic acids from strawberry and apple decrease glucose uptake and transport by human intestinal Caco-2 cells.

    PubMed

    Manzano, Susana; Williamson, Gary

    2010-12-01

    The effect of polyphenols, phenolic acids and tannins (PPTs) from strawberry and apple on uptake and apical to basolateral transport of glucose was investigated using Caco-2 intestinal cell monolayers. Substantial inhibition on both uptake and transport was observed by extracts from both strawberry and apple. Using sodium-containing (glucose transporters SGLT1 and GLUT2 both active) and sodium-free (only GLUT2 active) conditions, we show that the inhibition of GLUT2 was greater than that of SGLT1. The extracts were analyzed and some of the constituent PPTs were also tested. Quercetin-3-O-rhamnoside (IC₅₀ =31 μM), phloridzin (IC₅₀=146 μM), and 5-caffeoylquinic acid (IC₅₀=2570 μM) contributed 26, 52 and 12%, respectively, to the inhibitory activity of the apple extract, whereas pelargonidin-3-O-glucoside (IC₅₀=802 μM) contributed 26% to the total inhibition by the strawberry extract. For the strawberry extract, the inhibition of transport was non-competitive based on kinetic analysis, whereas the inhibition of cellular uptake was a mixed-type inhibition, with changes in both V(max) and apparent K(m) . The results in this assay show that some PPTs inhibit glucose transport from the intestinal lumen into cells and also the GLUT2-facilitated exit on the basolateral side.

  17. Glucagon-like peptide-2 reduces intestinal permeability but does not modify the onset of type 1 diabetes in the nonobese diabetic mouse.

    PubMed

    Hadjiyanni, Irene; Li, Kunmin Karen; Drucker, Daniel J

    2009-02-01

    The development of type 1 diabetes (T1D) has been linked to environmental factors and dietary components. Increasing evidence indicates that the integrity of the gut mucosa plays a role in the development of autoimmune diseases, and evidence from both preclinical and clinical studies demonstrates that increased leakiness of the intestinal epithelium precedes the development of type 1 diabetes. However, there is limited information on modulation of gut barrier function and its relationship to diabetes development. Here we show that the nonobese diabetic (NOD) mouse, a model of T1D, exhibits enhanced intestinal transcellular permeability before the development of autoimmune diabetes. Treatment of NOD mice with a glucagon-like peptide 2 (GLP-2) analog, synthetic human [Gly(2)] glucagon-like peptide-2 (h[Gly(2)]GLP-2, increased the length and weight of the small bowel and significantly improved jejunal transepithelial resistance. However, chronic administration of once daily h[Gly(2)]GLP-2 failed to delay or reverse the onset of T1D when treatment was initiated in young, normoglycemic female NOD mice. Furthermore, h[Gly(2)]GLP-2 administration had no significant effect on lymphocyte subpopulations in NOD mice. These findings demonstrate that h[Gly(2)]GLP-2-mediated enhancement of gut barrier function in normoglycemic NOD mice disease is not sufficient to prevent or delay the development of experimental T1D.

  18. Effect of MSH/ACTH peptides on fast axonal transport in intact and regenerating sciatic nerves

    SciTech Connect

    Crescitelli, L.A.

    1985-01-01

    Fast axonal transport was examined in intact rats treated with ACTH 4-10 or ACTH 4-9 (ORG 2766), hypophysectomized rats, adrenalectomized rats, and in ACTH 4-10 treated rats with crushed regenerating sciatic nerves by injecting /sup 3/H-leucine into the ventral horn region of the spinal cord. The distance traveled by the transported activity along the sciatic nerve and the rate of fast axonal transport were not significantly altered as a result of treatment with ACTH 4-10, ACTH 4-9 (ORG 2766), hypophysectomy, or adrenalectomy. Treatment with ACTH 4-9 (ORG 2766) at concentrations of 1 ..mu..g/Kg /day and 10 ..mu..g/Kg/day caused significant reductions (62% and 64% respectively) in the crest height of the fast axonal transport curve as compared to 0.9% saline treated control animals. No significant differences were found in comparing the distance, rate, slope, or crest height of ACTH 4-10 treated animals with crushed regenerating (7 or 14d) sciatic nerves to control animals. In the group of animals in days, the amount of radiolabeled activity was significantly increased in the ACTH 4-10 treated animals as compared to control animals. The results indicate that during regeneration the peptide acts to prolong the initially high levels of synthetic activity which occur in regenerating axons.

  19. Eicosapentaenoic acid inhibits intestinal β-carotene absorption by downregulation of lipid transporter expression via PPAR-α dependent mechanism.

    PubMed

    Mashurabad, Purna Chandra; Kondaiah, Palsa; Palika, Ravindranadh; Ghosh, Sudip; Nair, Madhavan K; Raghu, Pullakhandam

    2016-01-15

    The involvement of lipid transporters, the scavenger receptor class B, type I (SR-BI) and Niemann-Pick type C1 Like 1 protein (NPC1L1) in carotenoid absorption is demonstrated in intestinal cells and animal models. Dietary ω-3 fatty acids are known to possess antilipidemic properties, which could be mediated by activation of PPAR family transcription factors. The present study was conducted to determine the effect of docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA), on intestinal β-carotene absorption. β-carotene uptake in Caco-2/TC7 cells was inhibited by EPA (p < 0.01) and PPARα agonist (P < 0.01), but not by DHA, PPARγ or PPARδ agonists. Despite unaltered β-carotene uptake, both DHA and PPARδ agonists inhibited the NPC1L1 expression. Further, EPA also induced the expression of carnitine palmitoyl transferase 1A (CPT1A) expression, a PPARα target gene. Interestingly, EPA induced inhibition of β-carotene uptake and SR B1 expression were abrogated by specific PPARα antagonist, but not by PPARδ antagonist. EPA and PPARα agonist also inhibited the basolateral secretion of β-carotene from Caco-2 cells grown on permeable supports. These results suggest that EPA inhibits intestinal β-carotene absorption by down regulation of SR B1 expression via PPARα dependent mechanism and provide an evidence for dietary modulation of intestinal β-carotene absorption.

  20. Oat β-glucan depresses SGLT1- and GLUT2-mediated glucose transport in intestinal epithelial cells (IEC-6).

    PubMed

    Abbasi, Nazanin N; Purslow, Peter P; Tosh, Susan M; Bakovic, Marica

    2016-06-01

    Oat β-glucan consumption is linked to reduced risk factors associated with diabetes and obesity by lowering glycemic response and serum level of low-density lipoproteins. The purpose of this study was to identify the mechanism of action of oat β-glucan at the interface between the gut wall and the lumen responsible for attenuating glucose levels. We proposed that viscous oat β-glucan acts as a physical barrier to glucose uptake in normally absorptive gut epithelial cells IEC-6 by affecting the expression of intestinal glucose transporters. Concentration and time-dependent changes in glucose uptake were established by using a nonmetabolizable glucose analog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-d-glucose. The effectiveness of nutrient transport in IEC-6 cells was shown by significant differences in glucose uptake and corresponding transporter expression. The expressions of glucose transporters sodium-glucose-linked transport protein 1 (SGLT1) and glucose transporter 2 (GLUT2) increased with time (0-60 minutes) and glucose levels (5-25 mmol/L). The suppression of glucose uptake and SGLT1 and GLUT2 expression by increasing concentrations (4-8 mg/mL) of oat β-glucan demonstrated a direct effect of the physical properties of oat β-glucan on glucose transport. These results affirmed oat β-glucan as a dietary agent for minimizing postprandial glucose and showed that modulating the activity of the key intestinal glucose transporters with oat β-glucan could be an effective way of lowering blood glucose levels in patients with diabetes.

  1. Incorporation of Cestrum diurnum leaf improves intestinal Ca transport in broilers.

    PubMed

    Chennaiah, S; Qadri, S S Y H; Reddy, C V K; Rama Rao, S V; Shyamsunder, G; Raghuramulu, N

    2007-03-01

    The economy of Ca utilization is under the control of vitamin D(3), particularly its active metabolite 1,25-dihydroxy cholecalciferol [1,25(OH)(2)D(3)]. In sufficient Ca absorption leads to tibial dyschondroplasia resulting in not attaining optimum body weight. Our earlier studies [T.P. Prema, N. Raghuramulu, Phytochemistry 37 (1994) 167] have shown that the Cestrum diurnum (CD) leaves contain vitamin D(3) metabolites. It was felt whether incorporation of CD as a source of 1,25(OH)(2)D(3) could improve the Ca absorption in broilers. Four groups of 60 birds each were fed with either normal diet or normal diet+0.25% CD or normal diet without vitamin D(3) or normal diet without vitamin D(3)+0.25% CD leaf powder for 45 days. In subsample of six birds it was observed that incorporation of CD leaves in the feed had the maximal effect on all the parameters studied. The results indicate that the intestinal Ca transport as represented by Serosa/Mucosa (S/M) ratio was found to be significantly (p<0.01) higher in broilers fed diet with CD leaf powder and the 1alpha hydroxylase activity in kidney is significantly (p<0.001) higher in negative controls. On the other hand the supplementation of CD leaves enhanced the serum Ca, body weight, tibia weight, density and strength resulting in the disappearance of tibial dyschondroplasia. No lesions of toxicity were observed in any of the soft tissue examined. The results suggest that the incorporation of CD leaf powder in poultry feed could be beneficial to the poultry.

  2. Plasticity of osmoregulatory function in the killifish intestine: drinking rates, salt and water transport, and gene expression after freshwater transfer.

    PubMed

    Scott, Graham R; Schulte, Patricia M; Wood, Chris M

    2006-10-01

    We have explored intestinal function in the euryhaline killifish Fundulus heteroclitus after transfer from brackish water (10% seawater) to fresh water. Plasma Na+ and Cl- concentrations fell at 12 h post-transfer, but recovered by 7 days. Drinking rate decreased substantially at 12 h (32% of control value) and remained suppressed after 3 and 7 days in fresh water (34 and 43%). By contrast, there was a transient increase in the capacity for water absorption measured across isolated intestines in vitro (3.3- and 2.6-fold at 12 h and 3 days), which returned to baseline after 7 days. These changes in water absorption could be entirely accounted for by changes in net ion flux: there was an extremely strong correlation (R2=0.960) between water absorption and the sum of net Na+ and net Cl- fluxes (3.42+/-0.10 microl water micromol(-1) ion). However, enhanced ion transport across the intestine in fresh water would probably not increase water uptake in vivo, because the drinking rate was far less than the capacity for water absorption across the intestine. The increased intestinal ion absorption after freshwater transfer may instead serve to facilitate ion absorption from food when it is present in the gut. Modulation of net ion flux occurred without changes in mRNA levels of many ion transporters (Na+/K+-ATPase alpha(1a), carbonic anhydrase 2, CFTR Cl- channel, Na+/K+/2Cl- cotransporter 2, and the signalling protein 14-3-3a), and before a measured increase in Na+/K+-ATPase activity at 3 days, suggesting that there is some other mechanism responsible for increasing ion transport. Interestingly, net Cl- flux always exceeded net Na+ flux, possibly to help maintain Cl- balance and/or facilitate bicarbonate excretion. Our results suggest that intestinal NaCl absorption from food is important during the period of greatest ionic disturbance after transfer to fresh water, and provide further insight into the mechanisms of euryhalinity in killifish.

  3. Radioimmunoassay determination of tachykinin-related peptide in different portions of the central nervous system and intestine of the cockroach Leucophaea maderae.

    PubMed

    Muren, J E; Nässel, D R

    1996-11-11

    A radioimmunoassay was developed for insect tachykinin-related peptides with the use of an antiserum raised to the locust neuropeptide locustatachykinin I (LomTK I). Determination of tachykinin-related peptide was performed in different tissues of the cockroach Leucophaea maderae. The largest amounts of LomTK-like immunoreactivity (LomTK-LI) reside in the brain and in the midgut. Relatively large amounts were also found in the suboesophageal ganglion and throughout the ganglia of the ventral nerve cord, whereas smaller amounts of LomTK-LI were detected in the corpora cardiaca, foregut and hindgut. Extracts of unfused abdominal ganglia and midguts, respectively, were analysed by a combination of reversed phase high performance liquid chromatography, and radioimmunoassay for LomTK-LI. The extracts of abdominal ganglia and midguts both contain LomTK-LI material which separates in at least two major components. This LomTK-LI material had retention times corresponding approximately to those of synthetic LomTK I and II. Since the cellular source of LomTK-LI material in the foregut and hindgut was not known from earlier studies, we investigated these tissues by immunocytochemistry. We found that the LomTK-LI material associated with the foregut was in arborizing fibres in the oesophageal and gastric nerves and in the ingluvial ganglion. In the hindgut the muscle layer was innervated by immunoreactive fibres derived from cell bodies in the terminal ganglion. The amount of LomTK-LI material in other portions of the nervous system correlates well with previous immunocytochemical data. We conclude that L. maderae have two or more isoforms of tachykinin-related peptides in the nervous system and intestine and that these are present in various amounts in different parts of the central nervous system and intestine. The relative large amounts of LomTK-LI material in the suboesophageal ganglion, oesophageal nerve and associated ganglia and intestine indicate important roles of

  4. Early Endosomes Are Required for Major Histocompatiblity Complex Class II Transport to Peptide-loading Compartments

    PubMed Central

    Brachet, Valérie; Péhau-Arnaudet, Gérard; Desaymard, Catherine; Raposo, Graça; Amigorena, Sebastian

    1999-01-01

    Antigen presentation to CD4+ T lymphocytes requires transport of newly synthesized major histocompatibility complex (MHC) class II molecules to the endocytic pathway, where peptide loading occurs. This step is mediated by a signal located in the cytoplasmic tail of the MHC class II-associated Ii chain, which directs the MHC class II-Ii complexes from the trans-Golgi network (TGN) to endosomes. The subcellular machinery responsible for the specific targeting of MHC class II molecules to the endocytic pathway, as well as the first compartments these molecules enter after exit from the TGN, remain unclear. We have designed an original experimental approach to selectively analyze this step of MHC class II transport. Newly synthesized MHC class II molecules were caused to accumulate in the Golgi apparatus and TGN by incubating the cells at 19°C, and early endosomes were functionally inactivated by in vivo cross-linking of transferrin (Tf) receptor–containing endosomes using Tf-HRP complexes and the HRP-insoluble substrate diaminobenzidine. Inactivation of Tf-containing endosomes caused a marked delay in Ii chain degradation, peptide loading, and MHC class II transport to the cell surface. Thus, early endosomes appear to be required for delivery of MHC class II molecules to the endocytic pathway. Under cross-linking conditions, most αβIi complexes accumulated in tubules and vesicles devoid of γ-adaptin and/or mannose-6-phosphate receptor, suggesting an AP1-independent pathway for the delivery of newly synthesized MHC class II molecules from the TGN to endosomes. PMID:10473634

  5. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  6. The kiwi fruit peptide kissper displays anti-inflammatory and anti-oxidant effects in in-vitro and ex-vivo human intestinal models.

    PubMed

    Ciacci, C; Russo, I; Bucci, C; Iovino, P; Pellegrini, L; Giangrieco, I; Tamburrini, M; Ciardiello, M A

    2014-03-01

    Literature reports describe kiwi fruit as a food with significant effects on human health, including anti-oxidant and anti-inflammatory activity. Fresh fruit or raw kiwi fruit extracts have been used so far to investigate these effects, but the molecule(s) responsible for these health-promoting activities have not yet been identified. Kissper is a kiwi fruit peptide displaying pore-forming activity in synthetic lipid bilayers, the composition of which is similar to that found in intestinal cells. The objective of this study was to investigate the kissper influence on intestinal inflammation using cultured cells and ex-vivo tissues from healthy subjects and Crohn's disease (CD) patients. The anti-oxidant and anti-inflammatory properties of kissper were tested on Caco-2 cells and on the colonic mucosa from 23 patients with CD, by challenging with the lipopolysaccharide from Escherichia coli (EC-LPS) and monitoring the appropriate markers by Western blot and immunofluorescence. EC-LPS challenge determined an increase in the intracellular concentration of calcium and reactive oxygen species (ROS). The peptide kissper was highly effective in preventing the increase of LPS-induced ROS levels in both the Caco-2 cells and CD colonic mucosa. Moreover, it controls the calcium increase, p65-nuclear factor (NF)-kB induction and transglutaminase 2 (TG2) activation inflammatory response in Caco-2 cells and CD colonic mucosa. Kissper efficiently counteracts the oxidative stress and inflammatory response in valuable model systems consisting of intestinal cells and CD colonic mucosa. This study reports the first evidence supporting a possible correlation between some beneficial effects of kiwi fruit and a specific protein molecule rather than generic nutrients.

  7. Effects of salinity and prolactin on gene transcript levels of ion transporters, ion pumps and prolactin receptors in Mozambique tilapia intestine.

    PubMed

    Seale, Andre P; Stagg, Jacob J; Yamaguchi, Yoko; Breves, Jason P; Soma, Satoshi; Watanabe, Soichi; Kaneko, Toyoji; Cnaani, Avner; Harpaz, Sheenan; Lerner, Darren T; Grau, E Gordon

    2014-09-15

    Euryhaline teleosts are faced with significant challenges during changes in salinity. Osmoregulatory responses to salinity changes are mediated through the neuroendocrine system which directs osmoregulatory tissues to modulate ion transport. Prolactin (PRL) plays a major role in freshwater (FW) osmoregulation by promoting ion uptake in osmoregulatory tissues, including intestine. We measured mRNA expression of ion pumps, Na(+)/K(+)-ATPase α3-subunit (NKAα3) and vacuolar type H(+)-ATPase A-subunit (V-ATPase A-subunit); ion transporters/channels, Na(+)/K(+)/2Cl(-) co-transporter (NKCC2) and cystic fibrosis transmembrane conductance regulator (CFTR); and the two PRL receptors, PRLR1 and PRLR2 in eleven intestinal segments of Mozambique tilapia (Oreochromis mossambicus) acclimated to FW or seawater (SW). Gene expression levels of NKAα3, V-ATPase A-subunit, and NKCC2 were generally lower in middle segments of the intestine, whereas CFTR mRNA was most highly expressed in anterior intestine of FW-fish. In both FW- and SW-acclimated fish, PRLR1 was most highly expressed in the terminal segment of the intestine, whereas PRLR2 was generally most highly expressed in anterior intestinal segments. While NKCC2, NKAα3 and PRLR2 mRNA expression was higher in the intestinal segments of SW-acclimated fish, CFTR mRNA expression was higher in FW-fish; PRLR1 and V-ATPase A-subunit mRNA expression was similar between FW- and SW-acclimated fish. Next, we characterized the effects of hypophysectomy (Hx) and PRL replacement on the expression of intestinal transcripts. Hypophysectomy reduced both NKCC2 and CFTR expression in particular intestinal segments; however, only NKCC2 expression was restored by PRL replacement. Together, these findings describe how both acclimation salinity and PRL impact transcript levels of effectors of ion transport in tilapia intestine.

  8. Concord and Niagara Grape Juice and Their Phenolics Modify Intestinal Glucose Transport in a Coupled in Vitro Digestion/Caco-2 Human Intestinal Model.

    PubMed

    Moser, Sydney; Lim, Jongbin; Chegeni, Mohammad; Wightman, JoLynne D; Hamaker, Bruce R; Ferruzzi, Mario G

    2016-07-05

    While the potential of dietary phenolics to mitigate glycemic response has been proposed, the translation of these effects to phenolic rich foods such as 100% grape juice (GJ) remains unclear. Initial in vitro screening of GJ phenolic extracts from American grape varieties (V. labrusca; Niagara and Concord) suggested limited inhibitory capacity for amylase and α-glucosidase (6.2%-11.5% inhibition; p < 0.05). Separately, all GJ extracts (10-100 µM total phenolics) did reduce intestinal trans-epithelial transport of deuterated glucose (d7-glu) and fructose (d7-fru) by Caco-2 monolayers in a dose-dependent fashion, with 60 min d7-glu/d7-fru transport reduced 10%-38% by GJ extracts compared to control. To expand on these findings by assessing the ability of 100% GJ to modify starch digestion and glucose transport from a model starch-rich meal, 100% Niagara and Concord GJ samples were combined with a starch rich model meal (1:1 and 1:2 wt:wt) and glucose release and transport were assessed in a coupled in vitro digestion/Caco-2 cell model. Digestive release of glucose from the starch model meal was decreased when digested in the presence of GJs (5.9%-15% relative to sugar matched control). Furthermore, transport of d7-glu was reduced 10%-38% by digesta containing bioaccessible phenolics from Concord and Niagara GJ compared to control. These data suggest that phenolics present in 100% GJ may alter absorption of monosaccharides naturally present in 100% GJ and may potentially alter glycemic response if consumed with a starch rich meal.

  9. Concord and Niagara Grape Juice and Their Phenolics Modify Intestinal Glucose Transport in a Coupled in Vitro Digestion/Caco-2 Human Intestinal Model

    PubMed Central

    Moser, Sydney; Lim, Jongbin; Chegeni, Mohammad; Wightman, JoLynne D.; Hamaker, Bruce R.; Ferruzzi, Mario G.

    2016-01-01

    While the potential of dietary phenolics to mitigate glycemic response has been proposed, the translation of these effects to phenolic rich foods such as 100% grape juice (GJ) remains unclear. Initial in vitro screening of GJ phenolic extracts from American grape varieties (V. labrusca; Niagara and Concord) suggested limited inhibitory capacity for amylase and α-glucosidase (6.2%–11.5% inhibition; p < 0.05). Separately, all GJ extracts (10–100 µM total phenolics) did reduce intestinal trans-epithelial transport of deuterated glucose (d7-glu) and fructose (d7-fru) by Caco-2 monolayers in a dose-dependent fashion, with 60 min d7-glu/d7-fru transport reduced 10%–38% by GJ extracts compared to control. To expand on these findings by assessing the ability of 100% GJ to modify starch digestion and glucose transport from a model starch-rich meal, 100% Niagara and Concord GJ samples were combined with a starch rich model meal (1:1 and 1:2 wt:wt) and glucose release and transport were assessed in a coupled in vitro digestion/Caco-2 cell model. Digestive release of glucose from the starch model meal was decreased when digested in the presence of GJs (5.9%–15% relative to sugar matched control). Furthermore, transport of d7-glu was reduced 10%–38% by digesta containing bioaccessible phenolics from Concord and Niagara GJ compared to control. These data suggest that phenolics present in 100% GJ may alter absorption of monosaccharides naturally present in 100% GJ and may potentially alter glycemic response if consumed with a starch rich meal. PMID:27399765

  10. Evidence that transporters associated with antigen processing translocate a major histocompatibility complex class I-binding peptide into the endoplasmic reticulum in an ATP-dependent manner.

    PubMed Central

    Androlewicz, M J; Anderson, K S; Cresswell, P

    1993-01-01

    We have investigated the role of the putative peptide transporters associated with antigen processing (TAP) by using a permeabilized-cell system. The main objective was to determine whether these molecules, which bear homology to the ATP-binding cassette family of transporters, translocate antigenic peptides across the endoplasmic reticulum membrane for assembly with major histocompatibility complex (MHC) class I molecules and beta 2-microglobulin light chain. The pore-forming toxin streptolysin O was used to generate permeabilized cells, and peptide translocation was determined by measuring the amount of added radiolabeled peptide bound to endogenous class I molecules. No radiolabeled peptide was associated with MHC class I glycoproteins from unpermeabilized cells. We found that efficient peptide binding to MHC class I molecules in permeabilized cells is both transporter dependent and ATP dependent. In antigen-processing mutant cells lacking a functional transporter, uptake occurs only through a less-efficient transporter and ATP-independent pathway. In addition, short peptides (8-10 amino acids) known to bind MHC class I molecules compete efficiently with a radiolabeled peptide for TAP-dependent translocation, whereas longer peptides and a peptide derived from an endoplasmic reticulum signal sequence do not compete efficiently. This result indicates that the optimal substrates for TAP possess the characteristics of MHC-binding peptides. Images Fig. 2 Fig. 3 Fig. 4 PMID:8415666

  11. Seasonal plasticity in the peptide neuronal systems: potential roles of gonadotrophin-releasing hormone, gonadotrophin-inhibiting hormone, neuropeptide Y and vasoactive intestinal peptide in the regulation of the reproductive axis in subtropical Indian weaver birds.

    PubMed

    Surbhi; Rastogi, A; Rani, S; Kumar, V

    2015-05-01

    Two experiments examined the expression of gonadotrophin-releasing and inhibiting hormones (GnRH-I, GnRH-II and GnIH), neuropeptide Y (NPY) and vasoactive intestinal peptide (VIP) in subtropical Indian weaver birds, which demonstrate relative photorefractoriness. Experiment 1 measured peptide expression levels in the form of immunoreactive (-IR) cells, percentage cell area and cell optical density in the preoptic area (GnRH-I), midbrain (GnRH-II), paraventricular nucleus (GnIH), mediobasal hypothalamus [dorsomedial hypothalamus (DMH), infundibular complex (INc), NPY and VIP] and lateral septal organ (VIP) during the progressive, breeding, regressive and nonbreeding phases of the annual reproductive cycle. GnRH-I was decreased in the nonbreeding and VIP was increased in INc in the breeding and regressive states. GnRH-II and NPY levels did not differ between the testicular phases. Double-labelled immunohistochemistry (IHC) revealed a close association between the GnRH/GnIH, GnRH/NPY, GnRH/VIP and GnIH/NPY peptide systems, implicating them interacting and playing roles in the reproductive regulation in weaver birds. Experiment 2 further measured these peptide levels in the middle of day and night in weaver birds that were maintained under short days (8 : 16 h light /dark cycle; photosensitive), exposed to ten long days (16 : 8 h light /dark cycle; photostimulated) or maintained for approximately 2 years on a 16 : 8 h light /dark cycle (photorefractory). Reproductively immature testes in these groups precluded the possible effect of an enhanced gonadal feedback on the hypothalamic peptide expression. There were group differences in the GnRH-I (not GnRH-II), GnIH, NPY and VIP immunoreactivity, albeit with variations in immunoreactivity measures in the present study. These results, which are consistent with those reported in birds with relative photorefractoriness, show the distribution and possibly a complex interaction of key neuropeptides in the regulation of the

  12. Aquaporin expression in the Japanese medaka (Oryzias latipes) in freshwater and seawater: challenging the paradigm of intestinal water transport?

    PubMed

    Madsen, Steffen S; Bujak, Joanna; Tipsmark, Christian K

    2014-09-01

    We investigated the salinity-dependent expression dynamics of seven aquaporin paralogs (aqp1a, aqp3a, aqp7, aqp8ab, aqp10a, aqp10b and aqp11a) in several tissues of euryhaline Japanese medaka (Oryzias latipes). All paralogs except aqp7 and aqp10a had a broad tissue distribution, and several were affected by salinity in both osmoregulatory and non-osmoregulatory tissues. In the intestine, aqp1a, aqp7, aqp8ab and aqp10a decreased upon seawater (SW) acclimation in both long-term acclimated fish and during 1-3 days of the transition period. In the gill, aqp3a was lower and aqp10a higher in SW than in freshwater (FW). In the kidney no aqps were affected by salinity. In the skin, aqp1a and aqp3a were lower in SW than in FW. In the liver, aqp8ab and aqp10a were lower in SW than in FW. Furthermore, six Na(+),K(+)-ATPase α-subunit isoform transcripts were analysed in the intestine but none showed a consistent response to salinity, suggesting that water transport is not regulated at this level. In contrast, mRNA of the Na(+),K(+),2Cl(-)-cotransporter type-2 strongly increased in the intestine in SW compared with FW fish. Using custom-made antibodies, Aqp1a, Aqp8ab and Aqp10a were localized in the apical region of enterocytes of FW fish. Apical staining intensity strongly decreased, vanished or moved to subapical regions, when fish were acclimated to SW, supporting the lower mRNA expression in SW. Western blots confirmed the decrease in Aqp1a and Aqp10a in SW. The strong decrease in aquaporin expression in the intestine of SW fish is surprising, and challenges the paradigm for transepithelial intestinal water absorption in SW fishes.

  13. Dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes

    NASA Astrophysics Data System (ADS)

    Li, Rui; Fan, Jianfen; Li, Hui; Yan, Xiliang; Yu, Yi

    2015-07-01

    Classical molecular dynamics simulations have been performed to investigate the dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes (CPNTs) with various radii, i.e., 8 × ( W L ¯ ) n = 3 , 4 , 5 / POPE . The results show that ethanol molecules spontaneously fill the octa- and deca-CPNTs, but not the hexa-CPNT. In the octa-CPNT, ethanol molecules are trapped at individual gaps with their carbon skeletons perpendicular to the tube axis and hydroxyl groups towards the tube wall, forming a broken single-file chain. As the channel radius increases, ethanol molecules inside the deca-CPNT tend to form a tubular layer and the hydroxyl groups mainly stretch towards the tube axis. Computations of diffusion coefficients indicate that ethanol molecules in the octa-CPNT nearly lost their diffusion abilities, while those in the deca-CPNT diffuse as 4.5 times as in a (8, 8) carbon nanotube with a similar tube diameter. The osmotic and diffusion permeabilities (pf and pd, respectively) of the octa- and deca-CPNTs transporting ethanol were deduced for the first time. The distributions of the gauche and trans conformers of ethanol molecules in two CPNTs are quite similar, both with approximately 57% gauche conformers. The non-bonded interactions of channel ethanol with a CPNT wall and surrounding ethanol were explored. The potential of mean force elucidates the mechanism underlying the transporting characteristics of channel ethanol in a transmembrane CPNT.

  14. Dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes.

    PubMed

    Li, Rui; Fan, Jianfen; Li, Hui; Yan, Xiliang; Yu, Yi

    2015-07-07

    Classical molecular dynamics simulations have been performed to investigate the dynamic behaviors and transport properties of ethanol molecules in transmembrane cyclic peptide nanotubes (CPNTs) with various radii, i.e., 8×(WL¯)n=3,4,5/POPE. The results show that ethanol molecules spontaneously fill the octa- and deca-CPNTs, but not the hexa-CPNT. In the octa-CPNT, ethanol molecules are trapped at individual gaps with their carbon skeletons perpendicular to the tube axis and hydroxyl groups towards the tube wall, forming a broken single-file chain. As the channel radius increases, ethanol molecules inside the deca-CPNT tend to form a tubular layer and the hydroxyl groups mainly stretch towards the tube axis. Computations of diffusion coefficients indicate that ethanol molecules in the octa-CPNT nearly lost their diffusion abilities, while those in the deca-CPNT diffuse as 4.5 times as in a (8, 8) carbon nanotube with a similar tube diameter. The osmotic and diffusion permeabilities (pf and pd, respectively) of the octa- and deca-CPNTs transporting ethanol were deduced for the first time. The distributions of the gauche and trans conformers of ethanol molecules in two CPNTs are quite similar, both with approximately 57% gauche conformers. The non-bonded interactions of channel ethanol with a CPNT wall and surrounding ethanol were explored. The potential of mean force elucidates the mechanism underlying the transporting characteristics of channel ethanol in a transmembrane CPNT.

  15. Ion-pair mediated transport of small model peptides in liquid phase micro extraction under acidic conditions.

    PubMed

    Reubsaet, J Léon E; Paulsen, Jonas V

    2005-02-01

    This paper discusses the behaviour of five small model peptides in a three phase (aqueous donor-organic-aqueous acceptor) liquid phase micro extraction system in relation to their physico-chemical properties (charge, hydrophobicity). It is proved that for all peptides transport over the organic phase is mediated by aliphatic sulphonic acids. Heptane-1-sulphonic acid gave the best overall recoveries. It appeared that peptides with hydrophobic properties (IPI) and a high number of positive charges (KYK) show good recoveries and are enriched in the acceptor phase. Variation in the pH (1.6-4.4) of the donor phase shows that there are peptide-dependent optimal pH-values for their recovery. Increasing pH in the acceptor phase shows that in most cases the recovery decreases due to decreased ion-pair mediated membrane transport. For KYK the partition between the organic phase and the aqueous acceptor-phase is also driven by the solubility in the aqueous acceptor phase. Increase of the ion strength of the acceptor phase did not affect the recovery of the peptides. Except for KYK, which showed decreased recovery when the ion strength increased. Another finding is that delocalisation of positive charge causes bad recovery, probably due to incomplete ion-pair-peptide complex formation.

  16. Intestinal transport of bis(12)-hupyridone in Caco-2 cells and its improved permeability by the surfactant Brij-35.

    PubMed

    Yu, Hua; Hu, Yue Qing; Ip, Fanny C F; Zuo, Zhong; Han, Yi Fan; Ip, Nancy Y

    2011-04-01

    The objective of the present study was to elucidate the mechanisms of intestinal transport of bis(12)-hupyridone (B12H) to predict its oral bioavailability. The effect of the B12H concentration and the contribution of the drug efflux transporters, P-glycoprotein (P-gp or ABCB1) and multidrug resistance-associated proteins (MRPs or ABCC) on B12H absorption were measured and evaluated using the human intestinal epithelial Caco-2 cell monolayer in the presence of transporter inhibitors. The results indicated that B12H was absorbed in a dose-dependent manner at concentrations ranging from 132 to 264 µM. However, only apical efflux was observed in the directional transport studies for B12H below 88 µM (P(app) (AP-to-BL): virtually zero; P(app) (BL-to-AP): 1.591 ± 0.071 × 10(-5)  cm s(-1) ). P-gp and mixed P-gp/MRP inhibitors significantly increased the absorptive transport (P(app) (AP-to-BL)) to 0.619 ± 0.018 × 10(-5) and 0.608 ± 0.025 × 10(-5)  cm s(-1) , respectively, while decreasing secretory transport (P(app) (BL-to-AP)) by >75%. A multiple-MRP inhibitor, probenecid, increased the P(app) (AP-to-BL) to 0.329 ± 0.015 × 10(-5)  cm s(-1) while decreasing the P(app) (BL-to-AP) by 50%. Another multiple-MRP inhibitor, indomethacin, only modestly decreased the P(app) (BL-to-AP) by ∼30% and had no effect on the absorptive transport (P(app) (AP-to-BL): virtually zero). In addition, the effect of various pharmaceutical excipients (e.g. Pluronic F-68, Tween-80 and Brij-35) on B12H transport was determined and compared. Among them, Brij-35 effectively enhanced B12H absorption at a concentration lower than its critical micelle concentration (CMC, 60 µM). Therefore, Brij-35 can be used as a potential enhancer to improve intestinal absorption of B12H for oral administration.

  17. Effect of Dietary Nutrient Density on Small Intestinal Phosphate Transport and Bone Mineralization of Broilers during the Growing Period

    PubMed Central

    Miao, Zhiqiang; Song, Zhigang; Yang, Yu; Tian, Wenxia; Guo, Yuming

    2016-01-01

    A 2 × 4 factorial experiment was conducted to determine the effects of dietary nutrient density on growth performance, small intestinal epithelial phosphate transporter expression, and bone mineralization of broiler chicks fed with diets with different nutrient densities and nonphytate phosphorus (NPP) levels. The broilers were fed with the same starter diets from 0 to 21 days of age. In the grower phase (day 22 to 42), the broilers were randomly divided into eight groups according to body weight. Relatively high dietary nutrient density (HDND) and low dietary nutrient density (LDND) diets were assigned metabolic energy (ME) values of 3,150 and 2,950 kcal/kg, respectively. Crude protein and essential amino acid levels were maintained in the same proportion as ME to prepare the two diet types. NPP levels were 0.25%, 0.30%, 0.35%, and 0.40% of the diets. Results showed that a HDND diet significantly increased the body weight gain (BWG) of broilers and significantly decreased the feed conversion ratio and NPP consumed per BWG. HDND significantly decreased tibial P content of the broilers. Conversely, mRNA expression of NaPi-IIb and protein expression of calbindin were significantly increased in the intestine of broilers fed a HDND diet. HDND also increased vitamin D receptor (VDR) expression, especially at a relatively low dietary NPP level (0.25%). The mRNA expression of NaPi-IIa in the kidneys was significantly increased at a relatively low dietary NPP level (0.25%) to maintain P balance. Tibial P, calcium, and ash content were significantly decreased, as were calbindin and VDR expression levels in the intestine at a low NPP level. Therefore, HDND improved the growth rate of broilers and increased the expression of phosphate and calcium transporter in the small intestine, but adversely affected bone mineralization. PMID:27100791

  18. Effect of Dietary Nutrient Density on Small Intestinal Phosphate Transport and Bone Mineralization of Broilers during the Growing Period.

    PubMed

    Li, Jianhui; Yuan, Jianmin; Miao, Zhiqiang; Song, Zhigang; Yang, Yu; Tian, Wenxia; Guo, Yuming

    2016-01-01

    A 2 × 4 factorial experiment was conducted to determine the effects of dietary nutrient density on growth performance, small intestinal epithelial phosphate transporter expression, and bone mineralization of broiler chicks fed with diets with different nutrient densities and nonphytate phosphorus (NPP) levels. The broilers were fed with the same starter diets from 0 to 21 days of age. In the grower phase (day 22 to 42), the broilers were randomly divided into eight groups according to body weight. Relatively high dietary nutrient density (HDND) and low dietary nutrient density (LDND) diets were assigned metabolic energy (ME) values of 3,150 and 2,950 kcal/kg, respectively. Crude protein and essential amino acid levels were maintained in the same proportion as ME to prepare the two diet types. NPP levels were 0.25%, 0.30%, 0.35%, and 0.40% of the diets. Results showed that a HDND diet significantly increased the body weight gain (BWG) of broilers and significantly decreased the feed conversion ratio and NPP consumed per BWG. HDND significantly decreased tibial P content of the broilers. Conversely, mRNA expression of NaPi-IIb and protein expression of calbindin were significantly increased in the intestine of broilers fed a HDND diet. HDND also increased vitamin D receptor (VDR) expression, especially at a relatively low dietary NPP level (0.25%). The mRNA expression of NaPi-IIa in the kidneys was significantly increased at a relatively low dietary NPP level (0.25%) to maintain P balance. Tibial P, calcium, and ash content were significantly decreased, as were calbindin and VDR expression levels in the intestine at a low NPP level. Therefore, HDND improved the growth rate of broilers and increased the expression of phosphate and calcium transporter in the small intestine, but adversely affected bone mineralization.

  19. Very low density lipoproteins in intestinal lymph: origin, composition, and role in lipid transport in the fasting state

    PubMed Central

    Ockner, Robert K.; Hughes, Faith B.; Isselbacher, Kurt J.

    1969-01-01

    The transport of endogenous lipids in the lipoproteins of mesenteric lymph was studied in fasting rats with mesenteric lymph fistulas. The lymph was found to contain, in addition to chylomicrons (Sf >400), a significant amount of another, more dense, triglyceride-rich fraction, the very low density lipoproteins (VLDL), which showed a peak Sf of 102. The VLDL differed from chylomicrons not only in flotation, but also in per cent lipid composition and electrophoretic mobility in agarose gel. The VLDL fraction was found to contain 47% of the triglyceride and 54% of the cholesterol of fasting lymph and, in the fasting state, was the major lipoprotein species present. When cholestyramine resin was administered intraduodenally, or bile flow was acutely diverted from the intestine, it was demonstrated that the lipids in lymph VLDL, like those in chylomicrons, were derived from the intestine and bile. These data indicate that the VLDL in intestinal lymph are not derived from the plasma but are of intestinal origin. Because certain properties of lymph VLDL were similar to those reported for plasma VLDL (per cent lipid composition, flotation coefficient, and continuing entry into plasma in the fasting state), additional comparisons between these fractions were made. Although lymph VLDL moved to the α2 region in agarose gel, when they were mixed with VLDL-free serum immediately before electrophoresis they showed the α2 mobility of rat serum VLDL. Furthermore, immunoelectrophoretic comparison of partially delipidated lymph and serum VLDL revealed that these fractions shared in common their major apoprotein, and possibly others as well. The fatty acid composition of lymph and serum triglycerides, as determined by gas-liquid chromatography, revealed that although they were generally similar, differences existed which most likely reflected the presence in serum of triglycerides of hepatic origin. These experiments demonstrate the importance of intestinal VLDL in the transport

  20. Mechanism of Action of Glucagon-Like Peptide-2 to Increase IGF-I mRNA in Intestinal Subepithelial Fibroblasts

    PubMed Central

    Leen, Jason L. S.; Izzo, Angelo; Upadhyay, Chandani; Rowland, Katherine J.; Dubé, Philip E.; Gu, Steven; Heximer, Scott P.; Rhodes, Christopher J.; Storm, Daniel R.; Lund, P. Kay

    2011-01-01

    IGF-I, a known secretory product of intestinal subepithelial myofibroblasts (ISEMFs), is essential for the intestinotropic effects of glucagon-like peptide-2 (GLP-2). Furthermore, GLP-2 increases IGF-I mRNA transcript levels in vitro in heterogeneous fetal rat intestinal cultures, as well as in vivo in the rodent small intestine. To determine the mechanism underlying the stimulatory effect of GLP-2 on intestinal IGF-I mRNA, murine ISEMF cells were placed into primary culture. Immunocytochemistry showed that the ISEMF cells appropriately expressed α-smooth muscle actin and vimentin but not desmin. The cells also expressed GLP-2 receptor and IGF-I mRNA transcripts. Treatment of ISEMF cells with (Gly2)GLP-2 induced IGF-I mRNA transcripts by up to 5-fold of basal levels after treatment with 10−8 m GLP-2 for 2 h (P < 0.05) but did not increase transcript levels for other intestinal growth factors, such as ErbB family members. Immunoblot revealed a 1.6-fold increase in phospho (p)-Akt/total-(t)Akt with 10−8 m GLP-2 treatment (P < 0.05) but no changes in cAMP, cAMP-dependent β-galactosidase expression, pcAMP response element-binding protein/tcAMP response element-binding protein, pErk1/2/tErk1/2, or intracellular calcium. Furthermore, pretreatment of ISEMF cells with the phosphatidylinositol 3 kinase (PI3K) inhibitors, LY294002 and wortmannin, abrogated the IGF-I mRNA response to GLP-2, as did overexpression of kinase-dead Akt. The role of PI3K/Akt in GLP-2-induced IGF-I mRNA levels in the murine jejunum was also confirmed in vivo. These findings implicate the PI3K/Akt pathway in the stimulatory effects of GLP-2 to enhance intestinal IGF-I mRNA transcript levels and provide further evidence in support of a role for IGF-I produced by the ISEMF cells in the intestinotropic effects of GLP-2. PMID:21159855

  1. Development of an advanced intestinal in vitro triple culture permeability model to study transport of nanoparticles.

    PubMed

    Schimpel, Christa; Teubl, Birgit; Absenger, Markus; Meindl, Claudia; Fröhlich, Eleonore; Leitinger, Gerd; Zimmer, Andreas; Roblegg, Eva

    2014-03-03

    Intestinal epithelial cell culture models, such as Caco-2 cells, are commonly used to assess absorption of drug molecules and transcytosis of nanoparticles across the intestinal mucosa. However, it is known that mucus strongly impacts nanoparticle mobility and that specialized M cells are involved in particulate uptake. Thus, to get a clear understanding of how nanoparticles interact with the intestinal mucosa, in vitro models are necessary that integrate the main cell types. This work aimed at developing an alternative in vitro permeability model based on a triple culture: Caco-2 cells, mucus-secreting goblet cells and M cells. Therefore, Caco-2 cells and mucus-secreting goblet cells were cocultured on Transwells and Raji B cells were added to stimulate differentiation of M cells. The in vitro triple culture model was characterized regarding confluence, integrity, differentiation/expression of M cells and cell surface architecture. Permeability of model drugs and of 50 and 200 nm polystyrene nanoparticles was studied. Data from the in vitro model were compared with ex vivo permeability results (Ussing chambers and porcine intestine) and correlated well. Nanoparticle uptake was size-dependent and strongly impacted by the mucus layer. Moreover, nanoparticle permeability studies clearly demonstrated that particles were capable of penetrating the intestinal barrier mainly via specialized M cells. It can be concluded that goblet cells and M cells strongly impact nanoparticle uptake in the intestine and should thus be integrated in an in vitro permeability model. The presented model will be an efficient tool to study intestinal transcellular uptake of particulate systems.

  2. Gastro-intestinal transport of calcium and cadmium in fresh water and seawater acclimated trout (Oncorhynchus mykiss).

    PubMed

    Klinck, Joel S; Wood, Chris M

    2013-03-01

    Transport of calcium (Ca) and cadmium (Cd) was examined along the gastro-intestinal tract (GIT) of freshwater and seawater Oncorhynchus mykiss irideus (FWT and SWTies respectively) using in vitro and in vivo experiments. Based on known physiological differences between FWT and SWT which aid in regulating ion levels and osmolarity, we hypothesized that SWT would have lower rates of Ca uptake. Also, we predicted that Cd rates would also be lower because Cd is known to share a common transport mechanism with Ca. Kinetics of Ca and Cd transport were determined using mucosal salines of varying concentrations [1, 10, 30, 60, and 100 (mmolL(-1) for Ca, μmolL(-1) for Cd)]. Linear and saturating relationships were found for Ca for FWT and SWT, but overall SWT had lower rates. Linear and/or saturating relationships were also found for Cd uptake, but rates varied little between fish types. Elevated Ca had no inhibitory effect on Cd transport, and Ca channel blockers nifedipine and verapamil had little effect on Ca or Cd uptake. However, lanthanum reduced Ca transport into some compartments. A 21 day in vivo feeding experiment was also performed where FWT and SWT were exposed to control diets or Cd-spiked diets (552 μg Cd g(-1) food). Whole body Cd uptake between fish types was similar, but the majority of Cd in SWT remained in the posterior intestine tissue, while FWT transported more Cd through their gut wall. Overall it appears that large differences in Ca and Cd uptake between FWT and SWT exist, with SWT generally having lower rates.

  3. Effect of the six-mer synthetic peptide (AT1002) fragment of zonula occludens toxin on the intestinal absorption of cyclosporin A.

    PubMed

    Song, Keon-Hyoung; Fasano, Alessio; Eddington, Natalie D

    2008-03-03

    Zonula occludens toxin (Zot) and its biologically active fragment, delta G, have been shown to reversibly open tight junctions (TJ) in endothelial and epithelial cells. Recently, a six-mer synthetic peptide H-FCIGRL-OH (AT1002) was identified and synthesized that retains the Zot permeating effect on intercellular TJ. The objective of this study was to evaluate the biological activity of AT1002 on enhancing the oral administration of cyclosporin A (CsA). The intestinal permeability enhancing effect of AT1002 on the transport of CsA across Caco-2 cell monolayers was examined after the following treatments, i.e., CsA, CsA/protease inhibitors (PI), CsA/PI/benzalkonium chloride (BC), CsA/AT1002, CsA/PI/AT1002, and CsA/PI/BC/AT1002 (CsA 0.5 microCi/ml, PI (bestatin 15 mM and E-64 5mM), BC 0.005 w/v%, and AT1002 5mM, respectively). Apparent permeability coefficients (P app) were calculated for each treatment. In addition, four treatments, i.e., CsA, CsA/PI/BC, CsA/AT1002, and CsA/PI/BC/AT1002 (CsA 120 microCi/kg, PI (bestatin 30 mg/kg and E-64 10mg/kg), BC 0.1 w/v%, and AT1002 doses of 5, 10 or 40 mg/kg, respectively) were prepared and administered intraduodenally to male Sprague-Dawley rats (230-280 g, n=4-5). Blood samples were collected at 0, 20, 60, and 120 min post-dosing and CsA plasma concentrations were determined subsequently using a Beckman Liquid Scintillation Counter. No significant increases in CsA transport were observed in the Caco-2 cell culture experiments following pre-treatment with AT1002 (5mM). Even though, AT1002 appeared to increase the P app of CsA in each treatment (CsA/AT1002, 1.54+/-0.13 x 10(-6)cm/s and CsA/PI/AT1002, 1.76+/-0.05 x 10(-6)cm/s) compared to each control (CsA and CsA/PI), respectively. The plasma concentration of CsA was significantly increased over a range of 1.55-2.50 at 10 and 40 mg/kg dose of AT1002. Also, AUC 0-120 min of CsA over a range of 1.64-2.14 and the Cmax of CsA over a range of 1.77-2.56 was statistically and

  4. Acute Effects of Sugars and Artificial Sweeteners on Small Intestinal Sugar Transport: A Study Using CaCo-2 Cells As an In Vitro Model of the Human Enterocyte

    PubMed Central

    2016-01-01

    Background The gastrointestinal tract is responsible for the assimilation of nutrients and plays a key role in the regulation of nutrient metabolism and energy balance. The molecular mechanisms by which intestinal sugar transport are regulated are controversial. Based on rodent studies, two models currently exist that involve activation of the sweet-taste receptor, T1R2/3: an indirect model, whereby luminal carbohydrates activate T1R2/3 expressed on enteroendocrine cells, resulting in the release of gut peptides which in turn regulate enterocyte sugar transport capacity; and a direct model, whereby T1R2/3 expressed on the enterocyte regulates enterocyte function. Aims To study the direct model of intestinal sugar transport using CaCo-2 cells, a well-established in vitro model of the human enterocyte. Methods Uptake of 10mM 14C D-Glucose and D-Fructose into confluent CaCo-2/TC7 cells was assessed following 3hr preincubation with sugars and artificial sweeteners in the presence and absence of the sweet taste receptor inhibitor, lactisole. Expression of the intestinal sugar transporters and sweet-taste receptors were also determined by RT-PCR. Results In response to short term changes in extracellular glucose and glucose/fructose concentrations (2.5mM to 75mM) carrier-mediated sugar uptake mediated by SGLT1 and/or the facilitative hexose transporters (GLUT1,2,3 and 5) was increased. Lactisole and artificial sweeteners had no effect on sugar transport regulated by glucose alone; however, lactisole increased glucose transport in cells exposed to glucose/fructose. RT-PCR revealed Tas1r3 and SGLT3 gene expression in CaCo-2/TC7 cells, but not Tas1r2. Conclusions In the short term, enterocyte sugar transport activities respond directly to extracellular glucose levels, but not fructose or artificial sweeteners. We found no evidence of a functional heterodimeric sweet taste receptor, T1R2/3 in CaCo-2 cells. However, when glucose/fructose is administered together there is an

  5. Adaptive response of equine intestinal Na+/glucose co-transporter (SGLT1) to an increase in dietary soluble carbohydrate.

    PubMed

    Dyer, Jane; Al-Rammahi, Miran; Waterfall, Louise; Salmon, Kieron S H; Geor, Ray J; Bouré, Ludovic; Edwards, G Barrie; Proudman, Christopher J; Shirazi-Beechey, Soraya P

    2009-06-01

    Experimental and epidemiological evidence suggests that consumption of hydrolyzable carbohydrate, hCHO (grain), by horses is an important risk factor for colic, a common cause of equine mortality. It is unknown whether the small intestinal capacity to digest hCHO and/or to absorb monosaccharides is limiting, or even if horses can adapt to increased carbohydrate load. We investigated changes in the brush-border membrane carbohydrate digestive enzymes and glucose absorptive capacity of horse small intestine in response to increased hCHO. Expression of the Na(+)/glucose co-transporter, SGLT1, was assessed by Western blotting, immunohistochemistry, Northern blotting, QPCR, and Na(+)-dependent D-glucose transport. Glucose transport rates, SGLT1 protein, and mRNA expression were all 2-fold higher in the jejunum and 3- to 5-fold higher in the ileum of horses maintained on a hCHO-enriched diet compared to pasture forage. Activity of the disaccharidases was unaltered by diet. In a well-controlled study, we determined SGLT1 expression in the duodenal and ileal biopsies of horses switched, gradually over a 2-month period, from low (<1.0 g/kg bwt/day) to high hCHO (6.0 g/kg bwt/day) diets of known composition. We show that SGLT1 expression is enhanced, with time, 2-fold in the duodenum and 3.3-fold in the ileum. The study has important implications for dietary management of the horse.

  6. Volume regulation of intestinal cells of echinoderms: Putative role of ion transporters (Na(+)/K(+)-ATPase and NKCC).

    PubMed

    Castellano, Giovanna C; Souza, Marta M; Freire, Carolina A

    2016-11-01

    Echinoderms are exclusively marine osmoconformer invertebrates. Some species occupy the challenging intertidal region. Upon salinity changes, the extracellular osmotic concentration of these animals also varies, exposing tissues and cells to osmotic challenges. Cells and tissues may then respond with volume regulation mechanisms, which involve transport of ions and water into and/or out of the cells, through ion transporters, such as the Na(+)/K(+)-ATPase and NKCC. The goal of this study was to relate the cell volume regulation capacity of echinoderm intestinal cells Na(+)/K(+)-ATPase and NKCC activities, in three echinoderm species: Holothuria grisea, Arbacia lixula, and Echinometra lucunter. Isolated cells of these species displayed some control of their cell volume upon exposure to anisosmotic media (isolated intestinal cells, calcein fluorescence as indicator of volume change), with a distinct higher capacity shown by H. grisea, which did not swell even upon 50% hyposmotic shock. The holothuroid cells showed indirect evidence (effect of furosemide) of the participation of NKCC in this process, with a secretory function, and of a secondary role by the NKA (effect of ouabain). Other mechanisms are probably responsible for this function in the urchins. Variable expression of these transporters, and others not examined here, may to some extent account for the variability in cell volume regulation capacity in echinoderm cells.

  7. Intestinal mucosal changes and upregulated calcium transporter and FGF-23 expression during lactation: Contribution of lactogenic hormone prolactin.

    PubMed

    Wongdee, Kannikar; Teerapornpuntakit, Jarinthorn; Sripong, Chanakarn; Longkunan, Asma; Chankamngoen, Wasutorn; Keadsai, Chutiya; Kraidith, Kamonshanok; Krishnamra, Nateetip; Charoenphandhu, Narattaphol

    2016-01-15

    As the principal lactogenic hormone, prolactin (PRL) not only induces lactogenesis but also enhances intestinal calcium absorption to supply calcium for milk production. How the intestinal epithelium res-ponses to PRL is poorly understood, but it is hypothesized to increase mucosal absorptive surface area and calcium transporter expression. Herein, lactating rats were found to have greater duodenal, jejunal and ileal villous heights as well as cecal crypt depths than age-matched nulliparous rats. Morphometric analyses in the duodenum and cecum showed that their mucosal adaptations were diminished by bromocriptine, an inhibitor of pituitary PRL release. PRL also upregulated calcium transporter expression (e.g., TRPV6 and PMCA1b) in the duodenum of lactating rats. Since excessive calcium absorption could be detrimental to lactating rats, local negative regulator of calcium absorption, e.g., fibroblast growth factor (FGF)-23, should be increased. Immunohistochemistry confirmed the upregulation of FGF-23 protein expression in the duodenal and cecal mucosae of lactating rats, consistent with the enhanced FGF-23 mRNA expression in Caco-2 cells. Bromocriptine abolished this lactation-induced FGF-23 expression. Additionally, FGF-23 could negate PRL-stimulated calcium transport across Caco-2 monolayer. In conclusion, PRL was responsible for the lactation-induced mucosal adaptations, which were associated with compensatory increase in FGF-23 expression probably to prevent calcium hyperabsorption.

  8. DURIP: Electrokinetic Injection and Separation System for Analysis of Protein and Peptide Transport, Adsorption and Kinetics Instrumentation Proposal

    DTIC Science & Technology

    2015-03-18

    SECURITY CLASSIFICATION OF: We requested equipment necessary to build an electrokinetic injection and separation system for the analysis of protein...Jul-2014 Approved for Public Release; Distribution Unlimited Final Report: DURIP: Electrokinetic Injection and Separation System for Analysis of...Injection and Separation System for Analysis of Protein and Peptide Transport, Adsorption and Kinetics Instrumentation Proposal Report Title We requested

  9. Ventilatory and cardiovascular actions of centrally and peripherally administered trout pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) in the unanaesthetized trout.

    PubMed

    Le Mével, J-C; Lancien, F; Mimassi, N; Conlon, J M

    2009-12-01

    In mammals, pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) are involved in cardiovascular and respiratory regulation. Several studies have demonstrated the presence of PACAP, VIP and their receptors in various tissues of teleost fish, including the brain, but little is known about their respiratory and cardiovascular effects. The present study was undertaken to compare the central and peripheral actions of graded doses (25-100 pmol) of trout PACAP and trout VIP on ventilatory and cardiovascular variables in the unanaesthetized rainbow trout. Compared with vehicle, only intracerebroventricular injection of PACAP significantly (P<0.05) elevated the ventilation frequency and the ventilation amplitude, but both peptides significantly increased the total ventilation (total ventilation). However, the maximum hyperventilatory effect of PACAP was approximately 2.5-fold higher than the effect of VIP at the 100 pmol dose (PACAP, (total ventilation)=+5407+/-921 arbitrary units, a.u.; VIP, (total ventilation)=+2056+/-874 a.u.; means +/- s.e.m.). When injected centrally, only PACAP produced a significant increase in mean dorsal aortic blood pressure (P(DA)) (100 pmol: +21%) but neither peptide affected heart rate (f(H)). Intra-arterial injections of either PACAP or VIP were without effect on the ventilatory variables. PACAP was without significant action on P(DA) and f(H) while VIP significantly elevated P(DA) (100 pmol: +36%) without changing f(H). In conclusion, the selective central hyperventilatory actions of exogenously administered trout PACAP, and to a lesser extent VIP, suggest that the endogenous peptides may be implicated in important neuroregulatory functions related to the central control of ventilation in trout.

  10. Vasoactive intestinal peptide enhanced aromatase activity in the neonatal rat ovary before development of primary follicles or responsiveness to follicle-stimulating hormone

    SciTech Connect

    George, F.W.; Ojeda, S.R.

    1987-08-01

    The authors have investigated the factors that regulate aromatase activity in fetal-neonatal rat ovaries. Ovarian aromatase activity (assessed by measuring the amount of /sup 3/H/sub 2/O formed from (1..beta..-/sup 3/H)testosterone) is low prior to birth and increases to values greater than 30 pmol/hr per mg of protein between days 8 and 12 after birth. The appearance of ovarian aromatase coincides with the development of primordial follicles. Fetal-neonatal ovaries maintained in serum-free organ culture do not develop aromatase activity at the expected time. Ovine follicle-stimulating hormone, ovine luteinizing hormone, or their combination failed to induce the enzyme activity in cultured fetal ovaries, whereas follicle-stimulating hormone is effective in preventing the decline in aromatase activity when postnatal day 8 ovaries are placed in culture. In contrast to follicle-stimulating hormone, dibutyryl-cAMP markedly enhances ovarian aromatase in cultured fetal ovaries. Likewise, enhancement of endogenouse cAMP formation with forskolin or cholera toxin caused an increase in enzyme activity within 24 hr. Vasoactive intestinal peptide, a peptide known to occur in ovarian nerves, caused a dose-dependent increase in aromatase activity in fetal ovaries prior to folliculogenesis. Of related peptides tested, only the peptide having N-terminal histidine and C-terminal isoleucine amide was capable of inducing aromatase activity in fetal ovaries. The fact that VIP can induce aromatase activity in fetal rat ovaries prior to follicle formation and prior to responsiveness to follicle-stimulating hormone suggests that this neuropeptide may play a critical role in ovarian differentiation.

  11. Atrial Natriuretic Peptide Stimulates Dopamine Tubular Transport by Organic Cation Transporters: A Novel Mechanism to Enhance Renal Sodium Excretion

    PubMed Central

    Kouyoumdzian, Nicolás M.; Rukavina Mikusic, Natalia L.; Kravetz, María C.; Lee, Brenda M.; Carranza, Andrea; Del Mauro, Julieta S.; Pandolfo, Marcela; Gironacci, Mariela M.; Gorzalczany, Susana; Toblli, Jorge E.; Fernández, Belisario E.

    2016-01-01

    The aim of this study was to demonstrate the effects of atrial natriuretic peptide (ANP) on organic cation transporters (OCTs) expression and activity, and its consequences on dopamine urinary levels, Na+, K+-ATPase activity and renal function. Male Sprague Dawley rats were infused with isotonic saline solution during 120 minutes and randomized in nine different groups: control, pargyline plus tolcapone (P+T), ANP, dopamine (DA), D-22, DA+D-22, ANP+D-22, ANP+DA and ANP+DA+D-22. Renal functional parameters were determined and urinary dopamine concentration was quantified by HPLC. Expression of OCTs and D1-receptor in membrane preparations from renal cortex tissues were determined by western blot and Na+, K+-ATPase activity was determined using in vitro enzyme assay. 3H-DA renal uptake was determined in vitro. Compared to P+T group, ANP and dopamine infusion increased diuresis, urinary sodium and dopamine excretion significantly. These effects were more pronounced in ANP+DA group and reversed by OCTs blockade by D-22, demonstrating that OCTs are implied in ANP stimulated-DA uptake and transport in renal tissues. The activity of Na+, K+-ATPase exhibited a similar fashion when it was measured in the same experimental groups. Although OCTs and D1-receptor protein expression were not modified by ANP, OCTs-dependent-dopamine tubular uptake was increased by ANP through activation of NPR-A receptor and protein kinase G as signaling pathway. This effect was reflected by an increase in urinary dopamine excretion, natriuresis, diuresis and decreased Na+, K+-ATPase activity. OCTs represent a novel target that links the activity of ANP and dopamine together in a common mechanism to enhance their natriuretic and diuretic effects. PMID:27392042

  12. Physiology of Intestinal Absorption and Secretion

    PubMed Central

    Kiela, Pawel R.; Ghishan, Fayez K.

    2016-01-01

    Virtually all nutrients from the diet are absorbed into blood across the highly polarized epithelial cell layer forming the small and large intestinal mucosa. Anatomical, histological, and functional specializations along the gastrointestinal tract are responsible for the effective and regulated nutrient transport via both passive and active mechanisms. In this chapter, we summarize the current state of knowledge regarding the mechanism of intestinal absorption of key nutrients such as sodium, anions (chloride, sulfate, oxalate), carbohydrates, amino acids and peptides, lipids, lipidand water-soluble vitamins, as well as the major minerals and micronutrients. This outline, including the molecular identity, specificity, and coordinated activities of key transport proteins and genes involved, serves as the background for the following chapters focused on the pathophysiology of acquired and congenital intestinal malabsorption, as well as clinical tools to test and treat malabsorptive symptoms. PMID:27086882

  13. Inhibition of small-intestinal sugar and amino acid transport by the enterotoxin of Shigella dysenteriae I.

    PubMed

    Binder, H J; Whiting, D S

    1977-05-01

    The enterotoxin of Shigella dysenteriae I produces fluid and electrolyte secretion in the rabbit ileum. These present studies were designed to evaluate nonelectrolyte transport in rabbit ileal mucosa exposed to Shigella enterotoxin. Both 10 mM galactose and 5 mM L-alanine absorptions were significantly impaired in enterotoxin-exposed ileal mucosa compared with control mucosa. L-Alanine influx was not imparied in two other secretory processes: that induced by cholera enterotoxin and hyperosmolarity. These studies provide evidence that both surgar and amino acid absorptions are diminished in the small intestine by the enterotoxin of S. dysenteriae I.

  14. Inhibition of small-intestinal sugar and amino acid transport by the enterotoxin of Shigella dysenteriae I.

    PubMed Central

    Binder, H J; Whiting, D S

    1977-01-01

    The enterotoxin of Shigella dysenteriae I produces fluid and electrolyte secretion in the rabbit ileum. These present studies were designed to evaluate nonelectrolyte transport in rabbit ileal mucosa exposed to Shigella enterotoxin. Both 10 mM galactose and 5 mM L-alanine absorptions were significantly impaired in enterotoxin-exposed ileal mucosa compared with control mucosa. L-Alanine influx was not imparied in two other secretory processes: that induced by cholera enterotoxin and hyperosmolarity. These studies provide evidence that both surgar and amino acid absorptions are diminished in the small intestine by the enterotoxin of S. dysenteriae I. PMID:324910

  15. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  16. Effects of Bacillus cereus var. toyoi as probiotic feed supplement on intestinal transport and barrier function in piglets.

    PubMed

    Lodemann, Ulrike; Lorenz, Barbara Martha; Weyrauch, Karl Dietrich; Martens, Holger

    2008-04-01

    The objective of the study was to assess the effects of feed supplementation with the probiotic Bacillus cereus var. toyoi on transport and barrier properties of pig jejunum. Sows and their respective piglets were randomly assigned to two feeding groups: a control group and a probiotic group in which the standard diet was supplemented with Bacillus cereus var. toyoi. At the age of 14, 28, 35 and 56 days, 5 piglets per subgroup were killed and tissue samples from the mid jejunum were mounted in conventional Ussing chambers. Absorptive and secretory properties of the jejunum epithelia were assessed by stimulation of Na-coupled glucose and L-glutamine transport and stimulation of ion secretion by PGE2. Kinetic parameters maximal transport velocity (Vmax) and Michaelis Menten constant (Km) were calculated for glucose and PGE2-stimulated ion secretion. Mannitol fluxes and tissue resistance were measured to evaluate barrier function. With respect to absorption, glucose transport was not changed by treatment and only a slightly higher L-glutamine transport was observed in the probiotic group compared with the control group. The PGE2-stimulated the short circuit current (DeltaIsc) in the small intestine and Vmax were higher in the probiotic group at days 28 and 35 compared with the control group. The probiotic seems to have a stabilising (decreasing) effect on the variability of the data. Changes of absorptive and secretory transport properties dependent on age were observed.

  17. The H2 receptor antagonist nizatidine is a P-glycoprotein substrate: characterization of its intestinal epithelial cell efflux transport.

    PubMed

    Dahan, Arik; Sabit, Hairat; Amidon, Gordon L

    2009-06-01

    The aim of this study was to elucidate the intestinal epithelial cell efflux transport processes that are involved in the intestinal transport of the H(2) receptor antagonist nizatidine. The intestinal epithelial efflux transport mechanisms of nizatidine were investigated and characterized across Caco-2 cell monolayers, in the concentration range 0.05-10 mM in both apical-basolateral (AP-BL) and BL-AP directions, and the transport constants of P-glycoprotein (P-gp) efflux activity were calculated. The concentration-dependent effects of various P-gp (verapamil, quinidine, erythromycin, ketoconazole, and cyclosporine A), multidrug resistant-associated protein 2 (MRP2; MK-571, probenecid, indomethacin, and p-aminohipuric acid), and breast cancer resistance protein (BCRP; Fumitremorgin C) inhibitors on nizatidine bidirectional transport were examined. Nizatidine exhibited 7.7-fold higher BL-AP than AP-BL Caco-2 permeability, indicative of net mucosal secretion. All P-gp inhibitors investigated displayed concentration-dependent inhibition on nizatidine secretion in both directions. The IC(50) of verapamil on nizatidine P-gp secretion was 1.2 x 10(-2) mM. In the absence of inhibitors, nizatidine displayed concentration-dependent secretion, with one saturable (J(max) = 5.7 x 10(-3) nmol cm(-2) s(-1) and K(m) = 2.2 mM) and one nonsaturable component (K(d) = 7 x 10(-4) microL cm(-2) s(-1)). Under complete P-gp inhibition, nizatidine exhibited linear secretory flux, with a slope similar to the nonsaturable component. V(max) and K(m) estimated for nizatidine P-gp-mediated secretion were 4 x 10(-3) nmol cm(-2) s(-1) and 1.2 mM, respectively. No effect was obtained with the MRP2 or the BCRP inhibitors. Being a drug commonly used in pediatrics, adults, and elderly, nizatidine susceptibility to efflux transport by P-gp revealed in this paper may be of significance in its absorption, distribution, and clearance, as well as possible drug-drug interactions.

  18. Enhanced uptake and transport of (+)-catechin and (-)-epigallocatechin gallate in niosomal formulation by human intestinal Caco-2 cells.

    PubMed

    Song, Qinxin; Li, Danhui; Zhou, Yongzhi; Yang, Jie; Yang, Wanqi; Zhou, Guohua; Wen, Jingyuan

    2014-01-01

    The aim of this study was to evaluate (+)-catechin and (-)-epigallocatechin gallate (EGCG) cellular uptake and transport across human intestinal Caco-2 cell monolayer in both the absence and presence of niosomal carrier in variable conditions. The effect of free drugs and drug-loaded niosomes on the growth of Caco-2 cells was studied. The effects of time, temperature, and concentration on drug cellular uptake in the absence or presence of its niosomal delivery systems were investigated. The intestinal epithelial membrane transport of the drug-loaded niosomes was examined using the monolayer of the human Caco-2 cells. The kinetics of transport, and the effect of temperature, adenosine triphosphate inhibitor, permeability glycoprotein inhibitor, multidrug resistance-associated protein 2 inhibitor, and the absorption enhancer on transport mechanism were investigated. It was found that the uptake of catechin, EGCG, and their niosomes by Caco-2 cells was 1.22 ± 0.16, 0.90 ± 0.14, 3.25 ± 0.37, and 1.92 ± 0.22 μg/mg protein, respectively (n=3). The apparent permeability coefficient values of catechin, EGCG, and their niosomes were 1.68 ± 0.16, 0.88 ± 0.09, 2.39 ± 0.31, and 1.42 ± 0.24 cm/second (n=3) at 37°C, respectively. The transport was temperature- and energy-dependent. The inhibitors of permeability glycoprotein and multidrug resistance-associated protein 2 and the absorption enhancer significantly enhanced the uptake amount. Compared with the free drugs, niosomal formulation significantly enhanced drug absorption. Additionally, drug-loaded niosomes exhibited stronger stability and lower toxicity. These findings showed that the oral absorption of tea flavonoids could be improved by using the novel drug delivery systems.

  19. Combined treatment with dipeptidyl peptidase 4 (DPP4) inhibitor sitagliptin and elemental diets reduced indomethacin-induced intestinal injury in rats via the increase of mucosal glucagon-like peptide-2 concentration

    PubMed Central

    Fujiwara, Kaori; Inoue, Takuya; Yorifuji, Naoki; Iguchi, Munetaka; Sakanaka, Taisuke; Narabayashi, Ken; Kakimoto, Kazuki; Nouda, Sadaharu; Okada, Toshihiko; Ishida, Kumi; Abe, Yosuke; Masuda, Daisuke; Takeuchi, Toshihisa; Fukunishi, Shinya; Umegaki, Eiji; Akiba, Yasutada; Kaunitz, Jonathan D.; Higuchi, Kazuhide

    2015-01-01

    The gut incretin glucagon-like peptide-1 (GLP-1) and the intestinotropic hormone GLP-2 are released from enteroendocrine L cells in response to ingested nutrients. Treatment with an exogenous GLP-2 analogue increases intestinal villous mass and prevents intestinal injury. Since GLP-2 is rapidly degraded by dipeptidyl peptidase 4 (DPP4), DPP4 inhibition may be an effective treatment for intestinal ulcers. We measured mRNA expression and DPP enzymatic activity in intestinal segments. Mucosal DPP activity and GLP concentrations were measured after administration of the DPP4 inhibitor sitagliptin (STG). Small intestinal ulcers were induced by indomethacin (IM) injection. STG was given before IM treatment, or orally administered after IM treatment with or without an elemental diet (ED). DPP4 mRNA expression and enzymatic activity were high in the jejunum and ileum. STG dose-dependently suppressed ileal mucosal enzyme activity. Treatment with STG prior to IM reduced small intestinal ulcer scores. Combined treatment with STG and ED accelerated intestinal ulcer healing, accompanied by increased mucosal GLP-2 concentrations. The reduction of ulcers by ED and STG was reversed by co-administration of the GLP-2 receptor antagonist. DPP4 inhibition combined with luminal nutrients, which up-regulate mucosal concentrations of GLP-2, may be an effective therapy for the treatment of small intestinal ulcers. PMID:25759522

  20. Contributions of different NaPi cotransporter isoforms to dietary regulation of P transport in the pyloric caeca and intestine of rainbow trout.

    PubMed

    Sugiura, Shozo H; Ferraris, Ronaldo P

    2004-05-01

    The anatomical proximity and embryological relationship of the pyloric caeca (PC) and small intestine of rainbow trout has led to the frequent assumption, on little evidence, that they have the same enzymes and transporters. In trout, the PC is an important absorptive organ for dietary nutrients, but its role in dietary P absorption has not been reported. We found that apical inorganic phosphate (Pi) transport in PC comprises carrier-mediated and diffusive components. Carrier-mediated uptake was energy- and temperature-dependent, competitively inhibited and Na(+)-independent, and greater than the Na(+)-dependent intestinal uptake. Pi uptake in PC was pH-sensitive in the presence of Na(+). Despite the active Pi transport system in PC, high postprandial luminal Pi concentrations ( approximately 20 mmol l(-1)) indicate that diffusive uptake represents approximately 92% of total Pi uptake in PC of fed fish. The nucleotide sequence of a sodium-phosphate cotransporter (NaPi-II) isoform isolated from PC was approximately 8% different from the intestinal NaPi cotransporter. PC-NaPi mRNA was abundant in PC but rare in the intestine, whereas intestinal NaPi mRNA was abundant in the intestine but scarce in PC. Dietary P restriction reduced serum and bone P concentrations, increased intestine-type, but not PC-type, NaPi mRNA in PC, and increased Pi uptake in intestine but not in PC. Intestine-type NaPi expression may be useful for predicting dietary P deficiency.

  1. Mechanisms of nanoparticle internalization and transport across an intestinal epithelial cell model: effect of size and surface charge.

    PubMed

    Bannunah, Azzah M; Vllasaliu, Driton; Lord, Jennie; Stolnik, Snjezana

    2014-12-01

    This study investigated the effect of nanoparticle size (50 and 100 nm) and surface charge on their interaction with Caco-2 monolayers as a model of the intestinal epithelium, including cell internalization pathways and the level of transepithelial transport. Initially, toxicity assays showed that cell viability and cell membrane integrity were dependent on the surface charge and applied mass, number, and total surface area of nanoparticles, as tested in two epithelial cell lines, colon carcinoma Caco-2 and airway Calu-3. This also identified suitable nanoparticle concentrations for subsequent cell uptake experiments. Nanoparticle application at doses below half maximal effective concentration (EC₅₀) revealed that the transport efficiency (ratio of transport to cell uptake) across Caco-2 cell monolayers is significantly higher for negatively charged nanoparticles compared to their positively charged counterparts (of similar size), despite the higher level of internalization of positively charged systems. Cell internalization pathways were hence probed using a panel of pharmacological inhibitors aiming to establish whether the discrepancy in transport efficiency is due to different uptake and transport pathways. Vesicular trans-monolayer transport for both positively and negatively charged nanoparticles was confirmed via inhibition of dynamin (by dynasore) and microtubule network (via nocodazole), which significantly reduced the transport of both nanoparticle systems. For positively charged nanoparticles a significant decrease in internalization and transport (46% and 37%, respectively) occurred in the presence of a clathrin pathway inhibitor (chlorpromazine), macropinocytosis inhibition (42%; achieved by 5-(N-ethyl-N-isopropyi)-amiloride), and under cholesterol depletion (38%; via methyl-β-cyclodextrin), but remained unaffected by the inhibition of lipid raft associated uptake (caveolae) by genistein. On the contrary, the most prominent reduction in

  2. Monocytes from Sjögren's syndrome patients display increased vasoactive intestinal peptide receptor 2 expression and impaired apoptotic cell phagocytosis

    PubMed Central

    Hauk, V; Fraccaroli, L; Grasso, E; Eimon, A; Ramhorst, R; Hubscher, O; Pérez Leirós, C

    2014-01-01

    Sjögren's syndrome (SS) is a chronic autoimmune disease characterized by salivary and lacrimal gland dysfunction. Clinical observations and results from animal models of SS support the role of aberrant epithelial cell apoptosis and immune homeostasis loss in the glands as triggering factors for the autoimmune response. Vasoactive intestinal peptide (VIP) promotes potent anti-inflammatory effects in several inflammatory and autoimmune disease models, including the non-obese diabetic (NOD) mouse model of SS. With the knowledge that VIP modulates monocyte function through vasoactive intestinal peptide receptors (VPAC) and that immune homeostasis maintenance depends strongly upon a rapid and immunosuppressant apoptotic cell clearance by monocytes/macrophages, in this study we explored VPAC expression on monocytes from primary SS (pSS) patients and the ability of VIP to modulate apoptotic cell phagocytic function and cytokine profile. Monocytes isolated from individual pSS patients showed an increased expression of VPAC2 subtype of VIP receptors, absent in monocytes from control subjects, with no changes in VPAC1 expression. VPAC2 receptor expression could be induced further with lipopolysaccharide (LPS) in pSS monocytes and VIP inhibited the effect. Moreover, monocytes from pSS patients showed an impaired phagocytosis of apoptotic epithelial cells, as evidenced by reduced engulfment ability and the failure to promote an immunosuppressant cytokine profile. However, VIP neither modulated monocyte/macrophage phagocytic function nor did it reverse their inflammatory profile. We conclude that monocytes from pSS patients express high levels of VPAC2 and display a deficient clearance of apoptotic cells that is not modulated by VIP. PMID:24827637

  3. Annexin II binds progastrin and gastrin-like peptides, and mediates growth factor effects of autocrine and exogenous gastrins on colon cancer and intestinal epithelial cells.

    PubMed

    Singh, P; Wu, H; Clark, C; Owlia, A

    2007-01-18

    We and others have reported the presence of novel progastrin (PG)/gastrin receptors on normal and cancerous intestinal cells. We had earlier reported the presence of 33-36 kDa gastrin-binding proteins on cellular membranes of colon cancer cells. The goal of the current study was to identify the protein(s) in the 33-36 kDa band, and analyse its functional significance. A carbodiimide crosslinker was used for crosslinking radio-labeled gastrins to membrane proteins from gastrin/PG responsive cell lines. Native membrane proteins, crosslinked to the ligand, were solubulized and enriched by >1000-fold, and analysed by surface-enhanced laser desorption/ionization-time of flight-mass spectrometry. The peptide masses were researched against the NCBInr database using the ProFound search engine. Annexin II (ANX II) was identified, and confirmed by matrix-assisted laser desorption/ionization-time of flight-mass spectrometry. As HCT-116 cells express autocrine PG, the in situ association of PG with ANX II was demonstrated in pulldown assays. Direct binding of PG with ANX II was confirmed in an in vitro binding assay. In order to confirm a functional importance of these observations, sense and anti-sense (AS) ANX II RNA-expressing clones of intestinal epithelial (IEC-18) and human colon cancer (HCT-116) cell lines were generated. AS clones demonstrated a significant loss in the growth response to exogenous (IEC-18) and autocrine (HCT-116) PG. We have thus discovered that membrane-associated ANX II binds PG/gastrins, and partially mediates growth factor effects of the peptides.

  4. Fatty Acid-Binding Protein in Small Intestine IDENTIFICATION, ISOLATION, AND EVIDENCE FOR ITS ROLE IN CELLULAR FATTY ACID TRANSPORT

    PubMed Central

    Ockner, Robert K.; Manning, Joan A.

    1974-01-01

    A soluble fatty acid-binding protein (FABP), mol wt ∼ 12,000 is present in intestinal mucosa and other tissues that utilize fatty acids, including liver, myocardium, adipose, and kidney. This protein binds long chain fatty acids both in vivo and in vitro. FABP was isolated from rat intestine by gel filtration and isoelectric focusing. It showed a reaction of complete immunochemical identity with proteins in the 12,000 mol wt fatty acid-binding fractions of liver, myocardium, and adipose tissue supernates. (The presence of immunochemically nonidentical 12,000 mol wt FABP in these tissues is not excluded.) By quantitative radial immunodiffusion, supernatant FABP concentration in mucosa from proximal and middle thirds of jejuno-ileum significantly exceeded that in distal third, duodenum, and liver, expressed as micrograms per milligram soluble protein, micrograms per gram DNA, and micrograms per gram tissue. FABP concentration in villi was approximately three times greater than in crypts. Small quantities of FABP were present in washed nuclei-cell membrane, mitochondrial and microsomal fractions. However, the amount of FABP solubilized per milligram membrane protein was similar for all particulate fractions, and total membrane-associated FABP was only about 16% of supernatant FABP. Intestinal FABP concentration was significantly greater in animals maintained on high fat diets than on low fat; saturated and unsaturated fat diets did not differ greatly in this regard. The preponderance of FABP in villi from proximal and middle intestine, its ability to bind fatty acids in vivo as well as in vitro, and its response to changes in dietary fat intake support the concept that this protein participates in cellular fatty acid transport during fat absorption. Identical or closely related 12,000 mol wt proteins may serve similar functions in other tissues. Images PMID:4211161

  5. Mimicking cellular transport mechanism in stem cells through endosomal escape of new peptide-coated quantum dots

    NASA Astrophysics Data System (ADS)

    Narayanan, Karthikeyan; Yen, Swee Kuan; Dou, Qingqing; Padmanabhan, Parasuraman; Sudhaharan, Thankiah; Ahmed, Sohail; Ying, Jackie Y.; Selvan, Subramanian Tamil

    2013-07-01

    Protein transport is an important phenomenon in biological systems. Proteins are transported via several mechanisms to reach their destined compartment of cell for its complete function. One such mechanism is the microtubule mediated protein transport. Up to now, there are no reports on synthetic systems mimicking the biological protein transport mechanism. Here we report a highly efficient method of mimicking the microtubule mediated protein transport using newly designed biotinylated peptides encompassing a microtubule-associated sequence (MTAS) and a nuclear localization signaling (NLS) sequence, and their final conjugation with streptavidin-coated CdSe/ZnS quantum dots (QDs). Our results demonstrate that these novel bio-conjugated QDs enhance the endosomal escape and promote targeted delivery into the nucleus of human mesenchymal stem cells via microtubules. Mimicking the cellular transport mechanism in stem cells is highly desirable for diagnostics, targeting and therapeutic applications, opening up new avenues in the area of drug delivery.

  6. DLL4 promotes continuous adult intestinal lacteal regeneration and dietary fat transport

    PubMed Central

    Bernier-Latmani, Jeremiah; Cisarovsky, Christophe; Demir, Cansaran Saygili; Bruand, Marine; Jaquet, Muriel; Davanture, Suzel; Ragusa, Simone; Siegert, Stefanie; Dormond, Olivier; Benedito, Rui; Radtke, Freddy; Luther, Sanjiv A.; Petrova, Tatiana V.

    2015-01-01

    The small intestine is a dynamic and complex organ that is characterized by constant epithelium turnover and crosstalk among various cell types and the microbiota. Lymphatic capillaries of the small intestine, called lacteals, play key roles in dietary fat absorption and the gut immune response; however, little is known about the molecular regulation of lacteal function. Here, we performed a high-resolution analysis of the small intestinal stroma and determined that lacteals reside in a permanent regenerative, proliferative state that is distinct from embryonic lymphangiogenesis or quiescent lymphatic vessels observed in other tissues. We further demonstrated that this continuous regeneration process is mediated by Notch signaling and that the expression of the Notch ligand delta-like 4 (DLL4) in lacteals requires activation of VEGFR3 and VEGFR2. Moreover, genetic inactivation of Dll4 in lymphatic endothelial cells led to lacteal regression and impaired dietary fat uptake. We propose that such a slow lymphatic regeneration mode is necessary to match a unique need of intestinal lymphatic vessels for both continuous maintenance, due to the constant exposure to dietary fat and mechanical strain, and efficient uptake of fat and immune cells. Our work reveals how lymphatic vessel responses are shaped by tissue specialization and uncover a role for continuous DLL4 signaling in the function of adult lymphatic vasculature. PMID:26529256

  7. A stereological evaluation of secretin and gastric inhibitory peptide-containing mucosal cells of the perinatal small intestine of the pig.

    PubMed

    Van Ginneken, C; Weyns, A

    2004-10-01

    Stereological methods were used to quantify secretin and gastric inhibitory peptide (GIP)-immunoreactivity (GIP-IR) in paraffin sections of the duodenum, jejunum and ileum of fetal and neonatal piglets. In addition, sections were processed for GLP-1-immunohistochemistry. The volume density of the tunica mucosa increased after birth, giving rise to a decreased volume density of the tela submucosa and tunica muscularis. Generally known region-specific morphological distinctions were reflected in differing volume densities of the various layers. The highest volume density of GIP-IR epithelial cells was observed in the jejunum of the neonate. In contrast, the volume density of secretin-IR epithelial cells was highest in the duodenum of both fetal and neonatal piglets. The volume occupied by GIP-IR and secretin-IR epithelial cells increased in the jejunum after birth. Additionally, ileal secretin-IR epithelial cells were more numerous in the neonatal piglet. In conclusion, the quantitative and qualitative presence of GIP-IR and secretin-IR epithelial cells agree with earlier reports of their presence and co-localization between GIP-IR and GLP-1-IR, in the pig small intestine. Furthermore, the differences suggest that age- and region-related functional demands are temporally and probably causally related with the morphological diversification of the intestine and its endocrine cells.

  8. Beta-endorphin chimeric peptides: Transport through the blood-brain barrier in vivo and cleavage of disulfide linkage by brain

    SciTech Connect

    Pardridge, W.M.; Triguero, D.; Buciak, J.L. )

    1990-02-01

    Water soluble peptides are normally not transported through the blood-brain barrier (BBB). Chimeric peptides may be transportable through the BBB and are formed by the covalent coupling of a nontransportable peptide to a transportable peptide vector, e.g. cationized albumin, using disulfide-based coupling reagents such as N-succinimidyl 3-(2-pyridyldithio(propionate)) (SPDP). The transcytosis of peptide into brain parenchyma, as opposed to vascular sequestration of blood-borne peptide, was quantified using an internal carotid artery perfusion/capillary depletion method. It is shown that (125I)beta-endorphin is not transported through the BBB, but is rapidly cleaved to free (125I) tyrosine via capillary peptidase. Therefore, chimeric peptide was prepared using (125I) (D-Ala2)beta-endorphin (DABE), owing to the resistance of this analogue to peptidase degradation. The (125I) DABE-cationized albumin chimeric peptide is shown to enter brain parenchyma at a rate comparable to that reported previously for unconjugated cationized albumin. When the (125I) DABE-cationized albumin chimeric peptide was incubated with rat brain homogenate at 37 C, the free (125I) DABE was liberated from the cationized albumin conjugate prior to its subsequent degradation into free (125I) tyrosine. Approximately 50% of the chimeric peptide was cleaved within 60 sec of incubation at 37 C. These studies demonstrate that (1) (125I)beta-endorphin is not transported through the BBB in its unconjugated form, (2) a (125I) DABE-cationized albumin chimeric peptide is transported through the BBB into brain parenchyma at a rate comparable to the unconjugated cationized albumin, and (3) brain contains the necessary disulfide reductases for rapid cleavage of the chimeric peptide into free beta-endorphin and this cleavage occurs before degradation of the (125I) DABE into (125I) tyrosine.

  9. Short Bowel Patients Treated for Two Years with Glucagon-Like Peptide 2: Effects on Intestinal Morphology and Absorption, Renal Function, Bone and Body Composition, and Muscle Function

    PubMed Central

    Jeppesen, P. B.; Lund, P.; Gottschalck, I. B.; Nielsen, H. B.; Holst, J. J.; Mortensen, J.; Poulsen, S. S.; Quistorff, B.; Mortensen, P. B.

    2009-01-01

    Background and aims. In a short-term study, Glucagon-like peptide 2 (GLP-2) has been shown to improve intestinal absorption in short bowel syndrome (SBS) patients. This study describes longitudinal changes in relation to GLP-2 treatment for two years. Methods. GLP-2, 400 micrograms, s.c.,TID, were offered, to eleven SBS patients keeping parenteral support constant. 72-hour nutritional balance studies were performed at baseline, weeks 13, 26, 52 during two years intermitted by an 8-week washout period. In addition, mucosal morphometrics, renal function (by creatinine clearance), body composition and bone mineral density (by DEXA), biochemical markers of bone turnover (by s-CTX and osteocalcin, PTH and vitamin D), and muscle function (NMR, lungfunction, exercise test) were measured. Results. GLP-2 compliance was >93%. Three of eleven patients did not complete the study. In the remaining 8 patients, GLP-2 significantly reduced the fecal wet weight from approximately 3.0 to approximately 2.0 kg/day. This was accompanied by a decline in the oral wet weight intake, maintaining intestinal wet weight absorption and urinary weight constant. Renal function improved. No significant changes were demonstrated in energy intake or absorption, and GLP-2 did not significantly affect mucosal morphology, body composition, bone mineral density or muscle function. Conclusions. GLP-2 treatment reduces fecal weight by approximately 1000 g/d and enables SBS patients to maintain their intestinal fluid and electrolyte absorption at lower oral intakes. This was accompanied by a 28% improvement in creatinine clearance. PMID:19707516

  10. Kinetic analysis of hexose transport to determine the mechanism of amygdalin and prunasin absorption in the intestine.

    PubMed

    Wagner, Brent; Galey, William R

    2003-01-01

    Evidence is accumulating that glucose-conjugated compounds may be carried across the gut mucosa via the epithelial sodium-dependent monosaccharide transporter SGLT1. A modification of the everted intestinal sac technique was utilized to study the transport of the cyanogenic glycoside amygdalin (D-mandelonitrile beta-D-gentiobioside) and its metabolite D-mandelontrile beta-D-glucoside (prunasin). Everted sacs of rat jejunum and ileum were bathed in isotonic oxygenated sodium chloride-potassium phosphate buffer containing 2.8 microCi D-[(3)H]-mannose and 0.187 microCi D-[(14)C]-glucose. For treatment groups, buffers contained phloridzin, galactose, amygdalin or prunasin. The rate constant (k) for the transport process was calculated. Compared with the control (n = 33), phloridzin (n = 25) significantly reduced the rate constants of both D-[(14)C]-glucose and D-[(3)H]-mannose. Substitution of sodium with choline and incremental galactose treatments similarly reduced D-[(14)C]-glucose influx, indicating that a fraction of the transport is carrier-mediated. Treatment with amygdalin did not significantly affect the rate constants of D-[(14)C]-glucose or D-[(3)H]-mannose transport. However, treatment with 1 mM prunasin (n = 16) did reduce the influx of D-[(14)C]-glucose without affecting D-[(3)H]-mannose values. This is consistent with the reports finding that glycoside absorption may be mediated by SGLT1.

  11. Unique uptake and transport of isoflavone aglycones by human intestinal caco-2 cells: comparison of isoflavonoids and flavonoids.

    PubMed

    Murota, Kaeko; Shimizu, Sumie; Miyamoto, Sayuri; Izumi, Toru; Obata, Akio; Kikuchi, Mamoru; Terao, Junji

    2002-07-01

    Soy isoflavonoids have attracted much attention because of their estrogenic activity. To study the intestinal absorption of the isoflavonoids, we investigated the cellular uptake and metabolism of genistein and daidzein and their glucosides, genistin and daidzin, by Caco-2 cell monolayers as a model of the human intestinal epithelium. When Caco-2 monolayers were incubated with genistein or daidzein at 10 micromol/L from the apical (mucosal) side, aglycone was lost from the apical solution for 2.0 h (P < 0.05) and the glucuronide/sulfates appeared at the level of 1-2 micromol/L. In the basolateral (serosal) solution, both intact aglycones and their glucuronide/sulfates increased (P < 0.05) with time and reached approximately 20 and 15% of the initial dose, respectively. The transport of their glucosides, genistin and daidzin, through Caco-2 monolayers was less than one tenth that of the aglycones. The cellular metabolism of genistein was compared with quercetin, kaempferol, luteolin and apigenin. Only genistein aglycone was transported intact to the basolateral solution. Transport was greater (P < 0.05) than that of flavonoid aglycones and was without an appreciable decrease of transepithelial resistance. Radical scavenging activity was not related to the susceptibility to conjugation of flavonoids/isoflavonoids. Affinity to the liposomal membrane was increased in the order of genistin = daidzin < daidzein < genistein < flavonoid aglycones. These results strongly suggest that isoflavone aglycones are taken up into enterocytes more efficiently than their glucosides because of their moderate lipophilicity. Furthermore, they are generally transported to the basolateral side in intact form in contrast to flavonoids, probably due to their unique isoflavonoid structure.

  12. Effects of Enterococcus faecium NCIMB 10415 as probiotic supplement on intestinal transport and barrier function of piglets.

    PubMed

    Lodemann, Ulrike; Hübener, Katrin; Jansen, Nicole; Martens, Holger

    2006-02-01

    Many studies report positive effects of probiotic supplementation on the performance and health of piglets. The intention of this study was to describe the effects of Enterococcus faecium NCIMB 10415 on the transport and barrier functions of pig small intestine to improve our understanding of the underlying mechanisms of this probiotic. Ussing chamber studies were conducted with isolated jejunal epithelia of piglets at the age of 14, 28, 35 and 56 days. Jejunal tissues of the control group were compared with epithelia of piglets that had received a diet supplemented with the probiotic Enterococcus faecium NCIMB 10415. Transport properties (absorption and secretion) of the epithelia were examined by mucosal addition of glucose or L-glutamine or by serosal addition of PGE2. Electrophysiology of the epithelia was continuously recorded and the change in short circuit current (Isc) was determined. Paracellular permeability was measured by measuring the flux rates of mannitol. The increase of Isc caused by mucosal addition of glucose was, at all glucose concentrations, higher in the probiotic group compared with the control group. However, the difference (up to 100% of the control) was not significant. The increase of Isc after the mucosal addition of L-glutamine (12mmol/l) was higher in the tissues of the probiotic group but did not reach significance. Serosal PGE2 induced a significantly higher increase of Isc in tissues of the probiotic group at the age of 28 days. No consistent differences were observed in mannitol transport rates between the feeding groups. Significant age-dependent alterations of absorptive and secretory properties of the jejunal epithelium were observed; these were independent of the treatment. A probiotic supplementation seems to influence transport properties of small intestine epithelium. The increased absorption of glucose could be interpreted as a positive effect for the animal.

  13. Loss of organic anion transporting polypeptide 1a1 increases deoxycholic acid absorption in mice by increasing intestinal permeability.

    PubMed

    Zhang, Youcai; Csanaky, Iván L; Lehman-McKeeman, Lois D; Klaassen, Curtis D

    2011-12-01

    Deoxycholic acid (DCA) is a known hepatotoxicant, a tissue tumor promoter, and has been implicated in colorectal cancer. Male mice are more susceptible to DCA toxicity than female mice. Organic anion transporting polypeptide 1a1 (Oatp1a1), which is known to transport bile acids (BAs) in vitro, is predominantly expressed in livers of male mice. In addition, the concentrations of DCA and its taurine conjugate (TDCA) are increased in serum of Oatp1a1-null mice. To investigate whether Oatp1a1 contributes to the gender difference in DCA toxicity in mice, wild-type (WT) and Oatp1a1-null mice were fed a 0.3% DCA diet for 7 days. After feeding DCA, Oatp1a1-null mice had 30-fold higher concentrations of DCA in both serum and livers than WT mice. Feeding DCA caused more hepatotoxcity in Oatp1a1-null mice than WT mice. After feeding DCA, Oatp1a1-null mice expressed higher BA efflux-transporters (bile salt-export pump, organic solute transporter (Ost)α/β, and multidrug resistance-associated protein [Mrp]2) and lower BA-synthetic enzymes (cytochrome P450 [Cyp]7a1, 8b1, 27a1, and 7b1) in livers than WT mice. Intravenous administration of DCA and TDCA showed that lack of Oatp1a1 does not decrease the plasma elimination of DCA or TDCA. After feeding DCA, the concentrations of DCA in ileum and colon tissues are higher in Oatp1a1-null than in WT mice. In addition, Oatp1a1-null mice have enhanced intestinal permeability. Taken together, the current data suggest that Oatp1a1 does not mediate the hepatic uptake of DCA or TDCA, but lack of Oatp1a1 increases intestinal permeability and thus enhances the absorption of DCA in mice.

  14. Loss of Organic Anion Transporting Polypeptide 1a1 Increases Deoxycholic Acid Absorption in Mice by Increasing Intestinal Permeability

    PubMed Central

    Zhang, Youcai; Csanaky, Iván L.; Lehman-McKeeman, Lois D.; Klaassen, Curtis D.

    2011-01-01

    Deoxycholic acid (DCA) is a known hepatotoxicant, a tissue tumor promoter, and has been implicated in colorectal cancer. Male mice are more susceptible to DCA toxicity than female mice. Organic anion transporting polypeptide 1a1 (Oatp1a1), which is known to transport bile acids (BAs) in vitro, is predominantly expressed in livers of male mice. In addition, the concentrations of DCA and its taurine conjugate (TDCA) are increased in serum of Oatp1a1-null mice. To investigate whether Oatp1a1 contributes to the gender difference in DCA toxicity in mice, wild-type (WT) and Oatp1a1-null mice were fed a 0.3% DCA diet for 7 days. After feeding DCA, Oatp1a1-null mice had 30-fold higher concentrations of DCA in both serum and livers than WT mice. Feeding DCA caused more hepatotoxcity in Oatp1a1-null mice than WT mice. After feeding DCA, Oatp1a1-null mice expressed higher BA efflux-transporters (bile salt-export pump, organic solute transporter (Ost)α/β, and multidrug resistance-associated protein [Mrp]2) and lower BA-synthetic enzymes (cytochrome P450 [Cyp]7a1, 8b1, 27a1, and 7b1) in livers than WT mice. Intravenous administration of DCA and TDCA showed that lack of Oatp1a1 does not decrease the plasma elimination of DCA or TDCA. After feeding DCA, the concentrations of DCA in ileum and colon tissues are higher in Oatp1a1-null than in WT mice. In addition, Oatp1a1-null mice have enhanced intestinal permeability. Taken together, the current data suggest that Oatp1a1 does not mediate the hepatic uptake of DCA or TDCA, but lack of Oatp1a1 increases intestinal permeability and thus enhances the absorption of DCA in mice. PMID:21914718

  15. In-Situ-Generated Vasoactive Intestinal Peptide Loaded Microspheres in Mussel-Inspired Polycaprolactone Nanosheets Creating Spatiotemporal Releasing Microenvironment to Promote Wound Healing and Angiogenesis.

    PubMed

    Wang, Yuzhen; Chen, Zhiqiang; Luo, Gaoxing; He, Weifeng; Xu, Kaige; Xu, Rui; Lei, Qiang; Tan, Jianglin; Wu, Jun; Xing, Malcolm

    2016-03-23

    Vasoactive intestinal peptide (VIP) was reported to promote angiogenesis. Electrospun nanofibers lead to idea wound dressing substrates. Here we report a convenient and novel method to produce VIP loaded microspheres in polycaprolactone (PCL) nanofibrous membrane without complicated processes. We first coated mussel-inspired dopamine (DA) to nanofibers, then used strong adhesive DA to absorb the functional peptide. PCL membrane was then immersed into acetone to generate microspheres with VIP loading. We employed high pressure liquid chromatography to record encapsulation efficiency of (31.8 ± 2.2)% and loading capacity of (1.71 ± 0.16)%. The release profile of VIP from nanosheets showed a prolonged release. The results of laser scanning confocal microscope, scanning electron microscope and cell counting kit-8 proliferation assays showed that cell adhesion and proliferation were promoted. In order to verify the efficacy on wound healing, in vivo implantation was applied in the full-thickness defect wounds of BALB/c mice. Results showed that the wound healing was significantly promoted via favoring the growth of granulation tissue and angiogenesis. However, we found wound re-epithelialization was not significantly improved. The resulting VIP-DA-coated PCL (PCL-DA-VIP) nanosheets with spatiotemporal delivery of VIP could be a potential application in wound treatment and vascular tissue engineering.

  16. VPAC2 (vasoactive intestinal peptide receptor type 2) receptor deficient mice develop exacerbated experimental autoimmune encephalomyelitis with increased Th1/Th17 and reduced Th2/Treg responses.

    PubMed

    Tan, Yossan-Var; Abad, Catalina; Wang, Yuqi; Lopez, Robert; Waschek, James A

    2015-02-01

    Vasoactive intestinal peptide (VIP) and pituitary adenylyl cyclase-activating polypeptide (PACAP) are two structurally-related neuropeptides with widespread expression in the central and peripheral nervous systems. Although these peptides have been repeatedly shown to exert potent anti-inflammatory actions when administered in animal models of inflammatory disease, mice deficient in VIP and PACAP were recently shown to exhibit different phenotypes (ameliorated and exacerbated, respectively) in response to experimental autoimmune encephalomyelitis (EAE). Therefore, elucidating what are the specific immunoregulatory roles played by each of their receptor subtypes (VPAC1, VPAC2, and PAC1) is critical. In this study, we found that mice with a genetic deletion of VIPR2, encoding the VPAC2 receptor, exhibited exacerbated (MOG35-55)-induced EAE compared to wild type mice, characterized by enhanced clinical and histopathological features, increased proinflammatory cytokines (TNF-α, IL-6, IFN-γ (Th1), and IL-17 (Th17)) and reduced anti-inflammatory cytokines (IL-10, TGFβ, and IL-4 (Th2)) in the CNS and lymph nodes. Moreover, the abundance and proliferative index of lymph node, thymus and CNS CD4(+)CD25(+)FoxP3(+) Tregs were strikingly reduced in VPAC2-deficient mice with EAE. Finally, the in vitro suppressive activity of lymph node and splenic Tregs from VPAC2-deficient mice was impaired. Overall, our results demonstrate critical protective roles for PACAP and the VPAC2 receptor against autoimmunity, promoting the expansion and maintenance of the Treg pool.

  17. Experimental Cancer Cachexia Changes Neuron Numbers and Peptide Levels in the Intestine: Partial Protective Effects after Dietary Supplementation with L-Glutamine

    PubMed Central

    Vicentini, Geraldo E.; Fracaro, Luciane; de Souza, Sara R. G.; Martins, Heber A.; Guarnier, Flávia A.; Zanoni, Jacqueline N.

    2016-01-01

    Gastrointestinal dysmotility frequently occurs in cancer cachexia and may result from damage to enteric innervation caused by oxidative stress, especially due to glutathione depletion. We assessed the effect of dietary supplementation with 20 g/kg l-glutamine (a glutathione precursor) on the intrinsic innervation of the enteric nervous system in healthy and Walker 256 tumor-bearing Wistar rats during the development of experimental cachexia (14 days), in comparison with non-supplemented rats, by using immunohistochemical methods and Western blotting. The total neural population and cholinergic subpopulation densities in the myenteric plexus, as well as the total population and VIPergic subpopulation in the submucosal plexus of the jejunum and ileum, were reduced in cachectic rats, resulting in adaptive morphometric alterations and an increase in vasoactive intestinal peptide (VIP) and calcitonin gene-related peptide (CGRP) expression, suggesting a neuroplastic response. l-glutamine supplementation prevented decrease in myenteric neuronal density in the ileum, morphometric alterations in the neurons and nerve fibers (in both the plexuses of the jejunum and ileum), and the overexpression of VIP and CGRP. Cancer cachexia severely affected the intrinsic innervation of the jejunum and ileum to various degrees and this injury seems to be associated with adaptive neural plasticity. l-glutamine supplementation presented partial protective effects on the enteric innervation against cancer cachexia, possibly by attenuating oxidative stress. PMID:27635657

  18. Protected Graft Copolymer Excipient Leads to a Higher Acute Maximum Tolerated Dose and Extends Residence Time of Vasoactive Intestinal Peptide Significantly Better than Sterically Stabilized Micelles

    PubMed Central

    Reichstetter, Sandra; Castillo, Gerardo M.; Rubinstein, Israel; Nishimoto-Ashfield, Akiko; Lai, ManShun; Jones, Cynthia C.; Banjeree, Aryamitra; Lyubimov, Alex; Bloedow, Duane C.; Bogdanov, Alexei; Bolotin, Elijah M.

    2013-01-01

    Purpose To determine and compare pharmacokinetics and toxicity of two nanoformulations of Vasoactive Intestinal Peptide (VIP). Methods VIP was formulated using a micellar (Sterically Stabilized Micelles, SSM) and a polymer-based (Protected Graft Copolymer, PGC) nanocarrier at various loading percentages. VIP binding to the nanocarriers, pharmacokinetics, blood pressure, blood chemistry, and acute maximum tolerated dose (MTD) of the formulations after injection into BALB/c mice were determined. Results Both formulations significantly extend in vivo residence time compared to unformulated VIP. Formulation toxicity is dependent on loading percentage, showing major differences between the two carrier types. Both formulations increase in vivo potency of unformulated VIP and show acute MTDs at least 140 times lower than unformulated VIP, but still at least 100 times higher than the anticipated highest human dose, 1–5 μg/kg. These nanocarriers prevented a significant drop in arterial blood pressure compared to unformulated VIP. Conclusions While both carriers enhance in vivo residence time compared to unformulated VIP and reduce the drop in blood pressure immediately after injection, PGC is the excipient of choice to extend residence time and improve the safety of potent therapeutic peptides such as VIP. PMID:23224976

  19. Acute effects of the glucagon-like peptide 2 analogue, teduglutide, on intestinal adaptation in short bowel syndrome

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Neonatal short bowel syndrome following massive gut resection is associated with malabsorption of nutrients. The intestinotrophic factor glucagon-like peptide 2 (GLP-2) improves gut function in adult patients with short bowel syndrome, but its effect in pediatric patients remains unknown. Our object...

  20. Modulation of chicken intestinal immune gene expression by small cationic peptides as feed additives during the first week posthatch

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have been investigating modulation strategies tailored around the selective stimulation of the host’s immune system as an alternative to direct targeting of microbial pathogens by antibiotics. One such approach is the use of a group of small cationic peptides (BT) produced by a Gram-positive soi...

  1. In Vitro-In Vivo Extrapolation Scaling Factors for Intestinal P-Glycoprotein and Breast Cancer Resistance Protein: Part I: A Cross-Laboratory Comparison of Transporter-Protein Abundances and Relative Expression Factors in Human Intestine and Caco-2 Cells.

    PubMed

    Harwood, Matthew D; Achour, Brahim; Neuhoff, Sibylle; Russell, Matthew R; Carlson, Gordon; Warhurst, Geoffrey

    2016-03-01

    Over the last 5 years the quantification of transporter-protein absolute abundances has dramatically increased in parallel to the expanded use of in vitro-in vivo extrapolation (IVIVE) and physiologically based pharmacokinetics (PBPK)-linked models, for decision-making in pharmaceutical company drug development pipelines and regulatory submissions. Although several research groups have developed laboratory-specific proteomic workflows, it is unclear if the large range of reported variability is founded on true interindividual variability or experimental variability resulting from sample preparation or the proteomic methodology used. To assess the potential for methodological bias on end-point abundance quantification, two independent laboratories, the University of Manchester (UoM) and Bertin Pharma (BPh), employing different proteomic workflows, quantified the absolute abundances of Na/K-ATPase, P-gp, and breast cancer resistance protein (BCRP) in the same set of biologic samples from human intestinal and Caco-2 cell membranes. Across all samples, P-gp abundances were significantly correlated (P = 0.04, Rs = 0.72) with a 2.4-fold higher abundance (P = 0.001) generated at UoM compared with BPh. There was a systematically higher BCRP abundance in Caco-2 cell samples quantified by BPh compared with UoM, but not in human intestinal samples. Consequently, a similar intestinal relative expression factor (REF), derived from distal jejunum and Caco-2 monolayer samples, between laboratories was found for P-gp. However, a 2-fold higher intestinal REF was generated by UoM (2.22) versus BPh (1.11). We demonstrate that differences in absolute protein abundance are evident between laboratories and they probably result from laboratory-specific methodologies relating to peptide choice.

  2. Establishment and characterization of monoclonal and polyclonal antibodies against human intestinal fatty acid-binding protein (I-FABP) using synthetic regional peptides and recombinant I-FABP.

    PubMed

    Kajiura, Satoshi; Yashiki, Tetsuya; Funaoka, Hiroyuki; Ohkaru, Yasuhiko; Nishikura, Ken; Kanda, Tatsuo; Ajioka, Yoichi; Igarashi, Michihiro; Hatakeyama, Katsuyoshi; Fujii, Hiroshi

    2008-01-01

    We have succeeded in raising highly specific anti-human intestinal fatty acid-binding protein (I-FABP) monoclonal antibodies by immunizing animals with three synthetic regional peptides, i.e., the amino terminal (RP-1: N-acetylated 1-19-cysteine), middle portion (RP-2: cysteinyl-91-107) and carboxylic terminal (RP-3: cysteinyl-121-131) regions of human I-FABP, and the whole I-FABP molecule as antigens. We also raised a polyclonal antibody by immunizing with a recombinant (r) I-FABP. To ascertain the specificity of these antibodies for human I-FABP, the immunological reactivity of each was examined by a binding assay using rI-FABP, partially purified native I-FABP and related proteins such as liver-type (L)-FABP, heart-type (H)-FABP, as well as the regional peptides as reactants, and by Western blot analysis. In addition, the expression and distribution of I-FABP in the human gastrointestinal tract were investigated by an immunohistochemical technique using a carboxylic terminal region-specific monoclonal antibody, 8F9, and a polyclonal antibody, DN-R2. Our results indicated that both the monoclonal and polyclonal antibodies established in this study were highly specific for I-FABP, but not for L-FABP and H-FABP. Especially, the monoclonal antibodies raised against the regional peptides, showed regional specificity for the I-FABP molecule. Immunoreactivity of I-FABP was demonstrated in the mucosal epithelium of the jejunum and ileum by immunohistochemical staining, and the immunoreactivity was based on the presence of the whole I-FABP molecule but not the presence of any precursors or degradation products containing a carboxylic terminal fragment. It is concluded that some of these monoclonal and polyclonal antibodies, such as 8F9, 4205, and DN-R2, will be suitable for use in research on the immunochemistry and clinical chemistry of I-FABP because those antibodies can recognize both types of native and denatured I-FABP. In order to detect I-FABP in blood samples, it

  3. Rodent intestinal folate transporters (SLC46A1): secondary structure, functional properties, and response to dietary folate restriction.

    PubMed

    Qiu, Andong; Min, Sang Hee; Jansen, Michaela; Malhotra, Usha; Tsai, Eugenia; Cabelof, Diane C; Matherly, Larry H; Zhao, Rongbao; Akabas, Myles H; Goldman, I David

    2007-11-01

    This laboratory recently identified a human gene that encodes a novel folate transporter [Homo sapiens proton-coupled folate transporter (HsPCFT); SLC46A1] required for intestinal folate absorption. This study focused on mouse (Mus musculus) PCFT (MmPCFT) and rat (Rattus norvegicus) PCFT (RnPCFT) and addresses their secondary structure, specificity, tissue expression, and regulation by dietary folates. Both rodent PCFT proteins traffic to the cell membrane with the NH(2)- and COOH-termini accessible to antibodies targeted to these domains only in permeabilized HeLa cells. This, together with computer-based topological analyses, is consistent with a model in which rodent PCFT proteins likely contain 12 transmembrane domains. Transport of [(3)H]folates was optimal at pH 5.5 and decreased with increasing pH due to an increase in K(m) and a decrease in V(max). At pH 7.0, folic acid and methotrexate influx was negligible, but there was residual (6S)5-methyltetrahydrofolate transport. Uptake of folates in PCFT-injected Xenopus oocytes was electrogenic and pH dependent. Folic acid influx K(m) values of MmPCFT and RnPCFT, assessed electrophysiologically, were 0.7 and 0.3 microM at pH 5.5 and 1.1 and 0.8 microM at pH 6.5, respectively. Rodent PCFTs were highly specific for monoglutamyl but not polyglutamyl methotrexate. MmPCFT mRNA was highly expressed in the duodenum, proximal jejunum, liver, and kidney with lesser expression in the brain and other tissues. MmPCFT protein was localized to the apical brush-border membrane of the duodenum and proximal jejunum. MmPCFT mRNA levels increased approximately 13-fold in the proximal small intestine in mice fed a folate-deficient vesus folate-replete diet, consistent with the critical role that PCFT plays in intestinal folate absorption.

  4. A putative amino acid transporter determines sensitivity to the two-peptide bacteriocin plantaricin JK.

    PubMed

    Oppegård, Camilla; Kjos, Morten; Veening, Jan-Willem; Nissen-Meyer, Jon; Kristensen, Tom

    2016-08-01

    Lactobacillus plantarum produces a number of antimicrobial peptides (bacteriocins) that mostly target closely related bacteria. Although bacteriocins are important for the ecology of these bacteria, very little is known about how the peptides target sensitive cells. In this work, a putative membrane protein receptor of the two-peptide bacteriocin plantaricin JK was identified by comparing Illumina sequence reads from plantaricin JK-resistant mutants to a crude assembly of the sensitive wild-type Weissella viridescens genome using the polymorphism discovery tool VAAL. Ten resistant mutants harbored altogether seven independent mutations in a gene encoding an APC superfamily protein with 12 transmembrane helices. The APC superfamily transporter thus is likely to serve as a target for plantaricin JK on sensitive cells.

  5. High Levels of Dietary Supplement Vitamins A, C and E are Absorbed in the Small Intestine and Protect Nutrient Transport Against Chronic Gamma Irradiation

    PubMed Central

    Azzam, Edouard I.; Ferraris, Ronaldo P.; Howell, Roger W.

    2015-01-01

    We examined nutrient transport in the intestines of mice exposed to chronic low-LET 137Cs gamma rays. The mice were whole-body irradiated for 3 days at dose rates of 0, 0.13 and 0.20 Gy/h, for total dose delivery of 0, 9.6 or 14.4 Gy, respectively. The mice were fed either a control diet or a diet supplemented with high levels of vitamins A, C and E. Our results showed that nutrient transport was perturbed by the chronic irradiation conditions. However, no apparent alteration of the macroscopic intestinal structures of the small intestine were observed up to day 10 after initiating irradiation. Jejunal fructose uptake measured in vitro was strongly affected by the chronic irradiation, whereas uptake of proline, carnosine and the bile acid taurocholate in the ileum was less affected. D-glucose transport did not appear to be inhibited significantly by either 9.6 or 14.4 Gy exposure. In the 14.4 Gy irradiated groups, the diet supplemented with high levels of vitamins A, C and E increased intestinal transport of fructose compared to the control diet (day 10; t test, P = 0.032), which correlated with elevated levels of vitamins A, C and E in the plasma and jejunal enterocytes. Our earlier studies with mice exposed acutely to 137Cs gamma rays demonstrated significant protection for transport of fructose, glucose, proline and carnosine. Taken together, these results suggest that high levels of vitamins A, C and E dietary supplements help preserve intestinal nutrient transport when intestines are irradiated chronically or acutely with low-LET gamma rays. PMID:26484399

  6. High Levels of Dietary Supplement Vitamins A, C and E are Absorbed in the Small Intestine and Protect Nutrient Transport Against Chronic Gamma Irradiation.

    PubMed

    Roche, Marjolaine; Neti, Prasad V S V; Kemp, Francis W; Azzam, Edouard I; Ferraris, Ronaldo P; Howell, Roger W

    2015-11-01

    We examined nutrient transport in the intestines of mice exposed to chronic low-LET 137Cs gamma rays. The mice were whole-body irradiated for 3 days at dose rates of 0, 0.13 and 0.20 Gy/h, for total dose delivery of 0, 9.6 or 14.4 Gy, respectively. The mice were fed either a control diet or a diet supplemented with high levels of vitamins A, C and E. Our results showed that nutrient transport was perturbed by the chronic irradiation conditions. However, no apparent alteration of the macroscopic intestinal structures of the small intestine were observed up to day 10 after initiating irradiation. Jejunal fructose uptake measured in vitro was strongly affected by the chronic irradiation, whereas uptake of proline, carnosine and the bile acid taurocholate in the ileum was less affected. D-glucose transport did not appear to be inhibited significantly by either 9.6 or 14.4 Gy exposure. In the 14.4 Gy irradiated groups, the diet supplemented with high levels of vitamins A, C and E increased intestinal transport of fructose compared to the control diet (day 10; t test, P = 0.032), which correlated with elevated levels of vitamins A, C and E in the plasma and jejunal enterocytes. Our earlier studies with mice exposed acutely to 137Cs gamma rays demonstrated significant protection for transport of fructose, glucose, proline and carnosine. Taken together, these results suggest that high levels of vitamins A, C and E dietary supplements help preserve intestinal nutrient transport when intestines are irradiated chronically or acutely with low-LET gamma rays.

  7. A Morphofunctional Study on the Effect of Cytochalasin B on Intestinal Water Transport.

    DTIC Science & Technology

    1986-05-10

    Topic Category Selection hydrochloride . c. Signature Block for Member’s Signature d. Check Presentation Preference Box Each Abstract Form submitted...1999: 4-(2-isopropylamino-I-hydroxyethyl) methanesulfonanilide b. Topic Category Selection hydrochloride . c. Signature Block for Member’s Signature d...intestinal glyco- protein incorporation of 01-14 ) Glucosamine in vitro. Biochim Biophys Acta 261:353. Moe H (1955). On goblet cells, especially of

  8. Anti-allergic effects of a nonameric peptide isolated from the intestine gastrointestinal digests of abalone (Haliotis discus hannai) in activated HMC-1 human mast cells.

    PubMed

    Ko, Seok-Chun; Lee, Dae-Sung; Park, Won Sun; Yoo, Jong Su; Yim, Mi-Jin; Qian, Zhong-Ji; Lee, Chang-Min; Oh, Junghwan; Jung, Won-Kyo; Choi, Il-Whan

    2016-01-01

    The aim of the present study was to examine whether the intestine gastrointestinal (GI) digests of abalone [Haliotis discus hannai (H. discus hannai)] modulate inflammatory responses and to elucidate the mechanisms involved. The GI digests of the abalone intestines were fractionated into fractions I (>10 kDa), II (5-10 kDa) and Ⅲ (<5 kDa). Of the abalone intestine GI digests (AIGIDs), fraction Ⅲ inhibited the passive cutaneous anaphylaxis (PCA) reaction in mice. Subsequently, a bioactive peptide [abalone intestine GI digest peptide (AIGIDP)] isolated from fraction Ⅲ was determined to be 1175.2 Da, and the amino acid sequence was found to be PFNQGTFAS. We noted that the purified nonameric peptide (AIGIDP) attenuated the phorbol‑12‑myristate 13-acetate plus calcium ionophore A23187 (PMACI)-induced histamine release and the production of pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 in human mast cells (HMC-1 cells). In addition, we also noted that AIGIDP inhibited the PMACI‑induced activation of nuclear factor‑κB (NF-κB) by suppressing IκBα phosphorylation and that it suppressed the production of cytokines by decreasing the phosphorylation of JNK. The findings of our study indicate that AIGIDP exerts a modulatory, anti-allergic effect on mast cell-mediated inflammatory diseases.

  9. Lack of Effects of a Single High-Fat Meal Enriched with Vegetable n-3 or a Combination of Vegetable and Marine n-3 Fatty Acids on Intestinal Peptide Release and Adipokines in Healthy Female Subjects

    PubMed Central

    Narverud, Ingunn; Myhrstad, Mari C. W.; Herzig, Karl-Heinz; Karhu, Toni; Dahl, Tuva B.; Halvorsen, Bente; Ulven, Stine M.; Holven, Kirsten B.

    2016-01-01

    Peptides released from the small intestine and colon regulate short-term food intake by suppressing appetite and inducing satiety. Intake of marine omega-3 (n-3) fatty acids (FAs) from fish and fish oils is associated with beneficial health effects, whereas the relation between intake of the vegetable n-3 fatty acid α-linolenic acid and diseases is less clear. The aim of the present study was to investigate the postprandial effects of a single high-fat meal enriched with vegetable n-3 or a combination of vegetable and marine n-3 FAs with their different unsaturated fatty acid composition on intestinal peptide release and the adipose tissue. Fourteen healthy lean females consumed three test meals with different fat quality in a fixed order. The test meal consisted of three cakes enriched with coconut fat, linseed oil, and a combination of linseed and cod liver oil. The test days were separated by 2 weeks. Fasting and postprandial blood samples at 3 and 6 h after intake were analyzed. A significant postprandial effect was observed for cholecystokinin, peptide YY, glucose-dependent insulinotropic polypeptide, amylin and insulin, which increased, while leptin decreased postprandially independent of the fat composition in the high-fat meal. In conclusion, in healthy, young, lean females, an intake of a high-fat meal enriched with n-3 FAs from different origin stimulates intestinal peptide release without any difference between the different fat compositions. PMID:27630989

  10. Phenotypic characterization of cells participating in transport of prion protein aggregates across the intestinal mucosa of sheep

    PubMed Central

    Piercey Åkesson, Caroline; Press, Charles McL.; Tranulis, Michael A.; Jeffrey, Martin; Aleksandersen, Mona; Landsverk, Thor; Espenes, Arild

    2012-01-01

    The oral route is considered to be the main entry site of several transmissible spongiform encephalopathies or prion diseases of animals and man. Following natural and experimental oral exposure to scrapie, sheep first accumulate disease associated prion protein (PrPd) in Peyer’s patch (PP) lymphoid follicles. In this study, recombinant ovine prion protein (rPrP) was inoculated into gut loops of young lambs and the transportation across the intestinal wall studied. In particular, the immunohistochemical phenotypes of cells bearing the inoculated prion protein were investigated. The rPrP was shown to be transported across the villi of the gut, into the lacteals and submucosal lymphatics, mimicking the transport route of PrPd from scrapie brain inoculum observed in a previous intestinal loop experiment. The cells bearing the inoculated rPrP were mainly mononuclear cells, and multicolor immunofluorescence procedures were used to show that the rPrP bearing cells were professional antigen presenting cells expressing Major histocompatibility complex II (MHCII). In addition, the rPrP bearing cells labeled with CD205, CD11b and the macrophage marker CD68, and not with the dendritic cell markers CD11c and CD209. Others have reported that cells expressing CD205 and CD11b in the absence of CD11c have been shown to induce T cell tolerance or regulatory T cells. Based on this association, it was speculated that the rPrP and by extension PrPd and scrapie infective material may exploit the physiological process of macromolecular uptake across the gut, and that this route of entry may have implications for immune surveillance. PMID:22437736

  11. Iron-induced reactive oxygen species mediate transporter DMT1 endocytosis and iron uptake in intestinal epithelial cells.

    PubMed

    Esparza, Andrés; Gerdtzen, Ziomara P; Olivera-Nappa, Alvaro; Salgado, J Cristian; Núñez, Marco T

    2015-10-15

    Recent evidence shows that iron induces the endocytosis of the iron transporter dimetal transporter 1 (DMT1) during intestinal absorption. We, and others, have proposed that iron-induced DMT1 internalization underlies the mucosal block phenomena, a regulatory response that downregulates intestinal iron uptake after a large oral dose of iron. In this work, we investigated the participation of reactive oxygen species (ROS) in the establishment of this response. By means of selective surface protein biotinylation of polarized Caco-2 cells, we determined the kinetics of DMT1 internalization from the apical membrane after an iron challenge. The initial decrease in DMT1 levels in the apical membrane induced by iron was followed at later times by increased levels of DMT1. Addition of Fe(2+), but not of Cd(2+), Zn(2+), Cu(2+), or Cu(1+), induced the production of intracellular ROS, as detected by 2',7'-dichlorofluorescein (DCF) fluorescence. Preincubation with the antioxidant N-acetyl-l-cysteine (NAC) resulted in increased DMT1 at the apical membrane before and after addition of iron. Similarly, preincubation with the hydroxyl radical scavenger dimethyl sulfoxide (DMSO) resulted in the enhanced presence of DMT1 at the apical membrane. The decrease of DMT1 levels at the apical membrane induced by iron was associated with decreased iron uptake rates. A kinetic mathematical model based on operational rate constants of DMT1 endocytosis and exocytosis is proposed. The model qualitatively captures the experimental observations and accurately describes the effect of iron, NAC, and DMSO on the apical distribution of DMT1. Taken together, our data suggest that iron uptake induces the production of ROS, which modify DMT1 endocytic cycling, thus changing the iron transport activity at the apical membrane.

  12. Presumed LRP1-targeting transport peptide delivers β-secretase inhibitor to neurons in vitro with limited efficiency

    PubMed Central

    Kim, Jong Ah; Casalini, Tommaso; Brambilla, Davide; Leroux, Jean-Christophe

    2016-01-01

    Interfering with the activity of β-secretase to reduce the production of Aβ peptides is a conceivable therapeutic strategy for Alzheimer’s disease. However, the development of efficient yet safe inhibitors is hampered by secondary effects, usually linked to the indiscriminate inhibition of other substrates’ processing by the targeted enzyme. Based on the spatial compartmentalization of the cleavage of the amyloid precursor protein by β-secretase, we hypothesized that by exploiting the endocytosis receptor low-density lipoprotein receptor-related protein it would be possible to direct an otherwise cell-impermeable inhibitor to the endosomes of neurons, boosting the drug’s efficacy and importantly, sparing the off-target effects. We used the transport peptide Angiopep to build an endocytosis-competent conjugate and found that although the peptide facilitated the inhibitor’s internalization into neurons and delivered it to the endosomes, the delivery was not efficient enough to potently reduce β-secretase activity at the cellular level. This is likely connected to the finding that in the cell lines we used, Angiopep’s internalization was not mediated by its presumed receptor to a significant extent. Additionally, Angiopep exploited different internalization mechanisms when applied alone or when conjugated to the inhibitor, highlighting the impact that drug conjugation can have on transport peptides. PMID:27682851

  13. Changes in Sucrase, Enterokinase, and Peptide Hydrolase after Intestinal Resection THE ASSOCIATION OF CELLULAR HYPERPLASIA AND ADAPTATION

    PubMed Central

    McCarthy, Denis M.; Kim, Young S.

    1973-01-01

    In a study of changes in digestive enzymes after massive intestinal resection and the mechanisms by which such changes occur, rats were sacrified 4 wk after removal of the proximal two-thirds of the small intestine. Alterations in the mucosal levels of sucrase, enterokinase, and dipeptide hydrolase (L-leucyl-L-alanine substrate) were examined in the light of associated changes in protein. DNA and wet mucosal weight, measured in standardized gut segments from various regions of intestine. Metabolic studies showed that normal growth patterns were reestablished after the operation but significant elevations in stool weight and fecal nitrogen occurred in the second postoperative week, falling towards normal by the 4th wk. In standard gut segments wet weight of mucosa, protein, and DNA rose, especially in distal segments, DNA increasing disproportionately. Mucosal levels of the proximally distributed and membrane-bound enzymes, sucrase and enterokinase, showed similar patterns of change: when enzyme activity was expressed in terms of the total per segment, proximally there were considerable increases in both enzymes, but, expressed in terms of specific activity, that of sucrase fell and that of enterokinase was unaltered. By contrast, the largely soluble and more distally distributed dipeptide hydrolase increased more in distal segments and the increases in total activity were accompanied by lesser increases in specific activity. However, in spite of increases in total activity, enzyme activity per milligram DNA fell by over 50% in postanastomotic segments. Subcellular distribution studies showed no change in the percentage of the total activity which was membrane-bound and zymograms confirmed that no new dipeptide hydrolase had appeared after resection. It is concluded that increases in the segmental totals of various enzymes seen after resection are achieved by disproportinate increases in the number of mucosal cells per segment and that the greatest change in a

  14. A microRNA program in the C. elegans hypodermis couples to intestinal mTORC2/PQM-1 signaling to modulate fat transport

    PubMed Central

    Dowen, Robert H.; Breen, Peter C.; Tullius, Thomas; Conery, Annie L.; Ruvkun, Gary

    2016-01-01

    Animals integrate metabolic, developmental, and environmental information before committing key resources to reproduction. In Caenorhabditis elegans, adult animals transport fat from intestinal cells to the germline to promote reproduction. We identified a microRNA (miRNA)-regulated developmental timing pathway that functions in the hypodermis to nonautonomously coordinate the mobilization of intestinal fat stores to the germline upon initiation of adulthood. This developmental timing pathway, which is controlled by the lin-4 and let-7 miRNAs, engages mTOR signaling in the intestine. The intestinal signaling component is specific to mTORC2 and functions in parallel to the insulin pathway to modulate the activity of the serum/glucocorticoid-regulated kinase (SGK-1). Surprisingly, SGK-1 functions independently of DAF-16/FoxO; instead, SGK-1 promotes the cytoplasmic localization of the PQM-1 transcription factor, which antagonizes intestinal fat mobilization at the transcriptional level when localized to the nucleus. These results revealed that a non-cell-autonomous developmental input regulates intestinal fat metabolism by engaging mTORC2 signaling to promote the intertissue transport of fat reserves from the soma to the germline. PMID:27401555

  15. Lanthanide-stimulated glucose and proline transport across rabbit intestinal brush-border membranes.

    PubMed

    Stevens, B R; Kneer, C

    1988-07-07

    Trivalent cations of the lanthanide series (La3+----Yb3+) stimulated uptake of proline or glucose in rabbit small intestinal brush-border membrane vesicles. The lanthanides stimulated uptake to an extent greater than Al3+, choline, and in many cases, Na+. A time-course of Er3+-stimulated glucose uptake gave initial rates and overshoots greater than Na+ stimulation. The best activators were Sm3+, Eu3+ and Tm3+, which stimulated proline initial uptakes by 400-600%, and stimulated glucose uptake by 120-150%, compared to Na+. The best lanthanide cotransport activators possessed high third ionization potentials.

  16. Combinational enhancing effects of formulation and encapsulation on digestive stability and intestinal transport of green tea catechins.

    PubMed

    Son, Yu-Ra; Chung, Jae-Hwan; Ko, Sanghoon; Shim, Soon-Mi

    2016-01-01

    The hypothesis was that green tea catechins (GTCs) formulated with vitamin C and xylitol followed by enteric coating with hydroxypropyl methyl cellulose phthalate (HPMCP) or encapsulated into γ-cyclodextrin (γ-CD) could enhance intestinal absorption of GTCs. Surface morphology and size obtained by SEM were different. Digestive stability of GTCs encapsulated into γ-CD or coated with HPMCP was enhanced up to 65.56% or 57.63%, respectively. When GTCs were formulated, the digestive stability was greater than the one not formulated. Formulated GTCs followed by encapsulation into γ-CD significantly increased intestinal transport. Absorption of GTCs was 2.8%, 9.64%, 11.97%, 8.41% and 14.36% for only GTCs, GTCs encapsulated into γ-CD, formulated GTCs encapsulated into γ-CD, GTCs coated with HPMCP and formulated GTCs coated with HPMCP, respectively. This study suggests that GTCs, formulated with vitamin C and xylitol followed by γ-CD encapsulation or HPMCP enteric coating, provide combinational effect to increase bioavailability of GTCs.

  17. Chronic treatment with the gamma-secretase inhibitor LY-411,575 inhibits beta-amyloid peptide production and alters lymphopoiesis and intestinal cell differentiation.

    PubMed

    Wong, Gwendolyn T; Manfra, Denise; Poulet, Frederique M; Zhang, Qi; Josien, Hubert; Bara, Thomas; Engstrom, Laura; Pinzon-Ortiz, Maria; Fine, Jay S; Lee, Hu-Jung J; Zhang, Lili; Higgins, Guy A; Parker, Eric M

    2004-03-26

    Inhibition of gamma-secretase, one of the enzymes responsible for the cleavage of the amyloid precursor protein (APP) to produce the pathogenic beta-amyloid (Abeta) peptides, is an attractive approach to the treatment of Alzheimer disease. In addition to APP, however, several other gamma-secretase substrates have been identified (e.g. Notch), and altered processing of these substrates by gamma-secretase inhibitors could lead to unintended biological consequences. To study the in vivo consequences of gamma-secretase inhibition, the gamma-secretase inhibitor LY-411,575 was administered to C57BL/6 and TgCRND8 APP transgenic mice for 15 days. Although most tissues were unaffected, doses of LY-411,575 that inhibited Abeta production had marked effects on lymphocyte development and on the intestine. LY-411,575 decreased overall thymic cellularity and impaired intrathymic differentiation at the CD4(-)CD8(-)CD44(+)CD25(+) precursor stage. No effects on peripheral T cell populations were noted following LY-411,575 treatment, but evidence for the altered maturation of peripheral B cells was observed. In the intestine, LY-411,575 treatment increased goblet cell number and drastically altered tissue morphology. These effects of LY-411,575 were not seen in mice that were administered LY-D, a diastereoisomer of LY-411,575, which is a very weak gamma-secretase inhibitor. These studies show that inhibition of gamma-secretase has the expected benefit of reducing Abeta in a murine model of Alzheimer disease but has potentially undesirable biological effects as well, most likely because of the inhibition of Notch processing.

  18. L-carnitine, a diet component and organic cation transporter OCTN ligand, displays immunosuppressive properties and abrogates intestinal inflammation.

    PubMed

    Fortin, G; Yurchenko, K; Collette, C; Rubio, M; Villani, A-C; Bitton, A; Sarfati, M; Franchimont, D

    2009-04-01

    Allele variants in the L-carnitine (LCAR) transporters OCTN1 (SLC22A4, 1672 C --> T) and OCTN2 (SLC22A5, -207 G --> C) have been implicated in susceptibility to Crohn's disease (CD). LCAR is consumed in the diet and transported actively from the intestinal lumen via the organic cation transporter OCTN2. While recognized mainly for its role in fatty acid metabolism, several lines of evidence suggest that LCAR may also display immunosuppressive properties. This study sought to investigate the immunomodulatory capacity of LCAR on antigen-presenting cell (APC) and CD4+ T cell function by examining cytokine production and the expression of activation markers in LCAR-supplemented and deficient cell culture systems. The therapeutic efficacy of its systemic administration was then evaluated during the establishment of colonic inflammation in vivo. LCAR treatment significantly inhibited both APC and CD4+ T cell function, as assessed by the expression of classical activation markers, proliferation and cytokine production. Carnitine deficiency resulted in the hyperactivation of CD4+ T cells and enhanced cytokine production. In vivo, protection from trinitrobenzene sulphonic acid colitis was observed in LCAR-treated mice and was attributed to the abrogation of both innate [interleukin (IL)-1beta and IL-6 production] and adaptive (T cell proliferation in draining lymph nodes) immune responses. LCAR therapy may therefore represent a novel alternative therapeutic strategy and highlights the role of diet in CD.

  19. Investigating the transport dynamics of anthocyanins from unprocessed fruit and processed fruit juice from sour cherry (Prunus cerasus L.) across intestinal epithelial cells.

    PubMed

    Toydemir, Gamze; Boyacioglu, Dilek; Capanoglu, Esra; van der Meer, Ingrid M; Tomassen, Monic M M; Hall, Robert D; Mes, Jurriaan J; Beekwilder, Jules

    2013-11-27

    Anthocyanins can contribute to human health through preventing a variety of diseases. The uptake of these compounds from food and the parameters determining uptake efficiency within the human body are still poorly understood. Here we have employed a Caco-2 cell based system to investigate the transport of key antioxidant food components from sour cherry (Prunus cerasus L.) across the intestinal epithelial barrier. Anthocyanins and (-)-epicatechin were supplied in three contrasting matrices: fruit, processed fruit cherry juice, and polyphenolic fractions obtained by solid-phase extraction. Results show that both compound types behave differently. Fruit or juice matrices display comparable transport across the epithelial cell layer. The juice supplements sucrose and citric acid, which are regularly added to processed foods, have a positive effect on stability and transport. Polyphenolic fractions display a lower transport efficiency, relative to that of the fruit or juice, indicating the importance of food matrix components for intestinal absorption of polyphenols.

  20. Regional development of alpha-methyl-D-glucoside transport in the small intestine of chick embryos and newly-hatched chicks.

    PubMed

    Esteban, S; Moreno, M; Mestre, I; Planas, J M; Tur, J A

    1991-12-01

    A regional study of the intestinal hexose transport shows the role played by duodenum, jejunum and ileum during the chick perinatal development. From at least two days before hatching the three regions of small intestine accumulate alpha-Méthyl-D-Glucose (alpha-MG) by mediated transport mechanisms, and phloridzin inhibit about 90% of the uptakes. This ability reaches the maximal level at 1 day after hatch in the three regions. Before hatching the jejunum shows higher transport levels than the observed values in the duodenum and ileum, but the three regions show similar values at 1 day after hatch. In the following days, the alpha-MG transport ability is strongly reduced in the duodenum, slightly reduced in the jejunum and maintained in the ileum until at least 7 day-old chicks.

  1. Central pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal peptide (VIP) decrease the baroreflex sensitivity in trout.

    PubMed

    Lancien, Frédéric; Mimassi, Nagi; Conlon, J Michael; Le Mével, Jean-Claude

    2011-04-01

    Although PACAP and VIP exert diverse actions on heart and blood vessels along the vertebrate phylum, no information is currently available concerning the potential role of these peptides on the regulation of the baroreflex response, a major mechanism for blood pressure homeostasis. Consequently, the goal of this study was to examine in our experimental model, the unanesthetized rainbow trout Oncorhynchus mykiss, whether PACAP and VIP are involved in the regulation of the cardiac baroreflex sensitivity (BRS). Cross-spectral analysis techniques using a fast Fourier transform algorithm were employed to calculate the coherence, phase and gain of the transfer function between spontaneous fluctuations of systolic arterial blood pressure and R-R intervals of the electrocardiogram. The BRS was estimated as the mean of the gain of the transfer function when the coherence between the two signals was high and the phase negative. Compared with vehicle, intracerebroventricular (i.c.v.) injections of trout PACAP-27 and trout VIP (25-100 pmol) dose-dependently reduced the cardiac BRS to the same extent with a threshold dose of 50 pmol for a significant effect. When injected intra-arterially at the same doses as for i.c.v. injections, only the highest dose of VIP (100 pmol) significantly attenuated the BRS. These results suggest that the endogenous peptides PACAP and VIP might be implicated in the central control of cardiac baroreflex functions in trout.

  2. Exploring the dynamic behaviors and transport properties of gas molecules in a transmembrane cyclic peptide nanotube.

    PubMed

    Li, Rui; Fan, Jianfen; Li, Hui; Yan, Xiliang; Yu, Yi

    2013-12-05

    The dynamic behaviors and transport properties of O2, CO2, and NH3 molecules through a transmembrane cyclic peptide nanotube (CPNT) of 8×cyclo-(WL)4/POPE have been investigated by steered molecular dynamics (SMD) simulations and adaptive biasing force (ABF) samplings. Different external forces are needed for three gas molecules to enter the channel. The periodic change of the pulling force curve for a gas traveling through the channel mainly arises from the regular and periodic arrangement of the composed CP subunits of the CPNT. Radial distribution functions (RDFs) between gas and water disclose the density decrease of channel water, which strongly aggravates the discontinuity of H-bond formation between a gas molecule and the neighboring water. Compared to hardly any H-bond formation between CO2 (or O2) and the framework of the CPNT, NH3 can form abundant H-bonds with the carbonyl/amide groups of the CPNT, leading to a fierce competition to NH3-water H-bonded interactions. In addition to direct H-bonded interactions, all three gases can form water bridges with the tube. The potential profile of mean force coincides with the occurring probability of a gas molecule along the tube axis. The energy barriers at two mouths of the CPNT elucidate the phenomenon that CO2 and O2 are thoroughly confined in the narrow lumen while NH3 can easily go outside the tube. Intermolecular interactions of each gas with channel water and the CPNT framework and the formation of H-bonds and water bridges illuminate the different gas translocation behaviors. The results uncover interesting and comprehensive mechanisms underlying the permeation characteristics of three gas molecules traveling through a transmembrane CPNT.

  3. The ion transport peptide is a new functional clock neuropeptide in the fruit fly Drosophila melanogaster.

    PubMed

    Hermann-Luibl, Christiane; Yoshii, Taishi; Senthilan, Pingkalai R; Dircksen, Heinrich; Helfrich-Förster, Charlotte

    2014-07-16

    The clock network of Drosophila melanogaster expresses various neuropeptides, but a function in clock-mediated behavioral control was so far only found for the neuropeptide pigment dispersing factor (PDF). Here, we propose a role in the control of behavioral rhythms for the ion transport peptide (ITP), which is expressed in the fifth small ventral lateral neuron, one dorsal lateral neuron, and in only a few nonclock cells in the brain. Immunocytochemical analyses revealed that ITP, like PDF, is most probably released in a rhythmic manner at projection terminals in the dorsal protocerebrum. This rhythm continues under constant dark conditions, indicating that ITP release is clock controlled. ITP expression is reduced in the hypomorph mutant Clk(AR), suggesting that ITP expression is regulated by CLOCK. Using a genetically encoded RNAi construct, we knocked down ITP in the two clock cells and found that these flies show reduced evening activity and increased nocturnal activity. Overexpression of ITP with two independent timeless-GAL4 lines completely disrupted behavioral rhythms, but only slightly dampened PER cycling in important pacemaker neurons, suggesting a role for ITP in clock output pathways rather than in the communication within the clock network. Simultaneous knockdown (KD) of ITP and PDF made the flies hyperactive and almost completely arrhythmic under constant conditions. Under light-dark conditions, the double-KD combined the behavioral characteristics of the single-KD flies. In addition, it reduced the flies' sleep. We conclude that ITP and PDF are the clock's main output signals that cooperate in controlling the flies' activity rhythms.

  4. Effects of dietary supplementation with an expressed fusion peptide bovine lactoferricin-lactoferrampin on performance, immune function and intestinal mucosal morphology in piglets weaned at age 21 d.

    PubMed

    Tang, Zhiru; Yin, Yulong; Zhang, Youming; Huang, Ruilin; Sun, Zhihong; Li, Tiejun; Chu, Wuying; Kong, Xiangfeng; Li, Lili; Geng, Meimei; Tu, Qiang

    2009-04-01

    Lactoferrin has antimicrobial activity associated with peptide fragments lactoferricin (LFC) and lactoferrampin (LFA) released on digestion. These two fragments have been expressed in Photorhabdus luminescens as a fusion peptide linked to protein cipB. The construct cipB-LFC-LFA was tested as an alternative to antimicrobial growth promoters in pig production. Sixty piglets with an average live body weight of 5.42 (sem 0.59) kg were challenged with enterotoxigenic Escherichia coli and randomly assigned to four treatment groups fed a maize-soyabean meal diet containing either no addition (C), cipB at 100 mg/kg (C+B), cipB-LFC-LFA at 100 mg/kg (C+L) or colistin sulfate at 100 mg/kg (C+CS) for 3 weeks. Compared with C, dietary supplementation with C+L for 3 weeks increased daily weight gain by 21 %, increased recovery from diarrhoea, enhanced serum glutathione peroxidase (GPx), peroxidase (POD) and total antioxidant content (T-AOC), liver GPx, POD, superoxide dismutase and T-AOC, Fe, total Fe-binding capacity, IgA, IgG and IgM levels (P < 0.05), decreased the concentration of E. coli in the ileum, caecum and colon (P < 0.05), increased the concentration of lactobacilli and bifidobacteria in the ileum, caecum and colon (P < 0.05), and promoted development of the villus-crypt architecture of the small intestine. Growth performance was similar between C+L- and C+CS-supplemented pigs. The present results indicate that LFC-LFA is an effective alternative to the feed antibiotic CS for enhancing growth performance in piglets weaned at age 21 d.

  5. Basal Expression of Nucleoside Transporter mRNA Differs Among Small Intestinal Epithelia of Beef Steers and is Differentially Altered by Ruminal or Abomasal Infusion of Starch Hydrolysate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In ruminants, microbial-derived nucleic acids are a major source of N and are absorbed as nucleosides by small intestinal epithelia. Although the biochemical activities of 2 nucleoside transport systems have been described for cattle, little is known regarding the regulation of their gene expression...

  6. Ruminal and Abomasal Starch Hydrolysate Infusions Selectively Decrease the Expression of Cationic Amino Acid Transporter mRNA by Small Intestinal Epithelia of Forage-fed Beef Steers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although cationic amino acids (CAA) are consid-ered essential to maximize optimal growth of cattle, transporters responsible for CAA absorption by bovine small intestinal epithelia have not been described. This study was conducted to test 2 hypotheses: 1) the duo¬denal, jejunal, and ileal epithelia ...

  7. PEGylated porcine glucagon-like peptide-2 improved the intestinal digestive function and prevented inflammation of weaning piglets challenged with LPS.

    PubMed

    Qi, K K; Wu, J; Deng, B; Li, Y M; Xu, Z W

    2015-09-01

    This study was conducted to determine the effects on intestinal function, anti-inflammatory role and possible mechanism of polyethylene glycosylated (PEGylated) porcine glucagon-like peptide-2 (pGLP-2), a long-acting form of pGLP-2, in weaning piglets challenged with Escherichia coli lipopolysaccharide (LPS). We divided 18 weaned piglets on day 21 into three groups (control, LPS and LPS+PEG-pGLP-2; n=6). The piglets from the LPS+PEG-pGLP-2 group were injected with PEG-pGLP-2 at 10 nmol/kg BW from 5 to 7 days of the trials daily. On 8th day, the piglets in the LPS and LPS+PEG-pGLP-2 groups were intraperitoneally administered with 100 µg LPS/kg. The control group was administered with the same volume of saline solution. The piglets were then sacrificed on day 28. Afterwards, serum, duodenum, jejunum and ileum samples were collected for analysis of structural and functional endpoints. LPS+PEG-pGLP-2 treatment increased (P<0.05) lactase activities in the duodenum and the jejunum compared with LPS treatment. LPS+PEG-pGLP-2 treatment also significantly increased sucrase activity in the jejunum compared with LPS treatment. Furthermore, LPS treatment increased (P<0.05) the mRNA expression levels of interleukin (IL)-8, tumour necrosis factor-α (TNF-α) and IL-10 in the ileum compared with the control treatment. By contrast, LPS+PEG-pGLP-2 treatment decreased (P<0.05) the mRNA expression levels of IL-8, IL-10 and TNF-α in the ileum compared with the LPS treatment. LPS treatment also increased (P<0.05) the mRNA expression level of GLP-2 receptor (GLP-2R) and the percentage of GLP-2R-positive cells in the ileum; by comparison, these results were (P<0.05) reduced by LPS+PEG-pGLP-2 treatment. Moreover, LPS+PEG-pGLP-2 treatment increased (P<0.05) the content of serum keratinocyte growth factor compared with the control group and the LPS group. The protective effects of PEG-pGLP-2 on intestinal digestive function were associated with the release of GLP-2R mediator (keratinocyte

  8. Phosphatidylcholine passes through lateral tight junctions for paracellular transport to the apical side of the polarized intestinal tumor cell-line CaCo2.

    PubMed

    Stremmel, Wolfgang; Staffer, Simone; Gan-Schreier, Hongying; Wannhoff, Andreas; Bach, Margund; Gauss, Annika

    2016-09-01

    Phosphatidylcholine (PC) is the most abundant phospholipid in intestinal mucus, indicative of a specific transport system across the mucosal epithelium to the intestinal lumen. To elucidate this transport mechanism, we employed a transwell tissue culture system with polarized CaCo2 cells. It was shown that PC could not substantially be internalized by the cells. However, after basal application of increasing PC concentrations, an apical transport of 47.1±6.3nmolh(-1)mMPC(-1) was observed. Equilibrium distribution studies with PC applied in equal concentrations to the basal and apical compartments showed a 1.5-fold accumulation on the expense of basal PC. Disruption of tight junctions (TJ) by acetaldehyde or PPARγ inhibitors or by treatment with siRNA to TJ proteins suppressed paracellular transport by at least 50%. Transport was specific for the choline containing the phospholipids PC, lysoPC and sphingomyelin. We showed that translocation is driven by an electrochemical gradient generated by apical accumulation of Cl(-) and HCO3(-) through CFTR. Pretreatment with siRNA to mucin 3 which anchors in the apical plasma membrane of mucosal cells inhibited the final step of luminal PC secretion. PC accumulates in intestinal mucus using a paracellular, apically directed transport route across TJs.

  9. The effect of colitis on large-intestinal electrolyte transport in early childhood.

    PubMed

    Jenkins, H R; Milla, P J

    1993-05-01

    The large intestine plays an important role in the salvage of electrolytes and water, although little is known of its function in early childhood in health or in disease. Using an in vitro voltage clamp technique, we have measured bidirectional sodium (Na) and chloride (Cl) fluxes (J), electrical potential difference (PD), short circuit current (Isc), and tissue resistance (R) in 10 pairs of healthy human infant left colon and four pairs of inflamed colon. In healthy tissue there was net Na and Cl absorption with JNa net approximating Isc. In contrast, inflamed colon exhibited significant reductions in PD, Isc, and R and increases in net serosa to mucosa flux of Na and Cl (JNasm and JClsm) resulting in net Na and Cl secretion. These results suggest that Na and Cl absorption in left colon is highly efficient in young children and that mucosal inflammation may seriously impair the colon's ability to conserve salt and water.

  10. Understanding the structure, dynamics, and mass transport properties of self assembling peptide hydrogels for injectable, drug delivery applications

    NASA Astrophysics Data System (ADS)

    Branco, Monica Cristina

    hydrogels as a function of peptide sequence and concentration. Changes in nanoscale dynamics and structure inherently lead to substantial differences in bulk properties, such as the elastic modulus and network mesh size. Learning how the material properties of the gels influence the transport rate of therapeutics through the hydrogel is essential to the development of delivery vehicles. The remainder of the thesis focuses on correlating the mesh sizes of MAX1 and MAX8 gels to the diffusion and mass transport properties of model dextran and protein probes. Here, work is centered on how peptide charge and concentration, as well as probe structure, in particular hydrodynamic diameter and charge, dictate the temporal release of model probes from the peptide hydrogels. Experiments include self diffusion studies and bulk release experiments with model dextrans and proteins from gels before and after syringe delivery. Overall, this thesis will demonstrate the importance of understanding material properties from the nanoscale up to the macroscale for application based design. With this approach, better and specific development of self-assembling peptide materials can be achieved, allowing for the rational engineering of peptide sequences to form hydrogels appropriate for specific drug delivery applications.

  11. Overlapping transport and chaperone-binding functions within a bacterial twin-arginine signal peptide.

    PubMed

    Grahl, Sabine; Maillard, Julien; Spronk, Chris A E M; Vuister, Geerten W; Sargent, Frank

    2012-03-01

    The twin-arginine translocation (Tat) pathway is a protein targeting system present in many prokaryotes. The physiological role of the Tat pathway is the transmembrane translocation of fully-folded proteins, which are targeted by N-terminal signal peptides bearing conserved SRRxFLK 'twin-arginine' amino acid motifs. In Escherichia coli the majority of Tat targeted proteins bind redox cofactors and it is important that only mature, cofactor-loaded precursors are presented for export. Cellular processes have been unearthed that sequence these events, for example the signal peptide of the periplasmic nitrate reductase (NapA) is bound by a cytoplasmic chaperone (NapD) that is thought to regulate assembly and export of the enzyme. In this work, genetic, biophysical and structural approaches were taken to dissect the interaction between NapD and the NapA signal peptide. A NapD binding epitope was identified towards the N-terminus of the signal peptide, which overlapped significantly with the twin-arginine targeting motif. NMR spectroscopy revealed that the signal peptide adopted a α-helical conformation when bound by NapD, and substitution of single residues within the NapA signal peptide was sufficient to disrupt the interaction. This work provides an increased level of understanding of signal peptide function on the bacterial Tat pathway.

  12. Vasoactive intestinal peptide (VIP)-mediated expression and function of steroidogenic acute regulatory protein (StAR) in granulosa cells.

    PubMed

    Kowalewski, Mariusz P; Dyson, Matthew T; Boos, Alois; Stocco, Douglas M

    2010-10-26

    VIP is a peptide hormone capable of activating the cAMP/PKA pathway and modifying gonadal steroidogenic capacity. Less is known about the molecular mechanisms of VIP-mediated steroidogenesis and its role in regulating the steroidogenic acute regulatory protein (STAR). We examined the impact of VIP on STAR expression and function in immortalized (KK1) and primary mouse granulosa cells, where VIP strongly upregulated STAR expression and steroidogenesis. Inhibitors of the PKA and PKC pathways suggested that both are activated by VIP. VIP did not efficiently phosphorylate STAR (P-STAR); however, VIP together with cAMP-analogs that activate Type II PKA increased P-STAR and further increased steroidogenesis. Our results suggest that VIP-induced STAR expression and function in granulosa cells result from the preferential activation of Type I PKA. Furthermore, the PKA and PKC pathways appear to converge at regulating VIP-mediated Star transcription and translation.

  13. Peripheral nerve reconstruction with epsilon-caprolactone conduits seeded with vasoactive intestinal peptide gene-transfected mesenchymal stem cells in a rat model

    NASA Astrophysics Data System (ADS)

    Hernández-Cortés, P.; Toledo-Romero, M. A.; Delgado, M.; Sánchez-González, C. E.; Martin, F.; Galindo-Moreno, P.; O'Valle, F.

    2014-08-01

    Objective. Attempts have been made to improve nerve conduits in peripheral nerve reconstruction. We investigated the potential therapeutic effect of a vasoactive intestinal peptide (VIP), a neuropeptide with neuroprotective, trophic and developmental regulatory actions, in peripheral nerve regeneration in a severe model of nerve injury that was repaired with nerve conduits. Approach. The sciatic nerve of each male Wistar rat was transected unilaterally at 10 mm and then repaired with Dl-lactic-ɛ-caprolactone conduits. The rats were treated locally with saline, with the VIP, with adipose-derived mesenchymal stem cells (ASCs) or with ASCs that were transduced with the VIP-expressing lentivirus. The rats with the transected nerve, with no repairs, were used as untreated controls. At 12 weeks post-surgery, we assessed their limb function by measuring the ankle stance angle and the percentage of their muscle mass reduction, and we evaluated the histopathology, immunohistochemistry and morphometry of the myelinated fibers. Main results. The rats that received a single injection of VIP-expressing ASCs showed a significant functional recovery in the ankle stance angle (p = 0.049) and a higher number of myelinated fibers in the middle and distal segments of the operated nerve versus the other groups (p = 0.046). Significance. These results suggest that utilization of a cellular substrate, plus a VIP source, is a promising method for enhancing nerve regeneration using Dl-lactic-ɛ-caprolactone conduits and that this method represents a potential useful clinical approach to repairing peripheral nerve damage.

  14. Vasoactive intestinal peptide inhibits liver pathology in acute murine schistosomiasis mansoni and modulates IL-10, IL-12 and TNF-alpha production.

    PubMed

    Allam, Gamal

    2007-01-01

    Vasoactive intestinal peptide (VIP) exerts a broad range of biologic actions that may include modulation of hepatic granuloma formation. This study aimed to investigate the effect of VIP administration on the course of acute murine schistosomiasis mansoni. Mice were infected each with 40 Schistosoma (S.) mansoni cercariae and injected intraperitoneally with VIP at a total dose of 1mug/kg body weight. VIP treatment was very effective in diminishing worm fecundity, hepatic granuloma size and number by about 54%, 75% and 51%, respectively, and reducing liver collagen content. Serum level of interleukin (IL)-10 was increased, while level of IL-12 and tumor necrosis factor (TNF)-alpha were decreased as a result of VIP administration. Carbohydrate antigen 19.9 (CA 19.9) induced by S. mansoni infection was decreased with VIP treatment. Activities of hepatic gamma-glutamyl transferase (gamma-GT), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in liver tissue homogenate of infected treated mice were increased. These results indicate that suitable administration of exogenous VIP can be effective in ameliorating immunopathologic damage associated with schistosomiasis.

  15. Manganese-Enhanced Magnetic Resonance Imaging for Detection of Vasoactive Intestinal Peptide Receptor 2 Agonist Therapy in a Model of Parkinson's Disease.

    PubMed

    Olson, Katherine E; Bade, Aditya N; Schutt, Charles R; Dong, Jingdong; Shandler, Scott J; Boska, Michael D; Mosley, R Lee; Gendelman, Howard E; Liu, Yutong

    2016-07-01

    Neuroprotective immunity is defined by transformation of T-cell polarity for therapeutic gain. For neurodegenerative disorders and specifically for Parkinson's disease (PD), granulocyte-macrophage colony stimulating factor or vasoactive intestinal peptide receptor 2 (VIPR2) agonists elicit robust anti-inflammatory microglial responses leading to neuronal sparing in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-intoxicated mice. While neurotherapeutic potential was demonstrated for PD, there remain inherent limitations in translating these inventions from the laboratory to patients. One obstacle in translating such novel neurotherapeutics centers on the availability of suitable noninvasive methods to track disease progression and therapeutic efficacy. To this end, we developed manganese-enhanced magnetic resonance imaging (MEMRI) assays as a way to track a linkage between glial activation and VIPR2 agonist (LBT-3627)-induced neuroprotective immunity for MPTP-induced nigrostriatal degeneration. Notably, LBT-3627-treated, MPTP-intoxicated mice show reduced MEMRI brain signal intensities. These changes paralleled reduced astrogliosis and resulted in sparing of nigral tyrosine hydroxylase neurons. Most importantly, the data suggest that MEMRI can be developed as a biomarker tool to monitor neurotherapeutic responses that are relevant to common neurodegenerative disorders used to improve disease outcomes.

  16. Conjugated Alpha-Alumina nanoparticle with vasoactive intestinal peptide as a Nano-drug in treatment of allergic asthma in mice.

    PubMed

    Athari, Seyyed Shamsadin; Pourpak, Zahra; Folkerts, Gert; Garssen, Johan; Moin, Mostafa; Adcock, Ian M; Movassaghi, Masoud; Ardestani, Mehdi Shafiee; Moazzeni, Seyed Mohammad; Mortaz, Esmaeil

    2016-11-15

    Asthma is a chronic respiratory disease characterized by airway inflammation, bronchoconstriction, airway hyperresponsiveness and recurring attacks of impaired breathing. Vasoactive intestinal peptide (VIP) has been proposed as a novel anti-asthma drug due to its effects on airway smooth muscle relaxation, bronchodilation and vasodilation along with its immunomodulatory and anti-inflammatory properties. In the current study, we investigated the therapeutic effects of VIP when conjugated with α-alumina nanoparticle (α-AN) to prevent enzymatic degradation of VIP in the respiratory tract. VIP was conjugated with α-AN. Balb/c mice were sensitized and challenges with ovalbumin (OVA) or PBS and were divided in four groups; VIP-treated, α-AN-treated, α-AN-VIP-treated and beclomethasone-treated as a positive control group. Specific and total IgE level, airway hyperresponsiveness (AHR), bronchial cytokine expression and lung histology were measured. α-AN-VIP significantly reduced the number of eosinophils (Eos), serum IgE level, Th2 cytokines and AHR. These effects of α-AN-VIP were more pronounced than that seen with beclomethasone or VIP alone (P<0.05). The current data indicate that α-AN-VIP can be considered as an effective nano-drug for the treatment of asthma.

  17. Preservation of folate transport activity with a low-pH optimum in rat IEC-6 intestinal epithelial cell lines that lack reduced folate carrier function.

    PubMed

    Wang, Yanhua; Rajgopal, Arun; Goldman, I David; Zhao, Rongbao

    2005-01-01

    Intestinal folate transport has been well characterized, and rat small intestinal epithelial (IEC-6) cells have been used as a model system for the study of this process on the cellular level. The major intestinal folate transport activity has a low-pH optimum, and the current paradigm is that this process is mediated by the reduced folate carrier (RFC), despite the fact that this carrier has a neutral pH optimum in leukemia cells. The current study addressed the question of whether constitutive low-pH folate transport activity in IEC-6 cells is mediated by RFC. Two independent IEC-6 sublines, IEC-6/A4 and IEC-6/PT1, were generated by chemical mutagenesis followed by selective pressure with antifolates. In IEC-6/A4 cells, a premature stop resulted in truncation of RFC at Gln(420). A green fluorescent protein (GFP) fusion with the truncated protein was not stable. In IEC-6/PT1 cells, Ser(135) was deleted, and this alteration resulted in the failure of localization of the GFP fusion protein in the plasma membrane. In both cell lines, methotrexate (MTX) influx at neutral pH was markedly decreased compared with wild-type IEC-6 cells, but MTX influx at pH 5.5 was not depressed. Transient transfection of the GFP-mutated RFC constructs into RFC-null HeLa cells confirmed their lack of transport function. These results indicate that in IEC-6 cells, folate transport at neutral pH is mediated predominantly by RFC; however, the folate transport activity at pH 5.5 is RFC independent. Hence, constitutive folate transport activity with a low-pH optimum in this intestinal cell model is mediated by a process entirely distinct from that of RFC.

  18. Knockdown of copper-transporting ATPase 1 (Atp7a) impairs iron flux in fully-differentiated rat (IEC-6) and human (Caco-2) intestinal epithelial cells.

    PubMed

    Ha, Jung-Heun; Doguer, Caglar; Collins, James F

    2016-09-01

    Intestinal iron absorption is highly regulated since no mechanism for iron excretion exists. We previously demonstrated that expression of an intestinal copper transporter (Atp7a) increases in parallel with genes encoding iron transporters in the rat duodenal epithelium during iron deprivation (Am. J. Physiol.: Gastrointest. Liver Physiol., 2005, 288, G964-G971). This led us to postulate that Atp7a may influence intestinal iron flux. Therefore, to test the hypothesis that Atp7a is required for optimal iron transport, we silenced Atp7a in rat IEC-6 and human Caco-2 cells. Iron transport was subsequently quantified in fully-differentiated cells plated on collagen-coated, transwell inserts. Interestingly, (59)Fe uptake and efflux were impaired in both cell lines by Atp7a silencing. Concurrent changes in the expression of key iron transport-related genes were also noted in IEC-6 cells. Expression of Dmt1 (the iron importer), Dcytb (an apical membrane ferrireductase) and Fpn1 (the iron exporter) was decreased in Atp7a knockdown (KD) cells. Paradoxically, cell-surface ferrireductase activity increased (>5-fold) in Atp7a KD cells despite decreased Dcytb mRNA expression. Moreover, increased expression (>10-fold) of hephaestin (an iron oxidase involved in iron efflux) was associated with increased ferroxidase activity in KD cells. Increases in ferrireductase and ferroxidase activity may be compensatory responses to increase iron flux. In summary, in these reductionist models of the mammalian intestinal epithelium, Atp7a KD altered expression of iron transporters and impair